diff --git a/code/_helpers/game.dm b/code/_helpers/game.dm index e1c5d574f7..b84f46e650 100644 --- a/code/_helpers/game.dm +++ b/code/_helpers/game.dm @@ -728,4 +728,22 @@ result |= P result |= get_all_prey_recursive(P, client_check) - return result \ No newline at end of file + return result + +/proc/random_color(saturated) //Returns a random color. If saturated is true, it will avoid pure white or pure black + var/r = rand(1,255) + var/g = rand(1,255) + var/b = rand(1,255) + + if(saturated) //Let's make sure we don't get too close to pure black or pure white, as they won't look good with grayscale sprites + if(r + g + b < 50) + r = r + rand(5,20) + g = g + rand(5,20) + b = b + rand(5,20) + else if (r + g + b > 700) + r = r - rand(5,50) + g = g - rand(5,50) + b = b - rand(5,50) + + var/color = rgb(r, g, b) + return color diff --git a/code/_helpers/global_lists.dm b/code/_helpers/global_lists.dm index 1408896e55..95b7758922 100644 --- a/code/_helpers/global_lists.dm +++ b/code/_helpers/global_lists.dm @@ -14,6 +14,7 @@ var/global/list/cleanbot_reserved_turfs = list() //List of all turfs currently t var/global/list/cable_list = list() //Index for all cables, so that powernets don't have to look through the entire world all the time var/global/list/landmarks_list = list() //list of all landmarks created +var/global/list/event_triggers = list() //Associative list of creator_ckey:list(landmark references) for event triggers var/global/list/surgery_steps = list() //list of all surgery steps |BS12 var/global/list/side_effects = list() //list of all medical sideeffects types by thier names |BS12 var/global/list/mechas_list = list() //list of all mechs. Used by hostile mobs target tracking. diff --git a/code/controllers/subsystems/mapping.dm b/code/controllers/subsystems/mapping.dm index cf9593d35a..00e3153b3e 100644 --- a/code/controllers/subsystems/mapping.dm +++ b/code/controllers/subsystems/mapping.dm @@ -89,6 +89,7 @@ SUBSYSTEM_DEF(mapping) if(!istype(MT)) error("Lateload Z level \"[mapname]\" is not a valid map!") continue + admin_notice("Lateload: [MT]", R_DEBUG) MT.load_new_z(centered = FALSE) CHECK_TICK @@ -111,6 +112,7 @@ SUBSYSTEM_DEF(mapping) if(!istype(MT)) error("Randompick Z level \"[map]\" is not a valid map!") else + admin_notice("Gateway: [MT]", R_DEBUG) MT.load_new_z(centered = FALSE) if(LAZYLEN(also_load)) //Just copied from gateway picking, this is so we can have a kind of OM map version of the same concept. @@ -132,6 +134,7 @@ SUBSYSTEM_DEF(mapping) if(!istype(MT)) error("Randompick Z level \"[map]\" is not a valid map!") else + admin_notice("OM Adventure: [MT]", R_DEBUG) MT.load_new_z(centered = FALSE) if(LAZYLEN(redgate_load)) @@ -153,6 +156,7 @@ SUBSYSTEM_DEF(mapping) if(!istype(MT)) error("Randompick Z level \"[map]\" is not a valid map!") else + admin_notice("Redgate: [MT]", R_DEBUG) MT.load_new_z(centered = FALSE) diff --git a/code/datums/underwear/bottom.dm b/code/datums/underwear/bottom.dm index 7f16ba66b7..358fe20104 100644 --- a/code/datums/underwear/bottom.dm +++ b/code/datums/underwear/bottom.dm @@ -10,6 +10,10 @@ /datum/category_item/underwear/bottom/briefs/is_default(var/gender) return gender != FEMALE +/datum/category_item/underwear/bottom/briefs_hyper + name = "HYPER Briefs" + icon_state = "hyper_briefs" + /datum/category_item/underwear/bottom/boxers_loveheart name = "Boxers, Loveheart" icon_state = "boxers_loveheart" @@ -19,6 +23,10 @@ icon_state = "boxers" has_color = TRUE +/datum/category_item/underwear/bottom/boxers_hyper + name = "HYPER Boxers" + icon_state = "hyper_boxers" + /datum/category_item/underwear/bottom/boxers_green_and_blue name = "Boxers, green & blue striped" icon_state = "boxers_green_and_blue" diff --git a/code/game/area/Away Mission areas.dm b/code/game/area/Away Mission areas.dm index 5079e8b311..fc6ff0b01d 100644 --- a/code/game/area/Away Mission areas.dm +++ b/code/game/area/Away Mission areas.dm @@ -11,14 +11,15 @@ var/semirandom_group_min = 0 var/semirandom_group_max = 10 var/mob_intent = "default" //"default" uses default settings, use "hostile", "retaliate", or "passive" respectively + var/ghostjoin = FALSE //If true, enables ghost join on semirandom spawned mobs /area/proc/EvalValidSpawnTurfs() //Adds turfs to the valid)turfs list, used for spawning. if(mobcountmax || floracountmax || semirandom) for(var/turf/simulated/floor/F in src) - valid_spawn_turfs += F + valid_spawn_turfs |= F for(var/turf/unsimulated/floor/F in src) - valid_spawn_turfs += F + valid_spawn_turfs |= F /area/LateInitialize() ..() @@ -44,28 +45,33 @@ var/mob/M var/turf/Turf if(semirandom) - for(var/groupscount = 0 to (semirandom_groups - 1)) + for(var/groupscount = 1 to semirandom_groups) var/ourgroup = pickweight(valid_mobs) var/goodnum = rand(semirandom_group_min, semirandom_group_max) - for(var/mobscount = 0 to (goodnum - 1)) + for(var/mobscount = 1 to goodnum) M = pickweight(ourgroup) Turf = pick(valid_spawn_turfs) valid_spawn_turfs -= Turf var/mob/ourmob = new M(Turf) adjust_mob(ourmob) else - for(var/mobscount = 0 to mobcountmax) + for(var/mobscount = 1 to mobcountmax) M = pickweight(valid_mobs) Turf = pick(valid_spawn_turfs) valid_spawn_turfs -= Turf var/mob/ourmob = new M(Turf) adjust_mob(ourmob) -/area/proc/adjust_mob(var/mob/living/M) - if(!isliving(M)) - log_admin("[src] spawned [M.type], which is not mob/living, FIXIT") +/area/proc/adjust_mob(var/mob/living/simple_mob/M) + if(!isanimal(M)) + log_admin("[src] spawned [M.type], which is not a simplemob, FIXIT") return var/datum/ai_holder/AI = M.ai_holder + if(ghostjoin) + M.ghostjoin = TRUE + M.ghostjoin_icon() + if(!AI) + return switch(mob_intent) if("default") return @@ -86,7 +92,7 @@ var/obj/F var/turf/Turf - for(var/floracount = 0 to floracountmax) + for(var/floracount = 1 to floracountmax) F = pick(valid_flora) Turf = pick(valid_spawn_turfs) valid_spawn_turfs -= Turf diff --git a/code/game/area/areas_vr.dm b/code/game/area/areas_vr.dm index f932674566..8d7b54bdf4 100644 --- a/code/game/area/areas_vr.dm +++ b/code/game/area/areas_vr.dm @@ -8,6 +8,8 @@ // Size of the area in open turfs, only calculated for indoors areas. var/areasize = 0 + var/no_comms = FALSE //When true, blocks radios from working in the area + /area/Entered(var/atom/movable/AM, oldLoc) . = ..() if(enter_message && isliving(AM)) @@ -69,4 +71,4 @@ power_environ = 0 power_change() // all machines set to current power level, also updates lighting icon if(no_spoilers) - set_spoiler_obfuscation(TRUE) \ No newline at end of file + set_spoiler_obfuscation(TRUE) diff --git a/code/game/gamemodes/events/dust.dm b/code/game/gamemodes/events/dust.dm index 85391b7352..b3728390d0 100644 --- a/code/game/gamemodes/events/dust.dm +++ b/code/game/gamemodes/events/dust.dm @@ -52,6 +52,8 @@ The "dust" will damage the hull of the station causin minor hull breaches. endy = rand(TRANSITIONEDGE, world.maxy-TRANSITIONEDGE) endx = world.maxx-TRANSITIONEDGE + if(!affecting_z.len) + return var/randomz = pick(affecting_z) var/turf/startloc = locate(startx, starty, randomz) var/turf/endloc = locate(endx, endy, randomz) diff --git a/code/game/machinery/computer/computer.dm b/code/game/machinery/computer/computer.dm index 60935a8472..cad9e72e2f 100644 --- a/code/game/machinery/computer/computer.dm +++ b/code/game/machinery/computer/computer.dm @@ -64,7 +64,7 @@ /obj/machinery/computer/update_icon() cut_overlays() - + . = list() // Connecty @@ -128,7 +128,7 @@ else var/B_held = B.wrapped to_chat(user, "You use \the [B] to use \the [B_held] with \the [src].") - playsound(src, "keyboard", 100, 1, 0) + playsound(src, clicksound, 100, 1, 0) return attack_hand(user) return diff --git a/code/game/objects/effects/landmarks_events.dm b/code/game/objects/effects/landmarks_events.dm new file mode 100644 index 0000000000..d95832ee16 --- /dev/null +++ b/code/game/objects/effects/landmarks_events.dm @@ -0,0 +1,129 @@ +/* +Landmark to be spawned by GMs and admins when running events. +Do NOT directly spawn "" or buildmode spawn this. +Use the "Manage Event Triggers" verb under "Eventkit" category. +Admin verb is called by code\modules\admin\verbs\event_triggers.dm +*/ +/obj/effect/landmark/event_trigger + name = "ONLY FOR EVENTS. DO NOT USE WHEN MAPPING" + desc = "Please notify staff if you see this!" + var/creator_ckey = "" + var/isTeamwork = FALSE //Whether to notify creator or whole team. + var/isRepeating = FALSE + var/coordinates = "" + var/cooldown = 0 //Given in seconds in set_vars() but stored in ticks + var/last_trigger = 0 + var/isLoud = FALSE + var/isNarrate = FALSE + +/obj/effect/landmark/event_trigger/New() + ..() + coordinates = "(X:[loc.x];Y:[loc.y];Z:[loc.z])" + +/obj/effect/landmark/event_trigger/proc/set_vars(mob/M) + var/new_name = sanitize(tgui_input_text(M, "Input Name for the trigger", "Naming", "Event Trigger")) + if(!new_name) + return + name = new_name + creator_ckey = M.ckey + if(!event_triggers[creator_ckey]) + event_triggers[creator_ckey] = list() + event_triggers[creator_ckey] |= list(src) + isTeamwork = (tgui_alert(M, "Notify rest of team?", "Teamwork", list("No", "Yes")) == "Yes" ? TRUE : FALSE) + if(!isTeamwork) + isLoud = (tgui_alert(M, "Should it make a bwoink when triggered for YOU?", "bwoink", list("No", "Yes")) == "Yes" ? TRUE : FALSE) + isRepeating = (tgui_alert(M, "Make it fire repeatedly?", "Repetition", list("No", "Yes")) == "Yes" ? TRUE : FALSE) + if(isRepeating) + cooldown = tgui_input_number(M, "Set cooldown in seconds. Minimum 5 seconds!", "Cooldown", 60, min_value = 5) + cooldown = cooldown SECONDS + else + delete_me = TRUE + log_admin("[M.ckey] has created a [isNarrate ? "Narrtion" : "Notification"] landmark trigger at [coordinates]") + +/obj/effect/landmark/event_trigger/Destroy() + if(event_triggers[creator_ckey]) + event_triggers[creator_ckey] -= src + ..() + +/obj/effect/landmark/event_trigger/Crossed(var/atom/movable/AM) + if(!isliving(AM)) + return FALSE + var/mob/living/L = AM + if(!L.ckey) return FALSE + + if(world.time < (last_trigger + cooldown)) + return FALSE + if(!isRepeating && last_trigger) //Used to avoid spam if qdel(src) fires too slowly + return FALSE + last_trigger = world.time + + if(!creator_ckey) //For some reason, the user didn't have a ckey. Let's clean up + qdel(src) + return FALSE + var/mob/creator_reference = GLOB.directory[creator_ckey] + if(!creator_reference || isTeamwork) //If logged/crashed, we default to teamwork mode + message_admins("Player [L.name] ([L.ckey]) has triggered event narrate landmark [name] of type \ + [isNarrate ? "Narration" : "Notification"]. \n \ + The landmark was created by [creator_ckey], and it [isRepeating ? \ + "will be possible to trigger after [cooldown / (1 SECOND)] seconds" : "has self-deleted"]\n \ + COORDINATES: [coordinates]") + else + if(isLoud) + creator_reference << 'sound/effects/adminhelp.ogg' + to_chat(creator_reference, SPAN_WARNING("Player [L.name] ([L.ckey]) has triggered event \ + narrate landmark [name] of type [isNarrate ? "Narration" : "Notification"]. \n \ + It [isRepeating ? "will be possible to trigger after [cooldown / (1 SECOND)] seconds" : "has self-deleted"] \n \ + COORDINATES: [coordinates]")) + if(!isNarrate) + if(!isRepeating) + qdel(src) + return FALSE + else + return L + + +/obj/effect/landmark/event_trigger/auto_narrate + var/message + var/isPersonal_orVis_orAud = 0 //0 for personal, 1 for vis, 2 for aud + var/message_range //Leave at 0 for world.view + var/isWarning = FALSE //For personal messages + isNarrate = TRUE + +/obj/effect/landmark/event_trigger/auto_narrate/New() + message_range = world.view + ..() + +/obj/effect/landmark/event_trigger/auto_narrate/set_vars(mob/M) + ..() + message = encode_html_emphasis(sanitize(tgui_input_text(M, "What should the automatic narration say?", "Message"), encode = FALSE)) + isPersonal_orVis_orAud = (tgui_alert(M, "Should it send directly to the player, or send to the turf?", "Target", list("Player", "Turf")) == "Player" ? 0 : 1) + if(isPersonal_orVis_orAud == 0) + isWarning = (tgui_alert(M, "Should it be a normal message or a big scary red text?", "Scary Red", list("Big Red", "Normal")) == "Big Red" ? TRUE : FALSE) + else + isPersonal_orVis_orAud = (tgui_alert(M, "Should it be visible or audible?", "Mode", list("Visible", "Audible")) == "Audible" ? 2 : 1) + var/range = tgui_input_number(M, "Give narration range! Input value over 10 to use world.view", "Range",default = 11, min_value = 0) + if(range <= 10) + message_range = range + + + + + +/obj/effect/landmark/event_trigger/auto_narrate/Crossed(var/atom/movable/AM) + . = ..() //Checks if AM is mob/living and notifies admin(s) + if(!.) + return + var/mob/living/L = . + var/turf/T = get_turf(src) + switch(isPersonal_orVis_orAud) + if(0) + if(isWarning) + to_chat(L, SPAN_DANGER(message)) + else + to_chat(L, message) + if(1) + T.visible_message(message, range = message_range, runemessage = message) + if(2) + T.audible_message(message, hearing_distance = message_range, runemessage= message) + if(!isRepeating) + qdel(src) diff --git a/code/game/objects/effects/map_effects/effect_emitter.dm b/code/game/objects/effects/map_effects/effect_emitter.dm index d7086dafa6..7ea9a93eea 100644 --- a/code/game/objects/effects/map_effects/effect_emitter.dm +++ b/code/game/objects/effects/map_effects/effect_emitter.dm @@ -76,3 +76,7 @@ name = "steam emitter" icon_state = "smoke_emitter" effect_system_type = /datum/effect/effect/system/steam_spread + +/obj/effect/map_effect/interval/effect_emitter/steam/less_frequent + interval_lower_bound = 10 SECONDS + interval_upper_bound = 30 SECONDS diff --git a/code/game/objects/items/devices/radio/jammer.dm b/code/game/objects/items/devices/radio/jammer.dm index ace17fa07d..f7d8897780 100644 --- a/code/game/objects/items/devices/radio/jammer.dm +++ b/code/game/objects/items/devices/radio/jammer.dm @@ -4,6 +4,11 @@ var/global/list/active_radio_jammers = list() var/turf/Tr = get_turf(radio) if(!Tr) return 0 //Nullspace radios don't get jammed. + var/area/our_area = get_area(Tr) + + if(our_area.no_comms) + return TRUE + for(var/obj/item/device/radio_jammer/J as anything in active_radio_jammers) var/turf/Tj = get_turf(J) @@ -111,4 +116,3 @@ var/global/list/active_radio_jammers = list() cut_overlays() add_overlay("jammer_overlay_[overlay_percent]") last_overlay_percent = overlay_percent - diff --git a/code/game/objects/items/devices/radio/radio.dm b/code/game/objects/items/devices/radio/radio.dm index 12b684cb21..63f5929307 100644 --- a/code/game/objects/items/devices/radio/radio.dm +++ b/code/game/objects/items/devices/radio/radio.dm @@ -490,7 +490,12 @@ GLOBAL_DATUM(autospeaker, /mob/living/silicon/ai/announcer) else if(subspace_transmission) var/list/jamming = is_jammed(src) if(jamming) - var/distance = jamming["distance"] + var/distance = 0 + var/area/our_area = get_area(src) + if(our_area.no_comms) + distance = 99 + else + distance = jamming["distance"] to_chat(M, "\icon[src][bicon(src)] You hear the [distance <= 2 ? "loud hiss" : "soft hiss"] of static.") return FALSE diff --git a/code/game/objects/items/devices/translocator_vr.dm b/code/game/objects/items/devices/translocator_vr.dm index 57630d9c88..9bc4233ccf 100644 --- a/code/game/objects/items/devices/translocator_vr.dm +++ b/code/game/objects/items/devices/translocator_vr.dm @@ -217,8 +217,10 @@ This device records all warnings given and teleport events for admin review in c //No, you can't teleport if there's a jammer. if(is_jammed(src) || is_jammed(destination)) - to_chat(user,"\The [src] refuses to teleport you, due to strong interference!") - return FALSE + var/area/our_area = get_area(src) + if(!our_area.no_comms) //I don't actually want this to block teleporters, just comms + to_chat(user,"\The [src] refuses to teleport you, due to strong interference!") + return FALSE //No, you can't port to or from away missions. Stupidly complicated check. var/turf/uT = get_turf(user) diff --git a/code/game/objects/items/weapons/material/twohanded_vr.dm b/code/game/objects/items/weapons/material/twohanded_vr.dm index 17f7a56caa..a2e1a229ba 100644 --- a/code/game/objects/items/weapons/material/twohanded_vr.dm +++ b/code/game/objects/items/weapons/material/twohanded_vr.dm @@ -26,7 +26,6 @@ edge = TRUE sharp = TRUE - /obj/item/weapon/material/twohanded/saber/handle_shield(mob/user, var/damage, atom/damage_source = null, mob/attacker = null, var/def_zone = null, var/attack_text = "the attack") if (src.wielded == 1) if(unique_parry_check(user, attacker, damage_source) && prob(50)) @@ -34,3 +33,49 @@ playsound(src, 'sound/weapons/punchmiss.ogg', 50, 1) return 1 return 0 + +/obj/item/weapon/material/twohanded/staff + w_class = ITEMSIZE_LARGE + default_material = MAT_WOOD + name = "staff" + desc = "A sturdy length of metal or wood. A common traveler's aid mostly used for support or probing unstable ground, but also a fairly effective weapon in a pinch." + description_info = "When wielded with two hands, staves can be used to parry incoming melee attacks. Being on disarm intent also grants them an added chance to stun or knock down opponents, and increases your chances of parrying an attack." + icon = 'icons/obj/weapons_vr.dmi' + icon_state = "mat_staff" + base_icon = "mat_staff" + item_state = "mat_staff" + item_icons = list( + slot_l_hand_str = 'icons/mob/items/lefthand_melee_vr.dmi', + slot_r_hand_str = 'icons/mob/items/righthand_melee_vr.dmi', + ) + force_wielded = 18 //a bit stronger than a stun baton + force_divisor = 0.45 + unwielded_force_divisor = 0.1 + var/base_parry_chance = 20 + var/disarm_defense = 1.5 //bonus multiplier to parry rate when in disarm stance + var/stun_chance = 25 //chance to weaken an opponent when used in disarm stance only, remembering that disarm also halves damage dealt + var/stun_duration = 2 + attack_verb = list("struck","smashed","thumped","thrashed","beaten","slammed","battered") + edge = FALSE + sharp = FALSE + +/obj/item/weapon/material/twohanded/staff/handle_shield(mob/user, var/damage, atom/damage_source = null, mob/attacker = null, var/def_zone = null, var/attack_text = "the attack") + var/parry_chance + if(istype(damage_source, /obj/item/projectile)) //can't block ranged attacks, only melee! + return 0 + if(src.wielded == 1) + if(user.a_intent == I_DISARM) + parry_chance = base_parry_chance * disarm_defense + else + parry_chance = base_parry_chance + if(unique_parry_check(user, attacker, damage_source) && prob(parry_chance)) + user.visible_message("\The [user] parries [attack_text] with \the [src]!") + playsound(src, 'sound/weapons/punchmiss.ogg', 50, 1) + return 1 + return 0 + +/obj/item/weapon/material/twohanded/staff/apply_hit_effect(mob/living/target, mob/living/user, var/hit_zone) + . = ..() + if(src.wielded == 1 && user.a_intent == I_DISARM && prob(stun_chance)) + target.Weaken(stun_duration) + user.visible_message("\The [user] trips [target] with \the [src]!") \ No newline at end of file diff --git a/code/game/objects/structures/props/rocks.dm b/code/game/objects/structures/props/rocks.dm index 82a4696887..b76c477367 100644 --- a/code/game/objects/structures/props/rocks.dm +++ b/code/game/objects/structures/props/rocks.dm @@ -21,6 +21,16 @@ /obj/structure/prop/rock/small/alt icon_state = "lavarocks2" +// Warm rocks used as atoms retention fields outside! + +/obj/structure/prop/warmrocks + name = "warm rocks" + desc = "A number of small rocks that are warm to the touch." + icon = 'icons/obj/flora/rocks.dmi' + icon_state = "warmrocks" + density = FALSE + can_atmos_pass = ATMOS_PASS_NO + //Water-trim versions for placing in water /obj/structure/prop/rock/water diff --git a/code/game/turfs/flooring/flooring_vr.dm b/code/game/turfs/flooring/flooring_vr.dm index ac7f42a406..6e6fc78a27 100644 --- a/code/game/turfs/flooring/flooring_vr.dm +++ b/code/game/turfs/flooring/flooring_vr.dm @@ -17,6 +17,12 @@ desc = "This slick flesh ripples and squishes under your touch" icon = 'icons/turf/stomach_vr.dmi' icon_base = "flesh_floor" + footstep_sounds = list("human" = list( + 'sound/effects/footstep/mud1.ogg', + 'sound/effects/footstep/mud2.ogg', + 'sound/effects/footstep/mud3.ogg', + 'sound/effects/footstep/mud4.ogg' + )) /decl/flooring/grass/outdoors flags = 0 @@ -115,4 +121,4 @@ initial_flooring = /decl/flooring/tiling/milspec/raised /obj/item/stack/tile/floor/milspec/raised - name = "raised milspec floor tile" \ No newline at end of file + name = "raised milspec floor tile" diff --git a/code/game/turfs/simulated/water.dm b/code/game/turfs/simulated/water.dm index 500f719baa..725aefb854 100644 --- a/code/game/turfs/simulated/water.dm +++ b/code/game/turfs/simulated/water.dm @@ -4,6 +4,7 @@ desc = "A body of water. It seems shallow enough to walk through, if needed." icon = 'icons/turf/outdoors.dmi' icon_state = "seashallow" // So it shows up in the map editor as water. + var/water_icon = 'icons/turf/outdoors.dmi' var/water_state = "water_shallow" var/under_state = "rock" edge_blending_priority = -1 @@ -31,7 +32,7 @@ ..() // To get the edges. icon_state = under_state // This isn't set at compile time in order for it to show as water in the map editor. - var/image/water_sprite = image(icon = 'icons/turf/outdoors.dmi', icon_state = water_state, layer = WATER_LAYER) + var/image/water_sprite = image(icon = water_icon, icon_state = water_state, layer = WATER_LAYER) add_overlay(water_sprite) /turf/simulated/floor/water/get_edge_icon_state() diff --git a/code/modules/admin/admin_verb_lists_vr.dm b/code/modules/admin/admin_verb_lists_vr.dm index bf6fc1f2d6..ff66ed5cea 100644 --- a/code/modules/admin/admin_verb_lists_vr.dm +++ b/code/modules/admin/admin_verb_lists_vr.dm @@ -171,7 +171,8 @@ var/list/admin_verbs_fun = list( /client/proc/remove_mob_for_narration, //VOREStation Add /client/proc/narrate_mob, //VOREStation Add /client/proc/narrate_mob_args, //VOREStation Add - /client/proc/getPlayerStatus //VORESTation Add + /client/proc/getPlayerStatus, //VORESTation Add + /client/proc/manage_event_triggers ) diff --git a/code/modules/admin/verbs/buildmode.dm b/code/modules/admin/verbs/buildmode.dm index 8dabdc627a..be587b6f41 100644 --- a/code/modules/admin/verbs/buildmode.dm +++ b/code/modules/admin/verbs/buildmode.dm @@ -159,8 +159,9 @@ Left Mouse Button + alt on AI mob = Toggle hostility on mob
\ Left Mouse Button + shift on AI mob = Toggle AI (also resets)
\ Left Mouse Button + ctrl on AI mob = Copy mob faction
\ + Middle Mouse Button + alt on any atom = Add atom to entity narrate menu
\ Middle Mouse Button + shift on any = Set selected mob(s) to wander
\ - Middle Mouse Button + shift on any = Set selected mob(s) to NOT wander
\ + Middle Mouse Button + ctrl on any = Set selected mob(s) to NOT wander
\ Right Mouse Button + ctrl on any mob = Paste mob faction copied with Left Mouse Button + shift
\ Right Mouse Button on enemy mob = Command selected mobs to attack mob
\ Right Mouse Button on allied mob = Command selected mobs to follow mob
\ @@ -558,6 +559,9 @@ for(var/mob/living/unit in holder.selected_mobs) var/datum/ai_holder/AI = unit.ai_holder AI.wander = FALSE + if(pa.Find("alt") && isatom(object)) + to_chat(user, SPAN_NOTICE("Adding [object] to Entity Narrate List!")) + user.client.add_mob_for_narration(object) if(pa.Find("right")) diff --git a/code/modules/admin/verbs/entity_narrate.dm b/code/modules/admin/verbs/entity_narrate.dm index 0b42058c84..a0da92eb42 100644 --- a/code/modules/admin/verbs/entity_narrate.dm +++ b/code/modules/admin/verbs/entity_narrate.dm @@ -57,7 +57,7 @@ add_mob_for_narration(L) //Recursively calling ourselves until cancelled or a unique name is given. return holder.entity_names += unique_name - holder.entity_refs[unique_name] = L + holder.entity_refs[unique_name] = WEAKREF(L) log_and_message_admins("added [L.name] for their personal list to narrate", usr) //Logging here to avoid spam, while still safeguarding abuse //Covering functionality for turfs and objs. We need static type to access the name var @@ -70,7 +70,7 @@ add_mob_for_narration(A) return holder.entity_names += unique_name - holder.entity_refs[unique_name] = A + holder.entity_refs[unique_name] = WEAKREF(A) log_and_message_admins("added [A.name] for their personal list to narrate", usr) //Logging here to avoid spam, while still safeguarding abuse //Proc for keeping our ref list relevant, deleting mobs that are no longer relevant for our event @@ -164,8 +164,14 @@ //Separate definition for mob/living and /obj due to .say() code allowing us to engage with languages, stuttering etc //We also need this so we can check for .client - if(istype(holder.entity_refs[name], /mob/living)) - var/mob/living/our_entity = holder.entity_refs[name] + var/datum/weakref/wref = holder.entity_refs[name] + var/selection = wref.resolve() + if(!selection) + to_chat(usr, SPAN_NOTICE("[name] has invalid reference, deleting")) + holder.entity_names -= name + holder.entity_refs -= name + if(istype(selection, /mob/living)) + var/mob/living/our_entity = selection if(our_entity.client) //Making sure we can't speak for players log_and_message_admins("used entity-narrate to speak through [our_entity.ckey]'s mob", usr) if(!message) @@ -179,11 +185,11 @@ //This does cost us some code duplication, but I think it's worth it. //furthermore, objs/turfs require the usr to specify the verb when speaking, otherwise it looks like an emote. - else if(istype(holder.entity_refs[name], /atom)) - var/atom/our_entity = holder.entity_refs[name] + else if(istype(selection, /atom)) + var/atom/our_entity = selection if(!message) message = tgui_input_text(usr, "Input what you want [our_entity] to [mode]", "narrate", null) - message = sanitize(message) + message = encode_html_emphasis(sanitize(message)) if(message && mode == "Speak") our_entity.audible_message("[our_entity.name] [message]") else if(message && mode == "Emote") @@ -251,7 +257,16 @@ tgui_selected_id_multi = list() //Using the same var for ease of implementation. Thus, we must reset to empty each time. tgui_selected_id_multi += params["id_selected"] tgui_selected_id = params["id_selected"] - tgui_selected_refs = entity_refs[tgui_selected_id] + var/datum/weakref/wref = entity_refs[tgui_selected_id] + tgui_selected_refs = wref.resolve() + if(!tgui_selected_refs) + to_chat(usr, SPAN_NOTICE("[tgui_selected_id] has invalid reference, deleting")) + entity_names -= tgui_selected_id + entity_refs -= tgui_selected_id + tgui_selected_id = "" + tgui_selected_type = "" + tgui_selected_name = "" + tgui_selected_refs = null if(istype(tgui_selected_refs, /mob/living)) var/mob/living/L = tgui_selected_refs if(L.client) @@ -273,7 +288,14 @@ var/message = params["message"] //Sanitizing before speaking it if(tgui_selection_mode) for(var/entity in tgui_selected_id_multi) - var/ref = entity_refs[entity] + var/datum/weakref/wref = entity_refs[entity] + var/ref = wref.resolve() + if(!ref) + to_chat(usr, SPAN_NOTICE("[entity] has invalid reference, deleting")) + entity_names -= entity + entity_refs -= entity + tgui_selected_id_multi -= entity + continue if(istype(ref, /mob/living)) var/mob/living/L = ref if(L.client) @@ -283,7 +305,17 @@ var/atom/A = ref narrate_tgui_atom(A, message) else - var/ref = entity_refs[tgui_selected_id] + var/datum/weakref/wref = entity_refs[tgui_selected_id] + var/ref = wref.resolve() + if(!ref) + to_chat(usr, SPAN_NOTICE("[tgui_selected_id] has invalid reference, deleting")) + entity_names -= tgui_selected_id + entity_refs -= tgui_selected_id + tgui_selected_id = "" + tgui_selected_type = "" + tgui_selected_name = "" + tgui_selected_refs = null + return if(istype(ref, /mob/living)) var/mob/living/L = ref if(L.client) @@ -305,7 +337,7 @@ L.say(message) /datum/entity_narrate/proc/narrate_tgui_atom(atom/A, message as text) - message = sanitize(message) + message = encode_html_emphasis(sanitize(message)) if(tgui_narrate_mode && tgui_narrate_privacy) A.visible_message("\The [A.name] [message]", range = 1) else if(tgui_narrate_mode && !tgui_narrate_privacy) diff --git a/code/modules/admin/verbs/event_triggers.dm b/code/modules/admin/verbs/event_triggers.dm new file mode 100644 index 0000000000..332e6a7d62 --- /dev/null +++ b/code/modules/admin/verbs/event_triggers.dm @@ -0,0 +1,128 @@ +/* +Eventkit verb to be used to spawn the obj/effect/landmarks defined under code\game\objects\effects\landmarks_events.dm +*/ +/client/proc/manage_event_triggers() + set name = "Manage Event Triggers" + set desc = "Open dialogue to create or delete narration/notification triggers" + set category = "EventKit" + + if(!check_rights(R_FUN)) return + + + + var/mode = tgui_input_list(src, "What do you wish to do?", "Manage Event Triggers", \ + list( + "Create Notification Trigger", + "Create Narration Trigger", + "Manage Personal Triggers", + "Manage Other's Triggers", + "Cancel" + ), "Cancel" ) + if(!mode || mode == "Cancel") return + + feedback_add_details("admin_verb","EventTriggerManage") + switch(mode) + + if("Create Notification Trigger") + var/obj/effect/landmark/event_trigger/ET = new /obj/effect/landmark/event_trigger(usr.loc) + ET.set_vars(src) + + if("Create Narration Trigger") + + var/obj/effect/landmark/event_trigger/auto_narrate/AN = new /obj/effect/landmark/event_trigger/auto_narrate(usr.loc) + AN.set_vars(src) + + if("Manage Personal Triggers") + var/personal_list = event_triggers[src.ckey] + if(!LAZYLEN(personal_list)) + to_chat(src, SPAN_NOTICE("You don't have any landmarks to manage!")) + return + personal_list |= list("Cancel", "Delete All") + var/choice = tgui_input_list(src, "Select a landmark to choose between teleporting to it or deleting it, select delete all to clear them.", \ + "Manage Personal Triggers", personal_list) + if(!choice || choice == "Cancel") + return + if(choice == "Delete All") + var/confirm = tgui_alert(src, "ARE YOU SURE? THERE IS NO GOING BACK", "CONFIRM", list("Go Back", "Delete all my event triggers"), autofocus = FALSE) + if(confirm == "Go Back") + return + for(var/obj/effect/landmark/event_trigger/ET in personal_list) + ET.delete_me = TRUE + qdel(ET) + else if(istype(choice, /obj/effect/landmark/event_trigger)) + var/obj/effect/landmark/event_trigger/ET = choice + var/decision = tgui_alert(src, "Teleport to Landmark or Delete it?", "Manage [ET.name]", list("Teleport", "Delete"), autofocus = FALSE) + if(decision == "Teleport") + var/mob/M = usr + if(isobserver(M)) + var/confirm_teleport = tgui_alert(src, "You're not a ghost! Admin-ghost?", "You're not a ghost", \ + list("Cancel", "Teleport me with my character")) + if(confirm_teleport == "Cancel") + return + M.forceMove(get_turf(ET)) + if(decision == "Delete") + var/confirm = tgui_alert(src, "ARE YOU SURE? THERE IS NO GOING BACK FROM DELETING [ET.name]", "CONFIRM", list("Go Back", "Delete it!"), autofocus = FALSE) + if(confirm == "Go Back") + return + ET.delete_me = TRUE + qdel(ET) + if("Manage Other's Triggers") + var/other_ckey = sanitize(tgui_input_text(src, "input trigger owner's ckey", "CKEY", "")) + var/others_list = event_triggers[other_ckey] + if(!LAZYLEN(others_list)) + to_chat(src, SPAN_NOTICE("[other_ckey] doesn't have any landmarks to manage!")) + return + others_list |= list("Cancel", "Delete All") + var/choice = tgui_input_list(src, "Select a landmark to choose between teleporting to it or deleting it, select delete all to clear them.", \ + "Manage Personal Triggers", others_list) + if(!choice || choice == "Cancel") + return + if(choice == "Delete All") + if(other_ckey && GLOB.directory[other_ckey]) + var/client/C = GLOB.directory[other_ckey] + var/mob/M = C.statobj + if(M.client && M.client.inactivity < 30 MINUTES) + if(tgui_alert(src, "[M] has only been inactive for [M.client.inactivity / (1 MINUTE)] minutes.\n \ + If you want to delete their event triggers, ask them in asay or discord to do it themselves or wait 30 minutes. \n \ + Only proceed if you are absolutely certain.", "Force Delete", list("Confirm", "Cancel")) == "Confirm") + for(var/obj/effect/landmark/event_trigger/ET in others_list) + ET.delete_me = TRUE + qdel(ET) + log_and_message_admins("[src.ckey] deleted all of [other_ckey]'s event triggers while [other_ckey] was active") + return + var/confirm = tgui_alert(src, "ARE YOU SURE? THERE IS NO GOING BACK", "CONFIRM", list("Go Back", "Delete all my event triggers"), autofocus = FALSE) + if(confirm == "Go Back") + return + for(var/obj/effect/landmark/event_trigger/ET in others_list) + ET.delete_me = TRUE + qdel(ET) + log_and_message_admins("[src.ckey] deleted all of [other_ckey]'s event triggers. [other_ckey] was either inactive or disconnected at this time.") + else if(istype(choice, /obj/effect/landmark/event_trigger)) + var/obj/effect/landmark/event_trigger/ET = choice + var/decision = tgui_alert(src, "Teleport to Landmark or Delete it?", "Manage [ET]", list("Teleport", "Delete"), autofocus = FALSE) + if(decision == "Teleport") + var/mob/M = usr + if(isobserver(M)) + var/confirm_teleport = tgui_alert(src, "You're not a ghost! Admin-ghost?", "You're not a ghost", \ + list("Cancel", "Teleport me with my character")) + if(confirm_teleport == "Cancel") + return + M.forceMove(get_turf(ET)) + if(decision == "Delete") + if(other_ckey && GLOB.directory[other_ckey]) + var/client/C = GLOB.directory[other_ckey] + var/mob/M = C.statobj + if(M.client && M.client.inactivity < 30 MINUTES) + if(tgui_alert(src, "[M] has only been inactive for [M.client.inactivity / (1 MINUTE)] minutes.\n \ + If you want to delete their event triggers, ask them in asay or discord to do it themselves or wait 30 minutes. \n \ + Only proceed if you are absolutely certain.", "Force Delete", list("Confirm", "Cancel")) == "Confirm") + ET.delete_me = TRUE + qdel(ET) + log_and_message_admins("[src.ckey] tried to delete event trigger [ET.name] while [other_ckey] is active.") + return + var/confirm = tgui_alert(src, "ARE YOU SURE? THERE IS NO GOING BACK FROM DELETING [ET.name]", "CONFIRM", list("Go Back", "Delete it!"), autofocus = FALSE) + if(confirm == "Go Back") + return + ET.delete_me = TRUE + qdel(ET) + log_and_message_admins("[src.ckey] tried to deleted event trigger [ET.name], [other_ckey] is either disconnected or inactive.") diff --git a/code/modules/admin/view_variables/helpers.dm b/code/modules/admin/view_variables/helpers.dm index bad05eb138..a678271e88 100644 --- a/code/modules/admin/view_variables/helpers.dm +++ b/code/modules/admin/view_variables/helpers.dm @@ -38,6 +38,7 @@ + @@ -48,6 +49,7 @@ + diff --git a/code/modules/admin/view_variables/topic.dm b/code/modules/admin/view_variables/topic.dm index 6554626777..8a3f8811c2 100644 --- a/code/modules/admin/view_variables/topic.dm +++ b/code/modules/admin/view_variables/topic.dm @@ -92,6 +92,44 @@ src.admin_give_modifier(M) href_list["datumrefresh"] = href_list["give_modifier"] + else if(href_list["give_wound_internal"]) + if(!check_rights(R_ADMIN|R_FUN|R_DEBUG|R_EVENT)) + return + + var/mob/living/carbon/human/H = locate(href_list["give_wound_internal"]) + if(!istype(H)) + to_chat(usr, span_notice("This can only be used on instances of type /mob/living/carbon/human")) + return + + var/severity = tgui_input_number(usr, "How much damage should the bleeding internal wound cause? \ + Bleed timer directly correlates with this. 0 cancels. Input is rounded to nearest integer.", + "Wound Severity", 0, min_value = 0, round_value = TRUE ) + if(!severity) return + + var/obj/item/organ/external/chosen_organ = tgui_input_list(usr, "Choose an external organ to inflict IB on!", "Organ Choice", H.organs) + if(!chosen_organ || !istype(chosen_organ)) + to_chat(usr, span_notice("The chosen organ is of inappropriate type or no longer exists.")) + return + + var/datum/wound/internal_bleeding/I = new /datum/wound/internal_bleeding(severity) + if(!I || !istype(I)) + to_chat(usr, span_notice("Could not initialize internal wound")) + log_debug("[usr] attempted to create an internal bleeding wound on [H]'s [chosen_organ] of [severity] damage \ + and wound initialization failed") + + chosen_organ.wounds += I + chosen_organ.update_wounds() + chosen_organ.update_damages() + H.bad_external_organs += chosen_organ + H.handle_organs() + + if(H.client) + H.custom_pain("You feel a throbbing pain inside your [chosen_organ]", severity, force=TRUE) + log_and_message_admins("created an Internal Bleeding wound on [H.ckey]'s mob [H] on [chosen_organ] of [severity] damage", usr) + + href_list["datumrefresh"] = href_list["give_wound_internal"] + + else if(href_list["give_disease2"]) if(!check_rights(R_ADMIN|R_FUN|R_EVENT)) return @@ -157,6 +195,29 @@ if(usr.client) usr.client.cmd_assume_direct_control(M) + else if(href_list["give_ai"]) + if(!check_rights(0)) return + + var/mob/M = locate(href_list["give_ai"]) + if(!istype(M, /mob/living)) + to_chat(usr, span_notice("This can only be used on instances of type /mob/living")) + return + var/mob/living/L = M + if(L.client || L.teleop) + to_chat(usr, span_warning("This cannot be used on player mobs!")) + return + + if(L.ai_holder) //Cleaning up the original ai + var/ai_holder_old = L.ai_holder + L.ai_holder = null + qdel(ai_holder_old) //Only way I could make #TESTING - Unable to be GC'd to stop. del() logs show it works. + L.ai_holder_type = tgui_input_list(usr, "Choose AI holder", "AI Type", typesof(/datum/ai_holder/)) + L.initialize_ai_holder() + L.faction = sanitize(tgui_input_text(usr, "Please input AI faction", "AI faction", "neutral")) + L.a_intent = tgui_input_list(usr, "Please choose AI intent", "AI intent", list(I_HURT, I_HELP)) + if(tgui_alert(usr, "Make mob wake up? This is needed for carbon mobs.", "Wake mob?", list("Yes", "No")) == "Yes") + L.AdjustSleeping(-100) + else if(href_list["make_skeleton"]) if(!check_rights(R_FUN)) return diff --git a/code/modules/ai/ai_holder.dm b/code/modules/ai/ai_holder.dm index 307d3870b2..78e85bfa3e 100644 --- a/code/modules/ai/ai_holder.dm +++ b/code/modules/ai/ai_holder.dm @@ -15,12 +15,8 @@ var/ai_holder_type = null // Which ai_holder datum to give to the mob when initialized. If null, nothing happens. /mob/living/Initialize() - if(ai_holder_type) - ai_holder = new ai_holder_type(src) - if(istype(src, /mob/living/carbon/human)) - var/mob/living/carbon/human/H = src - H.hud_used = new /datum/hud(H) - H.create_mob_hud(H.hud_used) + if(!ai_holder) + initialize_ai_holder() return ..() /mob/living/Destroy() @@ -37,6 +33,22 @@ ai_holder.manage_processing(AI_PROCESSING) return ..() +//Extracted from mob/living/Initialize() so that we may call it at any time after a mob was created +/mob/living/proc/initialize_ai_holder() + if(ai_holder) //Making double sure we clean up and properly GC the original ai_holder + var/old_holder = ai_holder + ai_holder = null + qdel(old_holder) + if(ai_holder_type) + ai_holder = new ai_holder_type(src) + if(!ai_holder) + log_debug("[src] could not initialize ai_holder of type [ai_holder_type]") + return + if(istype(src, /mob/living/carbon/human)) + var/mob/living/carbon/human/H = src + H.hud_used = new /datum/hud(H) + H.create_mob_hud(H.hud_used) + /datum/ai_holder var/mob/living/holder = null // The mob this datum is going to control. var/stance = STANCE_IDLE // Determines if the mob should be doing a specific thing, e.g. attacking, following, standing around, etc. @@ -447,7 +459,7 @@ if(speak_chance) // In the long loop since otherwise it wont shut up. handle_idle_speaking() - if(hostile) + if(hostile || vore_hostile) ai_log("handle_stance_strategical() : STANCE_IDLE, going to find_target().", AI_LOG_TRACE) find_target() diff --git a/code/modules/ai/ai_holder_targeting.dm b/code/modules/ai/ai_holder_targeting.dm index ef301ccf71..835bd36fe9 100644 --- a/code/modules/ai/ai_holder_targeting.dm +++ b/code/modules/ai/ai_holder_targeting.dm @@ -6,6 +6,9 @@ var/mauling = FALSE // Attacks unconscious mobs var/unconscious_vore = FALSE //VOREStation Add - allows a mob to go for unconcious targets IF their vore prefs align var/handle_corpse = FALSE // Allows AI to acknowledge corpses (e.g. nurse spiders) + var/vore_hostile = FALSE // The same as hostile, but with vore pref checks + var/micro_hunt = FALSE // Will target mobs at or under the micro_hunt_size size, requires vore_hostile to be true + var/micro_hunt_size = 0.25 var/atom/movable/target = null // The thing (mob or object) we're trying to kill. var/atom/movable/preferred_target = null// If set, and if given the chance, we will always prefer to target this over other options. @@ -312,3 +315,14 @@ /datum/ai_holder/proc/lose_taunt() ai_log("lose_taunt() : Resetting preferred_target.", AI_LOG_INFO) preferred_target = null + +/datum/ai_holder/proc/vore_check(mob/living/L) + if(!holder.vore_selected) //We probably don't have a belly so don't even try + return FALSE + if(!isliving(L)) //We only want mob/living + return FALSE + if(!L.devourable || !L.allowmobvore) //Check their prefs + return FALSE + if(micro_hunt && !(L.get_effective_size(TRUE) <= micro_hunt_size)) //Are they small enough to get? + return FALSE + return TRUE // Let's go! diff --git a/code/modules/ai/ai_holder_targeting_vr.dm b/code/modules/ai/ai_holder_targeting_vr.dm index 4c7ef85403..0828e1b468 100644 --- a/code/modules/ai/ai_holder_targeting_vr.dm +++ b/code/modules/ai/ai_holder_targeting_vr.dm @@ -3,3 +3,50 @@ return FALSE return ..() + +/datum/ai_holder/simple_mob/vore + hostile = FALSE + retaliate = TRUE + vore_hostile = TRUE + forgive_resting = TRUE + cooperative = FALSE + +/datum/ai_holder/simple_mob/vore/micro_hunter + micro_hunt = TRUE + micro_hunt_size = 0.8 + +/datum/ai_holder/simple_mob/vore/hostile + hostile = TRUE + +/datum/ai_holder/simple_mob/vore/find_target(list/possible_targets, has_targets_list) + if(!vore_hostile) + return ..() + if(!isanimal(holder)) //Only simplemobs have the vars we need + return ..() + var/mob/living/simple_mob/H = holder + if(H.vore_fullness >= H.vore_capacity) //Don't beat people up if we're full + return ..() + ai_log("find_target() : Entered.", AI_LOG_TRACE) + + . = list() + if(!has_targets_list) + possible_targets = list_targets() + var/list/valid_mobs = list() + for(var/mob/living/possible_target in possible_targets) + if(!can_attack(possible_target)) + continue + . |= possible_target + if(!isliving(possible_target)) + continue + if(vore_check(possible_target)) + valid_mobs |= possible_target + + var/new_target + if(valid_mobs.len) + new_target = pick(valid_mobs) + else if(hostile) + new_target = pick(.) + if(!new_target) + return null + give_target(new_target) + return new_target diff --git a/code/modules/awaymissions/redgate.dm b/code/modules/awaymissions/redgate.dm index b9757e9aac..340fbd7421 100644 --- a/code/modules/awaymissions/redgate.dm +++ b/code/modules/awaymissions/redgate.dm @@ -9,7 +9,14 @@ pixel_x = -16 var/obj/structure/redgate/target - var/list/exceptions = list(/obj/structure/ore_box) //made it a var so that GMs or map makers can selectively allow things to pass through + var/secret = FALSE //If either end of the redgate has this enabled, ghosts will not be able to click to teleport + var/list/exceptions = list( + /obj/structure/ore_box + ) //made it a var so that GMs or map makers can selectively allow things to pass through + var/list/restrictions = list( + /mob/living/simple_mob/vore/overmap/stardog, + /mob/living/simple_mob/vore/bigdragon + ) //There are some things we don't want to come through no matter what. /obj/structure/redgate/Destroy() if(target) @@ -27,6 +34,10 @@ keycheck = FALSE //we'll allow it else return + + if(M.type in restrictions) //Some stuff we don't want to bring EVEN IF it has a key. + return + if(keycheck) //exceptions probably won't have a ckey if(!M.ckey) //We only want players, no bringing the weird stuff on the other side back return @@ -34,13 +45,22 @@ if(!target) toggle_portal() - var/turf/place = get_turf(target) - var/possible_turfs = place.AdjacentTurfs() - if(isemptylist(possible_turfs)) + var/turf/ourturf = find_our_turf(M) //Find the turf on the opposite side of the target + if(!ourturf.check_density(TRUE,TRUE)) //Make sure there isn't a wall there + M.unbuckle_all_mobs(TRUE) + M.stop_pulling() + playsound(src,'sound/effects/ominous-hum-2.ogg', 100,1) + M.forceMove(ourturf) //Let's just do forcemove, I don't really want people teleporting to weird places if they have bluespace stuff + else to_chat(M, "Something blocks your way.") - return - var/turf/temptarg = pick(possible_turfs) - do_safe_teleport(M, temptarg, 0) + +/obj/structure/redgate/proc/find_our_turf(var/atom/movable/AM) //This finds the turf on the opposite side of the target gate from where you are + var/offset_x = x - AM.x //used for more smooth teleporting + var/offset_y = y - AM.y + + var/turf/temptarg = locate((target.x + offset_x),(target.y + offset_y),target.z) + + return temptarg /obj/structure/redgate/proc/toggle_portal() if(target) @@ -71,8 +91,10 @@ /obj/structure/redgate/attack_ghost(var/mob/observer/dead/user) - if(target && user?.client?.holder) - user.forceMove(get_turf(target)) + + if(target) + if(!(secret || target.secret) || user?.client?.holder) + user.forceMove(get_turf(target)) else return ..() @@ -139,3 +161,47 @@ As soon as you read this, get yourself out of here and come find us. We left you enough money to make the trip in the usual spot. We'll be in the registry once we arrive. We're waiting for you.

Yours, Medley"} + +/area/redgate/hotsprings + name = "hotsprings" + requires_power = 0 + +/area/redgate/hotsprings/outdoors + name = "snowfields" + icon_state = "hotsprings_outside" + +/area/redgate/hotsprings/redgate + name = "redgate facility" + icon_state = "hotsprings_redgate" + +/area/redgate/hotsprings/westcave + name = "hotspring caves" + icon_state = "hotsprings_westcave" + +/area/redgate/hotsprings/eastcave + name = "icy caverns" + icon_state = "hotsprings_eastcave" + +/area/redgate/hotsprings/house + name = "snowy cabin" + icon_state = "hotsprings_house" + +/area/redgate/hotsprings/house/dorm1 + name = "hotsprings dorm 1" + icon_state = "hotsprings_dorm1" + +/area/redgate/hotsprings/house/dorm2 + name = "hotsprings dorm 2" + icon_state = "hotsprings_dorm2" + +/area/redgate/hotsprings/house/hotspringhouse + name = "small cabin" + icon_state = "hotsprings_hotspringhouse" + +/area/redgate/hotsprings/house/lovercave + name = "cosy cave" + icon_state = "hotsprings_lovercave" + +/area/redgate/hotsprings/house/succcave + name = "tiny cave" + icon_state = "hotsprings_succcave" \ No newline at end of file diff --git a/code/modules/client/client procs.dm b/code/modules/client/client procs.dm index 8c624ff369..ed652ad8ea 100644 --- a/code/modules/client/client procs.dm +++ b/code/modules/client/client procs.dm @@ -263,7 +263,7 @@ if(alert) for(var/client/X in GLOB.admins) if(X.is_preference_enabled(/datum/client_preference/holder/play_adminhelp_ping)) - X << 'sound/voice/bcriminal.ogg' + X << 'sound/effects/tones/newplayerping.ogg' window_flash(X) //VOREStation Edit end. diff --git a/code/modules/client/preference_setup/loadout/loadout_gloves.dm b/code/modules/client/preference_setup/loadout/loadout_gloves.dm index b3ea8d1b69..811d0740f3 100644 --- a/code/modules/client/preference_setup/loadout/loadout_gloves.dm +++ b/code/modules/client/preference_setup/loadout/loadout_gloves.dm @@ -58,8 +58,18 @@ /datum/gear/gloves/fingerless display_name = "fingerless gloves" + description = "A pair of gloves that don't actually cover the fingers. Available in classic black or recolourable white." path = /obj/item/clothing/gloves/fingerless +/datum/gear/gloves/fingerless/New() + ..() + var/list/selector_uniforms = list( + "black"=/obj/item/clothing/gloves/fingerless, + "recolourable white"=/obj/item/clothing/gloves/fingerless_recolourable + ) + gear_tweaks += new/datum/gear_tweak/path(sortAssoc(selector_uniforms)) + gear_tweaks += gear_tweak_free_color_choice + /datum/gear/gloves/ring display_name = "ring selection" description = "Choose from a number of rings." diff --git a/code/modules/client/verbs/ooc.dm b/code/modules/client/verbs/ooc.dm index 7019d70528..0a5622752c 100644 --- a/code/modules/client/verbs/ooc.dm +++ b/code/modules/client/verbs/ooc.dm @@ -53,7 +53,7 @@ var/ooc_style = "everyone" if(holder && !holder.fakekey) ooc_style = "elevated" - //VOREStation Block Edit Start + if(holder.rights & R_EVENT) //Retired Admins ooc_style = "event_manager" if(holder.rights & R_ADMIN && !(holder.rights & R_BAN)) //Game Masters @@ -62,7 +62,7 @@ ooc_style = "developer" if(holder.rights & R_ADMIN && holder.rights & R_BAN) //Admins ooc_style = "admin" - //VOREStation Block Edit End + for(var/client/target in GLOB.clients) if(target.is_preference_enabled(/datum/client_preference/show_ooc)) @@ -149,12 +149,12 @@ display_name = holder.fakekey if(mob.stat != DEAD) display_name = mob.name - //VOREStation Add - Resleeving shenanigan prevention + if(ishuman(mob)) var/mob/living/carbon/human/H = mob if(H.original_player && H.original_player != H.ckey) //In a body not their own display_name = "[H.mind.name] (as [H.name])" - //VOREStation Add End + // Everyone in normal viewing range of the LOOC for(var/mob/viewer in m_viewers) @@ -177,12 +177,12 @@ if(target in GLOB.admins) admin_stuff += "/([key])" - to_chat(target, "" + create_text_tag("looc", "LOOC:", target) + " [display_name][admin_stuff]: [msg]") + to_chat(target, "" + create_text_tag("looc", "LOOC:", target) + " [display_name][admin_stuff]: [msg]") for(var/client/target in r_receivers) var/admin_stuff = "/([key])([admin_jump_link(mob, target.holder)])" - to_chat(target, "" + create_text_tag("looc", "LOOC:", target) + " (R)[display_name][admin_stuff]: [msg]") + to_chat(target, "" + create_text_tag("looc", "LOOC:", target) + " (R)[display_name][admin_stuff]: [msg]") /mob/proc/get_looc_source() return src diff --git a/code/modules/clothing/gloves/color.dm b/code/modules/clothing/gloves/color.dm index 007fdd7528..efcd364922 100644 --- a/code/modules/clothing/gloves/color.dm +++ b/code/modules/clothing/gloves/color.dm @@ -90,4 +90,10 @@ desc = "A pair of gloves that don't actually cover the fingers." name = "fingerless gloves" icon_state = "fingerlessgloves" + fingerprint_chance = 100 + +/obj/item/clothing/gloves/fingerless_recolourable + desc = "A pair of gloves that don't actually cover the fingers." + name = "fingerless gloves" + icon_state = "fingerlessgloves_rc" fingerprint_chance = 100 \ No newline at end of file diff --git a/code/modules/economy/mint.dm b/code/modules/economy/mint.dm index db50578fe7..07bc1d22a7 100644 --- a/code/modules/economy/mint.dm +++ b/code/modules/economy/mint.dm @@ -1,210 +1,49 @@ /**********************Mint**************************/ /obj/machinery/mineral/mint name = "Coin press" + desc = "A relatively crude hand-operated coin press that turns sheets (or ingots, as the case may be) of materials into fresh coins. They're probably not going to be considered legal tender in most polities, but you might fool a vending machine with one..?

It looks like it'll accept silver, gold, diamond, iron, solid phoron, and uranium." icon = 'icons/obj/stationobjs.dmi' icon_state = "coinpress0" density = TRUE anchored = TRUE - var/obj/machinery/mineral/input = null - var/obj/machinery/mineral/output = null - var/amt_silver = 0 //amount of silver - var/amt_gold = 0 //amount of gold - var/amt_diamond = 0 - var/amt_iron = 0 - var/amt_phoron = 0 - var/amt_uranium = 0 - var/newCoins = 0 //how many coins the machine made in it's last load - var/processing = 0 - var/chosen = MAT_STEEL //which material will be used to make coins - var/coinsToProduce = 10 + var/coinsToProduce = 6 //how many coins do we make per sheet? a sheet is 2000 units whilst a coin is 250, and some material should be lost in the process + var/list/validMats = list("silver", "gold", "diamond", "iron", "phoron", "uranium") //what's valid stuff to make coins out of? - -/obj/machinery/mineral/mint/Initialize() - . = ..() - for (var/dir in cardinal) - input = locate(/obj/machinery/mineral/input, get_step(src, dir)) - if(input) - break - for (var/dir in cardinal) - output = locate(/obj/machinery/mineral/output, get_step(src, dir)) - if(output) - break - -/obj/machinery/mineral/mint/process() - if(!input) - return - - var/obj/item/stack/O = locate(/obj/item/stack, input.loc) - if(!O) - return - - var/processed = 1 - switch(O.get_material_name()) - if("gold") - amt_gold += 100 * O.get_amount() - if("silver") - amt_silver += 100 * O.get_amount() - if("diamond") - amt_diamond += 100 * O.get_amount() - if("phoron") - amt_phoron += 100 * O.get_amount() - if("uranium") - amt_uranium += 100 * O.get_amount() - if(MAT_STEEL) - amt_iron += 100 * O.get_amount() - else - processed = 0 - if(processed) - qdel(O) - -/obj/machinery/mineral/mint/attack_hand(user as mob) - - var/dat = "Coin Press
" - - if (!input) - dat += text("input connection status: ") - dat += text("NOT CONNECTED
") - if (!output) - dat += text("
output connection status: ") - dat += text("NOT CONNECTED
") - - dat += text("
Gold inserted: [amt_gold] ") - if (chosen == "gold") - dat += text("chosen") - else - dat += text("Choose") - dat += text("
Silver inserted: [amt_silver] ") - if (chosen == "silver") - dat += text("chosen") - else - dat += text("Choose") - dat += text("
Iron inserted: [amt_iron] ") - if (chosen == MAT_STEEL) - dat += text("chosen") - else - dat += text("Choose") - dat += text("
Diamond inserted: [amt_diamond] ") - if (chosen == "diamond") - dat += text("chosen") - else - dat += text("Choose") - dat += text("
Phoron inserted: [amt_phoron] ") - if (chosen == "phoron") - dat += text("chosen") - else - dat += text("Choose") - dat += text("
Uranium inserted: [amt_uranium] ") - if (chosen == "uranium") - dat += text("chosen") - else - dat += text("Choose") - - dat += text("

Will produce [coinsToProduce] [chosen] coins if enough materials are available.
") - //dat += text("The dial which controls the number of conins to produce seems to be stuck. A technician has already been dispatched to fix this.") - dat += text("-10 ") - dat += text("-5 ") - dat += text("-1 ") - dat += text("+1 ") - dat += text("+5 ") - dat += text("+10 ") - - dat += text("

In total this machine produced [newCoins] coins.") - dat += text("
Make coins") - user << browse("[dat]", "window=mint") - -/obj/machinery/mineral/mint/Topic(href, href_list) - if(..()) - return 1 - usr.set_machine(src) - src.add_fingerprint(usr) - if(processing==1) - to_chat(usr, "The machine is processing.") - return - if(href_list["choose"]) - chosen = href_list["choose"] - if(href_list["chooseAmt"]) - coinsToProduce = between(0, coinsToProduce + text2num(href_list["chooseAmt"]), 1000) - if(href_list["makeCoins"]) - var/temp_coins = coinsToProduce - if (src.output) - processing = 1; +/obj/machinery/mineral/mint/attackby(obj/item/stack/material/M as obj, mob/user as mob) + if(M.default_type in validMats) + user.visible_message("[user] starts to feed a sheet of [M.default_type] into \the [src].") + while(M.amount > 0) icon_state = "coinpress1" - var/obj/item/weapon/moneybag/M - switch(chosen) - if(MAT_STEEL) - while(amt_iron > 0 && coinsToProduce > 0) - if (locate(/obj/item/weapon/moneybag,output.loc)) - M = locate(/obj/item/weapon/moneybag,output.loc) - else - M = new/obj/item/weapon/moneybag(output.loc) - new/obj/item/weapon/coin/iron(M) - amt_iron -= 20 - coinsToProduce-- - newCoins++ - src.updateUsrDialog() - sleep(5); - if("gold") - while(amt_gold > 0 && coinsToProduce > 0) - if (locate(/obj/item/weapon/moneybag,output.loc)) - M = locate(/obj/item/weapon/moneybag,output.loc) - else - M = new/obj/item/weapon/moneybag(output.loc) - new /obj/item/weapon/coin/gold(M) - amt_gold -= 20 - coinsToProduce-- - newCoins++ - src.updateUsrDialog() - sleep(5); - if("silver") - while(amt_silver > 0 && coinsToProduce > 0) - if (locate(/obj/item/weapon/moneybag,output.loc)) - M = locate(/obj/item/weapon/moneybag,output.loc) - else - M = new/obj/item/weapon/moneybag(output.loc) - new /obj/item/weapon/coin/silver(M) - amt_silver -= 20 - coinsToProduce-- - newCoins++ - src.updateUsrDialog() - sleep(5); - if("diamond") - while(amt_diamond > 0 && coinsToProduce > 0) - if (locate(/obj/item/weapon/moneybag,output.loc)) - M = locate(/obj/item/weapon/moneybag,output.loc) - else - M = new/obj/item/weapon/moneybag(output.loc) - new /obj/item/weapon/coin/diamond(M) - amt_diamond -= 20 - coinsToProduce-- - newCoins++ - src.updateUsrDialog() - sleep(5); - if("phoron") - while(amt_phoron > 0 && coinsToProduce > 0) - if (locate(/obj/item/weapon/moneybag,output.loc)) - M = locate(/obj/item/weapon/moneybag,output.loc) - else - M = new/obj/item/weapon/moneybag(output.loc) - new /obj/item/weapon/coin/phoron(M) - amt_phoron -= 20 - coinsToProduce-- - newCoins++ - src.updateUsrDialog() - sleep(5); - if("uranium") - while(amt_uranium > 0 && coinsToProduce > 0) - if (locate(/obj/item/weapon/moneybag,output.loc)) - M = locate(/obj/item/weapon/moneybag,output.loc) - else - M = new/obj/item/weapon/moneybag(output.loc) - new /obj/item/weapon/coin/uranium(M) - amt_uranium -= 20 - coinsToProduce-- - newCoins++ - src.updateUsrDialog() - sleep(5) - icon_state = "coinpress0" - processing = 0; - coinsToProduce = temp_coins - src.updateUsrDialog() - return \ No newline at end of file + if(do_after(user, 2 SECONDS, src)) + M.amount-- + if(M.default_type == "silver") + while(coinsToProduce-- > 0) + new /obj/item/weapon/coin/silver(user.loc) + else if(M.default_type == "gold") + while(coinsToProduce-- > 0) + new /obj/item/weapon/coin/gold(user.loc) + else if(M.default_type == "diamond") + while(coinsToProduce-- > 0) + new /obj/item/weapon/coin/diamond(user.loc) + else if(M.default_type == "iron") + while(coinsToProduce-- > 0) + new /obj/item/weapon/coin/iron(user.loc) + else if(M.default_type == "phoron") + while(coinsToProduce-- > 0) + new /obj/item/weapon/coin/phoron(user.loc) + else if(M.default_type == "uranium") + while(coinsToProduce-- > 0) + new /obj/item/weapon/coin/uranium(user.loc) + src.visible_message("\The [src] rattles and dispenses several [M.default_type] coins!") + coinsToProduce = initial(coinsToProduce) + if(M.amount == 0) + icon_state = "coinpress0" + qdel(M) //clean it up just to be sure + src.visible_message("\The [src] has run out of usable materials.") + break + else + to_chat(usr,"\The [src] is hand-operated and requires your full attention!") + icon_state = "coinpress0" + break + else + src.visible_message("\The [src] doesn't look like it'll accept that material.") \ No newline at end of file diff --git a/code/modules/eventkit/gm_interfaces/mob_spawner.dm b/code/modules/eventkit/gm_interfaces/mob_spawner.dm index 568875065f..e5b9b4180c 100644 --- a/code/modules/eventkit/gm_interfaces/mob_spawner.dm +++ b/code/modules/eventkit/gm_interfaces/mob_spawner.dm @@ -2,6 +2,13 @@ // The path of the mob to be spawned var/path + //The ai type path to be assigned to the mob + var/use_custom_ai = FALSE + var/ai_type = "" + var/faction = "" + var/intent = "" + var/new_path = TRUE //Sets default ai vars based on path. Tracked explicitly because tgui_act wouldn't make it work, used in tgui_data thusly + // Defines if the location of the spawned mob should be bound of the users position var/loc_lock = FALSE @@ -28,26 +35,40 @@ data["initial_y"] = usr.y; data["initial_z"] = usr.z; + return data /datum/eventkit/mob_spawner/tgui_data(mob/user) var/list/data = list() - data["loc_lock"] = loc_lock; + data["loc_lock"] = loc_lock if(loc_lock) - data["loc_x"] = usr.x; - data["loc_y"] = usr.y; - data["loc_z"] = usr.z; + data["loc_x"] = usr.x + data["loc_y"] = usr.y + data["loc_z"] = usr.z data["path"] = path; + data["use_custom_ai"] = use_custom_ai + if(path) - var/mob/M = new path(); + var/mob/M = new path() if(M) - data["default_path_name"] = M.name; - data["default_desc"] = M.desc; - data["default_flavor_text"] = M.flavor_text; - qdel(M); + data["default_path_name"] = M.name + data["default_desc"] = M.desc + data["default_flavor_text"] = M.flavor_text + if(new_path && istype(M, /mob/living)) + var/mob/living/L = M + ai_type = (L.ai_holder_type ? L.ai_holder_type : /datum/ai_holder/simple_mob/inert) + faction = (L.faction ? L.faction : "neutral") + intent = (L.a_intent ? L.a_intent : I_HELP) + new_path = FALSE + qdel(L) + qdel(M) + data["ai_type"] = ai_type + data["faction"] = faction + data["intent"] = intent + return data @@ -63,7 +84,20 @@ var/newPath = tgui_input_list(usr, "Please select the new path of the mob you want to spawn.", items = choices) path = newPath - + new_path = TRUE + return TRUE + if("toggle_custom_ai") + use_custom_ai = !use_custom_ai + return TRUE + if("set_faction") + faction = sanitize(tgui_input_text(usr, "Please input your mobs' faction", "Faction", (faction ? faction : "neutral"))) + return TRUE + if("set_intent") + intent = tgui_input_list(usr, "Please select preferred intent", "Select Intent", list(I_HELP, I_HURT), (intent ? intent : I_HELP)) + return TRUE + if("set_ai_path") + ai_type = tgui_input_list(usr, "Select AI path. Not all subtypes are compatible!", "AI type", \ + typesof(/datum/ai_holder/), (ai_type ? ai_type : /datum/ai_holder/simple_mob/inert)) return TRUE if("loc_lock") loc_lock = !loc_lock @@ -99,6 +133,18 @@ M.name = sanitize(name) M.desc = sanitize(params["desc"]) M.flavor_text = sanitize(params["flavor_text"]) + if(use_custom_ai) + if(istype(M, /mob/living)) + var/mob/living/L = M + L.ai_holder_type = ai_type + L.faction = faction + L.a_intent = intent + L.initialize_ai_holder() + L.AdjustSleeping(-100) + else + to_chat(usr, span_notice("You can only set AI for subtypes of mob/living!")) + + /* WIP: Radius around selected coords diff --git a/code/modules/events/carp_migration.dm b/code/modules/events/carp_migration.dm index 5f7640b321..10b52ed41c 100644 --- a/code/modules/events/carp_migration.dm +++ b/code/modules/events/carp_migration.dm @@ -49,6 +49,8 @@ // Okay we did *not* have any landmarks, so lets do our best! var/i = 1 while (i <= num_groups) + if(!affecting_z.len) + return var/Z = pick(affecting_z) var/group_size = rand(group_size_min, group_size_max) var/turf/map_center = locate(round(world.maxx/2), round(world.maxy/2), Z) diff --git a/code/modules/events/gnat_migration.dm b/code/modules/events/gnat_migration.dm index 8d0428eab8..e8b7696cb6 100644 --- a/code/modules/events/gnat_migration.dm +++ b/code/modules/events/gnat_migration.dm @@ -49,6 +49,8 @@ // Okay we did *not* have any landmarks, so lets do our best! var/i = 1 while (i <= num_groups) + if(!affecting_z.len) + return var/Z = pick(affecting_z) var/group_size = rand(group_size_min, group_size_max) var/turf/map_center = locate(round(world.maxx/2), round(world.maxy/2), Z) diff --git a/code/modules/events/jellyfish_migration.dm b/code/modules/events/jellyfish_migration.dm index 0a0f639451..aecf726739 100644 --- a/code/modules/events/jellyfish_migration.dm +++ b/code/modules/events/jellyfish_migration.dm @@ -49,6 +49,8 @@ // Okay we did *not* have any landmarks, so lets do our best! var/i = 1 while (i <= num_groups) + if(!affecting_z.len) + return var/Z = pick(affecting_z) var/group_size = rand(group_size_min, group_size_max) var/turf/map_center = locate(round(world.maxx/2), round(world.maxy/2), Z) diff --git a/code/modules/events/meteors.dm b/code/modules/events/meteors.dm index 0e4ec62b74..12cbdb770c 100644 --- a/code/modules/events/meteors.dm +++ b/code/modules/events/meteors.dm @@ -45,6 +45,8 @@ /datum/event/meteor_wave/proc/send_wave() var/pick_side = prob(80) ? start_side : (prob(50) ? turn(start_side, 90) : turn(start_side, -90)) + if(!affecting_z.len) + return spawn() spawn_meteors(get_wave_size(), get_meteors(), pick_side, pick(affecting_z)) next_meteor += rand(next_meteor_lower, next_meteor_upper) / severity waves-- @@ -135,7 +137,7 @@ . = round(. * 0.5) if(speed > SHIP_SPEED_FAST) //Sanic stahp . *= 2 - + //Smol ship evasion if(victim.vessel_size < SHIP_SIZE_LARGE && speed < SHIP_SPEED_FAST) var/skill_needed = SKILL_PROF diff --git a/code/modules/events/ray_migration.dm b/code/modules/events/ray_migration.dm index 559f77169b..94674c7522 100644 --- a/code/modules/events/ray_migration.dm +++ b/code/modules/events/ray_migration.dm @@ -49,6 +49,8 @@ // Okay we did *not* have any landmarks, so lets do our best! var/i = 1 while (i <= num_groups) + if(!affecting_z.len) + return var/Z = pick(affecting_z) var/group_size = rand(group_size_min, group_size_max) var/turf/map_center = locate(round(world.maxx/2), round(world.maxy/2), Z) diff --git a/code/modules/events/shark_migration.dm b/code/modules/events/shark_migration.dm index dc3d0d9438..fd5d152f44 100644 --- a/code/modules/events/shark_migration.dm +++ b/code/modules/events/shark_migration.dm @@ -49,6 +49,8 @@ // Okay we did *not* have any landmarks, so lets do our best! var/i = 1 while (i <= num_groups) + if(!affecting_z.len) + return var/Z = pick(affecting_z) var/group_size = rand(group_size_min, group_size_max) var/turf/map_center = locate(round(world.maxx/2), round(world.maxy/2), Z) diff --git a/code/modules/events/spacefish_migration.dm b/code/modules/events/spacefish_migration.dm index 710946417e..e25ae3a3cb 100644 --- a/code/modules/events/spacefish_migration.dm +++ b/code/modules/events/spacefish_migration.dm @@ -64,6 +64,8 @@ // Okay we did *not* have any landmarks, so lets do our best! var/i = 1 while (i <= num_groups) + if(!affecting_z.len) + return var/Z = pick(affecting_z) var/group_size = rand(group_size_min, group_size_max) var/turf/map_center = locate(round(world.maxx/2), round(world.maxy/2), Z) diff --git a/code/modules/examine/examine.dm b/code/modules/examine/examine.dm index c33ecae6b9..6643e677d6 100644 --- a/code/modules/examine/examine.dm +++ b/code/modules/examine/examine.dm @@ -65,15 +65,34 @@ var/description_holders = client.description_holders stat(null,"[description_holders["icon"]] [description_holders["name"]]") //The name, written in big letters. stat(null,"[description_holders["desc"]]") //the default examine text. + + + var/color_i = "#084B8A" + var/color_f = "#298A08" + var/color_a = "#8A0808" +/* + The infowindow colours are set in code\modules\vchat\js\vchat.js file + Unfortunately, I cannot think of a way to do this elegantly where there's this central define that we can easily track. + As of 2023/08/05 13:10, the lightmode colour for vchat tabBackgroundColor is "none", this is also defined in interface\skin.dmf . + The darkmode colour for vchat tabBackgroundColor is "#272727". + Since it's possible that one day we'll have option to modify the user's preferred tabBackgroundColor + I will assume the lightmode colour will be left untouched - therefore, we are checking for none. +*/ + if(!(winget(src, "infowindow", "background-color") == "none")) + color_i = "#709ec9d8" + color_f = "#76d357" + color_a = "#c94d4d" + + if(description_holders["info"]) - stat(null,"[description_holders["info"]]") //Blue, informative text. + stat(null,"[description_holders["info"]]") //Blue, informative text. if(description_holders["interactions"]) for(var/line in description_holders["interactions"]) - stat(null, "[line]") + stat(null, "[line]") if(description_holders["fluff"]) - stat(null,"[description_holders["fluff"]]") //Yellow, fluff-related text. + stat(null,"[description_holders["fluff"]]") //Yellow, fluff-related text. if(description_holders["antag"]) - stat(null,"[description_holders["antag"]]") //Red, malicious antag-related text + stat(null,"[description_holders["antag"]]") //Red, malicious antag-related text //override examinate verb to update description holders when things are examined //mob verbs are faster than object verbs. See http://www.byond.com/forum/?post=1326139&page=2#comment8198716 for why this isn't atom/verb/examine() @@ -100,3 +119,79 @@ if(client) var/is_antag = ((mind && mind.special_role) || isobserver(src)) //ghosts don't have minds client.update_description_holders(A, is_antag) + + +/mob/verb/mob_examine() + set name = "Mob Examine" + set desc = "Allows one to examine mobs they can see, even from inside of bellies and objects." + set category = "IC" + set popup_menu = FALSE + + if((is_blind(src) || src.stat) && !isobserver(src)) + to_chat(src, "Something is there but you can't see it.") + return 1 + var/list/E = list() + if(isAI(src)) + var/mob/living/silicon/ai/my_ai = src + for(var/e in my_ai.all_eyes) + var/turf/my_turf = get_turf(e) + var/foundcam = FALSE + for(var/obj/cam in view(world.view, my_turf)) + if(istype(cam, /obj/machinery/camera)) + var/obj/machinery/camera/mycam = cam + if(!mycam.stat) + foundcam = TRUE + if(!foundcam) + continue + for(var/atom/M in view(world.view, my_turf)) + if(M == src || istype(M, /mob/observer)) + continue + if(ismob(M) && !M.invisibility) + if(src && src == M) + var/list/results = src.examine(src) + if(!results || !results.len) + results = list("You were unable to examine that. Tell a developer!") + to_chat(src, jointext(results, "
")) + update_examine_panel(src) + return + else + E |= M + if(E.len == 0) + return + else + var/my_turf = get_turf(src) + for(var/atom/M in view(world.view, my_turf)) + if(ismob(M) && M != src && !istype(M, /mob/observer) && !M.invisibility) + E |= M + for(var/turf/T in view(world.view, my_turf)) + if(!isopenspace(T)) + continue + var/turf/checked = T + var/keepgoing = TRUE + while(keepgoing) + var/checking = GetBelow(checked) + for(var/atom/m in checking) + if(ismob(m) && !istype(m, /mob/observer) && !m.invisibility) + E |= m + checked = checking + if(!isopenspace(checked)) + keepgoing = FALSE + + if(E.len == 0) + to_chat(src, SPAN_NOTICE("There are no mobs to examine.")) + return + var/atom/B = null + if(E.len == 1) + B = pick(E) + else + B = tgui_input_list(src, "What would you like to examine?", "Examine", E) + if(!B) + return + if(!isbelly(loc) && !istype(loc, /obj/item/weapon/holder) && !isAI(src)) + if(B.z == src.z) + face_atom(B) + var/list/results = B.examine(src) + if(!results || !results.len) + results = list("You were unable to examine that. Tell a developer!") + to_chat(src, jointext(results, "
")) + update_examine_panel(B) diff --git a/code/modules/examine/examine_vr.dm b/code/modules/examine/examine_vr.dm deleted file mode 100644 index f198da0edb..0000000000 --- a/code/modules/examine/examine_vr.dm +++ /dev/null @@ -1,74 +0,0 @@ -/mob/verb/mob_examine() - set name = "Mob Examine" - set desc = "Allows one to examine mobs they can see, even from inside of bellies and objects." - set category = "IC" - set popup_menu = FALSE - - if((is_blind(src) || src.stat) && !isobserver(src)) - to_chat(src, "Something is there but you can't see it.") - return 1 - var/list/E = list() - if(isAI(src)) - var/mob/living/silicon/ai/my_ai = src - for(var/e in my_ai.all_eyes) - var/turf/my_turf = get_turf(e) - var/foundcam = FALSE - for(var/obj/cam in view(world.view, my_turf)) - if(istype(cam, /obj/machinery/camera)) - var/obj/machinery/camera/mycam = cam - if(!mycam.stat) - foundcam = TRUE - if(!foundcam) - continue - for(var/atom/M in view(world.view, my_turf)) - if(M == src || istype(M, /mob/observer)) - continue - if(ismob(M) && !M.invisibility) - if(src && src == M) - var/list/results = src.examine(src) - if(!results || !results.len) - results = list("You were unable to examine that. Tell a developer!") - to_chat(src, jointext(results, "
")) - update_examine_panel(src) - return - else - E |= M - if(E.len == 0) - return - else - var/my_turf = get_turf(src) - for(var/atom/M in view(world.view, my_turf)) - if(ismob(M) && M != src && !istype(M, /mob/observer) && !M.invisibility) - E |= M - for(var/turf/T in view(world.view, my_turf)) - if(!isopenspace(T)) - continue - var/turf/checked = T - var/keepgoing = TRUE - while(keepgoing) - var/checking = GetBelow(checked) - for(var/atom/m in checking) - if(ismob(m) && !istype(m, /mob/observer) && !m.invisibility) - E |= m - checked = checking - if(!isopenspace(checked)) - keepgoing = FALSE - - if(E.len == 0) - to_chat(src, SPAN_NOTICE("There are no mobs to examine.")) - return - var/atom/B = null - if(E.len == 1) - B = pick(E) - else - B = tgui_input_list(src, "What would you like to examine?", "Examine", E) - if(!B) - return - if(!isbelly(loc) && !istype(loc, /obj/item/weapon/holder) && !isAI(src)) - if(B.z == src.z) - face_atom(B) - var/list/results = B.examine(src) - if(!results || !results.len) - results = list("You were unable to examine that. Tell a developer!") - to_chat(src, jointext(results, "
")) - update_examine_panel(B) \ No newline at end of file diff --git a/code/modules/materials/materials/_materials.dm b/code/modules/materials/materials/_materials.dm index 05046ba85a..6ce2fab16c 100644 --- a/code/modules/materials/materials/_materials.dm +++ b/code/modules/materials/materials/_materials.dm @@ -352,6 +352,7 @@ var/list/name_to_material // If is_brittle() returns true, these are only good for a single strike. recipes = list( new /datum/stack_recipe("[display_name] baseball bat", /obj/item/weapon/material/twohanded/baseballbat, 10, time = 20, one_per_turf = 0, on_floor = 1, supplied_material = "[name]", pass_stack_color = TRUE), + new /datum/stack_recipe("[display_name] staff", /obj/item/weapon/material/twohanded/staff, 10, time = 20, one_per_turf = 0, on_floor = 1, supplied_material = "[name]", pass_stack_color = TRUE), new /datum/stack_recipe("[display_name] ashtray", /obj/item/weapon/material/ashtray, 2, one_per_turf = 1, on_floor = 1, supplied_material = "[name]", pass_stack_color = TRUE), new /datum/stack_recipe("[display_name] spoon", /obj/item/weapon/material/kitchen/utensil/spoon/plastic, 1, on_floor = 1, supplied_material = "[name]", pass_stack_color = TRUE), new /datum/stack_recipe("[display_name] armor plate", /obj/item/weapon/material/armor_plating, 1, time = 20, on_floor = 1, supplied_material = "[name]", pass_stack_color = TRUE), diff --git a/code/modules/mob/living/living_movement.dm b/code/modules/mob/living/living_movement.dm index f58c741ded..4918df39f0 100644 --- a/code/modules/mob/living/living_movement.dm +++ b/code/modules/mob/living/living_movement.dm @@ -276,6 +276,8 @@ default behaviour is: is_shifted = FALSE pixel_x = default_pixel_x pixel_y = default_pixel_y + layer = MOB_LAYER + plane = MOB_PLANE // End VOREstation edit if(pulling) // we were pulling a thing and didn't lose it during our move. diff --git a/code/modules/mob/living/simple_mob/overmap_mob_vr.dm b/code/modules/mob/living/simple_mob/overmap_mob_vr.dm index 8a998d48ea..dd4fc73631 100644 --- a/code/modules/mob/living/simple_mob/overmap_mob_vr.dm +++ b/code/modules/mob/living/simple_mob/overmap_mob_vr.dm @@ -84,13 +84,60 @@ name = "DONT SPAWN ME" desc = "I'm a bad person I'm sorry" + maxHealth = 100000 + health = 100000 + movement_cooldown = 10 + + see_in_dark = 10 + faction = "overmap" low_priority = FALSE devourable = FALSE digestable = FALSE + + harm_intent_damage = 1 + melee_damage_lower = 50 + melee_damage_upper = 100 + attack_sharp = FALSE + + min_oxy = 0 + max_oxy = 0 + min_tox = 0 + max_tox = 0 + min_co2 = 0 + max_co2 = 0 + min_n2 = 0 + max_n2 = 0 + minbodytemp = 0 + maxbodytemp = 900 + + mob_size = MOB_HUGE + + loot_list = list(/obj/random/underdark/uncertain) + + armor = list( + "melee" = 1000, + "bullet" = 1000, + "laser" = 1000, + "energy" = 1000, + "bomb" = 1000, + "bio" = 1000, + "rad" = 1000) + + armor_soak = list( + "melee" = 1000, + "bullet" = 1000, + "laser" = 1000, + "energy" = 1000, + "bomb" = 1000, + "bio" = 1000, + "rad" = 1000 + ) + var/scanner_desc var/obj/effect/overmap/visitable/simplemob/child_om_marker var/om_child_type + var/shipvore = FALSE //Enable this to allow the mob to eat spaceships by dragging them onto its sprite. /mob/living/simple_mob/vore/overmap/New(mapload, new_child) if(new_child) @@ -99,7 +146,7 @@ /mob/living/simple_mob/vore/overmap/Initialize() . = ..() - if(!om_child_type && !om_child_type) + if(!om_child_type) log_and_message_admins("An improperly configured OM mob tried to spawn, and was deleted.") return INITIALIZE_HINT_QDEL if(!child_om_marker) @@ -109,3 +156,66 @@ /mob/living/simple_mob/vore/overmap/Destroy() qdel_null(child_om_marker) return ..() + +//SHIP + +/obj/effect/overmap/visitable/ship/simplemob + name = "unknown ship" + icon = 'icons/obj/overmap.dmi' + icon_state = "ship" + scannable = TRUE + known = FALSE + in_space = FALSE //Just cuz we don't want people getting here via map edge transitions normally. + unknown_name = "unknown ship" + unknown_state = "ship" + + var/mob/living/simple_mob/vore/overmap/parent_mob_type + var/mob/living/simple_mob/vore/overmap/parent + +/obj/effect/overmap/visitable/ship/simplemob/New(newloc, new_parent) + if(new_parent) + parent = new_parent + return ..() + +/obj/effect/overmap/visitable/ship/simplemob/Initialize() + . = ..() + if(!parent_mob_type && !parent) + log_and_message_admins("An improperly configured OM mob event tried to spawn, and was deleted.") + return INITIALIZE_HINT_QDEL + if(!parent) + var/mob/living/simple_mob/vore/overmap/P = new parent_mob_type(loc, src) + parent = P + om_mob_event_setup() + +/obj/effect/overmap/visitable/ship/simplemob/proc/om_mob_event_setup() + scanner_desc = parent.scanner_desc + RegisterSignal(parent, COMSIG_MOVABLE_MOVED, PROC_REF(on_parent_moved)) + skybox_pixel_x = rand(-100,100) + if(known) + name = initial(parent.name) + icon = initial(parent.icon) + icon_state = initial(parent.icon_state) + color = initial(parent.color) + desc = initial(parent.desc) + +/obj/effect/overmap/visitable/ship/simplemob/Destroy() + UnregisterSignal(parent, COMSIG_MOVABLE_MOVED) + qdel_null(parent) + return ..() + +/obj/effect/overmap/visitable/ship/simplemob/get_scan_data(mob/user) + if(!known) + known = TRUE + name = initial(parent.name) + icon = initial(parent.icon) + icon_state = initial(parent.icon_state) + color = initial(parent.color) + desc = initial(parent.desc) + + var/dat = {"\[b\]Scan conducted at\[/b\]: [stationtime2text()] [stationdate2text()]\n\[b\]Grid coordinates\[/b\]: [x],[y]\n\n[scanner_desc]"} + + return dat + +/obj/effect/overmap/visitable/ship/simplemob/proc/on_parent_moved(atom/movable/source, OldLoc, Dir, Forced) + forceMove(parent.loc) + set_dir(parent.dir) diff --git a/code/modules/mob/living/simple_mob/simple_mob_vr.dm b/code/modules/mob/living/simple_mob/simple_mob_vr.dm index 098ac1023e..e72e7aa160 100644 --- a/code/modules/mob/living/simple_mob/simple_mob_vr.dm +++ b/code/modules/mob/living/simple_mob/simple_mob_vr.dm @@ -268,6 +268,8 @@ /mob/living/simple_mob/proc/tryBumpNom(var/mob/tmob) //returns TRUE if we actually start an attempt to bumpnom, FALSE if checks fail or the random bump nom chance fails if(istype(tmob) && will_eat(tmob) && !istype(tmob, type) && prob(vore_bump_chance) && !ckey) //check if they decide to eat. Includes sanity check to prevent cannibalism. + if(!faction_bump_vore && faction == tmob.faction) + return FALSE if(tmob.canmove && prob(vore_pounce_chance)) //if they'd pounce for other noms, pounce for these too, otherwise still try and eat them if they hold still tmob.Weaken(5) tmob.visible_message("\The [src] [vore_bump_emote] \the [tmob]!!") diff --git a/code/modules/mob/living/simple_mob/subtypes/animal/alien animals/spacewhale.dm b/code/modules/mob/living/simple_mob/subtypes/animal/alien animals/spacewhale.dm index 71402e113b..65bd18c973 100644 --- a/code/modules/mob/living/simple_mob/subtypes/animal/alien animals/spacewhale.dm +++ b/code/modules/mob/living/simple_mob/subtypes/animal/alien animals/spacewhale.dm @@ -19,56 +19,13 @@ om_child_type = /obj/effect/overmap/visitable/simplemob/spacewhale - maxHealth = 100000 - health = 100000 - movement_cooldown = 10 - - see_in_dark = 10 - response_help = "pets" response_disarm = "gently pushes aside" response_harm = "punches" - - harm_intent_damage = 1 - melee_damage_lower = 50 - melee_damage_upper = 100 - attack_sharp = FALSE attacktext = list("chomped", "bashed", "monched", "bumped") ai_holder_type = /datum/ai_holder/simple_mob/melee/spacewhale - min_oxy = 0 - max_oxy = 0 - min_tox = 0 - max_tox = 0 - min_co2 = 0 - max_co2 = 0 - min_n2 = 0 - max_n2 = 0 - minbodytemp = 0 - maxbodytemp = 900 - - loot_list = list(/obj/random/underdark/uncertain) - - armor = list( - "melee" = 1000, - "bullet" = 1000, - "laser" = 1000, - "energy" = 1000, - "bomb" = 1000, - "bio" = 1000, - "rad" = 1000) - - armor_soak = list( - "melee" = 1000, - "bullet" = 1000, - "laser" = 1000, - "energy" = 1000, - "bomb" = 1000, - "bio" = 1000, - "rad" = 1000 - ) - speak_emote = list("rumbles") say_list_type = /datum/say_list/spacewhale diff --git a/code/modules/mob/living/simple_mob/subtypes/animal/alien animals/stardog.dm b/code/modules/mob/living/simple_mob/subtypes/animal/alien animals/stardog.dm new file mode 100644 index 0000000000..e7e0e9ecca --- /dev/null +++ b/code/modules/mob/living/simple_mob/subtypes/animal/alien animals/stardog.dm @@ -0,0 +1,1737 @@ +//I'm sorry for this file, no one should have to deal with this +//I am in a pain trance and coding is the only thing that can distract me +//I am a dwarf in a fey mood, but what I make will not be a masterwork, woe + +/datum/category_item/catalogue/fauna/stardog + name = "Alien Wildlife - Star Dog" + desc = "I appears to be a canine of some sort, though absolutely massive in scale and surrounded in radical redspace energies!" + value = CATALOGUER_REWARD_SUPERHARD + +/mob/living/simple_mob/vore/overmap/stardog + name = "dog" + desc = "It is a relatively ordinary looking canine mutt! It radiates mischief and otherworldly energy..." + tt_desc = "E Canis lupus stellarus" + + scanner_desc = "I appears to be a canine of some sort, though absolutely massive in scale and surrounded in radical redspace energies!" + catalogue_data = list(/datum/category_item/catalogue/fauna/stardog) + + icon = 'icons/mob/vore.dmi' + icon_state = "woof" + icon_living = "woof" + icon_dead = "woof_dead" + icon_rest = "woof_rest" + + om_child_type = /obj/effect/overmap/visitable/ship/simplemob/stardog + + response_help = "pets" + response_disarm = "rudely paps" + response_harm = "punches" + + attacktext = list("nipped", "chomped", "bullied", "gnaws on") + attack_sound = 'sound/voice/bork.ogg' + friendly = list("snoofs", "nuzzles", "ruffs happily at", "smooshes on") + + ai_holder_type = /datum/ai_holder/simple_mob/woof/stardog + + has_langs = list(LANGUAGE_ANIMAL, LANGUAGE_CANILUNZT, LANGUAGE_GALCOM) + say_list_type = /datum/say_list/softdog + swallowTime = 0.1 SECONDS + + loot_list = list(/obj/random/underdark/uncertain) + + armor = list( + "melee" = 1000, + "bullet" = 1000, + "laser" = 1000, + "energy" = 1000, + "bomb" = 1000, + "bio" = 1000, + "rad" = 1000) + + armor_soak = list( + "melee" = 1000, + "bullet" = 1000, + "laser" = 1000, + "energy" = 1000, + "bomb" = 1000, + "bio" = 1000, + "rad" = 1000 + ) + + movement_cooldown = 5 + copy_prefs_to_mob = FALSE + player_msg = "The dog accepts you into itself, allowing you to dictate what will happen. The dog occasionally thinks unknowable thoughts, though you can understand some of its needs and desires. The dog shares its experience with you. You can navigate space, 'transition' to certain locations, and you can dine upon some of the space weather. The dog doesn't seem to know how any of this works exactly, this is just how things are for the dog, they come as naturally to the dog as blinking." + + var/affinity = 0 + var/obj/structure/control_pod/control_node = null + var/admin_override = FALSE //If true, makes affinity and nutrition irrelevant. + var/list/weather_areas = list() //We'll call a proc on these areas when we eat, don't worry! + +/mob/living/simple_mob/vore/overmap/stardog/Login() + . = ..() + verbs -= /mob/living/simple_mob/proc/set_name + verbs -= /mob/living/simple_mob/proc/set_desc + +/mob/living/simple_mob/vore/overmap/stardog/attack_hand(mob/living/user) + if(!(user.pickup_pref && user.pickup_active)) + return ..() + var/list/possible_targets = list() + + for(var/mob/living/player in player_list) + if(!(player.z in child_om_marker.map_z)) + continue + if(!(isliving(player) && istype(player.loc,/turf/simulated/floor/outdoors/fur) && player.client)) + continue + if(player.resizable && player.pickup_pref) + possible_targets |= player + + if(!possible_targets.len) + return ..() + user.visible_message("\The [user] reaches for something in \the [src]'s fur...","You look through \the [src]'s fur...") + var/mob/living/that_one = tgui_input_list(user, "Select a mob:", "Select a mob to grab!", possible_targets) + if(!that_one) + return ..() + to_chat(that_one, "\The [user]'s hand reaches toward you!!!") + if(!do_after(user, 3 SECONDS, src)) + return ..() + if(!istype(that_one.loc,/turf/simulated/floor/outdoors/fur)) + to_chat(user, "\The [that_one] got away...") + to_chat(that_one, "You got away!") + return + var/prev_size = that_one.size_multiplier + that_one.resize(RESIZE_TINY, ignore_prefs = TRUE) + if(!that_one.attempt_to_scoop(user, ignore_size = TRUE)) + that_one.resize(prev_size, ignore_prefs = TRUE) + return ..() + +/mob/living/simple_mob/vore/overmap/stardog/Life() + . = ..() + if(admin_override) + affinity = 9999 + nutrition = 9999 + if(devourable) //This will cause problems probably so please do not eat the dog + devourable = FALSE + digestable = FALSE + if(ckey && control_node) + if(nutrition <= 200) + adjust_affinity(-10) + else if(nutrition < 500) + adjust_affinity(-3) + else + adjust_affinity(-1) + if(!affinity) + control_node.eject() + if(!ckey && resting) + lay_down() + + if(istype(loc, /turf/unsimulated/map)) + if(!invisibility) + invisibility = INVISIBILITY_ABSTRACT + child_om_marker.invisibility = 0 + ai_holder.base_wander_delay = 50 + ai_holder.wander_delay = 1 + melee_damage_lower = 50 + melee_damage_upper = 100 + mob_size = MOB_HUGE + child_om_marker.set_light(5, 1, "#ff8df5") + movement_cooldown = 5 + + else if(invisibility) + invisibility = 0 + child_om_marker.invisibility = INVISIBILITY_ABSTRACT + ai_holder.base_wander_delay = 5 + ai_holder.wander_delay = 1 + melee_damage_lower = 1 + melee_damage_upper = 5 + mob_size = MOB_SMALL + child_om_marker.set_light(0) + movement_cooldown = 0 + +/mob/living/simple_mob/vore/overmap/stardog/perform_the_nom(mob/living/user, mob/living/prey, mob/living/pred, obj/belly/belly, delay) + to_chat(src, "You can't do that.") //The dog can move back and forth between the overmap. + return //If it can do normal vore mechanics, it can carry players to the OM, + //and release them there. I think that's probably a bad idea. + +/mob/living/simple_mob/vore/overmap/stardog/Initialize() + . = ..() + child_om_marker.set_light(5, 1, "#ff8df5") + +/mob/living/simple_mob/vore/overmap/stardog/Destroy() + if(control_node) + control_node.host = null + control_node = null + for(var/anything in weather_areas) + weather_areas -= anything + return ..() + +/mob/living/simple_mob/vore/overmap/stardog/Stat() + ..() + if(statpanel("Status")) + stat(null, "Affinity: [round(affinity)]") + +/mob/living/simple_mob/vore/overmap/stardog/start_pulling(var/atom/movable/AM) + if(!istype(loc, /turf/unsimulated/map)) //Don't pull stuff on the overmap + ..() + +/mob/living/simple_mob/vore/overmap/stardog/proc/adjust_affinity(amount) + if(amount > 0) + var/multiplier = nutrition / 250 + affinity += (amount * multiplier) + if(amount < 0) + affinity += amount + if(affinity <= 0) + affinity = 0 + if(affinity > 1000) + affinity = 1000 + +/mob/living/simple_mob/vore/overmap/stardog/verb/eject() + set name = "Eject" + set desc = "Stop controlling the dog and return to your own body." + set category = "Abilities" + + control_node.eject() + +/mob/living/simple_mob/vore/overmap/stardog/verb/eat_space_weather() + set name = "Eat Space Weather" + set desc = "Eat carp or rocks!" + set category = "Abilities" + + var/obj/effect/overmap/event/E + var/nut = 0 + var/aff = 0 + var/mob = FALSE + var/ore = 0 + var/tre = 0 + var/msg = "REPLACE ME" + var/heal = FALSE + var/delet = TRUE + + for(var/obj/effect/overmap/event/e in loc) + if(istype(e, /obj/effect/overmap/event/carp)) + E = e + nut = 250 + aff = -50 + mob = TRUE + var/list/msglist = list( + "You lap up \the [E]. They're pretty filling, but you don't really like the taste...", + "You lap up \the [E]. You can feel them wiggle all the way down... They don't taste very good, but you feel energized afterward.", + "You lap up \the [E]. They flee away from you, attempting to scatter in all directions, but you're faster! They leave an unpleasant taste on your tongue, but your belly doesn't seem to mind them." + ) + msg = pick(msglist) + else if(istype(e, /obj/effect/overmap/event/dust)) + E = e + aff = -100 + tre = 15 + ore = 25 + var/list/msglist = list( + "You lap up \the [E]. The dust clings to your mouth and throat!!! You cough and splutter unhappily! It is literally space dirt, and it tastes like it!", + "You lap up \the [E]. The bitter taste of the dust sticks to your tongue and takes a lot of work to get off! It's really frustrating!", + "You lap up \the [E]. Not only does it taste horrible and feel worse going down, some of it gets in your eyes!" + ) + msg = pick(msglist) + else if(istype(e, /obj/effect/overmap/event/meteor)) + E = e + aff = -200 + tre = 5 + ore = 100 + var/list/msglist = list( + "You lap up \the [E]. The rocks roll down your gullet haphazardly. Some of them knock together and clatter their way down, while others turn to powder. Some of them even have some pretty sharp edges that don't feel very nice! They certainly don't taste very nice, and they weight heavily inside of your belly...", + "You lap up \the [E]. When they land inside you can feel the weight of them settle in. They make your insides kind of queasy...", + "You lap up \the [E]. They taste like rocks, and make you think of all the better things you could be eating..." + ) + + msg = pick(msglist) + else if(istype(e, /obj/effect/overmap/event/electric)) + E = e + aff = 15 + msg = "You try to eat \the [E], but you find that no matter how much of it you lick or homn upon, yet more remains! It makes your mouth tingle, and your fur stand on end! It's kind of fun, but it doesn't taste like anything, and you definitely don't feel any more full." + delet = FALSE + else if(istype(e, /obj/effect/overmap/event/ion)) + E = e + aff = 20 + msg = "When you approach \the [E], you find that the dog's will pulls away from your own a little bit. It seems to really like the shimmering clouds, and it feels really good to nestle up among them. Like taking a relaxing dip into a regenerative spring. Any aches and pains that the dog was experiencing seem to fade away, leaving it feeling refreshed!" + heal = TRUE + delet = FALSE + else + to_chat(src, "You can't eat \the [e].") + return + + if(!E) + to_chat(src, "There isn't anything to eat here.") + return + + to_chat(src, "You begin to eat \the [E]...") + + if(!do_after(src, 20 SECONDS, E, exclusive = TRUE)) + return + to_chat(src, "[msg]") + if(nut || aff) + adjust_nutrition(nut) + adjust_affinity(aff) + if(mob) + spawn_mob() + to_chat(src, "You can feel something moving inside of you...") + if(ore) + spawn_ore(ore) + if(tre) + spawn_treasure(tre) + if(heal) + adjustFireLoss(-999) + adjustBruteLoss(-999) + if(delet) + qdel(E) + +/mob/living/simple_mob/vore/overmap/stardog/proc/spawn_mob() + for(var/area/redgate/stardog/flesh_abyss/a in weather_areas) + if(istype(a, /area/redgate/stardog/flesh_abyss)) + a.spawn_mob() +/mob/living/simple_mob/vore/overmap/stardog/proc/spawn_ore(chance) + for(var/area/redgate/stardog/flesh_abyss/a in weather_areas) + if(istype(a, /area/redgate/stardog/flesh_abyss) && prob(chance)) + a.spawn_ore() +/mob/living/simple_mob/vore/overmap/stardog/proc/spawn_treasure(chance) + for(var/area/redgate/stardog/flesh_abyss/a in weather_areas) + if(istype(a, /area/redgate/stardog/flesh_abyss) && prob(chance)) + a.spawn_treasure() + +/mob/living/simple_mob/vore/overmap/stardog/verb/transition() //Don't ask how it works. I don't know. I didn't think about it. I just thought it would be cool. + set name = "Transition" + set desc = "Attempt to go to the location you have arrived at, or return to space!" + set category = "Abilities" + if(nutrition <= 500) + to_chat(src, "You're too hungry...") + return + if(istype(loc, /turf/unsimulated/map)) + var/list/destinations = list() + var/list/our_maps = list() + for(var/obj/effect/overmap/visitable/v in loc) + if(v == child_om_marker) + continue + if(!v.map_z.len) + continue + for(var/our_z in v.map_z) + our_maps |= our_z + if(!our_maps.len) + to_chat(src, "There is nowhere nearby to go to! You need to get closer to somewhere you can transition to before you can transition.") + return + for(var/obj/effect/landmark/l in landmarks_list) + if(l.z in our_maps) + if(istype(l,/obj/effect/landmark/stardog)) + destinations |= l + + if(!destinations.len) + to_chat(src, "There is nowhere nearby to land! You need to get closer to somewhere else that you can transition to before you can transition.") + return + for(var/obj/effect/landmark/stardog/l in destinations) + var/obj/effect/overmap/visitable/our_dest = tgui_input_list(src, "Where would you like to try to go?", "Transition", destinations, timeout = 15 SECONDS, strict_modern = TRUE) + if(!our_dest) + to_chat(src, "You decide not to transition.") + return + to_chat(src, "You begin to transition down to \the [our_dest], stay still...") + if(!do_after(src, 15 SECONDS, exclusive = TRUE)) + to_chat(src, "You were interrupted.") + return + visible_message("\The [src] disappears!!!") + stop_pulling() + forceMove(get_turf(our_dest)) + adjust_nutrition(-1000) + visible_message("\The [src] steps into the area as if from nowhere!") + + else + to_chat(src, "You begin to transition back to space, stay still...") + if(!do_after(src, 15 SECONDS, exclusive = TRUE)) + to_chat(src, "You were interrupted.") + return + + visible_message("\The [src] disappears!!!") + stop_pulling() + forceMove(get_turf(get_overmap_sector(z))) + adjust_nutrition(-500) + + +/obj/effect/overmap/visitable/ship/simplemob/stardog + icon = 'icons/obj/overmap.dmi' + icon_state = "ship" + skybox_icon = 'icons/skybox/anomaly.dmi' + skybox_icon_state = "space_dog" + skybox_pixel_x = 0 + skybox_pixel_y = 0 + glide_size = 2 + parent_mob_type = /mob/living/simple_mob/vore/overmap/stardog + scanner_desc = "CONFIGURE ME" + +/datum/ai_holder/simple_mob/woof/stardog + hostile = FALSE + cooperative = TRUE + retaliate = TRUE + speak_chance = 1 + wander = TRUE + wander_delay = 1 + base_wander_delay = 50 + +/turf/simulated/floor/outdoors/fur + name = "fur" + desc = "Thick, silky fur!" + icon = 'icons/turf/fur.dmi' + icon_state = "fur0" + edge_blending_priority = 4 + initial_flooring = /decl/flooring/fur + can_dig = FALSE + turf_layers = list() + var/tree_chance = 25 + var/tree_color = null + var/tree_type = /obj/structure/flora/tree/fur + +/turf/simulated/floor/outdoors/fur/attackby() + return + +/turf/simulated/floor/outdoors/fur/attack_hand(mob/user) + . = ..() + pet() + +/turf/simulated/floor/outdoors/fur/ex_act(severity) + return + + +/turf/simulated/floor/outdoors/fur/Entered(atom/movable/AM, atom/oldloc) + . = ..() + if(ishuman(AM)) + var/mob/living/carbon/human/L = AM + L.fur_submerge() + +/turf/simulated/floor/outdoors/fur/Exited(atom/movable/AM, atom/new_loc) + . = ..() + if(ishuman(AM)) + var/mob/living/carbon/human/L = AM + L.fur_submerge() + +/mob/living/carbon/human/proc/fur_submerge() + if(QDESTROYING(src)) + return + + remove_layer(MOB_WATER_LAYER) + + if(!istype(loc,/turf/simulated/floor/outdoors/fur) || lying) + return + + var/atom/A = loc + var/image/I = image(icon = 'icons/turf/fur.dmi', icon_state = "submerged", layer = BODY_LAYER+MOB_WATER_LAYER) + I.color = A.color + overlays_standing[MOB_WATER_LAYER] = I + + apply_layer(MOB_WATER_LAYER) + +/turf/simulated/floor/outdoors/fur/woof + color = "#c69c85" + tree_color = "#eeb698" + +/turf/simulated/floor/outdoors/fur/woof/no_trees + icon_state = "furX" + tree_chance = 0 + +/turf/simulated/floor/outdoors/fur/Initialize() + . = ..() + if(tree_chance && prob(tree_chance) && !check_density()) + var/obj/structure/flora/tree/tree = new tree_type(src) + if(tree_color) + tree.color = tree_color + else + tree.color = color + +/turf/simulated/floor/outdoors/fur/woof/wall + name = "dense fur" + desc = "Silky and soft, but too thick to pass or cut!" + color = "#92705d" + opacity = TRUE + tree_color = null + tree_chance = 100 + tree_type = /obj/structure/flora/tree/fur/wall + outdoors = FALSE + +/turf/simulated/floor/outdoors/fur/verb/pet() + set name = "Pet Fur" + set desc = "Pet the fur!" + set category = "IC" + set src in oview(1) + + usr.visible_message("\The [usr] pets \the [src].", "You pet \the [src].", runemessage = "pet pat...") + var/obj/effect/overmap/visitable/ship/simplemob/stardog/s = get_overmap_sector(z) + + if(s && istype(s, /obj/effect/overmap/visitable/ship/simplemob/stardog)) + var/mob/living/simple_mob/vore/overmap/stardog/m = s.parent + m.adjust_affinity(1) + if(m.affinity >= 10 && prob(5)) + m.visible_message("\The [m]'s tail wags happily!") + +/turf/simulated/floor/outdoors/fur/verb/emote_beyond(message as message) //Now even the stars will know your sin. + set name = "Emote Beyond" + set desc = "Emote to those beyond the fur!" + set category = "IC" + set src in oview(1) + + if(!isliving(usr)) + return + var/mob/living/L = usr + if(L.client.prefs.muted & MUTE_IC) + to_chat(L, "You cannot speak in IC (muted).") + return + if (!message) + message = tgui_input_text(usr, "Type a message to emote.","Emote Beyond") + message = sanitize_or_reflect(message,L) + if (!message) + return + if (L.stat == DEAD) + return L.say_dead(message) + var/obj/effect/overmap/visitable/ship/simplemob/stardog/s = get_overmap_sector(z) + if(!s || !istype(s, /obj/effect/overmap/visitable/ship/simplemob/stardog)) + return + + var/mob/living/simple_mob/vore/overmap/stardog/m = s.parent + + log_subtle(message,L) + message = "[L] [message]" + message = "(From the back of \the [m]) " + message + message = encode_html_emphasis(message) + + var/undisplayed_message = "[L] does something too subtle for you to see." + var/list/vis = get_mobs_and_objs_in_view_fast(get_turf(m),1,2) + var/list/vis_mobs = vis["mobs"] + vis_mobs |= L + for(var/mob/M as anything in vis_mobs) + if(isnewplayer(M)) + continue + if(isobserver(M) && !L.is_preference_enabled(/datum/client_preference/whisubtle_vis) && !M.client?.holder) + spawn(0) + M.show_message(undisplayed_message, 2) + else + spawn(0) + M.show_message(message, 2) + if(M.is_preference_enabled(/datum/client_preference/subtle_sounds)) + M << sound('sound/talksounds/subtle_sound.ogg', volume = 50) + +/decl/flooring/fur + name = "fur" + desc = "Thick, silky fur!" + icon = 'icons/turf/fur.dmi' + icon_base = "fur" + has_base_range = 15 + + can_paint = TRUE + + footstep_sounds = list("human" = list( + 'sound/effects/footstep/carpet1.ogg', + 'sound/effects/footstep/carpet2.ogg', + 'sound/effects/footstep/carpet3.ogg', + 'sound/effects/footstep/carpet4.ogg', + 'sound/effects/footstep/carpet5.ogg')) + +/obj/structure/flora/tree/fur + name = "tall fur" + desc = "Tall stalks of fur block your path! Someone needs a trim!" + icon = 'icons/obj/fur_tree.dmi' + icon_state = "tallfur1" + base_state = "tallfur" + opacity = TRUE + product = /obj/item/stack/material/fur + product_amount = 10 + health = 100 + max_health = 100 + pixel_x = 0 + pixel_y = 0 + shake_animation_degrees = 2 + sticks = FALSE + var/mob_chance = 5 + var/static/list/mob_list = list( //Just, all the vore mobs. If some of the paths weren't shitty I would just put like `subtypesof(/mob/living/simple_mob/vore)` here. Maybe I'll fix that later, I am dying right now, I hope I will be remembered fondly when I die + /mob/living/simple_mob/vore/aggressive/corrupthound, + /mob/living/simple_mob/vore/aggressive/corrupthound/prettyboi, + /mob/living/simple_mob/vore/aggressive/deathclaw, + /mob/living/simple_mob/vore/aggressive/dino, + /mob/living/simple_mob/vore/aggressive/dragon, + /mob/living/simple_mob/vore/aggressive/frog, + /mob/living/simple_mob/vore/aggressive/giant_snake, + /mob/living/simple_mob/vore/aggressive/mimic, + /mob/living/simple_mob/vore/aggressive/panther, + /mob/living/simple_mob/vore/aggressive/rat, + /mob/living/simple_mob/vore/alienanimals/catslug, + /mob/living/simple_mob/vore/alienanimals/dustjumper, + /mob/living/simple_mob/vore/alienanimals/skeleton, + /mob/living/simple_mob/vore/alienanimals/space_jellyfish, + /mob/living/simple_mob/vore/alienanimals/startreader, + /mob/living/simple_mob/vore/alienanimals/succlet, + /mob/living/simple_mob/vore/alienanimals/teppi, + /mob/living/simple_mob/vore/alienanimals/teppi/baby, + /mob/living/simple_mob/vore/bee, + /mob/living/simple_mob/vore/bigdragon, + /mob/living/simple_mob/vore/bigdragon/friendly, + /mob/living/simple_mob/vore/catgirl, + /mob/living/simple_mob/vore/fennec, + /mob/living/simple_mob/vore/fennec/huge, + /mob/living/simple_mob/vore/fennix, + /mob/living/simple_mob/vore/greatwolf, + /mob/living/simple_mob/vore/hippo, + /mob/living/simple_mob/vore/horse, + /mob/living/simple_mob/vore/horse/big, + /mob/living/simple_mob/vore/jelly, + /mob/living/simple_mob/vore/lamia/random, + /mob/living/simple_mob/vore/leopardmander, + /mob/living/simple_mob/vore/oregrub, + /mob/living/simple_mob/vore/otie, + /mob/living/simple_mob/vore/otie/red, + /mob/living/simple_mob/vore/pakkun, + /mob/living/simple_mob/vore/rabbit, + /mob/living/simple_mob/vore/redpanda, + /mob/living/simple_mob/vore/sect_drone, + /mob/living/simple_mob/vore/sect_queen, + /mob/living/simple_mob/vore/sheep, + /mob/living/simple_mob/vore/solargrub, + /mob/living/simple_mob/vore/squirrel, + /mob/living/simple_mob/vore/squirrel/big, + /mob/living/simple_mob/vore/weretiger, + /mob/living/simple_mob/vore/wolf, + /mob/living/simple_mob/vore/wolf/direwolf, + /mob/living/simple_mob/vore/wolfgirl, + /mob/living/simple_mob/vore/woof + ) + +/obj/structure/flora/tree/fur/choose_icon_state() + return "[base_state][rand(1, 2)]" + +/obj/structure/flora/tree/fur/attack_hand(mob/user) + return + +/obj/structure/flora/tree/fur/die() + if(product && product_amount) + var/obj/item/stack/material/fur/F = new product(get_turf(src), product_amount) + F.color = color + F.update_icon() + visible_message("\The [src] is felled!") + if(prob(mob_chance)) + if(!mob_list.len) + return + var/ourmob = pickweight(mob_list) + var/mob/living/simple_mob/s = new ourmob(get_turf(src)) + visible_message("\The [s] tumbles out of \the [src]!") + s.ai_holder.hostile = FALSE + s.ai_holder.retaliate = TRUE + s.ghostjoin = TRUE + s.ghostjoin_icon() + + var/obj/effect/overmap/visitable/ship/simplemob/stardog/s = get_overmap_sector(z) + if(s && istype(s,/obj/effect/overmap/visitable/ship/simplemob/stardog)) + var/mob/living/simple_mob/vore/overmap/stardog/dog = s.parent + dog.adjust_affinity(15) + + qdel(src) + +/obj/structure/flora/tree/fur/wall + name = "dense fur" + desc = "Silky and soft, but too thick to pass or cut!" + +/obj/structure/flora/tree/fur/wall/attackby(obj/item/weapon/W, mob/living/user) + return + +/area/redgate/stardog + name = "dog" +/area/redgate/stardog/flesh_abyss + name = "flesh abyss" + icon_state = "redblatri" + forced_ambience = list('sound/vore/stomach_loop.ogg', 'sound/vore/sunesound/prey/loop.ogg') + floracountmax = 0 + valid_flora = list( + /obj/structure/outcrop/coal = 10, + /obj/structure/outcrop/diamond = 1, + /obj/structure/outcrop/gold = 3, + /obj/structure/outcrop/iron = 10, + /obj/structure/outcrop/lead = 6, + /obj/structure/outcrop/phoron = 10, + /obj/structure/outcrop/platinum = 5, + /obj/structure/outcrop/silver = 8, + /obj/structure/outcrop/uranium = 3, + /obj/random/outcrop = 5 + ) + + semirandom = TRUE + semirandom_groups = 1 + semirandom_group_min = 5 + semirandom_group_max = 15 + mob_intent = "retaliate" + valid_mobs = list( + list( + /mob/living/simple_mob/vore/vore_hostile/abyss_lurker = 100, + /mob/living/simple_mob/vore/vore_hostile/leaper = 100, + /mob/living/simple_mob/vore/vore_hostile/gelatinous_cube = 10 + ) + ) + + var/mob_chance = 10 + var/treasure_chance = 50 + var/list/valid_treasure = list( + /obj/item/weapon/cell/infinite = 5, + /obj/item/weapon/cell/device/weapon/recharge/alien = 5, + /obj/item/device/nif/authentic = 1, + /obj/item/toy/bosunwhistle = 50, + /obj/random/mouseray = 50, + /obj/item/weapon/gun/energy/mouseray/metamorphosis/advanced/random = 10, + /obj/item/weapon/gun/energy/mouseray/metamorphosis/advanced = 5, + /obj/item/clothing/mask/gas/voice = 25, + /obj/item/device/perfect_tele = 15, + /obj/item/weapon/gun/energy/sizegun = 50, + /obj/item/device/slow_sizegun = 50, + /obj/item/capture_crystal/master = 5, + /obj/item/capture_crystal/ultra = 15, + /obj/item/capture_crystal/great = 25, + /obj/item/capture_crystal/random = 50, + /obj/random/pizzabox = 10, //The dog intercepted your pizza voucher delivery, what a scamp + /obj/item/weapon/bluespace_harpoon = 15, + /obj/random/awayloot = 5, + /obj/random/cash = 15, + /obj/random/cash/big = 10, + /obj/random/cash/huge = 5, + /obj/random/maintenance/clean = 10, + /obj/random/maintenance/misc = 10 + ) + no_comms = TRUE + ghostjoin = TRUE + sound_env = SOUND_ENVIRONMENT_CAVE + var/treasuremax = 3 + var/spawnstuff = TRUE + var/include_enzyme = FALSE + +/area/redgate/stardog/flesh_abyss/EvalValidSpawnTurfs() + for(var/turf/simulated/floor/F in src) + if(istype(F, /turf/simulated/floor/flesh)) + valid_spawn_turfs |= F + + if(include_enzyme) + if(istype(F, /turf/simulated/floor/water/digestive_enzymes)) + valid_spawn_turfs |= F + +/area/redgate/stardog/flesh_abyss/spawn_flora_on_turf() + if(!spawnstuff) + return + if(!valid_flora.len) + to_world_log("[src] does not have a set valid flora list!") + return TRUE + + var/obj/F + var/turf/Turf + var/howmany = rand(0,floracountmax) + for(var/floracount = 1 to howmany) + F = pickweight(valid_flora) + Turf = pick(valid_spawn_turfs) + if(!Turf.check_density()) + new F(Turf) + +/area/redgate/stardog/flesh_abyss/spawn_mob_on_turf() + if(!spawnstuff) + return + if(!valid_mobs.len) + to_world_log("[src] does not have a set valid mobs list!") + return TRUE + + var/mob/M + var/turf/Turf + if(semirandom) + for(var/groupscount = 1 to (semirandom_groups)) + var/ourgroup = pickweight(valid_mobs) + var/goodnum = rand(semirandom_group_min, semirandom_group_max) + for(var/mobscount = 1 to (goodnum)) + M = pickweight(ourgroup) + Turf = pick(valid_spawn_turfs) + if(!Turf.check_density()) + var/mob/ourmob = new M(Turf) + adjust_mob(ourmob) + else + for(var/mobscount = 1 to mobcountmax) + M = pickweight(valid_mobs) + Turf = pick(valid_spawn_turfs) + if(!Turf.check_density()) + var/mob/ourmob = new M(Turf) + adjust_mob(ourmob) + +/area/redgate/stardog/flesh_abyss/proc/spawn_mob() + if(!spawnstuff) + return + if(!valid_mobs.len) + to_world_log("[src] does not have a set valid mobs list!") + return + + if(!prob(mob_chance)) + return + var/mob/M + var/turf/Turf + var/goodnum = rand(semirandom_group_min, semirandom_group_max) + for(var/mobscount = 1 to goodnum) + M = pickweight(pickweight(valid_mobs)) + Turf = pick(valid_spawn_turfs) + if(!Turf.check_density()) + var/mob/ourmob = new M(Turf) + adjust_mob(ourmob) + +/area/redgate/stardog/flesh_abyss/proc/spawn_ore() + if(!spawnstuff) + return + if(!valid_flora.len) + to_world_log("[src] does not have a set valid flora list!") + return + + var/obj/F + var/turf/Turf + var/howmany = rand(1,floracountmax) + for(var/ore = 1 to howmany) + F = pickweight(valid_flora) + Turf = pick(valid_spawn_turfs) + if(!Turf.check_density()) + new F(Turf) + +/area/redgate/stardog/flesh_abyss/proc/spawn_treasure() + if(!spawnstuff) + return + if(treasure_chance <= 0) + return + if(!valid_treasure.len) + to_world_log("[src] does not have a set valid treasure list!") + return + + var/obj/F + var/turf/Turf + var/howmany = rand(1,treasuremax) + for(var/treasure = 1 to howmany) + if(prob(treasure_chance)) + continue + F = pickweight(valid_treasure) + Turf = pick(valid_spawn_turfs) + if(!Turf.check_density()) + new F(Turf) + +/area/redgate/stardog/flesh_abyss/no_spawn + icon_state = "blublacir" + semirandom_groups = 0 + semirandom_group_min = 0 + semirandom_group_max = 0 + + valid_mobs = null + spawnstuff = FALSE + +/area/redgate/stardog/flesh_abyss/digestive_tract + icon_state = "greblacir" + semirandom_groups = 1 + semirandom_group_min = 1 + semirandom_group_max = 10 + include_enzyme = TRUE + valid_mobs = list( + list( + /mob/living/simple_mob/vore/vore_hostile/abyss_lurker = 10, + /mob/living/simple_mob/vore/vore_hostile/leaper = 20, + /mob/living/simple_mob/vore/vore_hostile/gelatinous_cube = 100 + ) + ) + ghostjoin = TRUE + +/area/redgate/stardog/flesh_abyss/stomach + floracountmax = 3 + valid_flora = list( + /obj/structure/outcrop/coal = 10, + /obj/structure/outcrop/diamond = 1, + /obj/structure/outcrop/gold = 3, + /obj/structure/outcrop/iron = 10, + /obj/structure/outcrop/lead = 6, + /obj/structure/outcrop/phoron = 10, + /obj/structure/outcrop/platinum = 5, + /obj/structure/outcrop/silver = 8, + /obj/structure/outcrop/uranium = 3, + /obj/random/outcrop = 5 + ) + semirandom = FALSE + semirandom_groups = 1 + semirandom_group_min = 1 + semirandom_group_max = 3 + valid_mobs = list( + list( + /mob/living/simple_mob/animal/space/carp/event = 100, + /mob/living/simple_mob/animal/space/carp/large = 25, + /mob/living/simple_mob/animal/space/carp/large/huge = 5, + /mob/living/simple_mob/vore/alienanimals/space_jellyfish = 100 + ) + ) + mob_chance = 10 + treasure_chance = 25 + treasuremax = 1 + spawnstuff = TRUE + ghostjoin = FALSE + +/area/redgate/stardog/flesh_abyss/s_int + floracountmax = 1 + valid_flora = list( + /obj/structure/outcrop/coal = 5, + /obj/structure/outcrop/diamond = 2, + /obj/structure/outcrop/gold = 3, + /obj/structure/outcrop/iron = 7, + /obj/structure/outcrop/lead = 3, + /obj/structure/outcrop/phoron = 5, + /obj/structure/outcrop/platinum = 5, + /obj/structure/outcrop/silver = 8, + /obj/structure/outcrop/uranium = 3, + /obj/random/outcrop = 5 + ) + semirandom = FALSE + semirandom_groups = 1 + semirandom_group_min = 1 + semirandom_group_max = 3 + valid_mobs = list( + list( + /mob/living/simple_mob/animal/space/carp/event = 100, + /mob/living/simple_mob/animal/space/carp/large = 25, + /mob/living/simple_mob/animal/space/carp/large/huge = 5, + /mob/living/simple_mob/vore/alienanimals/space_jellyfish = 100 + ) + ) + mob_chance = 5 + treasure_chance = 33 + treasuremax = 5 + spawnstuff = TRUE + ghostjoin = FALSE + +/area/redgate/stardog/flesh_abyss/l_int + floracountmax = 5 + valid_flora = list( + /obj/structure/outcrop/diamond = 3, + /obj/structure/outcrop/gold = 3, + /obj/structure/outcrop/iron = 5, + /obj/structure/outcrop/phoron = 1, + /obj/structure/outcrop/platinum = 5, + /obj/structure/outcrop/silver = 8, + /obj/structure/outcrop/uranium = 3, + /obj/random/outcrop = 1 + ) + semirandom = FALSE + semirandom_groups = 1 + semirandom_group_min = 1 + semirandom_group_max = 1 + valid_mobs = list( + list( + /mob/living/simple_mob/animal/space/carp/event = 100, + /mob/living/simple_mob/animal/space/carp/large = 25, + /mob/living/simple_mob/animal/space/carp/large/huge = 5, + /mob/living/simple_mob/vore/alienanimals/space_jellyfish = 100 + ) + ) + mob_chance = 5 + treasure_chance = 50 + treasuremax = 5 + spawnstuff = TRUE + ghostjoin = FALSE + +/area/redgate/stardog/flesh_abyss/node + enter_message = "Radical energy hangs as a haze in the air. It's much less hot here than other places within the dog, but the air is thick with alien whispers and desires that you can hardly comprehend." + icon_state = "yelwhisqu" + requires_power = 0 + spawnstuff = FALSE + +/area/redgate/stardog/flesh_abyss/play_ambience(var/mob/living/L, initial = TRUE) + if(!L.is_preference_enabled(/datum/client_preference/digestion_noises)) + return + ..() + +/area/redgate/stardog/lounge + name = "redgate lounge" + icon_state = "redwhisqu" + requires_power = 0 + ambience = list( + 'sound/ambience/star_dog/dougcockpit.ogg', + 'sound/ambience/otherworldly/otherworldly1.ogg', + 'sound/ambience/otherworldly/otherworldly2.ogg', + 'sound/ambience/otherworldly/otherworldly3.ogg', + 'sound/ambience/boy.ogg', + 'sound/ambience/expoutpost/expoutpost1.ogg', + 'sound/ambience/expoutpost/expoutpost2.ogg', + 'sound/ambience/expoutpost/expoutpost3.ogg', + 'sound/ambience/expoutpost/expoutpost4.ogg', + 'sound/ambience/tech_ruins/tech_ruins1.ogg', + 'sound/ambience/tech_ruins/tech_ruins2.ogg', + 'sound/ambience/tech_ruins/tech_ruins3.ogg', + 'sound/ambience/signal.ogg' + ) + +/area/redgate/stardog/outside + name = "star dog" + icon_state = "redblacir" + semirandom = TRUE + ghostjoin = TRUE + ambience = list( + 'sound/ambience/star_dog/dark-cold-main-menu-loop-mild-mountain-sickness-marb7e.ogg', + 'sound/ambience/star_dog/ominous-ambience.ogg', + 'sound/ambience/star_dog/long_awoo.ogg', + 'sound/ambience/star_dog/woof.ogg', + 'sound/ambience/star_dog/woof2.ogg' + ) + sound_env = SOUND_ENVIRONMENT_DIZZY + + valid_mobs = list( //Dog map spawns the dogs. It's not hard to understand! + list( + /mob/living/simple_mob/vore/woof + ) = 100, + list( + /mob/living/simple_mob/vore/wolf, + /mob/living/simple_mob/vore/wolf/direwolf, + /mob/living/simple_mob/vore/greatwolf + ) = 50, + list( + /mob/living/simple_mob/vore/otie, + /mob/living/simple_mob/vore/otie/friendly/chubby, + /mob/living/simple_mob/vore/otie/red, + /mob/living/simple_mob/vore/otie/red/chubby + ) = 50, + list( + /mob/living/simple_mob/animal/passive/dog/corgi, + /mob/living/simple_mob/animal/passive/dog/brittany, + /mob/living/simple_mob/animal/passive/dog/bullterrier, + /mob/living/simple_mob/animal/passive/dog/tamaskan + ) = 1, + list( + /mob/living/simple_mob/animal/space/carp = 100, + /mob/living/simple_mob/animal/space/carp/large = 25, + /mob/living/simple_mob/animal/space/carp/large/huge = 10, + /mob/living/simple_mob/animal/space/bats = 5, + /mob/living/simple_mob/animal/space/bear = 5, + /mob/living/simple_mob/animal/space/gnat = 5, + /mob/living/simple_mob/animal/space/ray = 5, + /mob/living/simple_mob/animal/space/shark = 5 + ), + list( //The succlets can come too I guess lol + /mob/living/simple_mob/vore/alienanimals/succlet = 50, + /mob/living/simple_mob/vore/alienanimals/succlet/dark = 50, + /mob/living/simple_mob/vore/alienanimals/succlet/moss = 50, + /mob/living/simple_mob/vore/alienanimals/succlet/poison = 10, + /mob/living/simple_mob/vore/alienanimals/succlet/big = 10, + /mob/living/simple_mob/vore/alienanimals/succlet/king = 1 + ) = 10 + ) + semirandom_groups = 5 + semirandom_group_min = 1 + semirandom_group_max = 10 + mob_intent = "retaliate" + +/obj/structure/control_pod //god someone is going to try to fuck with this, everyone is going to be angry, I'm so sorry + name = "node" + desc = "A smooth node of nerves and flesh. It seems almost to radiate whispers of alien thought and emotion." + icon = 'icons/obj/flesh_machines.dmi' + icon_state = "control_node0" + + density = TRUE + anchored = TRUE + pixel_x = -16 + pixel_y = -10 + unacidable = TRUE + + var/mob/living/simple_mob/vore/overmap/stardog/host + var/mob/living/controller + +/obj/structure/control_pod/Initialize(mapload) + . = ..() + set_up() + +/obj/structure/control_pod/proc/set_up() + var/obj/effect/overmap/visitable/ship/simplemob/stardog/s = get_overmap_sector(z) + if(istype(s,/obj/effect/overmap/visitable/ship/simplemob/stardog)) + var/mob/living/simple_mob/vore/overmap/stardog/dog = s.parent + if(!dog.control_node) + host = dog + dog.control_node = src + +/obj/structure/control_pod/Destroy() + if(host) + host.control_node = null + host = null + return ..() + +/obj/structure/control_pod/attack_hand(mob/living/user) + . = ..() + if(!host) + set_up() + if(!host) + to_chat(user, "It doesn't respond...") + return + control(user) + +/obj/structure/control_pod/proc/control(mob/living/user) + if(!host.affinity) //take care of my dog + to_chat(user, "As you press your hand to \the [src], it resists your advance... A sense of longing ripples through your mind...") + return + if(controller) //busy + to_chat(user, "You can see \the [controller] inside! Tendrils of nerves seem to have attached themselves to \the [controller]! There's no room for you right now!") + return + user.visible_message("\The [user] reaches out to touch \the [src]...","You reach out to touch \the [src]...") + if(!do_after(user, 10 SECONDS, src, exclusive = TRUE)) + user.visible_message("\The [user] pulls back from \the [src].","You pull back from \the [src].") + return + if(controller) //got busy while you were waiting, get rekt + to_chat(user, "You can see \the [controller] inside! Tendrils of nerves seem to have attached themselves to \the [controller]! There's no room for you right now!") + return + controller = user + visible_message("\The [src] accepts \the [controller], submerging them beneath the surface of the flesh!") + user.stop_pulling() + user.forceMove(src) + host.ckey = user.ckey + log_admin("[host.ckey] has taken contol of \the [host].") + icon_state = "control_node1" + plane = ABOVE_MOB_PLANE + set_light(5, 0.75, "#f94bff") + +/obj/structure/control_pod/proc/eject() + to_chat(host, "You feel your control over \the [host] slip away from you!") + controller.forceMove(get_turf(src)) + controller.ckey = host.ckey + visible_message("\The [controller] is ejected from \the [src], tumbling free!") + log_admin("[controller.ckey] is no longer controlling [host], they have been returned to their body, [controller].") + icon_state = "control_node0" + plane = OBJ_PLANE + set_light(0) + var/our_x = rand(-5,5) + x + var/our_y = rand(-5,5) + y + + var/turf/throwtarg = locate(our_x, our_y, z) //teehee + spawn(0) + playsound(src, 'sound/vore/schlorp.ogg', vol = 100, vary = FALSE, volume_channel = VOLUME_CHANNEL_VORE) + controller.throw_at(throwtarg, 10, 1) + controller = null + +/obj/effect/landmark/stardog //I didn't know how else to decide where the dog will land + name = "stardog landing" + icon = 'icons/obj/landmark_vr.dmi' + icon_state = "transition" + +/obj/effect/landmark/stardog/Initialize() + . = ..() + var/area/a = get_area(src) + name = a.name + +/obj/effect/landmark/area_gatherer + name = "stardog area gatherer" +/obj/effect/landmark/area_gatherer/Initialize() + . = ..() + LateInitialize() + +/obj/effect/landmark/area_gatherer/LateInitialize() //I am very afraid + var/obj/effect/overmap/visitable/ship/simplemob/stardog/s = get_overmap_sector(z) + var/mob/living/simple_mob/vore/overmap/stardog/dog = s.parent + dog.weather_areas |= get_area(src) + for(var/thing in dog.weather_areas) + qdel(src) + +/obj/machinery/computer/ship/navigation/telescreen/dog_eye + name = "visual nexus" + desc = "A glowing bundle of nerves across which you can see what the dog sees." + icon = 'icons/obj/flesh_machines.dmi' + icon_state = "screen_eye" + pixel_x = -16 + pixel_y = -16 + clicksound = 'sound/vore/squish1.ogg' + +/obj/machinery/computer/ship/navigation/telescreen/dog_eye/attackby(I, user) + return + +/obj/machinery/computer/ship/navigation/telescreen/dog_eye/update_icon() + . = ..() + icon_state = "screen_eye" + +/obj/machinery/computer/ship/navigation/verb/emote_beyond(message as message) //I could have put this into any other file but right here will do + set name = "Emote Beyond" + set desc = "Emote to those beyond the ship!" + set category = "IC" + set src in oview(7) + + if(!isliving(usr)) + return + var/mob/living/L = usr + if(L.client.prefs.muted & MUTE_IC) + to_chat(L, "You cannot speak in IC (muted).") + return + if (!message) + message = tgui_input_text(usr, "Type a message to emote.","Emote Beyond") + message = sanitize_or_reflect(message,L) + if (!message) + return + if (L.stat == DEAD) + return L.say_dead(message) + var/obj/effect/overmap/visitable/ship/s = get_overmap_sector(z) + if(!s || !istype(s, /obj/effect/overmap/visitable/ship)) + to_chat(L, "You can't do that here.") + return + + log_subtle(message,L) + message = "[L] [message]" + message = "(From within \the [s]) " + message + message = encode_html_emphasis(message) + + var/undisplayed_message = "[L] does something too subtle for you to see." + var/list/vis = get_mobs_and_objs_in_view_fast(get_turf(s),1,2) + var/list/vis_mobs = vis["mobs"] + vis_mobs |= L + for(var/mob/M as anything in vis_mobs) + if(isnewplayer(M)) + continue + if(isobserver(M) && !L.is_preference_enabled(/datum/client_preference/whisubtle_vis) && !M.client?.holder) + spawn(0) + M.show_message(undisplayed_message, 2) + else + spawn(0) + M.show_message(message, 2) + if(M.is_preference_enabled(/datum/client_preference/subtle_sounds)) + M << sound('sound/talksounds/subtle_sound.ogg', volume = 50) + +/area/redgate/stardog/eyes + + name = "eye" + icon_state = "bluwhicir" + + var/list/our_eyes = list() + + +/area/redgate/stardog/eyes/Entered(mob/M) + . = ..() + consider_eyes() + +/area/redgate/stardog/eyes/Exited(atom/movable/AM, newLoc) + . = ..() + consider_eyes() + +/area/redgate/stardog/eyes/proc/consider_eyes() //CONSIDER THEM PLEASE + var/close = FALSE + var/list/check = get_area_turfs(/area/redgate/stardog/eyes) + for(var/turf/t in check) + for(var/thing in t.contents) + if(istype(thing, /obj/effect/dog_eye)) //We can have eyes in our eyes, it's fine + continue + if(isobserver(thing)) //Ghosts aren't real + continue + if(isobj(thing) || ismob(thing)) + close = TRUE //AAAAAAAAAAAAAAAUUUUUUUUGHHHHHHHHH ITS IN MY EYES HELP + + for(var/obj/effect/dog_eye/e in our_eyes) + if(close) + e.icon_state = "eye_closed" // u . u + else + e.icon_state = "eye_open" // * w * + +/obj/effect/dog_eye + name = "eye" + desc = "It's peeking!" + icon = 'icons/obj/flesh_machines.dmi' + icon_state = "eye_open" + anchored = TRUE + + pixel_x = -16 + +/obj/effect/dog_nose + name = "nose" + desc = "Good for sniffin' with!" + icon = 'icons/obj/flesh_machines.dmi' + icon_state = "nose" + anchored = TRUE + +/obj/effect/dog_nose/attack_hand(mob/living/user) + . = ..() + user.visible_message("\The [user] boops the snoot.","You boop the snoot.",runemessage = "boop") + +/obj/effect/dog_nose/Crossed(atom/movable/AM as mob|obj) + . = ..() + sneef(AM) + +/obj/effect/dog_nose/proc/sneef(mob/living/L) + if(!isliving(L)) + return + if(L.client) + to_chat(L, "A hot breath rushes up from under your feet, before the air rushes back down into the dog's nose as the dog sniffs you! SNEEF SNEEF!!!") + +/obj/effect/dog_eye/Initialize() + . = ..() + var/area/redgate/stardog/eyes/e = get_area(src) + if(istype(e,/area/redgate/stardog/eyes)) + e.our_eyes |= src + +/obj/effect/dog_teleporter //look, I could have just used a bump teleporter, and I don't have an excuse, also everyone is going to be angry but it hurts too much for me to care right now, hopefully I will finish this before I start caring + name = "mouth" + desc = "It's waiting to accept treats!" + icon = 'icons/obj/flesh_machines.dmi' + icon_state = "mouth" + invisibility = 0 + anchored = TRUE + pixel_x = -16 + var/id = "mouth_a" //same id will be linked + var/static/list/dog_teleporters = list() //List of all the teleporters + var/reciever = FALSE //If true, doesn't teleport, only recieves + var/obj/effect/dog_teleporter/target //Target for teleporting to, automatically set by id + var/throw_through = TRUE //When moved the mob/obj will be thrown south + var/teleport_sound = 'sound/vore/schlorp.ogg' //The sound that plays when we use the teleporter. Respects vore sound preferences. + var/teleport_message = "" + var/check_keys = FALSE + var/check_prefs = TRUE + +/obj/effect/dog_teleporter/Initialize() + . = ..() + dog_teleporters |= src + do_setup() + if(icon_state == "exit_b") //♪♫Blinded by the light♪♫ + set_light(5, 1, "#ffffff") + +/obj/effect/dog_teleporter/proc/do_setup() + if(target) + return + for(var/obj/effect/dog_teleporter/T in dog_teleporters) + if(!istype(T,/obj/effect/dog_teleporter)) + dog_teleporters -= T + continue + if(id == T.id) + if(T == src) + continue + target = T + if(!T.target) + T.target = src + +/obj/effect/dog_teleporter/Crossed(atom/movable/AM as mob|obj) //I am ashamed to admit how long it took to get this to do anything + . = ..() + lets_go(AM) + +/obj/effect/dog_teleporter/attack_hand(mob/living/user) + . = ..() + lets_go(user) + +/obj/effect/dog_teleporter/attack_generic(mob/user) + . = ..() + lets_go(user) + +/obj/effect/dog_teleporter/proc/lets_go(atom/movable/AM as mob|obj) //Wahoo! Here we go! + if(reciever) + return + if(!target) + do_setup() + if(!target) + return + var/mob/living/L = null + if(isliving(AM)) + L = AM + if(check_prefs && (!L.devourable || !L.allowmobvore)) + return + if(check_keys && !L.ckey) + return + L.stop_pulling() + L.Weaken(3) + GLOB.prey_eaten_roundstat++ + if(target.reciever) //We don't have to worry + AM.unbuckle_all_mobs(TRUE) + AM.forceMove(get_turf(target)) + extra(AM) + return + var/turf/place = locate(target.x, (target.y - 1), target.z) //If the target is also a teleporter, let's pick a place to set them down next to the target. + //Setting them ON the target will probably make an infinite loop, and that seems lame. + AM.unbuckle_all_mobs(TRUE) + AM.forceMove(place) + extra(AM) + +/obj/effect/dog_teleporter/proc/extra(atom/movable/AM as mob|obj) + var/go = FALSE + if(isobserver(AM)) + return + playsound(src, teleport_sound, vol = 100, vary = 1, preference = /datum/client_preference/eating_noises, volume_channel = VOLUME_CHANNEL_VORE) + playsound(target, teleport_sound, vol = 100, vary = 1, preference = /datum/client_preference/eating_noises, volume_channel = VOLUME_CHANNEL_VORE) + if(isliving(AM)) + var/mob/living/L = AM + if(teleport_message && L.client) + to_chat(src, "[teleport_message]") + go = TRUE + if(isobj(AM)) + go = FALSE + + if(!go) + return + + visible_message("\The [AM] passes through \the [src]!") + if(throw_through) //We will throw the target to the south! + var/turf/throwtarg = locate(target.x, (target.y - 5), target.z) + spawn(0) + AM.throw_at(throwtarg, 10, 1) //reverbfart.ogg + +/obj/effect/dog_teleporter/food_gobbler + teleport_sound = 'sound/vore/gulp.ogg' + teleport_message = "The thundering drum of the dog's heart beat throbs all around you, while the sweltering heat of its body soaks into you. It's soft and wet as a symphony of gurgles and glorps fills the steamy air!" + +/obj/effect/dog_teleporter/food_gobbler/Crossed(atom/movable/AM) + + if(istype(AM, /obj/item/weapon/reagent_containers/food)) + gobble_food(AM) + else return ..() + +/obj/effect/dog_teleporter/food_gobbler/proc/gobble_food(obj/item/I) + if(!isitem(I)) + return + var/obj/effect/overmap/visitable/ship/simplemob/stardog/s = get_overmap_sector(z) + if(s && istype(s,/obj/effect/overmap/visitable/ship/simplemob/stardog)) + if(!s.parent) + return + var/mob/living/simple_mob/vore/overmap/stardog/dog = s.parent + dog.adjust_nutrition(I.reagents.total_volume) + dog.adjust_affinity(25) + playsound(src, teleport_sound, vol = 100, vary = 1, preference = /datum/client_preference/eating_noises, volume_channel = VOLUME_CHANNEL_VORE) + visible_message("The dog gobbles up \the [I]!") + if(dog.client) + to_chat(dog, "[I.thrower ? "\The [I.thrower]" : "Someone"] feeds \the [I] to you!") + qdel(I) + GLOB.items_digested_roundstat++ + +/obj/effect/dog_teleporter/reciever + name = "exit" + desc = "It's too tight to go in there!" + icon_state = "exita" + pixel_y = -16 + reciever = TRUE + +/obj/effect/dog_teleporter/reciever/invisible + invisibility = INVISIBILITY_ABSTRACT + reciever = TRUE + id = "mouth_a" + +/obj/effect/dog_teleporter/reciever/invisible/mouth_return + invisibility = INVISIBILITY_ABSTRACT + reciever = TRUE + id = "mouth_b" + +/obj/effect/dog_teleporter/exit + name = "exit" + desc = "You can see the light at the end of the tunnel!" + icon_state = "exit_b" + id = "exit" + pixel_x = -16 + pixel_y = -16 + check_keys = TRUE + check_prefs = FALSE //We don't have to worry about it on the way out + +/obj/effect/dog_teleporter/mouth_return + name = "light" + desc = "You can see the light shining in from above!" + icon_state = "exit_b" + id = "mouth_b" + pixel_x = -16 + pixel_y = -16 + check_keys = TRUE + check_prefs = FALSE //We don't have to worry about it on the way out + +/obj/effect/dog_teleporter/reciever/exit //tee hee + name = "exit" + desc = "It's too tight to go in there!" + icon_state = "exit" + id = "exit" + pixel_x = -16 + pixel_y = -16 + layer = ABOVE_TURF_LAYER + plane = TURF_PLANE + +/turf/simulated/floor/water/digestive_enzymes //I'm sorry - Medical is going to be really angry. I hope people don't go ';HELP, HELP IN THE FLESH ABYSS!!!' but I know they will + name = "digestive enzymes" + desc = "A body of some kind of green fluid. It seems shallow enough to walk through, if needed." + icon = 'icons/turf/stomach_vr.dmi' + icon_state = "composite" + water_icon = 'icons/turf/stomach_vr.dmi' + water_state = "enzyme_shallow" + under_state = "flesh_floor" + + reagent_type = "Sulphuric acid" //why not + outdoors = FALSE + var/mob/living/simple_mob/vore/overmap/stardog/linked_mob + var/mobstuff = TRUE //if false, we don't care about dogs, and that's terrible + var/we_process = FALSE //don't start another process while you're processing, idiot + +/turf/simulated/floor/water/digestive_enzymes/Entered(atom/movable/AM) + if(digest_stuff(AM) && !we_process) + START_PROCESSING(SSturfs, src) + we_process = TRUE + +/turf/simulated/floor/water/digestive_enzymes/hitby(atom/movable/AM) + if(digest_stuff(AM) && !we_process) + START_PROCESSING(SSturfs, src) + we_process = TRUE + +/turf/simulated/floor/water/digestive_enzymes/process() + if(!digest_stuff()) + we_process = FALSE + return PROCESS_KILL + +/turf/simulated/floor/water/digestive_enzymes/proc/can_digest(atom/movable/AM as mob|obj) + . = FALSE + if(AM.loc != src) + return FALSE + if(isitem(AM)) + var/obj/item/I = AM + if(I.unacidable || I.throwing || I.is_incorporeal()) + return FALSE + var/food = FALSE + if(istype(I,/obj/item/weapon/reagent_containers/food)) + food = TRUE + if(prob(95)) //Give people a chance to pick them up + return TRUE + I.visible_message("\The [I] sizzles...") + var/yum = I.digest_act() //Glorp + if(istype(I , /obj/item/weapon/card)) + yum = 0 //No, IDs do not have infinite nutrition, thank you + if(mobstuff && linked_mob && yum) + if(food) + yum += 50 + linked_mob.adjust_nutrition(yum) + return TRUE + if(isliving(AM)) + var/mob/living/L = AM + if(L.unacidable || !L.digestable || L.buckled || L.hovering || L.throwing || L.is_incorporeal()) + return FALSE + if(ishuman(L)) + var/mob/living/carbon/human/H = L + if(!H.pl_suit_protected()) + return TRUE + if(H.resting && !H.pl_head_protected()) + return TRUE + else return TRUE + +/turf/simulated/floor/water/digestive_enzymes/proc/digest_stuff(atom/movable/AM) //I'm so sorry + . = FALSE + + var/damage = 1 + if(mobstuff && !linked_mob) //You might be wondering how we got here. It all started when I decided that I would make a vore level and make some of the turfs affect some mob somewhere in the world. So I used some convenient tools that people who are actually smart made, to make this horrible abomination. + var/obj/effect/overmap/visitable/ship/simplemob/stardog/s = get_overmap_sector(z) + if(s && istype(s,/obj/effect/overmap/visitable/ship/simplemob/stardog)) + linked_mob = s.parent //dogge + + if(linked_mob) //Please for the love of all that is good, make all this mob shit its own proc, future me + damage += clamp(((500 - linked_mob.nutrition) / 100), 1 , 5) + var/list/stuff = list() + for(var/thing in src) + if(can_digest(thing)) + stuff |= thing + if(!stuff.len) + return FALSE + var/thing = pick(stuff) //We only think about one thing at a time, otherwise things get wacky + . = TRUE + if(ishuman(thing)) + var/mob/living/carbon/human/H = thing + if(!H) + return + visible_message(runemessage = "blub...") + if(H.stat == DEAD) + H.unacidable = TRUE //Don't touch this one again, we're gonna delete it in a second + H.release_vore_contents() + for(var/obj/item/W in H) + if(istype(W, /obj/item/organ/internal/mmi_holder/posibrain)) + var/obj/item/organ/internal/mmi_holder/MMI = W + MMI.removed() + if(istype(W, /obj/item/weapon/implant/backup) || istype(W, /obj/item/device/nif) || istype(W, /obj/item/organ)) + continue + H.drop_from_inventory(W) + if(linked_mob) + var/how_much = H.mob_size + H.nutrition + if(!H.ckey) + how_much = how_much / 10 //Braindead mobs are worth less + linked_mob.adjust_nutrition(how_much) + H.mind?.vore_death = TRUE + GLOB.prey_digested_roundstat++ + spawn(0) + qdel(H) //glorp + return + if(linked_mob) + H.burn_skin(damage) + if(linked_mob) + var/how_much = (damage * H.size_multiplier) * H.get_digestion_nutrition_modifier() * linked_mob.get_digestion_efficiency_modifier() + if(!H.ckey) + how_much = how_much / 10 //Braindead mobs are worth less + linked_mob.adjust_nutrition(how_much) + else if (isliving(thing)) + var/mob/living/L = thing + if(!L) + return + visible_message(runemessage = "blub...") + if(L.stat == DEAD) + L.unacidable = TRUE //Don't touch this one again, we're gonna delete it in a second + L.release_vore_contents() + if(linked_mob) + var/how_much = L.mob_size + L.nutrition + if(!L.ckey) + how_much = how_much / 10 //Braindead mobs are worth less + linked_mob.adjust_nutrition(how_much) + qdel(L) //gloop + return + L.adjustFireLoss(damage) + if(linked_mob) + var/how_much = (damage * L.size_multiplier) * L.get_digestion_nutrition_modifier() * linked_mob.get_digestion_efficiency_modifier() + if(!L.ckey) + how_much = how_much / 10 //Braindead mobs are worth less + linked_mob.adjust_nutrition(how_much) + +/turf/simulated/floor/flesh/mover + icon_state = "flesh_floor_mover" + var/movechance = 5 + var/we_process = FALSE + var/move_dir = 2 + +/turf/simulated/floor/flesh/mover/Initialize(mapload) + . = ..() + move_dir = dir + dir = SOUTH + +/turf/simulated/floor/flesh/mover/Entered(atom/movable/AM) + if(!we_process) + START_PROCESSING(SSturfs, src) + +/turf/simulated/floor/flesh/mover/hitby(atom/movable/AM) + if(!we_process) + START_PROCESSING(SSturfs, src) + +/turf/simulated/floor/flesh/mover/process() //Mostly stolen from conveyor2.dm + if(movechance <= 0) + we_process = FALSE + return PROCESS_KILL + we_process = TRUE + if(!prob(movechance)) //Let's kind of control the speed that this happens at + return + var/items_moved = 0 + for(var/atom/movable/A in contents) + if(A.anchored) + continue + if(!isitem(A) && !isliving(A)) + continue + if(A.loc != src) //Don't move things that aren't here + continue + step(A,move_dir) + items_moved++ + + if(items_moved >= 10) + break + + if(!items_moved) //If we didn't move anything let's shut it down + we_process = FALSE + return PROCESS_KILL + +/obj/structure/auto_flesh_door //It's like a simple door, but it opens and closes automatically now and then! + name = "flesh valve" + density = TRUE + opacity = TRUE + anchored = TRUE + can_atmos_pass = ATMOS_PASS_DENSITY + + icon = 'icons/turf/stomach_vr.dmi' + icon_state = "fleshdoor" + + var/state = 0 //closed, 1 == open + var/isSwitchingStates = 0 + var/countdown = 0 + var/knock_sound = 'sound/effects/attackblob.ogg' + var/list/open_sounds = list( + 'sound/vore/sunesound/prey/squish_01.ogg', + 'sound/vore/sunesound/prey/squish_02.ogg', + 'sound/vore/sunesound/prey/squish_03.ogg', + 'sound/vore/sunesound/prey/squish_04.ogg', + 'sound/vore/sunesound/prey/stomachmove.ogg' + ) + var/faction = "macrobacteria" + +/obj/structure/auto_flesh_door/Initialize() + . = ..() + countdown = rand(50,250) + START_PROCESSING(SSobj, src) + update_icon() + +/obj/structure/auto_flesh_door/Destroy() + STOP_PROCESSING(SSobj, src) + update_nearby_tiles() + return ..() + +/obj/structure/auto_flesh_door/process() + if(countdown <= 0) + SwitchState() + else + countdown -- + if(!state) + for(var/mob/living/L in src.loc.contents) + if(isliving(L)) + L.Weaken(3) + if(prob(5)) + to_chat(L, "\The [src] throbs heavily around you...") + +/obj/structure/auto_flesh_door/attack_generic(mob/user, damage, attack_verb) + . = ..() + user.setClickCooldown(DEFAULT_ATTACK_COOLDOWN) + if(!Adjacent(user)) + return + else if(user.faction == faction) + SwitchState() + else if(user.a_intent == I_HELP) + visible_message("[user] knocks on \the [src].", "Someone knocks on \the [src].") + playsound(src, knock_sound, 50, 0, 3) + countdown -= 10 + else + visible_message("[user] hammers on \the [src]!", "Someone hammers loudly on \the [src]!") + playsound(src, knock_sound, 50, 0, 3) + countdown -= 25 + +/obj/structure/auto_flesh_door/attack_hand(mob/user as mob) + . = ..() + user.setClickCooldown(DEFAULT_ATTACK_COOLDOWN) + if(!Adjacent(user)) + return + else if(user.faction == faction) + SwitchState() + else if(user.a_intent == I_HELP) + visible_message("[user] knocks on \the [src].", "Someone knocks on \the [src].") + playsound(src, knock_sound, 50, 0, 3) + countdown -= 10 + else + visible_message("[user] hammers on \the [src]!", "Someone hammers loudly on \the [src]!") + playsound(src, knock_sound, 50, 0, 3) + countdown -= 25 + +/obj/structure/auto_flesh_door/CanPass(atom/movable/mover, turf/target) + return !density + +/obj/structure/auto_flesh_door/proc/SwitchState() + if(state) + Close() + else + Open() + +/obj/structure/auto_flesh_door/proc/Open() + isSwitchingStates = 1 + var/oursound = pick(open_sounds) + playsound(src, oursound, 100, 1, preference = /datum/client_preference/digestion_noises , volume_channel = VOLUME_CHANNEL_VORE) + flick("flesh-opening",src) + sleep(8) + density = FALSE + set_opacity(0) + state = 1 + update_icon() + isSwitchingStates = 0 + update_nearby_tiles() + countdown = rand(10,20) + layer = OBJ_LAYER + plane = OBJ_PLANE + +/obj/structure/auto_flesh_door/proc/Close() + isSwitchingStates = 1 + var/oursound = pick(open_sounds) + playsound(src, oursound, 100, 1, preference = /datum/client_preference/digestion_noises , volume_channel = VOLUME_CHANNEL_VORE) + flick("flesh-closing",src) + sleep(8) + density = TRUE + set_opacity(1) + state = 0 + update_icon() + isSwitchingStates = 0 + update_nearby_tiles() + countdown = rand(50,250) + layer = ABOVE_MOB_LAYER + plane = ABOVE_MOB_PLANE + for(var/mob/living/L in src.loc.contents) + if(isliving(L)) + L.Weaken(3) + L.visible_message("\The [src] closes up on \the [L]!","The weight of \the [src] closes in on you, squeezing you on all sides so tightly that you can hardly move! It throbs against you as the way is sealed, with you stuck in the middle!!!") + +/obj/structure/auto_flesh_door/update_icon() + if(state) + icon_state = "flesh-open" + else + icon_state = "flesh-closed" diff --git a/code/modules/mob/living/simple_mob/subtypes/animal/alien animals/teppi.dm b/code/modules/mob/living/simple_mob/subtypes/animal/alien animals/teppi.dm index d1613829e3..a1ebe4c214 100644 --- a/code/modules/mob/living/simple_mob/subtypes/animal/alien animals/teppi.dm +++ b/code/modules/mob/living/simple_mob/subtypes/animal/alien animals/teppi.dm @@ -124,7 +124,7 @@ GLOBAL_VAR_INIT(teppi_count, 0) // How mant teppi DO we have? attack_sound = 'sound/voice/teppi/roar.ogg' // make a better one idiot friendly = list("snoofs", "nuzzles", "nibbles", "smooshes on") - ai_holder_type = /datum/ai_holder/simple_mob/teppi + ai_holder_type = /datum/ai_holder/simple_mob/vore/micro_hunter mob_size = MOB_LARGE @@ -160,6 +160,10 @@ GLOBAL_VAR_INIT(teppi_count, 0) // How mant teppi DO we have? vore_default_contamination_flavor = "Wet" vore_default_contamination_color = "grey" vore_default_item_mode = IM_DIGEST + vore_bump_chance = 5 + vore_pounce_chance = 35 + vore_pounce_falloff = 0 + vore_standing_too = TRUE /mob/living/simple_mob/vore/alienanimals/teppi/init_vore() ..() diff --git a/code/modules/mob/living/simple_mob/subtypes/vore/vore.dm b/code/modules/mob/living/simple_mob/subtypes/vore/vore.dm index 76db60732b..caab987a8e 100644 --- a/code/modules/mob/living/simple_mob/subtypes/vore/vore.dm +++ b/code/modules/mob/living/simple_mob/subtypes/vore/vore.dm @@ -5,12 +5,18 @@ /mob/living/simple_mob var/nameset var/limit_renames = TRUE + var/copy_prefs_to_mob = TRUE /mob/living/simple_mob/Login() . = ..() verbs |= /mob/living/simple_mob/proc/set_name verbs |= /mob/living/simple_mob/proc/set_desc + if(copy_prefs_to_mob) + login_prefs() + +/mob/living/proc/login_prefs() + ooc_notes = client.prefs.metadata digestable = client.prefs_vr.digestable devourable = client.prefs_vr.devourable @@ -37,7 +43,6 @@ step_mechanics_pref = client.prefs_vr.step_mechanics_pref pickup_pref = client.prefs_vr.pickup_pref - /mob/living/simple_mob/proc/set_name() set name = "Set Name" set desc = "Sets your mobs name. You only get to do this once." diff --git a/code/modules/mob/living/simple_mob/subtypes/vore/vore_hostile.dm b/code/modules/mob/living/simple_mob/subtypes/vore/vore_hostile.dm new file mode 100644 index 0000000000..0d76550158 --- /dev/null +++ b/code/modules/mob/living/simple_mob/subtypes/vore/vore_hostile.dm @@ -0,0 +1,333 @@ +//Mobs who's primary purpose is to go eat people who have their vore prefs turned on. They're retaliate mobs to everyone else. +/mob/living/simple_mob/vore/vore_hostile + name = "peeb" + desc = "REPLACE ME" + ai_holder_type = /datum/ai_holder/simple_mob/vore + +/////ABYSS LURKER///// + +/datum/category_item/catalogue/fauna/abyss_lurker + name = "Alien Wildlife - Abyss Lurker" + desc = "Halitha Norotanis is a species of endobiotic life form that feeds primarily off of parasites, invaders, and other foreign bodies to its host. It responds to sound and touch, attacking and engulfing anything it deems to be a threat. It hardly makes any noise as it moves in the darkness and it will hunt down and investigate sound as it lurks. It doesn't seem to have any eyes or ears, but the golden antennae on its head seem to ripple in the direction of sounds." + value = CATALOGUER_REWARD_EASY + +/mob/living/simple_mob/vore/vore_hostile/abyss_lurker + name = "abyss lurker" + desc = "A pale mass of heaving flesh that gropes around in the gloom. It doesn't appear to have any eyes." + tt_desc = "Halitha Norotanis" + icon = 'icons/mob/alienanimals_x64.dmi' + icon_state = "abyss_lurker" + icon_living = "abyss_lurker" + icon_dead = "abyss_lurker-dead" + icon_rest = "abyss_lurker" + vis_height = 64 + + faction = "macrobacteria" + maxHealth = 600 + health = 600 + movement_cooldown = 3 + + harm_intent_damage = 1 + melee_damage_lower = 1 + melee_damage_upper = 1 + + meat_amount = 5 + meat_type = /obj/item/weapon/reagent_containers/food/snacks/meat + catalogue_data = list(/datum/category_item/catalogue/fauna/abyss_lurker) + + see_in_dark = 8 + + pixel_x = -16 + default_pixel_x = -16 + + + mob_size = MOB_LARGE + mob_bump_flag = HEAVY + mob_swap_flags = HEAVY + mob_push_flags = HEAVY + mob_size = MOB_LARGE + + attacktext = list("flashes", "slaps", "smothers", "grapples") + attack_sound = 'sound/effects/attackblob.ogg' + + ai_holder_type = /datum/ai_holder/simple_mob/say_aggro + + swallowTime = 2 SECONDS + vore_active = 1 + vore_capacity = 1 + vore_bump_chance = 50 + vore_bump_emote = "begins to absorb" + vore_ignores_undigestable = 0 + vore_default_mode = DM_SELECT + vore_icons = null + vore_stomach_name = "Stomach" + vore_default_item_mode = IM_DIGEST + vore_pounce_chance = 50 + vore_pounce_cooldown = 10 + vore_pounce_successrate = 75 + vore_pounce_falloff = 0 + vore_pounce_maxhealth = 100 + vore_standing_too = TRUE + unacidable = TRUE + +/mob/living/simple_mob/vore/vore_hostile/abyss_lurker/init_vore() + ..() + var/obj/belly/B = vore_selected + B.name = "interior" + B.desc = "It's hot and overwhelmingly tight! The interior of the pale creature groans with the effort of squeezing you. Everything is hot and churning and eager to grind and smother you in thick fluids. The weight of the creature's body pressing in at you makes it hard to move at all, while you are squeezed to the very core of the creature! There seems almost not to even be an organ for this so much as the creature has folded around you, trying to incorporate your matter into its body with vigor!" + B.mode_flags = DM_FLAG_THICKBELLY | DM_FLAG_NUMBING + B.belly_fullscreen = "yet_another_tumby" + B.digest_brute = 3 + B.digest_burn = 2 + B.digestchance = 0 + B.absorbchance = 0 + B.escapechance = 25 + B.escape_stun = 5 + +/mob/living/simple_mob/vore/vore_hostile/abyss_lurker/attack_hand(mob/living/user) + + if(client || !user.client || !ai_holder || !isliving(user)) + return ..() + if(!user.devourable || !user.allowmobvore || !user.can_be_drop_prey) + return ..() + ai_holder.give_target(user, TRUE) + ai_holder.track_target_position() + ai_holder.set_stance(STANCE_FIGHT) + +/datum/ai_holder/simple_mob/say_aggro + hostile = FALSE + forgive_resting = TRUE + cooperative = FALSE + +/datum/ai_holder/simple_mob/say_aggro/on_hear_say(mob/living/speaker, message) + . = ..() + if(holder.client || !speaker.client) + return + if(!speaker.devourable || !speaker.allowmobvore || !speaker.can_be_drop_prey) + return + if(speaker.z != holder.z) + return + give_target(speaker, TRUE) + track_target_position() + set_stance(STANCE_FIGHT) + +/////Leaper///// + +/datum/category_item/catalogue/fauna/leaper + name = "Alien Wildlife - Abyss Leaper" + desc = "Halitha Tannerack is a species of endobiotic life form that feeds primarily off of parasites, invaders, and other foreign bodies to its host. It pounces upon threats using its powerful legs to leap great distances. It has expressed higher thinking, though it seems not to act entirely in its own interest, serving its host organism's well-being before any other priorities. This means that it is capable of picking its targets, and will not attack indiscriminately. It chooses only to attack those it senses to be a threat to its host, though what exactly it qualifies to be a threat has not been fully explored. This creature radiates a strange energy from within, and while this energy has been studied, it is very poorly understood." + value = CATALOGUER_REWARD_EASY + +/mob/living/simple_mob/vore/vore_hostile/leaper + name = "abyss leaper" + desc = "A tall, pale creature with blood red markings. It has powerful legs and long dexterous tentacles. Its eyes and tentacles appear to glow from within with some unknown energy." + tt_desc = "Halitha Tannerack" + icon = 'icons/mob/alienanimals_x64.dmi' + icon_state = "filter" + icon_living = "filter" + icon_dead = "filter-dead" + icon_rest = "filter" + vis_height = 64 + + faction = "macrobacteria" + maxHealth = 600 + health = 600 + + harm_intent_damage = 1 + melee_damage_lower = 1 + melee_damage_upper = 1 + + movement_cooldown = 1 + meat_amount = 5 + meat_type = /obj/item/weapon/reagent_containers/food/snacks/meat + catalogue_data = list(/datum/category_item/catalogue/fauna/leaper) + + see_in_dark = 8 + + pixel_x = -16 + default_pixel_x = -16 + + mob_size = MOB_LARGE + mob_bump_flag = HEAVY + mob_swap_flags = HEAVY + mob_push_flags = HEAVY + mob_size = MOB_LARGE + + has_eye_glow = TRUE + + attacktext = list("pushes", "slaps", "whips", "grapples") + attack_sound = 'sound/effects/attackblob.ogg' + + ai_holder_type = /datum/ai_holder/simple_mob/vore + + swallowTime = 1 SECONDS + vore_active = 1 + vore_capacity = 2 + vore_bump_chance = 75 + vore_bump_emote = "grabs ahold of" + vore_ignores_undigestable = 0 + vore_default_mode = DM_SELECT + vore_icons = SA_ICON_LIVING + vore_stomach_name = "stomach" + vore_default_item_mode = IM_DIGEST + vore_pounce_chance = 75 + vore_pounce_cooldown = 10 + vore_pounce_successrate = 75 + vore_pounce_falloff = 0 + vore_pounce_maxhealth = 100 + vore_standing_too = TRUE + can_be_drop_prey = FALSE + can_be_drop_pred = TRUE + throw_vore = TRUE + unacidable = TRUE + + special_attack_min_range = 2 + special_attack_max_range = 6 + special_attack_cooldown = 10 SECONDS + + var/leap_warmup = 1 SECOND // How long the leap telegraphing is. + var/leap_sound = 'sound/weapons/spiderlunge.ogg' + +/mob/living/simple_mob/vore/vore_hostile/leaper/init_vore() + ..() + var/obj/belly/B = vore_selected + B.name = "stomach" + B.desc = "The flesh of the tall creature's stomach folds over you in doughy waves, squeezing you into the tightest shape it can manage with idle flexes churning down on you. Your limbs often find themselves lost between folds and tugged this way or that, held in a skin tight press that is not painful, but is hard to pull away from. You can see a strange, glittering pink and purple light glimmering through the flesh of the monster all around you, like your very own sea of stars. The walls rush in to fill all the space, squeezing you from head to toe no matter how you might wiggle, the weight of the semi-transparent interior flesh keeping you neatly secured deep inside while wringing the fight out of you." + B.mode_flags = DM_FLAG_THICKBELLY | DM_FLAG_NUMBING + B.belly_fullscreen = "yet_another_tumby" + B.digest_brute = 2 + B.digest_burn = 2 + B.digestchance = 0 + B.absorbchance = 0 + B.escapechance = 25 + B.colorization_enabled = TRUE + B.belly_fullscreen_color = "#591579" + B.escape_stun = 3 + +// The leaping attack. +/mob/living/simple_mob/vore/vore_hostile/leaper/do_special_attack(atom/A) //Mostly copied from hunter.dm + set waitfor = FALSE + if(!isliving(A)) + return FALSE + var/mob/living/L = A + if(!L.devourable || !L.allowmobvore || !L.can_be_drop_prey || !L.throw_vore || L.unacidable) + return FALSE + + set_AI_busy(TRUE) + visible_message(span("warning","\The [src]'s eyes flash ominously!")) + to_chat(L, span("danger","\The [src] focuses on you!")) + // Telegraph, since getting stunned suddenly feels bad. + do_windup_animation(A, leap_warmup) + sleep(leap_warmup) // For the telegraphing. + + if(L.z != z) //Make sure you haven't disappeared to somewhere we can't go + set_AI_busy(FALSE) + return FALSE + + // Do the actual leap. + status_flags |= LEAPING // Lets us pass over everything. + visible_message(span("critical","\The [src] leaps at \the [L]!")) + throw_at(get_step(L, get_turf(src)), special_attack_max_range+1, 1, src) + playsound(src, leap_sound, 75, 1) + + sleep(5) // For the throw to complete. It won't hold up the AI ticker due to waitfor being false. + + if(status_flags & LEAPING) + status_flags &= ~LEAPING // Revert special passage ability. + + set_AI_busy(FALSE) + if(Adjacent(L)) //We leapt at them but we didn't manage to hit them, let's see if we're next to them + L.Weaken(2) //get knocked down, idiot + +/////Gelatinous Cube///// + +/datum/category_item/catalogue/fauna/gelatinous_cube + name = "Alien Wildlife - Gelatinous Cube" + desc = "Macrocollagen Vulgaris is a species of slow moving slime. Debate still rages over whether or not it is actually even alive. It is most commonly found in the shape of a cube, while its colors can vary wildly depending upon what it has ingested. The cube is comprised of an extremely thick gel like substance that is highly corrosive, anything caught inside without appropriate protection will only last a few moments. This slime does move around, which is the primary argument for classifying it as alive, but it seems to wander randomly toward sources of nutrients. It seems perfectly indifferent to what it can ingest, and will simply ingest everything, from dirt, to people." + value = CATALOGUER_REWARD_EASY + +/mob/living/simple_mob/vore/vore_hostile/gelatinous_cube + name = "gelatinous cube" + desc = "A cube of corrosive slime. It seems to slide around very slowly. You're not sure if it's actually moving under its own power, or if it is just sliding around haphazardly. It is somewhat transparent, and you can see clouds of still processing materials inside as they break down." + tt_desc = "Macrocollagen Vulgaris" + icon = 'icons/mob/alienanimals_x64.dmi' + icon_state = "cube" + icon_living = "cube" + icon_dead = " " + icon_rest = "cube" + vis_height = 64 + + faction = "macrobacteria" + maxHealth = 500 + health = 500 + + harm_intent_damage = 1 + melee_damage_lower = 1 + melee_damage_upper = 1 + + movement_cooldown = 50 + meat_amount = 0 + meat_type = null + catalogue_data = list(/datum/category_item/catalogue/fauna/gelatinous_cube) + + see_in_dark = 8 + + pixel_x = -16 + default_pixel_x = -16 + + mob_size = MOB_LARGE + mob_bump_flag = HUMAN + mob_swap_flags = HEAVY + mob_push_flags = HEAVY + mob_size = MOB_LARGE + + attacktext = list("splashes against", "slaps", "smothers", "engulfs") + attack_sound = 'sound/effects/attackblob.ogg' + + ai_holder_type = /datum/ai_holder/simple_mob/vore + + swallowTime = 0 SECONDS + vore_active = 1 + vore_capacity = 1 + vore_bump_chance = 100 + vore_bump_emote = "begins to absorb" + vore_ignores_undigestable = 0 + vore_default_mode = DM_SELECT + vore_icons = SA_ICON_LIVING + vore_stomach_name = "interior" + vore_default_item_mode = IM_DIGEST + vore_pounce_chance = 50 + vore_pounce_cooldown = 10 + vore_pounce_successrate = 75 + vore_pounce_falloff = 0 + vore_pounce_maxhealth = 100 + vore_standing_too = TRUE + unacidable = TRUE + +/mob/living/simple_mob/vore/vore_hostile/gelatinous_cube/init_vore() + ..() + var/obj/belly/B = vore_selected + B.name = "interior" + B.desc = "An incredibly thick oozing slime surrounds you, filling in all the space around your form! It's hard to catch a breath here as the jiggling gel that makes up the body of the creature swiftly fills in the hole you made in its surface by entering. The gel is semi-transparent, and you can see your surroundings though its surface, and similarly you can be seen floating in the gel from the outside. When the cube moves, your whole body is wobbled along with it. There are clouds of still processing material floating all around you as the corrosive substance works on breaking everything down." + B.mode_flags = DM_FLAG_NUMBING + B.belly_fullscreen = "yet_another_tumby" + B.colorization_enabled = TRUE + B.belly_fullscreen_color = color + B.digest_brute = 2 + B.digest_burn = 10 + B.digest_oxy = 12 + B.digestchance = 0 + B.absorbchance = 0 + B.escapechance = 10 + B.escapetime = 10 SECONDS + B.selective_preference = DM_DIGEST + B.escape_stun = 3 + +/mob/living/simple_mob/vore/vore_hostile/gelatinous_cube/Initialize() + . = ..() + color = random_color(TRUE) + +/mob/living/simple_mob/vore/vore_hostile/gelatinous_cube/death() + . = ..() + + qdel(src) diff --git a/code/modules/mob/mob.dm b/code/modules/mob/mob.dm index 219a11db30..cd94acf4da 100644 --- a/code/modules/mob/mob.dm +++ b/code/modules/mob/mob.dm @@ -1090,6 +1090,33 @@ if(pixel_x <= (default_pixel_x + 16)) pixel_x++ is_shifted = TRUE + +/mob/verb/planeup() + set hidden = TRUE + if(!canface()) + return FALSE + if(plane >= MOB_PLANE + 3) //Don't bother going too high! + return + if(layer == MOB_LAYER) //Become higher + layer = ABOVE_MOB_LAYER + plane += 1 //Increase the plane + if(plane == MOB_PLANE) //Return to normal + layer = MOB_LAYER + is_shifted = TRUE + +/mob/verb/planedown() + set hidden = TRUE + if(!canface()) + return FALSE + if(plane <= MOB_PLANE - 3) //Don't bother going too low! + return + if(layer == MOB_LAYER) //Become lower + layer = BELOW_MOB_LAYER + plane -= 1 //Decrease the plane + if(plane == MOB_PLANE) //Return to normal + layer = MOB_LAYER + is_shifted = TRUE + // End VOREstation edit /mob/proc/adjustEarDamage() diff --git a/code/modules/mob/mob_defines_vr.dm b/code/modules/mob/mob_defines_vr.dm index 09ada3789b..619cfe5940 100644 --- a/code/modules/mob/mob_defines_vr.dm +++ b/code/modules/mob/mob_defines_vr.dm @@ -9,8 +9,9 @@ var/size_multiplier = 1 //multiplier for the mob's icon size var/accumulated_rads = 0 // For radiation stuff. + var/faction_bump_vore = FALSE // Don't bump nom mobs of the same faction /mob/drop_location() if(temporary_form) return temporary_form.drop_location() - return ..() \ No newline at end of file + return ..() diff --git a/code/modules/overmap/events/event_handler.dm b/code/modules/overmap/events/event_handler.dm index 2d9c2badda..b2782c2450 100644 --- a/code/modules/overmap/events/event_handler.dm +++ b/code/modules/overmap/events/event_handler.dm @@ -80,7 +80,7 @@ GLOBAL_DATUM_INIT(overmap_event_handler, /decl/overmap_event_handler, new) E.startWhen = 0 E.endWhen = INFINITY // TODO - Leshana - Note: event.setup() is called before these are set! - E.affecting_z = ship.map_z + E.affecting_z = ship.map_z.Copy() E.victim = ship LAZYADD(ship_events[ship], E) diff --git a/code/modules/overmap/ships/ship_vr.dm b/code/modules/overmap/ships/ship_vr.dm index 97afe44e72..4eed0abd23 100644 --- a/code/modules/overmap/ships/ship_vr.dm +++ b/code/modules/overmap/ships/ship_vr.dm @@ -9,6 +9,10 @@ /obj/effect/overmap/visitable/ship/MouseDrop(atom/over) if(!isliving(over) || !Adjacent(over) || !Adjacent(usr)) return + if(istype(over, /mob/living/simple_mob/vore/overmap)) + var/mob/living/simple_mob/vore/overmap/sdog = over + if(!sdog.shipvore) + return var/mob/living/L = over var/confirm = tgui_alert(L, "You COULD eat this spaceship...", "Eat spaceship?", list("Eat it!", "No, thanks.")) if(confirm == "Eat it!") @@ -28,14 +32,14 @@ /obj/effect/overmap/visitable/ship/hear_talk(mob/talker, list/message_pieces, verb) . = ..() - + var/list/listeners = get_people_in_ship() for(var/mob/M as anything in listeners) M.hear_say(message_pieces, verb, FALSE, talker) /obj/effect/overmap/visitable/ship/show_message(msg, type, alt, alt_type) . = ..() - + var/list/listeners = get_people_in_ship() for(var/mob/M as anything in listeners) M.show_message(msg, type, alt, alt_type) @@ -43,6 +47,6 @@ /obj/effect/overmap/visitable/ship/see_emote(source, message, m_type) . = ..() - var/list/listeners = get_people_in_ship() + var/list/listeners = get_people_in_ship() for(var/mob/M as anything in listeners) M.show_message(message, m_type) diff --git a/code/modules/paperwork/faxmachine.dm b/code/modules/paperwork/faxmachine.dm index c0811a4575..1e16e3c453 100644 --- a/code/modules/paperwork/faxmachine.dm +++ b/code/modules/paperwork/faxmachine.dm @@ -1,16 +1,17 @@ var/list/obj/machinery/photocopier/faxmachine/allfaxes = list() -var/list/admin_departments = list("[using_map.boss_name]", "Virgo-Prime Governmental Authority", "Virgo-Erigonne Job Boards", "Supply") // Vorestation Edit +var/list/admin_departments = list("[using_map.boss_name]", "Virgo-Prime Governmental Authority", "Virgo-Erigonne Job Boards", "Supply") var/list/alldepartments = list() +var/global/last_fax_role_request var/list/adminfaxes = list() //cache for faxes that have been sent to admins /obj/machinery/photocopier/faxmachine name = "fax machine" - desc = "Sent papers and pictures far away! Or to your co-worker's office a few doors down." + desc = "Send papers and pictures far away! Or to your co-worker's office a few doors down." icon = 'icons/obj/library.dmi' icon_state = "fax" insert_anim = "faxsend" - req_one_access = list(access_lawyer, access_heads, access_armory, access_qm) + req_one_access = list() use_power = USE_POWER_IDLE idle_power_usage = 30 @@ -37,6 +38,109 @@ var/list/adminfaxes = list() //cache for faxes that have been sent to admins tgui_interact(user) +/obj/machinery/photocopier/faxmachine/verb/remove_card() + set name = "Remove ID card" + set category = "Object" + set src in oview(1) + + var/mob/living/L = usr + + if(!L || !isturf(L.loc) || !isliving(L)) + return + if(!ishuman(L) && !issilicon(L)) + return + if(L.stat || L.restrained()) + return + if(!scan) + to_chat(L, span_notice("There is no I.D card to remove!")) + return + + scan.forceMove(loc) + if(ishuman(usr) && !usr.get_active_hand()) + usr.put_in_hands(scan) + scan = null + authenticated = null + +/obj/machinery/photocopier/faxmachine/verb/request_roles() + set name = "Staff Request Form" + set category = "Object" + set src in oview(1) + + var/mob/living/L = usr + + if(!L || !isturf(L.loc) || !isliving(L)) + return + if(!ishuman(L) && !issilicon(L)) + return + if(L.stat || L.restrained()) + return + if(last_fax_role_request && (world.time - last_fax_role_request < 5 MINUTES)) + to_chat(L, "The global automated relays are still recalibrating. Try again later or relay your request in written form for processing.") + return + + var/confirmation = tgui_alert(L, "Are you sure you want to send automated crew request?", "Confirmation", list("Yes", "No", "Cancel")) + if(confirmation != "Yes") + return + + var/list/jobs = list() + for(var/datum/department/dept as anything in SSjob.get_all_department_datums()) + if(!dept.assignable || dept.centcom_only) + continue + for(var/job in SSjob.get_job_titles_in_department(dept.name)) + var/datum/job/J = SSjob.get_job(job) + if(J.requestable) + jobs |= job + + var/role = tgui_input_list(L, "Pick the job to request.", "Job Request", jobs) + if(!role) + return + + var/datum/job/job_to_request = SSjob.get_job(role) + var/reason = "Unspecified" + var/list/possible_reasons = list("Unspecified", "General duties", "Emergency situation") + possible_reasons += job_to_request.get_request_reasons() + reason = tgui_input_list(L, "Pick request reason.", "Request reason", possible_reasons) + + var/final_conf = tgui_alert(L, "You are about to request [role]. Are you sure?", "Confirmation", list("Yes", "No", "Cancel")) + if(final_conf != "Yes") + return + + var/datum/department/ping_dept = SSjob.get_ping_role(role) + if(!ping_dept) + to_chat(L, "Selected job cannot be requested for \[ERRORDEPTNOTFOUND] reason. Please report this to system administrator.") + return + var/message_color = "#FFFFFF" + var/ping_name = null + switch(ping_dept.name) + if(DEPARTMENT_COMMAND) + ping_name = "Command" + if(DEPARTMENT_SECURITY) + ping_name = "Security" + if(DEPARTMENT_ENGINEERING) + ping_name = "Engineering" + if(DEPARTMENT_MEDICAL) + ping_name = "Medical" + if(DEPARTMENT_RESEARCH) + ping_name = "Research" + if(DEPARTMENT_CARGO) + ping_name = "Supply" + if(DEPARTMENT_CIVILIAN) + ping_name = "Service" + if(DEPARTMENT_PLANET) + ping_name = "Expedition" + if(DEPARTMENT_SYNTHETIC) + ping_name = "Silicon" + //if(DEPARTMENT_TALON) + // ping_name = "Offmap" + if(!ping_name) + to_chat(L, "Selected job cannot be requested for \[ERRORUNKNOWNDEPT] reason. Please report this to system administrator.") + return + message_color = ping_dept.color + + message_chat_rolerequest(message_color, ping_name, reason, role) + last_fax_role_request = world.time + to_chat(L, "Your request was transmitted.") + /obj/machinery/photocopier/faxmachine/tgui_interact(mob/user, datum/tgui/ui) ui = SStgui.try_update_ui(user, src, ui) if(!ui) @@ -50,6 +154,7 @@ var/list/adminfaxes = list() //cache for faxes that have been sent to admins data["rank"] = rank data["isAI"] = isAI(user) data["isRobot"] = isrobot(user) + data["adminDepartments"] = admin_departments data["bossName"] = using_map.boss_name data["copyItem"] = copyitem @@ -107,6 +212,8 @@ var/list/adminfaxes = list() //cache for faxes that have been sent to admins usr.put_in_hands(copyitem) to_chat(usr, "You take \the [copyitem] out of \the [src].") copyitem = null + if("send_automated_staff_request") + request_roles() if(!authenticated) return @@ -216,8 +323,8 @@ var/list/adminfaxes = list() //cache for faxes that have been sent to admins // Sadly, we can't use a switch statement here due to not using a constant value for the current map's centcom name. if(destination == using_map.boss_name) message_admins(sender, "[uppertext(using_map.boss_short)] FAX", rcvdcopy, "CentComFaxReply", "#006100") - else if(destination == "Virgo-Prime Governmental Authority") // Vorestation Edit - message_admins(sender, "VIRGO GOVERNMENT FAX", rcvdcopy, "CentComFaxReply", "#1F66A0") // Vorestation Edit + else if(destination == "Virgo-Prime Governmental Authority") + message_admins(sender, "VIRGO GOVERNMENT FAX", rcvdcopy, "CentComFaxReply", "#1F66A0") else if(destination == "Supply") message_admins(sender, "[uppertext(using_map.boss_short)] SUPPLY FAX", rcvdcopy, "CentComFaxReply", "#5F4519") else @@ -253,10 +360,8 @@ var/list/adminfaxes = list() //cache for faxes that have been sent to admins to_chat(C,msg) C << 'sound/machines/printer.ogg' - // VoreStation Edit Start var/faxid = export_fax(sent) - message_chat_admins(sender, faxname, sent, faxid, font_colour) - // VoreStation Edit End + message_chat_admins(sender, faxname, sent, faxid, font_colour) //Sends to admin chat // Webhooks don't parse the HTML on the paper, so we gotta strip them out so it's still readable. var/summary = make_summary(sent) @@ -277,3 +382,80 @@ var/list/adminfaxes = list() //cache for faxes that have been sent to admins "body" = summary ) ) + +/* + ##### #### + ##### Webhook Functionality #### + ##### #### +*/ + +/datum/configuration + var/chat_webhook_url = "" // URL of the webhook for sending announcements/faxes to discord chat. + var/chat_webhook_key = "" // Shared secret for authenticating to the chat webhook + var/fax_export_dir = "data/faxes" // Directory in which to write exported fax HTML files. + + +/** + * Write the fax to disk as (potentially multiple) HTML files. + * If the fax is a paper_bundle, do so recursively for each page. + * returns a random unique faxid. + */ +/obj/machinery/photocopier/faxmachine/proc/export_fax(fax) + var faxid = "[num2text(world.realtime,12)]_[rand(10000)]" + if (istype(fax, /obj/item/weapon/paper)) + var/obj/item/weapon/paper/P = fax + var/text = "[P.name][P.info][P.stamps]"; + file("[config.fax_export_dir]/fax_[faxid].html") << text; + else if (istype(fax, /obj/item/weapon/photo)) + var/obj/item/weapon/photo/H = fax + fcopy(H.img, "[config.fax_export_dir]/photo_[faxid].png") + var/text = "[H.name]" \ + + "" \ + + "" \ + + "[H.scribble ? "
Written on the back:
[H.scribble]" : ""]"\ + + "" + file("[config.fax_export_dir]/fax_[faxid].html") << text + else if (istype(fax, /obj/item/weapon/paper_bundle)) + var/obj/item/weapon/paper_bundle/B = fax + var/data = "" + for (var/page = 1, page <= B.pages.len, page++) + var/obj/pageobj = B.pages[page] + var/page_faxid = export_fax(pageobj) + data += "Page [page] - [pageobj.name]
" + var/text = "[B.name][data]" + file("[config.fax_export_dir]/fax_[faxid].html") << text + return faxid + + + +/** + * Call the chat webhook to transmit a notification of an admin fax to the admin chat. + */ +/obj/machinery/photocopier/faxmachine/proc/message_chat_admins(var/mob/sender, var/faxname, var/obj/item/sent, var/faxid, font_colour="#006100") + if (config.chat_webhook_url) + spawn(0) + var/query_string = "type=fax" + query_string += "&key=[url_encode(config.chat_webhook_key)]" + query_string += "&faxid=[url_encode(faxid)]" + query_string += "&color=[url_encode(font_colour)]" + query_string += "&faxname=[url_encode(faxname)]" + query_string += "&sendername=[url_encode(sender.name)]" + query_string += "&sentname=[url_encode(sent.name)]" + world.Export("[config.chat_webhook_url]?[query_string]") + + + + +/** + * Call the chat webhook to transmit a notification of a job request + */ +/obj/machinery/photocopier/faxmachine/proc/message_chat_rolerequest(var/font_colour="#006100", var/role_to_ping, var/reason, var/jobname) + if(config.chat_webhook_url) + spawn(0) + var/query_string = "type=rolerequest" + query_string += "&key=[url_encode(config.chat_webhook_key)]" + query_string += "&ping=[url_encode(role_to_ping)]" + query_string += "&color=[url_encode(font_colour)]" + query_string += "&reason=[url_encode(reason)]" + query_string += "&job=[url_encode(jobname)]" + world.Export("[config.chat_webhook_url]?[query_string]") diff --git a/code/modules/paperwork/faxmachine_vr.dm b/code/modules/paperwork/faxmachine_vr.dm deleted file mode 100644 index 078a17403f..0000000000 --- a/code/modules/paperwork/faxmachine_vr.dm +++ /dev/null @@ -1,154 +0,0 @@ -var/global/last_fax_role_request - -/obj/machinery/photocopier/faxmachine - req_one_access = list() - -/** - * Write the fax to disk as (potentially multiple) HTML files. - * If the fax is a paper_bundle, do so recursively for each page. - * returns a random unique faxid. - */ -/obj/machinery/photocopier/faxmachine/proc/export_fax(fax) - var faxid = "[num2text(world.realtime,12)]_[rand(10000)]" - if (istype(fax, /obj/item/weapon/paper)) - var/obj/item/weapon/paper/P = fax - var/text = "[P.name][P.info][P.stamps]"; - file("[config.fax_export_dir]/fax_[faxid].html") << text; - else if (istype(fax, /obj/item/weapon/photo)) - var/obj/item/weapon/photo/H = fax - fcopy(H.img, "[config.fax_export_dir]/photo_[faxid].png") - var/text = "[H.name]" \ - + "" \ - + "" \ - + "[H.scribble ? "
Written on the back:
[H.scribble]" : ""]"\ - + "" - file("[config.fax_export_dir]/fax_[faxid].html") << text - else if (istype(fax, /obj/item/weapon/paper_bundle)) - var/obj/item/weapon/paper_bundle/B = fax - var/data = "" - for (var/page = 1, page <= B.pages.len, page++) - var/obj/pageobj = B.pages[page] - var/page_faxid = export_fax(pageobj) - data += "Page [page] - [pageobj.name]
" - var/text = "[B.name][data]" - file("[config.fax_export_dir]/fax_[faxid].html") << text - return faxid - -/** - * Call the chat webhook to transmit a notification of an admin fax to the admin chat. - */ -/obj/machinery/photocopier/faxmachine/proc/message_chat_admins(var/mob/sender, var/faxname, var/obj/item/sent, var/faxid, font_colour="#006100") - if (config.chat_webhook_url) - spawn(0) - var/query_string = "type=fax" - query_string += "&key=[url_encode(config.chat_webhook_key)]" - query_string += "&faxid=[url_encode(faxid)]" - query_string += "&color=[url_encode(font_colour)]" - query_string += "&faxname=[url_encode(faxname)]" - query_string += "&sendername=[url_encode(sender.name)]" - query_string += "&sentname=[url_encode(sent.name)]" - world.Export("[config.chat_webhook_url]?[query_string]") - -/** - * Call the chat webhook to transmit a notification of a job request - */ -/obj/machinery/photocopier/faxmachine/proc/message_chat_rolerequest(var/font_colour="#006100", var/role_to_ping, var/reason, var/jobname) - if(config.chat_webhook_url) - spawn(0) - var/query_string = "type=rolerequest" - query_string += "&key=[url_encode(config.chat_webhook_key)]" - query_string += "&ping=[url_encode(role_to_ping)]" - query_string += "&color=[url_encode(font_colour)]" - query_string += "&reason=[url_encode(reason)]" - query_string += "&job=[url_encode(jobname)]" - world.Export("[config.chat_webhook_url]?[query_string]") - -// -// Overrides/additions to stock defines go here, as well as hooks. Sort them by -// the object they are overriding. So all /mob/living together, etc. -// -/datum/configuration - var/chat_webhook_url = "" // URL of the webhook for sending announcements/faxes to discord chat. - var/chat_webhook_key = "" // Shared secret for authenticating to the chat webhook - var/fax_export_dir = "data/faxes" // Directory in which to write exported fax HTML files. - - -/obj/machinery/photocopier/faxmachine/verb/request_roles() - set name = "Staff Request Form" - set category = "Object" - set src in oview(1) - - var/mob/living/L = usr - - if(!L || !isturf(L.loc) || !isliving(L)) - return - if(!ishuman(L) && !issilicon(L)) - return - if(L.stat || L.restrained()) - return - if(last_fax_role_request && (world.time - last_fax_role_request < 5 MINUTES)) - to_chat(L, "The global automated relays are still recalibrating. Try again later or relay your request in written form for processing.") - return - - var/confirmation = tgui_alert(L, "Are you sure you want to send automated crew request?", "Confirmation", list("Yes", "No", "Cancel")) - if(confirmation != "Yes") - return - - var/list/jobs = list() - for(var/datum/department/dept as anything in SSjob.get_all_department_datums()) - if(!dept.assignable || dept.centcom_only) - continue - for(var/job in SSjob.get_job_titles_in_department(dept.name)) - var/datum/job/J = SSjob.get_job(job) - if(J.requestable) - jobs |= job - - var/role = tgui_input_list(L, "Pick the job to request.", "Job Request", jobs) - if(!role) - return - - var/datum/job/job_to_request = SSjob.get_job(role) - var/reason = "Unspecified" - var/list/possible_reasons = list("Unspecified", "General duties", "Emergency situation") - possible_reasons += job_to_request.get_request_reasons() - reason = tgui_input_list(L, "Pick request reason.", "Request reason", possible_reasons) - - var/final_conf = tgui_alert(L, "You are about to request [role]. Are you sure?", "Confirmation", list("Yes", "No", "Cancel")) - if(final_conf != "Yes") - return - - var/datum/department/ping_dept = SSjob.get_ping_role(role) - if(!ping_dept) - to_chat(L, "Selected job cannot be requested for \[ERRORDEPTNOTFOUND] reason. Please report this to system administrator.") - return - var/message_color = "#FFFFFF" - var/ping_name = null - switch(ping_dept.name) - if(DEPARTMENT_COMMAND) - ping_name = "Command" - if(DEPARTMENT_SECURITY) - ping_name = "Security" - if(DEPARTMENT_ENGINEERING) - ping_name = "Engineering" - if(DEPARTMENT_MEDICAL) - ping_name = "Medical" - if(DEPARTMENT_RESEARCH) - ping_name = "Research" - if(DEPARTMENT_CARGO) - ping_name = "Supply" - if(DEPARTMENT_CIVILIAN) - ping_name = "Service" - if(DEPARTMENT_PLANET) - ping_name = "Expedition" - if(DEPARTMENT_SYNTHETIC) - ping_name = "Silicon" - //if(DEPARTMENT_TALON) - // ping_name = "Offmap" - if(!ping_name) - to_chat(L, "Selected job cannot be requested for \[ERRORUNKNOWNDEPT] reason. Please report this to system administrator.") - return - message_color = ping_dept.color - - message_chat_rolerequest(message_color, ping_name, reason, role) - last_fax_role_request = world.time - to_chat(L, "Your request was transmitted.") diff --git a/code/modules/vchat/README.md b/code/modules/vchat/README.md new file mode 100644 index 0000000000..fc7029b217 --- /dev/null +++ b/code/modules/vchat/README.md @@ -0,0 +1,24 @@ +# VChat +(Please add to this file as you learn how this thing works. Thank you!) +## Development + +To implement changes to VChat, one must modify either vchat.js or vchat_client, + where vchat.js corresponds to what actually appears to the user. + Not all of the logic is isolated within vchat_client, vchat.js handles a significant amount of processing as well. + +### vchat.js + +vchat.js is a development file - it is not actually included in the actual game code. Instead, what the game expects is +the minified version "vchat.min.js" + +Therefore, to have your changes in "vchat.js" apply to the game for either PR or testing - you must first minify your script. +If you are unfamiliar how to, simply you copy the file contants in vchat.js, paste them into https://codebeautify.org/minify-js +or any similar tool and paste its output into vchat.min.js . + +As of 2023/08/05, no tool is provided by the codebase to handle minification for the developer. + +### ss13styles.css + +Handles chat colours, background colours, filtering. + +Please keep this file synchronized with code\stylesheet.dm where possible (filters, lightmode colours). diff --git a/code/modules/vchat/css/css-testing.html b/code/modules/vchat/css/css-testing.html index 94e2844b91..0aee4628e9 100644 --- a/code/modules/vchat/css/css-testing.html +++ b/code/modules/vchat/css/css-testing.html @@ -15,7 +15,7 @@ OOC
15
- +
@@ -26,7 +26,7 @@
{{latency}}ms
- +
@@ -36,35 +36,40 @@ Testing danger message.
[Security] Secu Person says, "Testing radio message."
Testing OOC message.
- Testing LOOC message.
+ Testing LOOC message.
+ Testing RLOOC message.
Testing asay message.
Test Person says, "Testing say message 2."
Testing notice message 2.
Testing danger message 2.
[Security] Secu Person says, "Testing radio message 2".
Testing OOC message 2.
- Testing LOOC message 2.
+ Testing LOOC message 2.
+ Testing RLOOC message 2.
Testing asay message 2.
Test Person says, "Testing say message 3."
Testing notice message 3.
Testing danger message 3.
[Security] Secu Person says, "Testing radio message 3".
Testing OOC message 3.
- Testing LOOC message 3.
+ Testing LOOC message 3.
+ Testing RLOOC message 3.
Testing asay message 3.
Test Person says, "Testing say message 4."
Testing notice message 4.
Testing danger message 4.
[Security] Secu Person says, "Testing radio message 4".
Testing OOC message 4.
- Testing LOOC message 4.
+ Testing LOOC message 4.
+ Testing RLOOC message 4.
Testing asay message 4.
Test Person says, "Testing say message 5."
Testing notice message 5.
Testing danger message 5.
[Security] Secu Person says, "Testing radio message 5".
Testing OOC message 5.
- Testing LOOC message 5.
+ Testing LOOC message 5.
+ Testing RLOOC message 5.
Testing asay message 5.
@@ -73,38 +78,43 @@ Testing danger message.
[Security] Secu Person says, "Testing radio message."
Testing OOC message.
- Testing LOOC message.
+ Testing LOOC message.
+ Testing RLOOC message.
Testing asay message.
Test Person says, "Testing say message 2."
Testing notice message 2.
Testing danger message 2.
[Security] Secu Person says, "Testing radio message 2".
Testing OOC message 2.
- Testing LOOC message 2.
+ Testing LOOC message 2.
+ Testing RLOOC message 2.
Testing asay message 2.
Test Person says, "Testing say message 3."
Testing notice message 3.
Testing danger message 3.
[Security] Secu Person says, "Testing radio message 3".
Testing OOC message 3.
- Testing LOOC message 3.
+ Testing LOOC message 3.
+ Testing RLOOC message 3.
Testing asay message 3.
Test Person says, "Testing say message 4."
Testing notice message 4.
Testing danger message 4.
[Security] Secu Person says, "Testing radio message 4".
Testing OOC message 4.
- Testing LOOC message 4.
+ Testing LOOC message 4.
+ Testing RLOOC message 4.
Testing asay message 4.
Test Person says, "Testing say message 5."
Testing notice message 5.
Testing danger message 5.
[Security] Secu Person says, "Testing radio message 5".
Testing OOC message 5.
- Testing LOOC message 5.
+ Testing LOOC message 5.
+ Testing RLOOC message 5.
Testing asay message 5.
- \ No newline at end of file + diff --git a/code/modules/vchat/css/ss13styles.css b/code/modules/vchat/css/ss13styles.css index af6fe46bd3..daba8f5e58 100644 --- a/code/modules/vchat/css/ss13styles.css +++ b/code/modules/vchat/css/ss13styles.css @@ -75,7 +75,8 @@ body.inverted { .ooc .everyone {color: #002eb8;} .inverted .ooc .everyone {color: #004ed8;} /* Dark mode */ -.looc {color: #3A9696;} +.looc {color: #3A9696; font-weight: bold} +.rlooc {color: #3ABB96; font-weight: bold} .ooc .elevated {color: #2e78d9;} .ooc .moderator {color: #184880;} .ooc .developer {color: #1b521f;} diff --git a/code/modules/vchat/js/vchat.js b/code/modules/vchat/js/vchat.js index 8450fe3111..7fc406e475 100644 --- a/code/modules/vchat/js/vchat.js +++ b/code/modules/vchat/js/vchat.js @@ -30,6 +30,14 @@ var vchat_opts = { vchatTabsVer: 1.0 //Version of vchat tabs save 'file' }; +/*********** +* If you are changing either tabBackgroundColor in dark or lightmode, +* lease keep this synchronized with code\modules\examine\examine.dm +* I cannot think of a elegant way to ensure it tracks these settings properly. +* As long as LIGHTMODE stays as "none", stuff should not break. +* Thank you! +************/ + var DARKMODE_COLORS = { buttonBgColor: "#40628a", buttonTextColor: "#FFFFFF", @@ -177,7 +185,7 @@ function start_vue() { admin: false }, { - matches: ".filter_ooc, .ooc:not(.looc)", + matches: ".ooc, .filter_ooc", becomes: "vc_globalooc", pretty: "Global OOC", tooltip: "The bluewall of global OOC messages", @@ -267,12 +275,20 @@ function start_vue() { admin: true }, { - matches: ".ooc.looc, .ooc, .looc", //Dumb game + matches: ".looc", becomes: "vc_looc", pretty: "Local OOC", tooltip: "Local OOC messages, always enabled", required: true }, + { + matches: ".rlooc", + becomes: "vc_rlooc", + pretty: "Remote LOOC", + tooltip: "Remote LOOC messages", + required: false, + admin: true + }, { matches: ".boldannounce, .filter_system", becomes: "vc_system", diff --git a/code/modules/vchat/js/vchat.min.js b/code/modules/vchat/js/vchat.min.js index bcd2c699c7..0a6df956f7 100644 --- a/code/modules/vchat/js/vchat.min.js +++ b/code/modules/vchat/js/vchat.min.js @@ -1 +1 @@ -!function(){var e=console.log;console.log=function(t){send_debug(t),e.apply(console,arguments)};var t=console.error;console.error=function(e){send_debug(e),t.apply(console,arguments)},window.onerror=function(e,t,s,a,n){var o="";return n&&n.stack&&(o=n.stack),send_debug(e+" ("+t+"@"+s+":"+a+") "+n+"|UA: "+navigator.userAgent+"|Stack: "+o),!0}}();var vchat_opts={msBeforeDropped:3e4,cookiePrefix:"vst-",alwaysShow:["vc_looc","vc_system"],vchatTabsVer:1},DARKMODE_COLORS={buttonBgColor:"#40628a",buttonTextColor:"#FFFFFF",windowBgColor:"#272727",highlightColor:"#009900",tabTextColor:"#FFFFFF",tabBackgroundColor:"#272727"},LIGHTMODE_COLORS={buttonBgColor:"none",buttonTextColor:"#000000",windowBgColor:"none",highlightColor:"#007700",tabTextColor:"#000000",tabBackgroundColor:"none"},set_storage=set_cookie,get_storage=get_cookie,domparser=new DOMParser;storageAvailable("localStorage")&&(set_storage=set_localstorage,get_storage=get_localstorage);var vueapp,vchat_state={ready:!1,byond_ip:null,byond_cid:null,byond_ckey:null,lastPingReceived:0,latency_sent:0,lastId:0};function start_vchat(){start_vue(),vchat_state.ready=!0,push_Topic("done_loading"),push_Topic_showingnum(this.showingnum),doWinset("htmloutput",{"is-visible":!0}),doWinset("oldoutput",{"is-visible":!1}),doWinset("chatloadlabel",{"is-visible":!1}),setInterval(check_ping,vchat_opts.msBeforeDropped),send_debug("VChat Loaded!")}function start_vue(){vueapp=new Vue({el:"#app",data:{messages:[],shown_messages:[],unshown_messages:0,archived_messages:[],tabs:[{name:"Main",categories:[],immutable:!0,active:!0}],unread_messages:{},editing:!1,paused:!1,latency:0,reconnecting:!1,ext_styles:"",is_admin:!1,inverted:!1,crushing:3,animated:!1,fontsize:.9,lineheight:130,showingnum:200,type_table:[{matches:".filter_say, .say, .emote, .emote_subtle",becomes:"vc_localchat",pretty:"Local Chat",tooltip:"In-character local messages (say, emote, etc)",required:!1,admin:!1},{matches:".filter_radio, .alert, .syndradio, .centradio, .airadio, .entradio, .comradio, .secradio, .engradio, .medradio, .sciradio, .supradio, .srvradio, .expradio, .radio, .deptradio, .newscaster",becomes:"vc_radio",pretty:"Radio Comms",tooltip:"All departments of radio messages",required:!1,admin:!1},{matches:".filter_notice, .notice:not(.pm), .adminnotice, .info, .sinister, .cult",becomes:"vc_info",pretty:"Notices",tooltip:"Non-urgent messages from the game and items",required:!1,admin:!1},{matches:".filter_warning, .warning:not(.pm), .critical, .userdanger, .italics",becomes:"vc_warnings",pretty:"Warnings",tooltip:"Urgent messages from the game and items",required:!1,admin:!1},{matches:".filter_deadsay, .deadsay",becomes:"vc_deadchat",pretty:"Deadchat",tooltip:"All of deadchat",required:!1,admin:!1},{matches:".filter_ooc, .ooc:not(.looc)",becomes:"vc_globalooc",pretty:"Global OOC",tooltip:"The bluewall of global OOC messages",required:!1,admin:!1},{matches:".nif",becomes:"vc_nif",pretty:"NIF Messages",tooltip:"Messages from the NIF itself and people inside",required:!1,admin:!1},{matches:".mentor_channel, .mentor",becomes:"vc_mentor",pretty:"Mentor messages",tooltip:"Mentorchat and mentor pms",required:!1,admin:!1},{matches:".filter_pm, .pm",becomes:"vc_adminpm",pretty:"Admin PMs",tooltip:"Messages to/from admins ('adminhelps')",required:!1,admin:!1},{matches:".filter_ASAY, .admin_channel",becomes:"vc_adminchat",pretty:"Admin Chat",tooltip:"ASAY messages",required:!1,admin:!0},{matches:".filter_MSAY, .mod_channel",becomes:"vc_modchat",pretty:"Mod Chat",tooltip:"MSAY messages",required:!1,admin:!0},{matches:".filter_ESAY, .event_channel",becomes:"vc_eventchat",pretty:"Event Chat",tooltip:"ESAY messages",required:!1,admin:!0},{matches:".filter_combat, .danger",becomes:"vc_combat",pretty:"Combat Logs",tooltip:"Urist McTraitor has stabbed you with a knife!",required:!1,admin:!1},{matches:".filter_adminlogs, .log_message",becomes:"vc_adminlogs",pretty:"Admin Logs",tooltip:"ADMIN LOG: Urist McAdmin has jumped to coordinates X, Y, Z",required:!1,admin:!0},{matches:".filter_attacklogs",becomes:"vc_attacklogs",pretty:"Attack Logs",tooltip:"Urist McTraitor has shot John Doe",required:!1,admin:!0},{matches:".filter_debuglogs",becomes:"vc_debuglogs",pretty:"Debug Logs",tooltip:"DEBUG: SSPlanets subsystem Recover().",required:!1,admin:!0},{matches:".ooc.looc, .ooc, .looc",becomes:"vc_looc",pretty:"Local OOC",tooltip:"Local OOC messages, always enabled",required:!0},{matches:".boldannounce, .filter_system",becomes:"vc_system",pretty:"System Messages",tooltip:"Messages from your client, always enabled",required:!0},{matches:".unsorted",becomes:"vc_unsorted",pretty:"Unsorted",tooltip:"Messages that don't have any filters.",required:!1,admin:!1}]},mounted:function(){this.load_settings();var e=new XMLHttpRequest;e.open("GET","ss13styles.css"),e.onreadystatechange=function(){this.ext_styles=e.responseText}.bind(this),e.send()},updated:function(){this.editing||this.paused||window.scrollTo(0,document.getElementById("messagebox").scrollHeight)},watch:{reconnecting:function(e,t){1==e&&0==t?this.internal_message("Your client has lost connection to the server, or there is severe lag. Your client will reconnect if possible."):0==e&&1==t&&this.internal_message("Your client has reconnected to the server.")},inverted:function(e){set_storage("darkmode",e),e?(document.body.classList.add("inverted"),switch_ui_mode(DARKMODE_COLORS)):(document.body.classList.remove("inverted"),switch_ui_mode(LIGHTMODE_COLORS))},crushing:function(e){set_storage("crushing",e)},animated:function(e){set_storage("animated",e)},fontsize:function(e,t){isNaN(e)?this.fontsize=t:(e<.2?this.fontsize=.2:e>5&&(this.fontsize=5),set_storage("fontsize",e))},lineheight:function(e,t){isFinite(e)?(e<100?this.lineheight=100:e>200&&(this.lineheight=200),set_storage("lineheight",e)):this.lineheight=t},showingnum:function(e,t){isFinite(e)?((e=Math.floor(e))<50?this.showingnum=50:e>2e3&&(this.showingnum=2e3),set_storage("showingnum",this.showingnum),push_Topic_showingnum(this.showingnum),this.attempt_archive()):this.showingnum=t},current_categories:function(e,t){e.length&&this.apply_filter(e)}},computed:{active_tab:function(){return this.tabs.find((function(e){return e.active}))},ping_classes:function(){return this.latency?"?"==this.latency?"grey":this.latency<0?"red":this.latency<=200?"green":this.latency<=400?"yellow":"grey":this.reconnecting?"red":"green"},current_categories:function(){return this.active_tab==this.tabs[0]?[]:this.active_tab.categories.concat(vchat_opts.alwaysShow)}},methods:{load_settings:function(){this.inverted=get_storage("darkmode",!1),this.crushing=get_storage("crushing",3),this.animated=get_storage("animated",!1),this.fontsize=get_storage("fontsize",.9),this.lineheight=get_storage("lineheight",130),this.showingnum=get_storage("showingnum",200),isNaN(this.crushing)&&(this.crushing=3),isNaN(this.fontsize)&&(this.fontsize=.9),this.load_tabs()},load_tabs:function(){var e=get_storage("tabs");if(e){var t=JSON.parse(e);t.version&&t.tabs?!t.version!=vchat_opts.vchatTabsVer?this.tabs.push.apply(this.tabs,t.tabs):this.internal_message("Your saved tabs are for an older version of VChat and must be recreated, sorry."):this.internal_message("There was a problem loading your tabs. Any new ones you make will be saved, however.")}},save_tabs:function(){var e={version:vchat_opts.vchatTabsVer,tabs:[]};this.tabs.forEach((function(t){if(!t.immutable){var s=t.name,a=[];t.categories.forEach((function(e){a.push(e)}));var n={name:s,categories:a,immutable:!1,active:!1};e.tabs.push(n)}}));var t=JSON.stringify(e);set_storage("tabs",t)},switchtab:function(e){e!=this.active_tab&&(this.active_tab.active=!1,e.active=!0,e.categories.forEach((function(e){this.unread_messages[e]=0}),this),this.apply_filter(this.current_categories))},editmode:function(){this.editing=!this.editing,this.save_tabs()},pause:function(){this.paused=!this.paused},newtab:function(){this.tabs.push({name:"New Tab",categories:[],immutable:!1,active:!1}),this.switchtab(this.tabs[this.tabs.length-1])},renametab:function(){if(!this.active_tab.immutable){var e=this.active_tab,t=window.prompt("Type the desired tab name:",e.name);null!==t&&""!==t&&null!==e&&(e.name=t)}},deltab:function(e){e||(e=this.active_tab),e.immutable||(this.switchtab(this.tabs[0]),this.tabs.splice(this.tabs.indexOf(e),1))},movetab:function(e,t){if(e&&!e.immutable){var s=this.tabs.indexOf(e),a=s+t;this.tabs.splice(a,0,this.tabs.splice(s,1)[0])}},tab_unread_count:function(e){var t=0,s=this.unread_messages;return e.categories.find((function(e){s[e]&&(t+=s[e])})),t},tab_unread_categories:function(e){var t=!1,s=this.unread_messages;return e.categories.find((function(e){if(s[e])return t=!0,!0})),{red:t,grey:!t}},attempt_archive:function(){if(this.messages.length>this.showingnum){var e=this.messages.splice(0,20);Array.prototype.push.apply(this.archived_messages,e)}},apply_filter:function(e){this.shown_messages.splice(0),this.unshown_messages=0,this.messages.forEach((function(t){e.indexOf(t.category)>-1&&this.shown_messages.push(t)}),this),this.archived_messages.forEach((function(t){e.indexOf(t.category)>-1&&this.unshown_messages++}),this)},add_message:function(e){let t={time:e.time,category:"error",content:e.message,repeats:1};if(t.category=this.get_category(t.content),"vc_unsorted"==t.category&&(t.content=""+t.content+""),this.crushing){let e=this.messages.slice(-this.crushing);for(let s=e.length-1;s>=0;s--){let a=e[s];a.content==t.content&&(t.repeats+=a.repeats,this.messages.splice(this.messages.indexOf(a),1))}}t.content=t.content.replace(/(\b(https?):\/\/[\-A-Z0-9+&@#\/%?=~_|!:,.;]*[\-A-Z0-9+&@#\/%=~_|])/gim,'$1'),this.current_categories.length&&this.current_categories.indexOf(t.category)<0?(isNaN(this.unread_messages[t.category])&&(this.unread_messages[t.category]=0),this.unread_messages[t.category]+=1):this.current_categories.length&&this.shown_messages.push(t),t.id=++vchat_state.lastId,this.attempt_archive(),this.messages.push(t)},internal_message:function(e){let t={time:this.messages.length?this.messages.slice(-1).time+1:0,category:"vc_system",content:"[VChat Internal] "+e+""};t.id=++vchat_state.lastId,this.messages.push(t)},on_mouseup:function(e){let t=e.target;"getSelection"in window&&!1===window.getSelection().isCollapsed||t&&("INPUT"===t.tagName||"TEXTAREA"===t.tagName)||(focusMapWindow(),e.preventDefault(),e.target.click())},click_message:function(e){let t=e.target;if("A"===t.tagName){e.stopPropagation(),e.preventDefault?e.preventDefault():e.returnValue=!1;var s=t.getAttribute("href");"?"==s[0]||s.length>=8&&"byond://"==s.substring(0,8)?window.location=s:window.location="byond://?action=openLink&link="+encodeURIComponent(s)}},get_category:function(e){if(!vchat_state.ready)return void push_Topic("not_ready");let t=domparser.parseFromString(e,"text/html").querySelector("span"),s="vc_unsorted";return t?(this.type_table.find((function(e){if(t.msMatchesSelector(e.matches))return s=e.becomes,!0})),s):s},save_chatlog:function(){var e="",t=this.archived_messages.concat(this.messages),s=this.current_categories;t.forEach((function(t){(0==s.length||s.indexOf(t.category)>=0)&&(e+=t.content,t.repeats>1&&(e+="(x"+t.repeats+")"),e+="
\n")})),e+="";var a=new Date,n=String(a.getHours());n.length<2&&(n="0"+n);var o=String(a.getMinutes());o.length<2&&(o="0"+o);var i=String(a.getDate());i.length<2&&(i="0"+i);var r=String(a.getMonth()+1);r.length<2&&(r="0"+r);var c="log"+(" "+String(a.getFullYear())+"-"+r+"-"+i+" ("+n+" "+o+")")+".html",l=document.createElement("a");if(void 0!==l.download)l.href="data:attachment/text,"+encodeURI(e),l.target="_blank",l.download=c,l.click();else{var h=new Blob([e],{type:"text/html;charset=utf8;"});saved=window.navigator.msSaveOrOpenBlob(h,c)}},do_latency_test:function(){send_latency_check()},blur_this:function(e){e.target.blur()}}})}function check_ping(){Date.now()-vchat_state.lastPingReceived>vchat_opts.msBeforeDropped&&(vueapp.reconnecting=!0)}function send_latency_check(){vchat_state.latency_sent||(vchat_state.latency_sent=Date.now(),vueapp.latency="?",push_Topic("ping"),setTimeout((function(){"?"==vchat_state.latency_ms&&(vchat_state.latency_ms=999)}),1e3),setTimeout((function(){vchat_state.latency_sent=0,vueapp.latency=0}),5e3))}function get_latency_check(){vchat_state.latency_sent&&(vueapp.latency=Date.now()-vchat_state.latency_sent)}function byondDecode(e){e=e.replace(/\+/g,"%20");try{e=decodeURIComponent(e)}catch(t){e=unescape(e)}return JSON.parse(e)}function putmessage(e){e=byondDecode(e),Array.isArray(e)?e.forEach((function(e){vueapp.add_message(e)})):"object"==typeof e&&vueapp.add_message(e)}function system_message(e){vueapp.internal_message(e)}function push_Topic(e){window.location="?_src_=chat&proc="+e}function push_Topic_showingnum(e){window.location="?_src_=chat&showingnum="+e}function focusMapWindow(){window.location="byond://winset?mapwindow.map.focus=true"}function send_debug(e){push_Topic("debug¶m[message]="+encodeURIComponent(e))}function get_event(e){if(vchat_state.ready){var t;switch((t=byondDecode(e)).evttype){case"internal_error":system_message("Event parse error: "+e);break;case"byond_player":send_client_data(),vueapp.is_admin="true"===t.admin,vchat_state.byond_ip=t.address,vchat_state.byond_cid=t.cid,vchat_state.byond_ckey=t.ckey,set_storage("ip",vchat_state.byond_ip),set_storage("cid",vchat_state.byond_cid),set_storage("ckey",vchat_state.byond_ckey);break;case"keepalive":vchat_state.lastPingReceived=Date.now(),vueapp.reconnecting=!1;break;case"pong":get_latency_check();break;case"availability":push_Topic("done_loading");break;default:system_message("Didn't know what to do with event: "+e)}}else push_Topic("not_ready")}function send_client_data(){let e={ip:get_storage("ip"),cid:get_storage("cid"),ckey:get_storage("ckey")};push_Topic("ident¶m[clientdata]="+JSON.stringify(e))}function set_localstorage(e,t){window.localStorage.setItem(vchat_opts.cookiePrefix+e,t)}function get_localstorage(e,t){let s=window.localStorage.getItem(vchat_opts.cookiePrefix+e);return"null"===s||null===s?s=t:"true"===s?s=!0:"false"===s?s=!1:isNaN(s)||(s=+s),s}function set_cookie(e,t){let s=new Date;s.setFullYear(s.getFullYear()+1);let a=s.toUTCString();document.cookie=vchat_opts.cookiePrefix+e+"="+t+";expires="+a+";path=/"}function get_cookie(e,t){let s=document.cookie.split(";"),a={};s.forEach((function(e){let s=e.replace(vchat_opts.cookiePrefix,"").trim(),n=s.search("="),o=decodeURIComponent(s.substring(0,n)),i=decodeURIComponent(s.substring(n+1));"null"==i||null===i?i=t:"true"===i?i=!0:"false"===i?i=!1:isNaN(i)||(i=+i),a[o]=i})),a[e]}var SKIN_BUTTONS=["rpane.textb","rpane.infob","rpane.wikib","rpane.forumb","rpane.rulesb","rpane.github","rpane.discord","rpane.mapb","rpane.changelog","mainwindow.saybutton","mainwindow.mebutton","mainwindow.hotkey_toggle"],SKIN_ELEMENTS=["mainwindow","mainwindow.mainvsplit","mainwindow.tooltip","rpane","rpane.rpanewindow","rpane.mediapanel"];function switch_ui_mode(e){doWinset(SKIN_BUTTONS.reduce((function(t,s){return t[s+".background-color"]=e.buttonBgColor,t}),{})),doWinset(SKIN_BUTTONS.reduce((function(t,s){return t[s+".text-color"]=e.buttonTextColor,t}),{})),doWinset(SKIN_ELEMENTS.reduce((function(t,s){return t[s+".background-color"]=e.windowBgColor,t}),{})),doWinset("infowindow",{"background-color":e.tabBackgroundColor,"text-color":e.tabTextColor}),doWinset("infowindow.info",{"background-color":e.tabBackgroundColor,"text-color":e.tabTextColor,"highlight-color":e.highlightColor,"tab-text-color":e.tabTextColor,"tab-background-color":e.tabBackgroundColor})}function doWinset(e,t){void 0===t&&(t=e,e=null);var s="byond://winset?";e&&(s+="id="+e+"&"),s+=Object.keys(t).map((function(e){return e+"="+encodeURIComponent(t[e])})).join("&"),window.location=s} \ No newline at end of file +!function(){var e=console.log;console.log=function(t){send_debug(t),e.apply(console,arguments)};var t=console.error;console.error=function(e){send_debug(e),t.apply(console,arguments)},window.onerror=function(e,t,s,a,n){var o="";return n&&n.stack&&(o=n.stack),send_debug(e+" ("+t+"@"+s+":"+a+") "+n+"|UA: "+navigator.userAgent+"|Stack: "+o),!0}}();var vchat_opts={msBeforeDropped:3e4,cookiePrefix:"vst-",alwaysShow:["vc_looc","vc_system"],vchatTabsVer:1},DARKMODE_COLORS={buttonBgColor:"#40628a",buttonTextColor:"#FFFFFF",windowBgColor:"#272727",highlightColor:"#009900",tabTextColor:"#FFFFFF",tabBackgroundColor:"#272727"},LIGHTMODE_COLORS={buttonBgColor:"none",buttonTextColor:"#000000",windowBgColor:"none",highlightColor:"#007700",tabTextColor:"#000000",tabBackgroundColor:"none"},set_storage=set_cookie,get_storage=get_cookie,domparser=new DOMParser;storageAvailable("localStorage")&&(set_storage=set_localstorage,get_storage=get_localstorage);var vueapp,vchat_state={ready:!1,byond_ip:null,byond_cid:null,byond_ckey:null,lastPingReceived:0,latency_sent:0,lastId:0};function start_vchat(){start_vue(),vchat_state.ready=!0,push_Topic("done_loading"),push_Topic_showingnum(this.showingnum),doWinset("htmloutput",{"is-visible":!0}),doWinset("oldoutput",{"is-visible":!1}),doWinset("chatloadlabel",{"is-visible":!1}),setInterval(check_ping,vchat_opts.msBeforeDropped),send_debug("VChat Loaded!")}function start_vue(){vueapp=new Vue({el:"#app",data:{messages:[],shown_messages:[],unshown_messages:0,archived_messages:[],tabs:[{name:"Main",categories:[],immutable:!0,active:!0}],unread_messages:{},editing:!1,paused:!1,latency:0,reconnecting:!1,ext_styles:"",is_admin:!1,inverted:!1,crushing:3,animated:!1,fontsize:.9,lineheight:130,showingnum:200,type_table:[{matches:".filter_say, .say, .emote, .emote_subtle",becomes:"vc_localchat",pretty:"Local Chat",tooltip:"In-character local messages (say, emote, etc)",required:!1,admin:!1},{matches:".filter_radio, .alert, .syndradio, .centradio, .airadio, .entradio, .comradio, .secradio, .engradio, .medradio, .sciradio, .supradio, .srvradio, .expradio, .radio, .deptradio, .newscaster",becomes:"vc_radio",pretty:"Radio Comms",tooltip:"All departments of radio messages",required:!1,admin:!1},{matches:".filter_notice, .notice:not(.pm), .adminnotice, .info, .sinister, .cult",becomes:"vc_info",pretty:"Notices",tooltip:"Non-urgent messages from the game and items",required:!1,admin:!1},{matches:".filter_warning, .warning:not(.pm), .critical, .userdanger, .italics",becomes:"vc_warnings",pretty:"Warnings",tooltip:"Urgent messages from the game and items",required:!1,admin:!1},{matches:".filter_deadsay, .deadsay",becomes:"vc_deadchat",pretty:"Deadchat",tooltip:"All of deadchat",required:!1,admin:!1},{matches:".ooc, .filter_ooc",becomes:"vc_globalooc",pretty:"Global OOC",tooltip:"The bluewall of global OOC messages",required:!1,admin:!1},{matches:".nif",becomes:"vc_nif",pretty:"NIF Messages",tooltip:"Messages from the NIF itself and people inside",required:!1,admin:!1},{matches:".mentor_channel, .mentor",becomes:"vc_mentor",pretty:"Mentor messages",tooltip:"Mentorchat and mentor pms",required:!1,admin:!1},{matches:".filter_pm, .pm",becomes:"vc_adminpm",pretty:"Admin PMs",tooltip:"Messages to/from admins ('adminhelps')",required:!1,admin:!1},{matches:".filter_ASAY, .admin_channel",becomes:"vc_adminchat",pretty:"Admin Chat",tooltip:"ASAY messages",required:!1,admin:!0},{matches:".filter_MSAY, .mod_channel",becomes:"vc_modchat",pretty:"Mod Chat",tooltip:"MSAY messages",required:!1,admin:!0},{matches:".filter_ESAY, .event_channel",becomes:"vc_eventchat",pretty:"Event Chat",tooltip:"ESAY messages",required:!1,admin:!0},{matches:".filter_combat, .danger",becomes:"vc_combat",pretty:"Combat Logs",tooltip:"Urist McTraitor has stabbed you with a knife!",required:!1,admin:!1},{matches:".filter_adminlogs, .log_message",becomes:"vc_adminlogs",pretty:"Admin Logs",tooltip:"ADMIN LOG: Urist McAdmin has jumped to coordinates X, Y, Z",required:!1,admin:!0},{matches:".filter_attacklogs",becomes:"vc_attacklogs",pretty:"Attack Logs",tooltip:"Urist McTraitor has shot John Doe",required:!1,admin:!0},{matches:".filter_debuglogs",becomes:"vc_debuglogs",pretty:"Debug Logs",tooltip:"DEBUG: SSPlanets subsystem Recover().",required:!1,admin:!0},{matches:".looc",becomes:"vc_looc",pretty:"Local OOC",tooltip:"Local OOC messages, always enabled",required:!0},{matches:".rlooc",becomes:"vc_rlooc",pretty:"Remote LOOC",tooltip:"Remote LOOC messages",required:!1,admin:!0},{matches:".boldannounce, .filter_system",becomes:"vc_system",pretty:"System Messages",tooltip:"Messages from your client, always enabled",required:!0},{matches:".unsorted",becomes:"vc_unsorted",pretty:"Unsorted",tooltip:"Messages that don't have any filters.",required:!1,admin:!1}]},mounted:function(){this.load_settings();var e=new XMLHttpRequest;e.open("GET","ss13styles.css"),e.onreadystatechange=function(){this.ext_styles=e.responseText}.bind(this),e.send()},updated:function(){this.editing||this.paused||window.scrollTo(0,document.getElementById("messagebox").scrollHeight)},watch:{reconnecting:function(e,t){1==e&&0==t?this.internal_message("Your client has lost connection to the server, or there is severe lag. Your client will reconnect if possible."):0==e&&1==t&&this.internal_message("Your client has reconnected to the server.")},inverted:function(e){set_storage("darkmode",e),e?(document.body.classList.add("inverted"),switch_ui_mode(DARKMODE_COLORS)):(document.body.classList.remove("inverted"),switch_ui_mode(LIGHTMODE_COLORS))},crushing:function(e){set_storage("crushing",e)},animated:function(e){set_storage("animated",e)},fontsize:function(e,t){isNaN(e)?this.fontsize=t:(e<.2?this.fontsize=.2:e>5&&(this.fontsize=5),set_storage("fontsize",e))},lineheight:function(e,t){isFinite(e)?(e<100?this.lineheight=100:e>200&&(this.lineheight=200),set_storage("lineheight",e)):this.lineheight=t},showingnum:function(e,t){isFinite(e)?((e=Math.floor(e))<50?this.showingnum=50:e>2e3&&(this.showingnum=2e3),set_storage("showingnum",this.showingnum),push_Topic_showingnum(this.showingnum),this.attempt_archive()):this.showingnum=t},current_categories:function(e,t){e.length&&this.apply_filter(e)}},computed:{active_tab:function(){return this.tabs.find((function(e){return e.active}))},ping_classes:function(){return this.latency?"?"==this.latency?"grey":this.latency<0?"red":this.latency<=200?"green":this.latency<=400?"yellow":"grey":this.reconnecting?"red":"green"},current_categories:function(){return this.active_tab==this.tabs[0]?[]:this.active_tab.categories.concat(vchat_opts.alwaysShow)}},methods:{load_settings:function(){this.inverted=get_storage("darkmode",!1),this.crushing=get_storage("crushing",3),this.animated=get_storage("animated",!1),this.fontsize=get_storage("fontsize",.9),this.lineheight=get_storage("lineheight",130),this.showingnum=get_storage("showingnum",200),isNaN(this.crushing)&&(this.crushing=3),isNaN(this.fontsize)&&(this.fontsize=.9),this.load_tabs()},load_tabs:function(){var e=get_storage("tabs");if(e){var t=JSON.parse(e);t.version&&t.tabs?!t.version!=vchat_opts.vchatTabsVer?this.tabs.push.apply(this.tabs,t.tabs):this.internal_message("Your saved tabs are for an older version of VChat and must be recreated, sorry."):this.internal_message("There was a problem loading your tabs. Any new ones you make will be saved, however.")}},save_tabs:function(){var e={version:vchat_opts.vchatTabsVer,tabs:[]};this.tabs.forEach((function(t){if(!t.immutable){var s=t.name,a=[];t.categories.forEach((function(e){a.push(e)}));var n={name:s,categories:a,immutable:!1,active:!1};e.tabs.push(n)}}));var t=JSON.stringify(e);set_storage("tabs",t)},switchtab:function(e){e!=this.active_tab&&(this.active_tab.active=!1,e.active=!0,e.categories.forEach((function(e){this.unread_messages[e]=0}),this),this.apply_filter(this.current_categories))},editmode:function(){this.editing=!this.editing,this.save_tabs()},pause:function(){this.paused=!this.paused},newtab:function(){this.tabs.push({name:"New Tab",categories:[],immutable:!1,active:!1}),this.switchtab(this.tabs[this.tabs.length-1])},renametab:function(){if(!this.active_tab.immutable){var e=this.active_tab,t=window.prompt("Type the desired tab name:",e.name);null!==t&&""!==t&&null!==e&&(e.name=t)}},deltab:function(e){e||(e=this.active_tab),e.immutable||(this.switchtab(this.tabs[0]),this.tabs.splice(this.tabs.indexOf(e),1))},movetab:function(e,t){if(e&&!e.immutable){var s=this.tabs.indexOf(e),a=s+t;this.tabs.splice(a,0,this.tabs.splice(s,1)[0])}},tab_unread_count:function(e){var t=0,s=this.unread_messages;return e.categories.find((function(e){s[e]&&(t+=s[e])})),t},tab_unread_categories:function(e){var t=!1,s=this.unread_messages;return e.categories.find((function(e){if(s[e])return t=!0,!0})),{red:t,grey:!t}},attempt_archive:function(){if(this.messages.length>this.showingnum){var e=this.messages.splice(0,20);Array.prototype.push.apply(this.archived_messages,e)}},apply_filter:function(e){this.shown_messages.splice(0),this.unshown_messages=0,this.messages.forEach((function(t){e.indexOf(t.category)>-1&&this.shown_messages.push(t)}),this),this.archived_messages.forEach((function(t){e.indexOf(t.category)>-1&&this.unshown_messages++}),this)},add_message:function(e){let t={time:e.time,category:"error",content:e.message,repeats:1};if(t.category=this.get_category(t.content),"vc_unsorted"==t.category&&(t.content=""+t.content+""),this.crushing){let e=this.messages.slice(-this.crushing);for(let s=e.length-1;s>=0;s--){let a=e[s];a.content==t.content&&(t.repeats+=a.repeats,this.messages.splice(this.messages.indexOf(a),1))}}t.content=t.content.replace(/(\b(https?):\/\/[\-A-Z0-9+&@#\/%?=~_|!:,.;]*[\-A-Z0-9+&@#\/%=~_|])/gim,'$1'),this.current_categories.length&&this.current_categories.indexOf(t.category)<0?(isNaN(this.unread_messages[t.category])&&(this.unread_messages[t.category]=0),this.unread_messages[t.category]+=1):this.current_categories.length&&this.shown_messages.push(t),t.id=++vchat_state.lastId,this.attempt_archive(),this.messages.push(t)},internal_message:function(e){let t={time:this.messages.length?this.messages.slice(-1).time+1:0,category:"vc_system",content:"[VChat Internal] "+e+""};t.id=++vchat_state.lastId,this.messages.push(t)},on_mouseup:function(e){let t=e.target;"getSelection"in window&&!1===window.getSelection().isCollapsed||t&&("INPUT"===t.tagName||"TEXTAREA"===t.tagName)||(focusMapWindow(),e.preventDefault(),e.target.click())},click_message:function(e){let t=e.target;if("A"===t.tagName){e.stopPropagation(),e.preventDefault?e.preventDefault():e.returnValue=!1;var s=t.getAttribute("href");"?"==s[0]||s.length>=8&&"byond://"==s.substring(0,8)?window.location=s:window.location="byond://?action=openLink&link="+encodeURIComponent(s)}},get_category:function(e){if(!vchat_state.ready)return void push_Topic("not_ready");let t=domparser.parseFromString(e,"text/html").querySelector("span"),s="vc_unsorted";return t?(this.type_table.find((function(e){if(t.msMatchesSelector(e.matches))return s=e.becomes,!0})),s):s},save_chatlog:function(){var e="",t=this.archived_messages.concat(this.messages),s=this.current_categories;t.forEach((function(t){(0==s.length||s.indexOf(t.category)>=0)&&(e+=t.content,t.repeats>1&&(e+="(x"+t.repeats+")"),e+="
\n")})),e+="";var a=new Date,n=String(a.getHours());n.length<2&&(n="0"+n);var o=String(a.getMinutes());o.length<2&&(o="0"+o);var i=String(a.getDate());i.length<2&&(i="0"+i);var r=String(a.getMonth()+1);r.length<2&&(r="0"+r);var c="log"+(" "+String(a.getFullYear())+"-"+r+"-"+i+" ("+n+" "+o+")")+".html",l=document.createElement("a");if(void 0!==l.download)l.href="data:attachment/text,"+encodeURI(e),l.target="_blank",l.download=c,l.click();else{var h=new Blob([e],{type:"text/html;charset=utf8;"});saved=window.navigator.msSaveOrOpenBlob(h,c)}},do_latency_test:function(){send_latency_check()},blur_this:function(e){e.target.blur()}}})}function check_ping(){Date.now()-vchat_state.lastPingReceived>vchat_opts.msBeforeDropped&&(vueapp.reconnecting=!0)}function send_latency_check(){vchat_state.latency_sent||(vchat_state.latency_sent=Date.now(),vueapp.latency="?",push_Topic("ping"),setTimeout((function(){"?"==vchat_state.latency_ms&&(vchat_state.latency_ms=999)}),1e3),setTimeout((function(){vchat_state.latency_sent=0,vueapp.latency=0}),5e3))}function get_latency_check(){vchat_state.latency_sent&&(vueapp.latency=Date.now()-vchat_state.latency_sent)}function byondDecode(e){e=e.replace(/\+/g,"%20");try{e=decodeURIComponent(e)}catch(t){e=unescape(e)}return JSON.parse(e)}function putmessage(e){e=byondDecode(e),Array.isArray(e)?e.forEach((function(e){vueapp.add_message(e)})):"object"==typeof e&&vueapp.add_message(e)}function system_message(e){vueapp.internal_message(e)}function push_Topic(e){window.location="?_src_=chat&proc="+e}function push_Topic_showingnum(e){window.location="?_src_=chat&showingnum="+e}function focusMapWindow(){window.location="byond://winset?mapwindow.map.focus=true"}function send_debug(e){push_Topic("debug¶m[message]="+encodeURIComponent(e))}function get_event(e){if(vchat_state.ready){var t;switch((t=byondDecode(e)).evttype){case"internal_error":system_message("Event parse error: "+e);break;case"byond_player":send_client_data(),vueapp.is_admin="true"===t.admin,vchat_state.byond_ip=t.address,vchat_state.byond_cid=t.cid,vchat_state.byond_ckey=t.ckey,set_storage("ip",vchat_state.byond_ip),set_storage("cid",vchat_state.byond_cid),set_storage("ckey",vchat_state.byond_ckey);break;case"keepalive":vchat_state.lastPingReceived=Date.now(),vueapp.reconnecting=!1;break;case"pong":get_latency_check();break;case"availability":push_Topic("done_loading");break;default:system_message("Didn't know what to do with event: "+e)}}else push_Topic("not_ready")}function send_client_data(){let e={ip:get_storage("ip"),cid:get_storage("cid"),ckey:get_storage("ckey")};push_Topic("ident¶m[clientdata]="+JSON.stringify(e))}function set_localstorage(e,t){window.localStorage.setItem(vchat_opts.cookiePrefix+e,t)}function get_localstorage(e,t){let s=window.localStorage.getItem(vchat_opts.cookiePrefix+e);return"null"===s||null===s?s=t:"true"===s?s=!0:"false"===s?s=!1:isNaN(s)||(s=+s),s}function set_cookie(e,t){let s=new Date;s.setFullYear(s.getFullYear()+1);let a=s.toUTCString();document.cookie=vchat_opts.cookiePrefix+e+"="+t+";expires="+a+";path=/"}function get_cookie(e,t){let s=document.cookie.split(";"),a={};s.forEach((function(e){let s=e.replace(vchat_opts.cookiePrefix,"").trim(),n=s.search("="),o=decodeURIComponent(s.substring(0,n)),i=decodeURIComponent(s.substring(n+1));"null"==i||null===i?i=t:"true"===i?i=!0:"false"===i?i=!1:isNaN(i)||(i=+i),a[o]=i})),a[e]}var SKIN_BUTTONS=["rpane.textb","rpane.infob","rpane.wikib","rpane.forumb","rpane.rulesb","rpane.github","rpane.discord","rpane.mapb","rpane.changelog","mainwindow.saybutton","mainwindow.mebutton","mainwindow.hotkey_toggle"],SKIN_ELEMENTS=["mainwindow","mainwindow.mainvsplit","mainwindow.tooltip","rpane","rpane.rpanewindow","rpane.mediapanel"];function switch_ui_mode(e){doWinset(SKIN_BUTTONS.reduce((function(t,s){return t[s+".background-color"]=e.buttonBgColor,t}),{})),doWinset(SKIN_BUTTONS.reduce((function(t,s){return t[s+".text-color"]=e.buttonTextColor,t}),{})),doWinset(SKIN_ELEMENTS.reduce((function(t,s){return t[s+".background-color"]=e.windowBgColor,t}),{})),doWinset("infowindow",{"background-color":e.tabBackgroundColor,"text-color":e.tabTextColor}),doWinset("infowindow.info",{"background-color":e.tabBackgroundColor,"text-color":e.tabTextColor,"highlight-color":e.highlightColor,"tab-text-color":e.tabTextColor,"tab-background-color":e.tabBackgroundColor})}function doWinset(e,t){void 0===t&&(t=e,e=null);var s="byond://winset?";e&&(s+="id="+e+"&"),s+=Object.keys(t).map((function(e){return e+"="+encodeURIComponent(t[e])})).join("&"),window.location=s} diff --git a/code/modules/vore/eating/belly_obj_vr.dm b/code/modules/vore/eating/belly_obj_vr.dm index 9660d97691..9f58927a78 100644 --- a/code/modules/vore/eating/belly_obj_vr.dm +++ b/code/modules/vore/eating/belly_obj_vr.dm @@ -31,6 +31,7 @@ var/digestchance = 0 // % Chance of stomach beginning to digest if prey struggles var/absorbchance = 0 // % Chance of stomach beginning to absorb if prey struggles var/escapechance = 0 // % Chance of prey beginning to escape if prey struggles. + var/escape_stun = 0 // AI controlled mobs with a number here will be weakened by the provided var when someone escapes, to prevent endless nom loops var/transferchance = 0 // % Chance of prey being trasnsfered, goes from 0-100% var/transferchance_secondary = 0 // % Chance of prey being transfered to transferchance_secondary, also goes 0-100% var/save_digest_mode = TRUE // Whether this belly's digest mode persists across rounds @@ -536,6 +537,9 @@ var/mob/ourmob = M ourmob.reset_view(null) + if(!owner.ckey && escape_stun) + owner.Weaken(escape_stun) + return 1 // Actually perform the mechanics of devouring the tasty prey. diff --git a/code/modules/vore/resizing/resize_vr.dm b/code/modules/vore/resizing/resize_vr.dm index d8fd0d8203..7ca4cdae6c 100644 --- a/code/modules/vore/resizing/resize_vr.dm +++ b/code/modules/vore/resizing/resize_vr.dm @@ -171,7 +171,7 @@ * Attempt to scoop up this mob up into H's hands, if the size difference is large enough. * @return false if normal code should continue, 1 to prevent normal code. */ -/mob/living/proc/attempt_to_scoop(mob/living/M, mob/living/G) //second one is for the Grabber, only exists for animals to self-grab +/mob/living/proc/attempt_to_scoop(mob/living/M, mob/living/G, ignore_size = FALSE) //second one is for the Grabber, only exists for animals to self-grab if(!(pickup_pref && M.pickup_pref && M.pickup_active)) return 0 if(!(M.a_intent == I_HELP)) @@ -185,7 +185,7 @@ var/mob/living/simple_mob/SA = M if(!SA.has_hands) return 0 - if(size_diff >= 0.50 || mob_size < MOB_SMALL || size_diff >= get_effective_size()) + if(size_diff >= 0.50 || mob_size < MOB_SMALL || size_diff >= get_effective_size() || ignore_size) if(buckled) to_chat(usr,"You have to unbuckle \the [src] before you pick them up.") return 0 diff --git a/code/stylesheet.dm b/code/stylesheet.dm index 0031006404..faa0e3e99f 100644 --- a/code/stylesheet.dm +++ b/code/stylesheet.dm @@ -15,8 +15,9 @@ em {font-style: normal;font-weight: bold;} .log_message {color: #386AFF; font-weight: bold;} /* OOC */ -.ooc {font-weight: bold;} -.looc {color: #3A9696;} +.ooc {font-weight: bold;} +.looc {color: #3A9696; font-weight: bold} +.rlooc {color: #3ABB96; font-weight: bold} .ooc img.text_tag {width: 32px; height: 10px;} .ooc .everyone {color: #002eb8;} diff --git a/icons/inventory/hands/item.dmi b/icons/inventory/hands/item.dmi index 05dbda93cf..5ee9a81b13 100644 Binary files a/icons/inventory/hands/item.dmi and b/icons/inventory/hands/item.dmi differ diff --git a/icons/inventory/hands/mob.dmi b/icons/inventory/hands/mob.dmi index eac6c88a5f..4631d2650b 100644 Binary files a/icons/inventory/hands/mob.dmi and b/icons/inventory/hands/mob.dmi differ diff --git a/icons/misc/title_vr.dmi b/icons/misc/title_vr.dmi index bbd2e4afe5..f3727a5ca4 100644 Binary files a/icons/misc/title_vr.dmi and b/icons/misc/title_vr.dmi differ diff --git a/icons/mob/alienanimals_x64.dmi b/icons/mob/alienanimals_x64.dmi index 03e8f63dcb..b4cd461dae 100644 Binary files a/icons/mob/alienanimals_x64.dmi and b/icons/mob/alienanimals_x64.dmi differ diff --git a/icons/mob/human.dmi b/icons/mob/human.dmi index 8d0a1f5e2e..1c3ad0e96c 100644 Binary files a/icons/mob/human.dmi and b/icons/mob/human.dmi differ diff --git a/icons/mob/items/lefthand_melee_vr.dmi b/icons/mob/items/lefthand_melee_vr.dmi index ac33a12ad5..2cc11d8ed8 100644 Binary files a/icons/mob/items/lefthand_melee_vr.dmi and b/icons/mob/items/lefthand_melee_vr.dmi differ diff --git a/icons/mob/items/righthand_melee_vr.dmi b/icons/mob/items/righthand_melee_vr.dmi index ea3b23c817..29134f5dcb 100644 Binary files a/icons/mob/items/righthand_melee_vr.dmi and b/icons/mob/items/righthand_melee_vr.dmi differ diff --git a/icons/mob/pai_vr64x32.dmi b/icons/mob/pai_vr64x32.dmi index 8feafd80ab..468e5cd216 100644 Binary files a/icons/mob/pai_vr64x32.dmi and b/icons/mob/pai_vr64x32.dmi differ diff --git a/icons/mob/pai_vr64x64.dmi b/icons/mob/pai_vr64x64.dmi index ec0c95934d..53840e0ec6 100644 Binary files a/icons/mob/pai_vr64x64.dmi and b/icons/mob/pai_vr64x64.dmi differ diff --git a/icons/obj/flesh_machines.dmi b/icons/obj/flesh_machines.dmi new file mode 100644 index 0000000000..92c19b6a21 Binary files /dev/null and b/icons/obj/flesh_machines.dmi differ diff --git a/icons/obj/flora/rocks.dmi b/icons/obj/flora/rocks.dmi index 4713360313..1b5e67e3f7 100644 Binary files a/icons/obj/flora/rocks.dmi and b/icons/obj/flora/rocks.dmi differ diff --git a/icons/obj/fur_tree.dmi b/icons/obj/fur_tree.dmi new file mode 100644 index 0000000000..5f6546a5f3 Binary files /dev/null and b/icons/obj/fur_tree.dmi differ diff --git a/icons/obj/landmark_vr.dmi b/icons/obj/landmark_vr.dmi index 709bcfcfde..ab0f5da5d9 100644 Binary files a/icons/obj/landmark_vr.dmi and b/icons/obj/landmark_vr.dmi differ diff --git a/icons/obj/weapons_vr.dmi b/icons/obj/weapons_vr.dmi index 7a1b9844d1..591c65ab09 100644 Binary files a/icons/obj/weapons_vr.dmi and b/icons/obj/weapons_vr.dmi differ diff --git a/icons/turf/areas_vr.dmi b/icons/turf/areas_vr.dmi index 75748b0731..807d7c195d 100644 Binary files a/icons/turf/areas_vr.dmi and b/icons/turf/areas_vr.dmi differ diff --git a/icons/turf/fur.dmi b/icons/turf/fur.dmi new file mode 100644 index 0000000000..abb35c6349 Binary files /dev/null and b/icons/turf/fur.dmi differ diff --git a/icons/turf/stomach_vr.dmi b/icons/turf/stomach_vr.dmi index 69c8ddd6f6..4916051159 100644 Binary files a/icons/turf/stomach_vr.dmi and b/icons/turf/stomach_vr.dmi differ diff --git a/interface/skin.dmf b/interface/skin.dmf index 8af2d728d2..ee01d95107 100644 --- a/interface/skin.dmf +++ b/interface/skin.dmf @@ -1,5 +1,5 @@ macro "borghotkeymode" - elem + elem name = "TAB" command = ".winset \"mainwindow.macro=borgmacro hotkey_toggle.is-checked=false input.focus=true input.background-color=#D3B5B5\"" elem @@ -20,58 +20,58 @@ macro "borghotkeymode" elem name = "Alt+UP" command = "KeyUp Alt" - elem + elem name = "NORTHEAST" command = ".northeast" - elem + elem name = "SOUTHEAST" command = ".southeast" - elem + elem name = "SOUTHWEST" command = ".southwest" - elem + elem name = "NORTHWEST" command = ".northwest" - elem + elem name = "ALT+WEST" command = "westfaceperm" - elem + elem name = "CTRL+WEST" command = "westface" - elem + elem name = "West" command = "KeyDown West" elem name = "West+UP" command = "KeyUp West" - elem + elem name = "ALT+NORTH" command = "northfaceperm" - elem + elem name = "CTRL+NORTH" command = "northface" - elem + elem name = "North" command = "KeyDown North" elem name = "North+UP" command = "KeyUp North" - elem + elem name = "ALT+EAST" command = "eastfaceperm" - elem + elem name = "CTRL+EAST" command = "eastface" - elem + elem name = "East" command = "KeyDown East" elem name = "East+UP" command = "KeyUp East" - elem + elem name = "ALT+SOUTH" command = "southfaceperm" - elem + elem name = "CTRL+SOUTH" command = "southface" elem @@ -83,91 +83,91 @@ macro "borghotkeymode" elem name = "CTRL+SHIFT+NORTH" command = "shiftnorth" - elem + elem name = "CTRL+SHIFT+SOUTH" command = "shiftsouth" - elem + elem name = "CTRL+SHIFT+WEST" command = "shiftwest" - elem + elem name = "CTRL+SHIFT+EAST" command = "shifteast" - elem + elem name = "INSERT" command = "a-intent right" - elem + elem name = "DELETE" command = "delete-key-pressed" - elem + elem name = "1" command = "toggle-module 1" - elem + elem name = "CTRL+1" command = "toggle-module 1" - elem + elem name = "2" command = "toggle-module 2" - elem + elem name = "CTRL+2" command = "toggle-module 2" - elem + elem name = "3" command = "toggle-module 3" - elem + elem name = "CTRL+3" command = "toggle-module 3" - elem + elem name = "4" command = "a-intent left" - elem + elem name = "CTRL+4" command = "a-intent left" - elem + elem name = "5" command = ".me" - elem + elem name = "6" command = ".Subtle" - elem + elem name = "A" command = "KeyDown A" elem name = "A+UP" command = "KeyUp A" - elem + elem name = "D" command = "KeyDown D" elem name = "D+UP" command = "KeyUp D" - elem + elem name = "F" command = "a-intent left" - elem + elem name = "CTRL+F" command = "a-intent left" - elem + elem name = "G" command = "a-intent right" - elem + elem name = "CTRL+G" command = "a-intent right" - elem + elem name = "J" command = "toggle-gun-mode" - elem + elem name = "CTRL+J" command = "toggle-gun-mode" - elem + elem name = "Q" command = "unequip-module" - elem + elem name = "CTRL+Q" command = "unequip-module" - elem + elem name = "R" command = ".southwest" - elem + elem name = "CTRL+R" command = ".southwest" elem "s_key" @@ -176,7 +176,7 @@ macro "borghotkeymode" elem name = "S+UP" command = "KeyUp S" - elem + elem name = "T" command = ".say" elem "w_key" @@ -185,90 +185,96 @@ macro "borghotkeymode" elem name = "W+UP" command = "KeyUp W" - elem + elem name = "X" command = ".northeast" - elem + elem name = "CTRL+X" command = ".northeast" - elem + elem name = "Y" command = ".Whisper" - elem + elem name = "CTRL+Y" command = ".Whisper" - elem + elem name = "Z" command = "Activate-Held-Object" - elem + elem name = "CTRL+Z" command = "Activate-Held-Object" - elem + elem name = "U" command = "Rest" - elem + elem name = "NUMPAD1" command = "body-r-leg" - elem + elem name = "NUMPAD2" command = "body-groin" - elem + elem name = "NUMPAD3" command = "body-l-leg" - elem + elem name = "NUMPAD4" command = "body-r-arm" - elem + elem name = "NUMPAD5" command = "body-chest" - elem + elem name = "NUMPAD6" command = "body-l-arm" - elem + elem name = "NUMPAD8" command = "body-toggle-head" - elem + elem name = "F1" command = "request-help" - elem + elem name = "CTRL+SHIFT+F1+REP" command = ".options" - elem + elem name = "F2" command = "ooc" - elem + elem name = "F2+REP" command = ".screenshot auto" - elem + elem name = "SHIFT+F2+REP" command = ".screenshot" - elem + elem name = "F3" command = ".say" - elem + elem name = "F4" command = ".me" - elem + elem name = "F5" command = "asay" - elem + elem name = "F6" command = "Player-Panel-New" - elem + elem name = "F7" command = "Admin-PM" - elem + elem name = "F8" command = "Invisimin" - elem + elem name = "F12" command = "F12" + elem + name = "CTRL+SHIFT+ADD" + command = "planeup" + elem + name = "CTRL+SHIFT+SUBTRACT" + command = "planedown" macro "macro" - elem + elem name = "TAB" command = ".winset \"mainwindow.macro=hotkeymode hotkey_toggle.is-checked=true mapwindow.map.focus=true\"" - elem + elem name = "Shift" command = "KeyDown Shift" elem @@ -286,58 +292,58 @@ macro "macro" elem name = "Alt+UP" command = "KeyUp Alt" - elem + elem name = "NORTHEAST" command = ".northeast" - elem + elem name = "SOUTHEAST" command = ".southeast" - elem + elem name = "SOUTHWEST" command = ".southwest" - elem + elem name = "NORTHWEST" command = ".northwest" - elem + elem name = "ALT+WEST" command = "westfaceperm" - elem + elem name = "CTRL+WEST" command = "westface" - elem + elem name = "West" command = "KeyDown West" elem name = "West+UP" command = "KeyUp West" - elem + elem name = "ALT+NORTH" command = "northfaceperm" - elem + elem name = "CTRL+NORTH" command = "northface" - elem + elem name = "North" command = "KeyDown North" elem name = "North+UP" command = "KeyUp North" - elem + elem name = "ALT+EAST" command = "eastfaceperm" - elem + elem name = "CTRL+EAST" command = "eastface" - elem + elem name = "East" command = "KeyDown East" elem name = "East+UP" command = "KeyUp East" - elem + elem name = "ALT+SOUTH" command = "southfaceperm" - elem + elem name = "CTRL+SOUTH" command = "southface" elem @@ -349,150 +355,156 @@ macro "macro" elem name = "CTRL+SHIFT+NORTH" command = "shiftnorth" - elem + elem name = "CTRL+SHIFT+SOUTH" command = "shiftsouth" - elem + elem name = "CTRL+SHIFT+WEST" command = "shiftwest" - elem + elem name = "CTRL+SHIFT+EAST" command = "shifteast" - elem + elem name = "INSERT" command = "a-intent right" - elem + elem name = "DELETE" command = "delete-key-pressed" - elem + elem name = "CTRL+1" command = "a-intent help" - elem + elem name = "CTRL+2" command = "a-intent disarm" - elem + elem name = "CTRL+3" command = "a-intent grab" - elem + elem name = "CTRL+4" command = "a-intent harm" - elem + elem name = "CTRL+A" command = "KeyDown A" elem name = "CTRL+A+UP" command = "KeyUp A" - elem + elem name = "CTRL+D" command = "KeyDown D" elem name = "CTRL+D+UP" command = "KeyUp D" - elem + elem name = "CTRL+E" command = "quick-equip" - elem + elem name = "CTRL+F" command = "a-intent left" - elem + elem name = "CTRL+G" command = "a-intent right" - elem + elem name = "CTRL+Q" command = ".northwest" - elem + elem name = "CTRL+R" command = ".southwest" - elem + elem name = "CTRL+S" command = "KeyDown S" elem name = "CTRL+S+UP" command = "KeyUp S" - elem + elem name = "CTRL+W" command = "KeyDown W" elem name = "CTRL+W+UP" command = "KeyUp W" - elem + elem name = "CTRL+X" command = ".northeast" - elem + elem name = "CTRL+Y" command = "Activate-Held-Object" - elem + elem name = "CTRL+Z" command = "Activate-Held-Object" - elem + elem name = "CTRL+U" command = "Rest" - elem + elem name = "CTRL+B" command = "Resist" - elem + elem name = "CTRL+NUMPAD1" command = "body-r-leg" - elem + elem name = "CTRL+NUMPAD2" command = "body-groin" - elem + elem name = "CTRL+NUMPAD3" command = "body-l-leg" - elem + elem name = "CTRL+NUMPAD4" command = "body-r-arm" - elem + elem name = "CTRL+NUMPAD5" command = "body-chest" - elem + elem name = "CTRL+NUMPAD6" command = "body-l-arm" - elem + elem name = "CTRL+NUMPAD8" command = "body-toggle-head" - elem + elem name = "F1" command = "request-help" - elem + elem name = "CTRL+SHIFT+F1+REP" command = ".options" - elem + elem name = "F2" command = "ooc" - elem + elem name = "F2+REP" command = ".screenshot auto" - elem + elem name = "SHIFT+F2+REP" command = ".screenshot" - elem + elem name = "F3" command = ".say" - elem + elem name = "F4" command = ".me" - elem + elem name = "F5" command = "asay" - elem + elem name = "F6" command = "Player-Panel-New" - elem + elem name = "F7" command = "Admin-PM" - elem + elem name = "F8" command = "Invisimin" - elem + elem name = "F12" command = "F12" + elem + name = "CTRL+SHIFT+ADD" + command = "planeup" + elem + name = "CTRL+SHIFT+SUBTRACT" + command = "planedown" macro "hotkeymode" - elem + elem name = "TAB" command = ".winset \"mainwindow.macro=macro hotkey_toggle.is-checked=false input.focus=true\"" - elem + elem name = "Shift" command = "KeyDown Shift" elem @@ -510,58 +522,58 @@ macro "hotkeymode" elem name = "Alt+UP" command = "KeyUp Alt" - elem + elem name = "NORTHEAST" command = ".northeast" - elem + elem name = "SOUTHEAST" command = ".southeast" - elem + elem name = "SOUTHWEST" command = ".southwest" - elem + elem name = "NORTHWEST" command = ".northwest" - elem + elem name = "ALT+WEST" command = "westfaceperm" - elem + elem name = "CTRL+WEST" command = "westface" - elem + elem name = "West" command = "KeyDown West" elem name = "West+UP" command = "KeyUp West" - elem + elem name = "ALT+NORTH" command = "northfaceperm" - elem + elem name = "CTRL+NORTH" command = "northface" - elem + elem name = "North" command = "KeyDown North" elem name = "North+UP" command = "KeyUp North" - elem + elem name = "ALT+EAST" command = "eastfaceperm" - elem + elem name = "CTRL+EAST" command = "eastface" - elem + elem name = "East" command = "KeyDown East" elem name = "East+UP" command = "KeyUp East" - elem + elem name = "ALT+SOUTH" command = "southfaceperm" - elem + elem name = "CTRL+SOUTH" command = "southface" elem @@ -573,103 +585,103 @@ macro "hotkeymode" elem name = "CTRL+SHIFT+NORTH" command = "shiftnorth" - elem + elem name = "CTRL+SHIFT+SOUTH" command = "shiftsouth" - elem + elem name = "CTRL+SHIFT+WEST" command = "shiftwest" - elem + elem name = "CTRL+SHIFT+EAST" command = "shifteast" - elem + elem name = "INSERT" command = "a-intent right" - elem + elem name = "DELETE" command = "delete-key-pressed" - elem + elem name = "1" command = "a-intent help" - elem + elem name = "CTRL+1" command = "a-intent help" - elem + elem name = "2" command = "a-intent disarm" - elem + elem name = "CTRL+2" command = "a-intent disarm" - elem + elem name = "3" command = "a-intent grab" - elem + elem name = "CTRL+3" command = "a-intent grab" - elem + elem name = "4" command = "a-intent harm" - elem + elem name = "CTRL+4" command = "a-intent harm" - elem + elem name = "5" command = ".me" - elem + elem name = "6" command = ".Subtle" - elem + elem name = "A" command = "KeyDown A" elem name = "A+UP" command = "KeyUp A" - elem + elem name = "D" command = "KeyDown D" elem name = "D+UP" command = "KeyUp D" - elem + elem name = "E" command = "quick-equip" - elem + elem name = "CTRL+E" command = "quick-equip" - elem + elem name = "F" command = "a-intent left" - elem + elem name = "CTRL+F" command = "a-intent left" - elem + elem name = "G" command = "a-intent right" - elem + elem name = "CTRL+G" command = "a-intent right" - elem + elem name = "H" command = "holster" - elem + elem name = "CTRL+H" command = "holster" - elem + elem name = "J" command = "toggle-gun-mode" - elem + elem name = "CTRL+J" command = "toggle-gun-mode" - elem + elem name = "Q" command = ".northwest" - elem + elem name = "CTRL+Q" command = ".northwest" - elem + elem name = "R" command = ".southwest" - elem + elem name = "CTRL+R" command = ".southwest" elem "s_key" @@ -678,7 +690,7 @@ macro "hotkeymode" elem name = "S+UP" command = "KeyUp S" - elem + elem name = "T" command = ".say" elem "w_key" @@ -687,90 +699,96 @@ macro "hotkeymode" elem name = "W+UP" command = "KeyUp W" - elem + elem name = "X" command = ".northeast" - elem + elem name = "CTRL+X" command = ".northeast" - elem + elem name = "Y" command = ".Whisper" - elem + elem name = "CTRL+Y" command = ".Whisper" - elem + elem name = "Z" command = "Activate-Held-Object" - elem + elem name = "CTRL+Z" command = "Activate-Held-Object" - elem + elem name = "U" command = "Rest" - elem + elem name = "B" command = "Resist" - elem + elem name = "NUMPAD1" command = "body-r-leg" - elem + elem name = "NUMPAD2" command = "body-groin" - elem + elem name = "NUMPAD3" command = "body-l-leg" - elem + elem name = "NUMPAD4" command = "body-r-arm" - elem + elem name = "NUMPAD5" command = "body-chest" - elem + elem name = "NUMPAD6" command = "body-l-arm" - elem + elem name = "NUMPAD8" command = "body-toggle-head" - elem + elem name = "F1" command = "request-help" - elem + elem name = "CTRL+SHIFT+F1+REP" command = ".options" - elem + elem name = "F2" command = "ooc" - elem + elem name = "F2+REP" command = ".screenshot auto" - elem + elem name = "SHIFT+F2+REP" command = ".screenshot" - elem + elem name = "F3" command = ".say" - elem + elem name = "F4" command = ".me" - elem + elem name = "F5" command = "asay" - elem + elem name = "F6" command = "Player-Panel-New" - elem + elem name = "F7" command = "Admin-PM" - elem + elem name = "F8" command = "Invisimin" - elem + elem name = "F12" command = "F12" + elem + name = "CTRL+SHIFT+ADD" + command = "planeup" + elem + name = "CTRL+SHIFT+SUBTRACT" + command = "planedown" macro "borgmacro" - elem + elem name = "TAB" command = ".winset \"mainwindow.macro=borghotkeymode hotkey_toggle.is-checked=true mapwindow.map.focus=true input.background-color=#F0F0F0\"" elem @@ -791,58 +809,58 @@ macro "borgmacro" elem name = "Alt+UP" command = "KeyUp Alt" - elem + elem name = "NORTHEAST" command = ".northeast" - elem + elem name = "SOUTHEAST" command = ".southeast" - elem + elem name = "SOUTHWEST" command = ".southwest" - elem + elem name = "NORTHWEST" command = ".northwest" - elem + elem name = "ALT+WEST" command = "westfaceperm" - elem + elem name = "CTRL+WEST" command = "westface" - elem + elem name = "West" command = "KeyDown West" elem name = "West+UP" command = "KeyUp West" - elem + elem name = "ALT+NORTH" command = "northfaceperm" - elem + elem name = "CTRL+NORTH" command = "northface" - elem + elem name = "North" command = "KeyDown North" elem name = "North+UP" command = "KeyUp North" - elem + elem name = "ALT+EAST" command = "eastfaceperm" - elem + elem name = "CTRL+EAST" command = "eastface" - elem + elem name = "East" command = "KeyDown East" elem name = "East+UP" command = "KeyUp East" - elem + elem name = "ALT+SOUTH" command = "southfaceperm" - elem + elem name = "CTRL+SOUTH" command = "southface" elem @@ -854,176 +872,181 @@ macro "borgmacro" elem name = "CTRL+SHIFT+NORTH" command = "shiftnorth" - elem + elem name = "CTRL+SHIFT+SOUTH" command = "shiftsouth" - elem + elem name = "CTRL+SHIFT+WEST" command = "shiftwest" - elem + elem name = "CTRL+SHIFT+EAST" command = "shifteast" - elem + elem name = "INSERT" command = "a-intent right" - elem + elem name = "DELETE" command = "delete-key-pressed" - elem + elem name = "CTRL+1" command = "toggle-module 1" - elem + elem name = "CTRL+2" command = "toggle-module 2" - elem + elem name = "CTRL+3" command = "toggle-module 3" - elem + elem name = "CTRL+4" command = "a-intent left" - elem + elem name = "CTRL+A" command = "KeyDown A" elem name = "CTRL+A+UP" command = "KeyUp A" - elem + elem name = "CTRL+D" command = "KeyDown D" elem name = "CTRL+D+UP" command = "KeyUp D" - elem + elem name = "CTRL+F" command = "a-intent left" - elem + elem name = "CTRL+G" command = "a-intent right" - elem + elem name = "CTRL+Q" command = ".northwest" - elem + elem name = "CTRL+R" command = ".southwest" - elem + elem name = "CTRL+S" command = "KeyDown S" elem name = "CTRL+S+UP" command = "KeyUp S" - elem + elem name = "CTRL+W" command = "KeyDown W" elem name = "CTRL+W+UP" command = "KeyUp W" - elem + elem name = "CTRL+X" command = ".northeast" - elem + elem name = "CTRL+Y" command = "Activate-Held-Object" - elem + elem name = "CTRL+Z" command = "Activate-Held-Object" - elem + elem name = "CTRL+U" command = "Rest" - elem + elem name = "CTRL+NUMPAD1" command = "body-r-leg" - elem + elem name = "CTRL+NUMPAD2" command = "body-groin" - elem + elem name = "CTRL+NUMPAD3" command = "body-l-leg" - elem + elem name = "CTRL+NUMPAD4" command = "body-r-arm" - elem + elem name = "CTRL+NUMPAD5" command = "body-chest" - elem + elem name = "CTRL+NUMPAD6" command = "body-l-arm" - elem + elem name = "CTRL+NUMPAD8" command = "body-toggle-head" - elem + elem name = "F1" command = "request-help" - elem + elem name = "CTRL+SHIFT+F1+REP" command = ".options" - elem + elem name = "F2" command = "ooc" - elem + elem name = "F2+REP" command = ".screenshot auto" - elem + elem name = "SHIFT+F2+REP" command = ".screenshot" - elem + elem name = "F3" command = ".say" - elem + elem name = "F4" command = ".me" - elem + elem name = "F5" command = "asay" - elem + elem name = "F6" command = "Player-Panel-New" - elem + elem name = "F7" command = "Admin-PM" - elem + elem name = "F8" command = "Invisimin" - elem + elem name = "F12" command = "F12" - + elem + name = "CTRL+SHIFT+ADD" + command = "planeup" + elem + name = "CTRL+SHIFT+SUBTRACT" + command = "planedown" menu "menu" - elem + elem name = "&File" command = "" saved-params = "is-checked" - elem + elem name = "&Quick screenshot\tF2" command = ".screenshot auto" category = "&File" saved-params = "is-checked" - elem + elem name = "&Save screenshot as...\tShift+F2" command = ".screenshot" category = "&File" saved-params = "is-checked" - elem + elem name = "&Reconnect" command = ".reconnect" category = "&File" saved-params = "is-checked" - elem + elem name = "&Check ping" command = ".ping" category = "&File" saved-params = "is-checked" - elem + elem name = "" command = "" category = "&File" saved-params = "is-checked" - elem + elem name = "&Quit" command = ".quit" category = "&File" saved-params = "is-checked" - elem + elem name = "&Icons" command = "" saved-params = "is-checked" @@ -1070,7 +1093,7 @@ menu "menu" can-check = true group = "size" saved-params = "is-checked" - elem + elem name = "" command = "" category = "&Icons" @@ -1081,7 +1104,7 @@ menu "menu" category = "&Icons" can-check = true saved-params = "is-checked" - elem + elem name = "&Scaling" command = "" saved-params = "is-checked" @@ -1106,16 +1129,16 @@ menu "menu" can-check = true group = "scale" saved-params = "is-checked" - elem + elem name = "&Help" command = "" saved-params = "is-checked" - elem + elem name = "&Admin help\tF1" command = "request-help" category = "&Help" saved-params = "is-checked" - elem + elem name = "&Hotkeys" command = "hotkeys-help" category = "&Help" @@ -1525,4 +1548,3 @@ window "text_editor" border = line saved-params = "" multi-line = true - diff --git a/maps/expedition_vr/beach/beach.dmm b/maps/expedition_vr/beach/beach.dmm index 31a4549279..f30d64f3f4 100644 --- a/maps/expedition_vr/beach/beach.dmm +++ b/maps/expedition_vr/beach/beach.dmm @@ -1064,6 +1064,10 @@ outdoors = 1 }, /area/tether_away/beach/resort/kitchen) +"sq" = ( +/obj/effect/landmark/stardog, +/turf/simulated/floor/beach/sand/desert/outdoors, +/area/tether_away/beach) "ss" = ( /obj/machinery/light/small{ dir = 1 @@ -1191,6 +1195,10 @@ name = "dirt" }, /area/tether_away/beach/cavebase) +"vk" = ( +/obj/effect/landmark/stardog, +/turf/simulated/floor/outdoors/grass, +/area/tether_away/beach/cavebase) "vU" = ( /obj/structure/table/woodentable, /obj/item/device/flashlight/lamp/green, @@ -1835,6 +1843,10 @@ "Nv" = ( /turf/simulated/floor/beach/sand/outdoors, /area/tether_away/beach/resort) +"Nw" = ( +/obj/effect/landmark/stardog, +/turf/simulated/floor/outdoors/grass, +/area/tether_away/beach/jungle) "ND" = ( /obj/structure/table/glass, /obj/machinery/vending/wallmed1/public{ @@ -2214,6 +2226,10 @@ outdoors = 1 }, /area/tether_away/beach/resort) +"Yn" = ( +/obj/effect/landmark/stardog, +/turf/simulated/floor/beach/sand/outdoors, +/area/tether_away/beach/resort) "Yq" = ( /obj/structure/cable/cyan{ d1 = 1; @@ -4092,7 +4108,7 @@ ae au ae au -ae +Nw ae au ae @@ -4482,7 +4498,7 @@ rp xy Xd Xd -LQ +vk LQ xb pw @@ -4539,7 +4555,7 @@ bq bq bq bq -tr +sq aj ak am @@ -17296,7 +17312,7 @@ Nv Nv Nv Nv -Nv +Yn Nv Nv Nv diff --git a/maps/groundbase/gb-z1.dmm b/maps/groundbase/gb-z1.dmm index 45d7316c9a..268688936a 100644 --- a/maps/groundbase/gb-z1.dmm +++ b/maps/groundbase/gb-z1.dmm @@ -9116,6 +9116,20 @@ }, /turf/simulated/floor/carpet/gaycarpet, /area/groundbase/civilian/clown) +"uq" = ( +/obj/structure/cable{ + icon_state = "2-4" + }, +/obj/structure/disposalpipe/segment{ + dir = 4; + icon_state = "pipe-c" + }, +/obj/effect/landmark/stardog, +/turf/simulated/floor{ + edge_blending_priority = -1; + outdoors = 0 + }, +/area/maintenance/groundbase/level1/setunnel) "ur" = ( /obj/machinery/atmospherics/pipe/manifold4w/visible/green, /obj/machinery/meter, @@ -15960,6 +15974,12 @@ /obj/random/vendorall, /turf/simulated/floor/tiled, /area/groundbase/civilian/apparel) +"KJ" = ( +/obj/effect/landmark/stardog, +/turf/simulated/floor/outdoors/newdirt_nograss{ + outdoors = 0 + }, +/area/maintenance/groundbase/level1/stunnel) "KK" = ( /obj/structure/table/standard, /obj/item/weapon/stock_parts/subspace/crystal, @@ -17152,6 +17172,7 @@ /obj/structure/cable{ icon_state = "2-8" }, +/obj/effect/landmark/stardog, /turf/simulated/floor{ edge_blending_priority = -1; outdoors = 0 @@ -19536,6 +19557,12 @@ }, /turf/simulated/floor/tiled/white, /area/groundbase/medical/or2) +"Tt" = ( +/obj/effect/landmark/stardog, +/turf/simulated/floor/outdoors/newdirt_nograss{ + outdoors = 0 + }, +/area/maintenance/groundbase/level1/swtunnel) "Tu" = ( /obj/structure/cable{ icon_state = "1-2" @@ -24935,7 +24962,7 @@ ce ce ce ce -dM +Tt dM dM dM @@ -33890,7 +33917,7 @@ Lt Lt Lt Lt -nS +KJ nS SH Bk @@ -40239,7 +40266,7 @@ Bk Bk ce ce -VL +uq jF jF jF diff --git a/maps/groundbase/gb-z2.dmm b/maps/groundbase/gb-z2.dmm index 008bb083f7..d596a553a5 100644 --- a/maps/groundbase/gb-z2.dmm +++ b/maps/groundbase/gb-z2.dmm @@ -9853,6 +9853,12 @@ outdoors = 0 }, /area/groundbase/cargo/office) +"BJ" = ( +/obj/effect/landmark/stardog, +/turf/simulated/floor/outdoors/newdirt{ + outdoors = 0 + }, +/area/groundbase/level2/se) "BK" = ( /obj/structure/sink/kitchen{ pixel_y = 22 @@ -17376,6 +17382,12 @@ }, /turf/simulated/floor/outdoors/sidewalk/slab, /area/groundbase/level2/se) +"WI" = ( +/obj/effect/landmark/stardog, +/turf/simulated/floor/outdoors/newdirt_nograss{ + outdoors = 0 + }, +/area/groundbase/level2/nw) "WK" = ( /obj/structure/bed/chair/sofa/corp/right, /obj/machinery/atmospherics/unary/vent_pump/on, @@ -18917,7 +18929,7 @@ Kl Kl xE xE -KW +WI xE xE xE @@ -35439,7 +35451,7 @@ fk fk oF oF -oF +BJ fk fk fk diff --git a/maps/groundbase/groundbase_defines.dm b/maps/groundbase/groundbase_defines.dm index 4e14ad1cb7..7319b0847d 100644 --- a/maps/groundbase/groundbase_defines.dm +++ b/maps/groundbase/groundbase_defines.dm @@ -203,7 +203,6 @@ list(list("Honleth Highlands A", "Honleth Highlands B")), list("Arynthi Lake Underground A","Arynthi Lake A"), list("Arynthi Lake Underground B","Arynthi Lake B"), - list("Eggnog Town Underground","Eggnog Town"), list("Wild West") ) @@ -215,7 +214,10 @@ list("Teppi Ranch"), list("Innland"), list("Abandoned Island"), - list("Dark Adventure") + list("Dark Adventure"), + list("Eggnog Town Underground","Eggnog Town"), + list("Star Dog"), + list("Hotsprings") ) lateload_gb_north = list( diff --git a/maps/offmap_vr/common_offmaps.dm b/maps/offmap_vr/common_offmaps.dm index 69567512a2..94905bf82f 100644 --- a/maps/offmap_vr/common_offmaps.dm +++ b/maps/offmap_vr/common_offmaps.dm @@ -120,7 +120,7 @@ name = "Gateway Submap" desc = "Please do not use this." mappath = null - associated_map_datum = null + associated_map_datum = /datum/map_z_level/common_lateload/gateway_destination /datum/map_z_level/common_lateload/gateway_destination name = "Gateway Destination" @@ -138,41 +138,35 @@ name = "Zoo" desc = "Gigantic space zoo" mappath = 'maps/gateway_vr/zoo.dmm' - associated_map_datum = /datum/map_z_level/common_lateload/gateway_destination #include "../gateway_vr/carpfarm.dm" /datum/map_template/common_lateload/gateway/carpfarm name = "Carp Farm" desc = "Asteroid base surrounded by carp" mappath = 'maps/gateway_vr/carpfarm.dmm' - associated_map_datum = /datum/map_z_level/common_lateload/gateway_destination #include "../gateway_vr/snowfield.dm" /datum/map_template/common_lateload/gateway/snowfield name = "Snow Field" desc = "An old base in middle of snowy wasteland" mappath = 'maps/gateway_vr/snowfield.dmm' - associated_map_datum = /datum/map_z_level/common_lateload/gateway_destination #include "../gateway_vr/listeningpost.dm" /datum/map_template/common_lateload/gateway/listeningpost name = "Listening Post" desc = "Asteroid-bound mercenary listening post" mappath = 'maps/gateway_vr/listeningpost.dmm' - associated_map_datum = /datum/map_z_level/common_lateload/gateway_destination #include "../gateway_vr/variable/honlethhighlands.dm" /datum/map_template/common_lateload/gateway/honlethhighlands_a name = "Honleth Highlands A" desc = "The cold surface of some planet." mappath = 'maps/gateway_vr/variable/honlethhighlands_a.dmm' - associated_map_datum = /datum/map_z_level/common_lateload/gateway_destination /datum/map_template/common_lateload/gateway/honlethhighlands_b name = "Honleth Highlands B" desc = "The cold surface of some planet." mappath = 'maps/gateway_vr/variable/honlethhighlands_b.dmm' - associated_map_datum = /datum/map_z_level/common_lateload/gateway_destination #include "../gateway_vr/variable/arynthilake.dm" @@ -180,45 +174,27 @@ name = "Arynthi Lake A" desc = "A grassy surface with some abandoned structures." mappath = 'maps/gateway_vr/variable/arynthilake_a.dmm' - associated_map_datum = /datum/map_z_level/common_lateload/gateway_destination /datum/map_template/common_lateload/gateway/arynthilakeunderground name = "Arynthi Lake Underground A" desc = "A grassy surface with some abandoned structures." mappath = 'maps/gateway_vr/variable/arynthilakeunderground_a.dmm' - associated_map_datum = /datum/map_z_level/common_lateload/gateway_destination /datum/map_template/common_lateload/gateway/arynthilake_b name = "Arynthi Lake B" desc = "A grassy surface with some abandoned structures." mappath = 'maps/gateway_vr/variable/arynthilake_b.dmm' - associated_map_datum = /datum/map_z_level/common_lateload/gateway_destination /datum/map_template/common_lateload/gateway/arynthilakeunderground_b name = "Arynthi Lake Underground B" desc = "A grassy surface with some abandoned structures." mappath = 'maps/gateway_vr/variable/arynthilakeunderground_b.dmm' - associated_map_datum = /datum/map_z_level/common_lateload/gateway_destination - -#include "../gateway_vr/eggnogtown.dm" -/datum/map_template/common_lateload/gateway/eggnogtown - name = "Eggnog Town" - desc = "A comfortable snowy town." - mappath = 'maps/gateway_vr/eggnogtown.dmm' - associated_map_datum = /datum/map_z_level/common_lateload/gateway_destination - -/datum/map_template/common_lateload/gateway/eggnogtownunderground - name = "Eggnog Town Underground" - desc = "A comfortable snowy town." - mappath = 'maps/gateway_vr/eggnogtownunderground.dmm' - associated_map_datum = /datum/map_z_level/common_lateload/gateway_destination #include "../gateway_vr/wildwest.dm" /datum/map_template/common_lateload/gateway/wildwest name = "Wild West" desc = "A classic." mappath = 'maps/gateway_vr/wildwest.dmm' - associated_map_datum = /datum/map_z_level/common_lateload/gateway_destination #include "../gateway_vr/lucky_7.dm" @@ -259,6 +235,7 @@ /datum/map_z_level/common_lateload/redgate_destination name = "Redgate Destination" z = Z_LEVEL_REDGATE + flags = MAP_LEVEL_PLAYER|MAP_LEVEL_SEALED /datum/map_template/common_lateload/redgate/on_map_loaded(z) . = ..() @@ -285,6 +262,29 @@ desc = "This place seems broken!" mappath = 'maps/redgate/darkadventure.dmm' + +/datum/map_template/common_lateload/redgate/stardog + name = "Star Dog" + desc = "That's a big dog!" + mappath = 'maps/redgate/stardog.dmm' + +#include "../redgate/eggnogtown.dm" +/datum/map_template/common_lateload/redgate/eggnogtown + name = "Eggnog Town" + desc = "A comfortable snowy town." + mappath = 'maps/redgate/eggnogtown.dmm' + +/datum/map_template/common_lateload/redgate/eggnogtownunderground + name = "Eggnog Town Underground" + desc = "A comfortable snowy town." + mappath = 'maps/redgate/eggnogtownunderground.dmm' + +/datum/map_template/common_lateload/redgate/hotsprings + name = "Hotsprings" + desc = "This place is rather cosy for somewhere so abandoned!" + mappath = 'maps/redgate/hotsprings.dmm' + + ////////////////////////////////////////////////////////////////////////////////////// // Admin-use z-levels for loading whenever an admin feels like #if AWAY_MISSION_TEST diff --git a/maps/offmap_vr/talon/talon_v2.dmm b/maps/offmap_vr/talon/talon_v2.dmm index a530b752a9..3210f9f76e 100644 --- a/maps/offmap_vr/talon/talon_v2.dmm +++ b/maps/offmap_vr/talon/talon_v2.dmm @@ -1594,6 +1594,12 @@ /obj/random/multiple/corp_crate/talon_cargo, /turf/simulated/floor/tiled/techfloor, /area/talon_v2/maintenance/wing_starboard) +"es" = ( +/obj/machinery/light/small, +/obj/structure/catwalk, +/obj/effect/landmark/stardog, +/turf/simulated/floor/plating, +/area/talon_v2/maintenance/fore_starboard) "et" = ( /obj/structure/disposalpipe/segment{ dir = 4 @@ -8047,6 +8053,7 @@ "zz" = ( /obj/structure/catwalk, /obj/machinery/light/small, +/obj/effect/landmark/stardog, /turf/simulated/floor/plating, /area/talon_v2/maintenance/fore_port) "zA" = ( @@ -8198,6 +8205,7 @@ /obj/structure/railing/grey{ dir = 4 }, +/obj/effect/landmark/stardog, /turf/simulated/floor/plating, /area/talon_v2/engineering/port_store) "Ag" = ( @@ -10381,6 +10389,7 @@ dir = 4 }, /obj/structure/closet/walllocker_double/survival/north, +/obj/effect/landmark/stardog, /turf/simulated/floor/tiled/techfloor/grid, /area/shuttle/talonboat) "Hz" = ( @@ -15496,6 +15505,7 @@ /obj/machinery/light/small{ dir = 1 }, +/obj/effect/landmark/stardog, /turf/simulated/floor/plating, /area/talon_v2/engineering/star_store) "WV" = ( @@ -29064,7 +29074,7 @@ Sg uZ rx XD -jr +es Bw av yJ diff --git a/maps/gateway_vr/eggnogtown.dm b/maps/redgate/eggnogtown.dm similarity index 64% rename from maps/gateway_vr/eggnogtown.dm rename to maps/redgate/eggnogtown.dm index 33e4f8bf3a..528b4a38f1 100644 --- a/maps/gateway_vr/eggnogtown.dm +++ b/maps/redgate/eggnogtown.dm @@ -1,174 +1,174 @@ -/obj/effect/overmap/visitable/sector/common_gateway/eggnogtown - name = "bluespace shimmer" - desc = "The shimmering reflection of some sort of bluespace phenomena." - scanner_desc = @{"It is difficult to tell just what is beyond this strange shimmering shape. The air beyond seems breathable, if cold."} - icon = 'icons/obj/overmap_vr.dmi' - icon_state = "shimmer" - color = "#171DFF" //bloo - in_space = 0 - - skybox_icon = 'icons/skybox/anomaly.dmi' - skybox_icon_state = "shimmer_b" - skybox_pixel_x = 0 - skybox_pixel_y = 0 - -/datum/map_template/common_lateload/gateway/eggnogtown/on_map_loaded(z) - . = ..() - new /datum/random_map/automata/cave_system/no_cracks(null, 3, 3, z, world.maxx - 4, world.maxy - 4) // Create the mining Z-level. - new /datum/random_map/noise/ore(null, 1, 1, z, 64, 64) // Create the mining ore distribution map. - -/datum/map_template/common_lateload/gateway/eggnogtownunderground/on_map_loaded(z) - . = ..() - new /datum/random_map/automata/cave_system/no_cracks(null, 3, 3, z, world.maxx - 4, world.maxy - 4) // Create the mining Z-level. - new /datum/random_map/noise/ore(null, 1, 1, z, 64, 64) // Create the mining ore distribution map. - - -/obj/effect/landmark/map_data/eggnogtown - height = 2 - -//Areas// - -/area/gateway/eggnogtown - name = "Eggnog Town" - icon = 'icons/turf/areas_vr.dmi' - icon_state = "purwhicir" - requires_power = FALSE - dynamic_lighting = TRUE - flags = RAD_SHIELDED - base_turf = /turf/simulated/floor/outdoors/newdirt - - -/area/gateway/eggnogtown/gateway - name = "Eggnog Town Gateway" - icon_state = "cyawhisqu" - -/area/gateway/eggnogtown/bar - name = "Heart's Hearth Bar" - icon_state = "cyawhisqu" - -/area/gateway/eggnogtown/hall - name = "Eggnog Town Event Hall" - icon_state = "cyawhisqu" -/area/gateway/eggnogtown/hall/north - name = "Eggnog Town Event Hall north" - icon_state = "cyawhisqu" -/area/gateway/eggnogtown/hall/south - name = "Eggnog Town Event Hall south" - icon_state = "cyawhisqu" - -/area/gateway/eggnogtown/dining - name = "Eggnog Town Dining Hall" - icon_state = "cyawhisqu" -/area/gateway/eggnogtown/dining/kitchen - name = "Eggnog Town Dining Hall Kitchen" - icon_state = "cyawhisqu" -/area/gateway/eggnogtown/dining/botany - name = "Eggnog Town Dining Hall Botany" - icon_state = "cyawhisqu" -/area/gateway/eggnogtown/dining/storage - name = "Eggnog Town Dining Hall Storage" - icon_state = "cyawhisqu" - -/area/gateway/eggnogtown/storage - name = "Eggnog Town Storage Shed" - icon_state = "cyawhisqu" - -/area/gateway/eggnogtown/visitorlounge - name = "Eggnog Town Visitor Lounge" - icon_state = "cyawhisqu" -/area/gateway/eggnogtown/visitorlounge/room1 - name = "Eggnog Town Visitor Lounge Room 1" -/area/gateway/eggnogtown/visitorlounge/room2 - name = "Eggnog Town Visitor Lounge Room 2" - -/area/gateway/eggnogtown/houserhomestead - name = "Houser Homestead" - icon_state = "redwhisqu" -/area/gateway/eggnogtown/houserhomestead/basement - name = "Houser Homestead Basement" - -/area/gateway/eggnogtown/teshnest - name = "Je'rehi's Nest" - icon_state = "redwhisqu" - -/area/gateway/eggnogtown/arturoswolfden - name = "Arturo's Wolf Den" - icon_state = "redwhisqu" - -/area/gateway/eggnogtown/kitchihome - name = "Kitchi's House" - icon_state = "redwhisqu" -/area/gateway/eggnogtown/kitchihome/bedroom - name = "Kitchi's Bedroom" -/area/gateway/eggnogtown/kitchihome/kitchen - name = "Kitchi's Kitchen" -/area/gateway/eggnogtown/kitchihome/diningroom - name = "Kitchi's Dining Room" -/area/gateway/eggnogtown/kitchihome/guestroom - name = "Kitchi's Guest Room" -/area/gateway/eggnogtown/kitchihome/den - name = "Kitchi's House's Den" - -/area/gateway/eggnogtown/alipad - name = "Ali's Kickass Pad of Awesomeness" - icon_state = "redwhisqu" -/area/gateway/eggnogtown/alipad/bedroom - name = "Ali's Bedroom" - -/area/gateway/eggnogtown/loniabode - name = "Loni Nesumi's Humble Abode" - icon_state = "redwhisqu" - -/area/gateway/eggnogtown/vibeout - name = "Voided Vibeout" - icon_state = "redwhisqu" -/area/gateway/eggnogtown/vibeout/underground - name = "Voided Vibeout Underground" - -/area/gateway/eggnogtown/stokeswashere - name = "Underground Sneakzone" - icon_state = "redwhisqu" -/area/gateway/eggnogtown/stokeswashere/bathroom - name = "Underground Sneakzone Bathroom" -/area/gateway/eggnogtown/stokeswashere/bedroom - name = "Underground Sneakzone Bedroom" - -/area/gateway/eggnogtown/cavehome - name = "Cave Home" - icon_state = "redwhisqu" -/area/gateway/eggnogtown/cavehome/office - name = "Cave Home Office" -/area/gateway/eggnogtown/cavehome/bedroom - name = "Cave Home Bedroom" - -/area/gateway/eggnogtown/sigloo - name = "Southern Igloo" - icon_state = "cyawhisqu" - -/area/gateway/eggnogtown/nigloo - name = "Northern Igloo" - icon_state = "redwhisqu" - -/area/gateway/eggnogtown/eastcaveland - name = "Cave Lounge" - icon_state = "redwhisqu" - -/area/gateway/eggnogtown/hotspring - name = "Eggnog Town Hotspring" - icon_state = "redwhisqu" - -/area/gateway/eggnogtown/caves - name = "caves" - icon_state = "purblacir" - -/area/gateway/eggnogtown/underground - name = "underground" - icon_state = "purblacir" - -/area/gateway/eggnogtown/hotsprings - name = "Eggnog Town Hotsprings" - icon_state = "cyawhisqu" - -/area/gateway/eggnogtown/greenhouse - name = "Eggnog Town Greenhouse" - icon_state = "cyawhisqu" +/obj/effect/overmap/visitable/sector/common_gateway/eggnogtown + name = "bluespace shimmer" + desc = "The shimmering reflection of some sort of bluespace phenomena." + scanner_desc = @{"It is difficult to tell just what is beyond this strange shimmering shape. The air beyond seems breathable, if cold."} + icon = 'icons/obj/overmap_vr.dmi' + icon_state = "shimmer" + color = "#171DFF" //bloo + in_space = 0 + + skybox_icon = 'icons/skybox/anomaly.dmi' + skybox_icon_state = "shimmer_b" + skybox_pixel_x = 0 + skybox_pixel_y = 0 +/* +/datum/map_template/common_lateload/gateway/eggnogtown/on_map_loaded(z) + . = ..() + new /datum/random_map/automata/cave_system/no_cracks(null, 3, 3, z, world.maxx - 4, world.maxy - 4) // Create the mining Z-level. + new /datum/random_map/noise/ore(null, 1, 1, z, 64, 64) // Create the mining ore distribution map. + +/datum/map_template/common_lateload/gateway/eggnogtownunderground/on_map_loaded(z) + . = ..() + new /datum/random_map/automata/cave_system/no_cracks(null, 3, 3, z, world.maxx - 4, world.maxy - 4) // Create the mining Z-level. + new /datum/random_map/noise/ore(null, 1, 1, z, 64, 64) // Create the mining ore distribution map. +*/ + +/obj/effect/landmark/map_data/eggnogtown + height = 2 + +//Areas// + +/area/redgate/eggnogtown + name = "Eggnog Town" + icon = 'icons/turf/areas_vr.dmi' + icon_state = "purwhicir" + requires_power = FALSE + dynamic_lighting = TRUE + flags = RAD_SHIELDED + base_turf = /turf/simulated/floor/outdoors/newdirt + + +/area/redgate/eggnogtown/telecomms + name = "Eggnog Town Telecomms" + icon_state = "cyawhisqu" + +/area/redgate/eggnogtown/bar + name = "Heart's Hearth Bar" + icon_state = "cyawhisqu" + +/area/redgate/eggnogtown/hall + name = "Eggnog Town Event Hall" + icon_state = "cyawhisqu" +/area/redgate/eggnogtown/hall/north + name = "Eggnog Town Event Hall north" + icon_state = "cyawhisqu" +/area/redgate/eggnogtown/hall/south + name = "Eggnog Town Event Hall south" + icon_state = "cyawhisqu" + +/area/redgate/eggnogtown/dining + name = "Eggnog Town Dining Hall" + icon_state = "cyawhisqu" +/area/redgate/eggnogtown/dining/kitchen + name = "Eggnog Town Dining Hall Kitchen" + icon_state = "cyawhisqu" +/area/redgate/eggnogtown/dining/botany + name = "Eggnog Town Dining Hall Botany" + icon_state = "cyawhisqu" +/area/redgate/eggnogtown/dining/storage + name = "Eggnog Town Dining Hall Storage" + icon_state = "cyawhisqu" + +/area/redgate/eggnogtown/storage + name = "Eggnog Town Storage Shed" + icon_state = "cyawhisqu" + +/area/redgate/eggnogtown/visitorlounge + name = "Eggnog Town Visitor Lounge" + icon_state = "cyawhisqu" +/area/redgate/eggnogtown/visitorlounge/room1 + name = "Eggnog Town Visitor Lounge Room 1" +/area/redgate/eggnogtown/visitorlounge/room2 + name = "Eggnog Town Visitor Lounge Room 2" + +/area/redgate/eggnogtown/houserhomestead + name = "Houser Homestead" + icon_state = "redwhisqu" +/area/redgate/eggnogtown/houserhomestead/basement + name = "Houser Homestead Basement" + +/area/redgate/eggnogtown/teshnest + name = "Je'rehi's Nest" + icon_state = "redwhisqu" + +/area/redgate/eggnogtown/arturoswolfden + name = "Arturo's Wolf Den" + icon_state = "redwhisqu" + +/area/redgate/eggnogtown/kitchihome + name = "Kitchi's House" + icon_state = "redwhisqu" +/area/redgate/eggnogtown/kitchihome/bedroom + name = "Kitchi's Bedroom" +/area/redgate/eggnogtown/kitchihome/kitchen + name = "Kitchi's Kitchen" +/area/redgate/eggnogtown/kitchihome/diningroom + name = "Kitchi's Dining Room" +/area/redgate/eggnogtown/kitchihome/guestroom + name = "Kitchi's Guest Room" +/area/redgate/eggnogtown/kitchihome/den + name = "Kitchi's House's Den" + +/area/redgate/eggnogtown/alipad + name = "Ali's Kickass Pad of Awesomeness" + icon_state = "redwhisqu" +/area/redgate/eggnogtown/alipad/bedroom + name = "Ali's Bedroom" + +/area/redgate/eggnogtown/loniabode + name = "Loni Nesumi's Humble Abode" + icon_state = "redwhisqu" + +/area/redgate/eggnogtown/vibeout + name = "Voided Vibeout" + icon_state = "redwhisqu" +/area/redgate/eggnogtown/vibeout/underground + name = "Voided Vibeout Underground" + +/area/redgate/eggnogtown/stokeswashere + name = "Underground Sneakzone" + icon_state = "redwhisqu" +/area/redgate/eggnogtown/stokeswashere/bathroom + name = "Underground Sneakzone Bathroom" +/area/redgate/eggnogtown/stokeswashere/bedroom + name = "Underground Sneakzone Bedroom" + +/area/redgate/eggnogtown/cavehome + name = "Cave Home" + icon_state = "redwhisqu" +/area/redgate/eggnogtown/cavehome/office + name = "Cave Home Office" +/area/redgate/eggnogtown/cavehome/bedroom + name = "Cave Home Bedroom" + +/area/redgate/eggnogtown/sigloo + name = "Southern Igloo" + icon_state = "cyawhisqu" + +/area/redgate/eggnogtown/nigloo + name = "Northern Igloo" + icon_state = "redwhisqu" + +/area/redgate/eggnogtown/eastcaveland + name = "Cave Lounge" + icon_state = "redwhisqu" + +/area/redgate/eggnogtown/hotspring + name = "Eggnog Town Hotspring" + icon_state = "redwhisqu" + +/area/redgate/eggnogtown/caves + name = "caves" + icon_state = "purblacir" + +/area/redgate/eggnogtown/underground + name = "underground" + icon_state = "purblacir" + +/area/redgate/eggnogtown/hotsprings + name = "Eggnog Town Hotsprings" + icon_state = "cyawhisqu" + +/area/redgate/eggnogtown/greenhouse + name = "Eggnog Town Greenhouse" + icon_state = "cyawhisqu" diff --git a/maps/gateway_vr/eggnogtown.dmm b/maps/redgate/eggnogtown.dmm similarity index 83% rename from maps/gateway_vr/eggnogtown.dmm rename to maps/redgate/eggnogtown.dmm index ee67207fc4..df5d59b2ad 100644 --- a/maps/gateway_vr/eggnogtown.dmm +++ b/maps/redgate/eggnogtown.dmm @@ -3,16 +3,16 @@ /turf/unsimulated/wall/planetary/normal{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "ab" = ( /obj/machinery/recharge_station, /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "ac" = ( /turf/simulated/wall/wood, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "ad" = ( /obj/effect/floor_decal/spline/plain{ dir = 8 @@ -21,7 +21,7 @@ dir = 1 }, /turf/simulated/floor/lino, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "ae" = ( /obj/machinery/light/small{ dir = 8 @@ -29,7 +29,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "af" = ( /obj/structure/table/fancyblack, /obj/item/weapon/reagent_containers/food/drinks/cup{ @@ -48,13 +48,13 @@ pixel_y = 21 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "ag" = ( /obj/machinery/vending/boozeomat{ req_access = list() }, /turf/simulated/floor/lino, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "ah" = ( /obj/machinery/camera/network/civilian{ c_tag = "Heart's Hearth Bar" @@ -62,39 +62,39 @@ /obj/structure/table/marble, /obj/machinery/chemical_dispenser/bar_alc/full, /turf/simulated/floor/lino, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "ai" = ( /turf/simulated/floor/outdoors/newdirt{ temperature = 253.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "aj" = ( /obj/structure/table/marble, /obj/machinery/chemical_dispenser/bar_coffee/full, /turf/simulated/floor/lino, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "ak" = ( /obj/structure/table/marble, /obj/machinery/chemical_dispenser/bar_soft/full, /turf/simulated/floor/lino, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "al" = ( /obj/structure/bonfire, -/turf/simulated/mineral/floor/ignore_cavegen{ +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/nigloo) +/area/redgate/eggnogtown/nigloo) "am" = ( /obj/structure/bed/double/padded, /obj/item/weapon/bedsheet/purpledouble, /obj/random/awayloot, -/turf/simulated/mineral/floor/ignore_cavegen{ +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/nigloo) +/area/redgate/eggnogtown/nigloo) "an" = ( /turf/simulated/wall/iron, -/area/gateway/eggnogtown/dining) +/area/redgate/eggnogtown/dining) "ao" = ( /obj/structure/noticeboard{ pixel_y = 32 @@ -102,10 +102,10 @@ /obj/item/weapon/paper{ info = "Loni Nesumi's humbble abode, feel free to rest inside if the lights are out, please go change the cell in the maint room otherwise enjoy your stay and please don't take anything" }, -/turf/simulated/mineral/floor/ignore_cavegen{ +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "ap" = ( /obj/structure/table/marble, /obj/item/weapon/flame/lighter/zippo, @@ -116,7 +116,7 @@ }, /obj/item/weapon/reagent_containers/spray/cleaner, /turf/simulated/floor/lino, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "aq" = ( /obj/structure/cable/yellow{ d1 = 1; @@ -126,7 +126,7 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "ar" = ( /obj/effect/floor_decal/spline/plain{ dir = 4 @@ -135,7 +135,7 @@ dir = 1 }, /turf/simulated/floor/lino, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "as" = ( /obj/machinery/light/small{ dir = 4 @@ -143,7 +143,7 @@ /turf/simulated/floor/outdoors/newdirt_nograss{ temperature = 258.15 }, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "at" = ( /obj/machinery/light/small{ dir = 8 @@ -151,7 +151,7 @@ /turf/simulated/floor/outdoors/newdirt_nograss{ temperature = 258.15 }, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "au" = ( /obj/machinery/light_switch{ dir = 4; @@ -162,48 +162,48 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "av" = ( /obj/machinery/light/small{ dir = 8 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "aw" = ( /obj/structure/bonfire, /turf/simulated/floor/outdoors/newdirt{ temperature = 253.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "ax" = ( /obj/machinery/light/small{ dir = 4 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "ay" = ( /turf/simulated/floor/outdoors/ice{ outdoors = 0; temperature = 258.15 }, -/area/gateway/eggnogtown/caves) +/area/redgate/eggnogtown/caves) "az" = ( -/turf/simulated/mineral/floor/ignore_cavegen{ +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "aA" = ( /obj/structure/simple_door/wood, -/turf/simulated/mineral/floor/ignore_cavegen{ +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "aB" = ( /obj/structure/bed/chair/bay/chair/padded/red/bignest, -/turf/simulated/mineral/floor/ignore_cavegen{ +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/teshnest) +/area/redgate/eggnogtown/teshnest) "aC" = ( /obj/structure/bed/chair/wood, /obj/structure/window/reinforced{ @@ -214,24 +214,24 @@ name = "window" }, /turf/simulated/floor/carpet/turcarpet, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "aD" = ( /obj/structure/bed/double/padded, /obj/item/weapon/bedsheet/browndouble, -/turf/simulated/mineral/floor/ignore_cavegen{ +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/teshnest) +/area/redgate/eggnogtown/teshnest) "aE" = ( /obj/structure/bonfire/sifwood, -/turf/simulated/mineral/floor/ignore_cavegen{ +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/teshnest) +/area/redgate/eggnogtown/teshnest) "aF" = ( /obj/structure/bed/chair/wood, /turf/simulated/floor/carpet/turcarpet, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "aG" = ( /obj/structure/bed/chair/wood, /obj/structure/window/reinforced{ @@ -242,7 +242,7 @@ name = "window" }, /turf/simulated/floor/carpet/turcarpet, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "aH" = ( /obj/structure/table/woodentable, /obj/structure/window/reinforced{ @@ -253,14 +253,14 @@ name = "window" }, /turf/simulated/floor/carpet/turcarpet, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "aI" = ( /obj/structure/grille, /obj/structure/window/reinforced/full, /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "aJ" = ( /obj/structure/table/woodentable, /obj/structure/window/reinforced{ @@ -271,7 +271,7 @@ name = "window" }, /turf/simulated/floor/carpet/turcarpet, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "aK" = ( /obj/structure/bed/chair/wood{ dir = 1 @@ -284,18 +284,18 @@ name = "window" }, /turf/simulated/floor/carpet/turcarpet, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "aL" = ( /turf/simulated/floor/outdoors/ice{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "aM" = ( /obj/structure/bed/chair/wood{ dir = 1 }, /turf/simulated/floor/carpet/turcarpet, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "aN" = ( /obj/structure/bed/chair/wood{ dir = 1 @@ -308,10 +308,10 @@ name = "window" }, /turf/simulated/floor/carpet/turcarpet, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "aO" = ( /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "aP" = ( /obj/machinery/light/small{ dir = 8 @@ -319,7 +319,7 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "aQ" = ( /obj/structure/railing/grey{ dir = 8 @@ -327,26 +327,26 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "aR" = ( /obj/structure/table/woodentable, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "aS" = ( /obj/structure/closet, /obj/random/awayloot, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad/bedroom) +/area/redgate/eggnogtown/alipad/bedroom) "aT" = ( /obj/structure/bed/chair/backed_grey{ dir = 4 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "aU" = ( /obj/structure/table/darkglass, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "aV" = ( /obj/machinery/light/small{ dir = 4 @@ -354,7 +354,7 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "aW" = ( /obj/structure/table/fancyblack, /obj/item/device/flashlight/lantern{ @@ -362,103 +362,103 @@ pixel_y = 12 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/den) +/area/redgate/eggnogtown/kitchihome/den) "aX" = ( /obj/structure/bed/chair/backed_grey, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "aY" = ( /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/den) +/area/redgate/eggnogtown/kitchihome/den) "aZ" = ( /obj/item/clothing/accessory/scarf/purple, /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "ba" = ( /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/bedroom) +/area/redgate/eggnogtown/kitchihome/bedroom) "bb" = ( /obj/structure/dogbed, /mob/living/simple_mob/animal/passive/fox, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/den) +/area/redgate/eggnogtown/kitchihome/den) "bc" = ( /obj/machinery/computer/arcade/battle, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/den) +/area/redgate/eggnogtown/kitchihome/den) "bd" = ( /obj/machinery/light/small{ dir = 8 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/den) +/area/redgate/eggnogtown/kitchihome/den) "be" = ( /obj/machinery/light/small{ dir = 4 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/den) +/area/redgate/eggnogtown/kitchihome/den) "bf" = ( /obj/structure/grille, /obj/structure/window/reinforced/full, /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/dining/kitchen) +/area/redgate/eggnogtown/dining/kitchen) "bg" = ( /obj/structure/table/fancyblack, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/den) +/area/redgate/eggnogtown/kitchihome/den) "bk" = ( /obj/machinery/alarm/alarms_hidden{ dir = 1; pixel_y = -20 }, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "bm" = ( /turf/simulated/wall/wood{ can_open = 1 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "bn" = ( /turf/simulated/floor/wmarble, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "bo" = ( /obj/machinery/door/airlock{ id_tag = "wintera"; name = "Automatic Door" }, /turf/simulated/floor/tiled/steel_ridged, -/area/gateway/eggnogtown/visitorlounge/room1) +/area/redgate/eggnogtown/visitorlounge/room1) "bq" = ( /obj/structure/table/bench/padded, /turf/simulated/floor/carpet/gaycarpet{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "br" = ( /obj/structure/catwalk, /obj/structure/window/basic/full, /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "bt" = ( /obj/structure/musician/piano, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "bu" = ( /obj/structure/table/wooden_reinforced, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge/room2) +/area/redgate/eggnogtown/visitorlounge/room2) "bv" = ( /turf/simulated/floor/carpet/gaycarpet{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "bw" = ( /obj/structure/table/woodentable, /obj/item/weapon/storage/toolbox/mechanical, @@ -478,7 +478,7 @@ /turf/simulated/floor/tiled/techmaint{ temperature = 258.15 }, -/area/gateway/eggnogtown/storage) +/area/redgate/eggnogtown/storage) "bx" = ( /obj/structure/fans/tiny, /obj/machinery/door/airlock/freezer{ @@ -487,16 +487,12 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/storage) +/area/redgate/eggnogtown/storage) "bz" = ( /turf/simulated/floor/tiled/techmaint{ temperature = 258.15 }, -/area/gateway/eggnogtown/storage) -"bA" = ( -/obj/machinery/vending/fitness, -/turf/simulated/floor/wood, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/storage) "bH" = ( /obj/random/maintenance, /obj/random/maintenance, @@ -525,7 +521,7 @@ /turf/simulated/floor/tiled/techmaint{ temperature = 258.15 }, -/area/gateway/eggnogtown/storage) +/area/redgate/eggnogtown/storage) "bL" = ( /obj/structure/table/rack, /obj/random/maintenance, @@ -533,7 +529,7 @@ /turf/simulated/floor/tiled/techmaint{ temperature = 258.15 }, -/area/gateway/eggnogtown/storage) +/area/redgate/eggnogtown/storage) "bM" = ( /obj/structure/table/woodentable, /obj/item/weapon/storage/toolbox/mechanical, @@ -553,7 +549,7 @@ /turf/simulated/floor/tiled/techmaint{ temperature = 258.15 }, -/area/gateway/eggnogtown/storage) +/area/redgate/eggnogtown/storage) "bO" = ( /obj/structure/table/woodentable, /obj/item/weapon/storage/toolbox/mechanical, @@ -578,13 +574,13 @@ /turf/simulated/floor/tiled/techmaint{ temperature = 258.15 }, -/area/gateway/eggnogtown/storage) +/area/redgate/eggnogtown/storage) "bT" = ( /obj/machinery/alarm/alarms_hidden{ pixel_y = 21 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/den) +/area/redgate/eggnogtown/kitchihome/den) "bU" = ( /obj/structure/bed/chair/sofa/right/beige{ dir = 8 @@ -592,7 +588,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/sigloo) +/area/redgate/eggnogtown/sigloo) "bW" = ( /obj/machinery/light/small{ dir = 4 @@ -600,7 +596,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "bX" = ( /obj/machinery/light_switch{ dir = 4; @@ -608,34 +604,34 @@ pixel_x = -25 }, /turf/simulated/floor/bmarble, -/area/gateway/eggnogtown/hall/north) +/area/redgate/eggnogtown/hall/north) "ca" = ( /obj/structure/bed/chair/sofa/corner/beige{ dir = 1 }, /turf/simulated/floor/wmarble, -/area/gateway/eggnogtown/arturoswolfden) +/area/redgate/eggnogtown/arturoswolfden) "cj" = ( /turf/simulated/wall/wood, -/area/gateway/eggnogtown/cavehome/office) +/area/redgate/eggnogtown/cavehome/office) "cn" = ( /obj/structure/bed/chair/sofa/right/black{ dir = 4 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "cq" = ( /obj/structure/grille, /obj/structure/window/reinforced/full, /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/dining/botany) +/area/redgate/eggnogtown/dining/botany) "cv" = ( /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "cx" = ( /obj/structure/table/fancyblack, /obj/item/device/flashlight/lantern{ @@ -643,7 +639,7 @@ pixel_y = 10 }, /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "cz" = ( /obj/machinery/light_switch{ dir = 1; @@ -653,11 +649,11 @@ /turf/simulated/floor/outdoors/newdirt{ outdoors = 0 }, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "cD" = ( /obj/structure/bonfire, /turf/simulated/floor/bmarble, -/area/gateway/eggnogtown/arturoswolfden) +/area/redgate/eggnogtown/arturoswolfden) "cF" = ( /obj/structure/cable/yellow{ icon_state = "2-9" @@ -665,7 +661,7 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "cJ" = ( /obj/structure/closet/walllocker_double{ pixel_y = 28 @@ -673,7 +669,7 @@ /obj/fiftyspawner/log, /obj/fiftyspawner/log, /turf/simulated/floor/bmarble, -/area/gateway/eggnogtown/hall) +/area/redgate/eggnogtown/hall) "cL" = ( /obj/structure/table/woodentable, /obj/machinery/light{ @@ -681,13 +677,13 @@ }, /obj/random/maintenance, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad/bedroom) +/area/redgate/eggnogtown/alipad/bedroom) "cN" = ( /obj/random/maintenance, -/turf/simulated/mineral/floor/ignore_cavegen{ +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/teshnest) +/area/redgate/eggnogtown/teshnest) "cQ" = ( /obj/structure/fans/tiny, /obj/machinery/door/airlock/freezer{ @@ -696,11 +692,11 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/caves) +/area/redgate/eggnogtown/caves) "cZ" = ( /obj/machinery/light, /turf/simulated/floor/outdoors/grass/forest, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "da" = ( /obj/structure/table/woodentable, /obj/machinery/light{ @@ -709,27 +705,27 @@ /obj/fiftyspawner/log, /obj/fiftyspawner/log, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad) +/area/redgate/eggnogtown/alipad) "dh" = ( /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "di" = ( -/turf/simulated/mineral/floor/ignore_cavegen{ +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "dj" = ( /obj/machinery/light{ dir = 1 }, /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "dm" = ( /obj/structure/lattice, /turf/simulated/open, -/area/gateway/eggnogtown/storage) +/area/redgate/eggnogtown/storage) "do" = ( /obj/structure/bed/chair/sofa/right/black{ dir = 8 @@ -737,24 +733,24 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/eastcaveland) +/area/redgate/eggnogtown/eastcaveland) "dp" = ( /obj/machinery/seed_storage/garden{ dir = 1 }, /turf/simulated/floor/tiled/monotile, -/area/gateway/eggnogtown/dining/botany) +/area/redgate/eggnogtown/dining/botany) "dq" = ( /obj/structure/fans/tiny, /obj/machinery/door/airlock/freezer{ name = "Automatic Door" }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "dr" = ( /obj/structure/simple_door/wood, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "dv" = ( /obj/structure/railing{ dir = 8 @@ -762,35 +758,35 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/sigloo) +/area/redgate/eggnogtown/sigloo) "dy" = ( /obj/item/weapon/stool/padded, /obj/effect/floor_decal/spline/plain{ dir = 8 }, /turf/simulated/floor/lino, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "dz" = ( /obj/structure/railing, /obj/structure/bonfire/sifwood, /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "dB" = ( /obj/structure/table/woodentable, /obj/random/maintenance, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad/bedroom) +/area/redgate/eggnogtown/alipad/bedroom) "dK" = ( /turf/simulated/wall/snowbrick{ can_open = 1 }, -/area/gateway/eggnogtown/nigloo) +/area/redgate/eggnogtown/nigloo) "dL" = ( /obj/structure/sink/puddle, /turf/simulated/floor/outdoors/grass/forest, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "dM" = ( /obj/structure/bed/chair/sofa/left/beige{ dir = 8 @@ -798,13 +794,13 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/sigloo) +/area/redgate/eggnogtown/sigloo) "dN" = ( /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad) +/area/redgate/eggnogtown/alipad) "dV" = ( /turf/simulated/wall/iron, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "dX" = ( /obj/structure/table/woodentable, /obj/item/weapon/reagent_containers/food/snacks/lasagna, @@ -816,7 +812,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead) +/area/redgate/eggnogtown/houserhomestead) "ea" = ( /obj/machinery/button/windowtint{ id = "winterwindowa"; @@ -827,27 +823,27 @@ range = 10 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge/room1) +/area/redgate/eggnogtown/visitorlounge/room1) "ef" = ( /obj/effect/fake_sun/cool, -/turf/simulated/mineral/ignore_cavegen{ +/turf/simulated/mineral/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/caves) +/area/redgate/eggnogtown/caves) "ek" = ( /turf/simulated/wall/wood, -/area/gateway/eggnogtown/cavehome/bedroom) +/area/redgate/eggnogtown/cavehome/bedroom) "es" = ( /obj/structure/table/bench/wooden, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "ew" = ( /obj/structure/table/woodentable, /obj/item/device/flashlight/lamp, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere/bedroom) +/area/redgate/eggnogtown/stokeswashere/bedroom) "ex" = ( /obj/structure/table/fancyblack, /obj/item/weapon/reagent_containers/food/drinks/cup{ @@ -867,7 +863,7 @@ pixel_y = 9 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "ez" = ( /obj/structure/bed/chair/sofa/left/beige{ dir = 8 @@ -875,28 +871,28 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "eE" = ( /obj/machinery/vending/hydronutrients{ dir = 8 }, /turf/simulated/floor/tiled/monotile, -/area/gateway/eggnogtown/dining/botany) +/area/redgate/eggnogtown/dining/botany) "eF" = ( /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome/office) +/area/redgate/eggnogtown/cavehome/office) "eI" = ( /turf/simulated/wall, -/area/gateway/eggnogtown/caves) +/area/redgate/eggnogtown/caves) "eL" = ( /obj/structure/table/woodentable, /obj/random/maintenance, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome) +/area/redgate/eggnogtown/cavehome) "eO" = ( /obj/structure/bed/chair/sofa/right/beige{ dir = 8 @@ -904,20 +900,20 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "eY" = ( /obj/structure/bed/double/padded, /obj/item/weapon/bedsheet/double, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome/bedroom) +/area/redgate/eggnogtown/cavehome/bedroom) "fa" = ( /turf/simulated/wall/sandstone, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "fb" = ( /turf/simulated/wall/wood, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "fe" = ( /obj/machinery/light{ dir = 8 @@ -928,19 +924,19 @@ /turf/simulated/floor/tiled/asteroid_steel/outdoors{ outdoors = 0 }, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "fh" = ( /obj/structure/curtain/open/shower/security, /obj/effect/catwalk_plated, /obj/machinery/shower, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/diningroom) +/area/redgate/eggnogtown/kitchihome/diningroom) "fj" = ( /obj/structure/bed/double/padded, /obj/item/weapon/bedsheet/iandouble, /obj/structure/curtain/black, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge/room2) +/area/redgate/eggnogtown/visitorlounge/room2) "ft" = ( /obj/structure/noticeboard{ pixel_x = -32 @@ -949,7 +945,7 @@ info = "Ali's Kickass Pad of Awesomeness" }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad) +/area/redgate/eggnogtown/alipad) "fu" = ( /obj/structure/bed/chair/sofa/right{ dir = 4 @@ -957,25 +953,25 @@ /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "fx" = ( /obj/structure/bed/chair/backed_grey{ dir = 8 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "fB" = ( /obj/structure/table/woodentable, /turf/simulated/floor/carpet/turcarpet, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "fI" = ( /turf/simulated/wall/wood, -/area/gateway/eggnogtown/visitorlounge/room1) +/area/redgate/eggnogtown/visitorlounge/room1) "fS" = ( /obj/machinery/portable_atmospherics/hydroponics/soil, /obj/machinery/light, /turf/simulated/floor/outdoors/grass/forest, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "fX" = ( /obj/structure/grille, /obj/structure/window/titanium, @@ -992,13 +988,13 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/kitchihome/bedroom) +/area/redgate/eggnogtown/kitchihome/bedroom) "ge" = ( /obj/structure/bed/chair/comfy/black{ dir = 8 }, /turf/simulated/floor/tiled, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "gk" = ( /obj/item/weapon/reagent_containers/food/condiment/carton/flour, /obj/item/weapon/reagent_containers/food/condiment/carton/flour, @@ -1029,25 +1025,25 @@ pixel_y = 21 }, /turf/simulated/floor/tiled/eris/cafe, -/area/gateway/eggnogtown/dining/kitchen) +/area/redgate/eggnogtown/dining/kitchen) "gs" = ( /obj/structure/table/steel_reinforced, /obj/machinery/reagentgrinder, /turf/simulated/floor/tiled/eris/cafe, -/area/gateway/eggnogtown/dining/kitchen) +/area/redgate/eggnogtown/dining/kitchen) "gA" = ( /obj/machinery/light{ dir = 4 }, /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "gB" = ( /obj/structure/fans/tiny, /obj/machinery/door/airlock/freezer{ name = "Automatic Door" }, /turf/simulated/floor/tiled/steel_ridged, -/area/gateway/eggnogtown/cavehome) +/area/redgate/eggnogtown/cavehome) "gG" = ( /obj/structure/railing, /obj/structure/railing{ @@ -1062,32 +1058,32 @@ /turf/simulated/floor/reinforced{ temperature = 258.15 }, -/area/gateway/eggnogtown/eastcaveland) +/area/redgate/eggnogtown/eastcaveland) "gH" = ( /obj/item/clothing/gloves/black, /obj/structure/table/rack/shelf/steel, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "gJ" = ( /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome) +/area/redgate/eggnogtown/cavehome) "gK" = ( /obj/structure/bed/chair/sofa/black{ dir = 4 }, /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/kitchihome/den) +/area/redgate/eggnogtown/kitchihome/den) "gP" = ( /obj/item/weapon/stool/padded, /turf/simulated/floor/outdoors/newdirt{ outdoors = 0 }, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "gS" = ( /turf/simulated/wall/wood, -/area/gateway/eggnogtown/eastcaveland) +/area/redgate/eggnogtown/eastcaveland) "gV" = ( /obj/structure/table/marble, /obj/item/device/flashlight/lantern{ @@ -1095,7 +1091,7 @@ }, /obj/item/weapon/storage/box/beakers, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "hd" = ( /obj/machinery/light_switch{ dir = 1; @@ -1104,25 +1100,25 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead) +/area/redgate/eggnogtown/houserhomestead) "he" = ( /obj/structure/simple_door/wood, /turf/simulated/floor/tiled, -/area/gateway/eggnogtown/stokeswashere/bathroom) +/area/redgate/eggnogtown/stokeswashere/bathroom) "hg" = ( /turf/simulated/floor/bmarble, -/area/gateway/eggnogtown/hall/north) +/area/redgate/eggnogtown/hall/north) "hj" = ( /turf/unsimulated/mineral{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "hl" = ( /obj/machinery/light/small, /turf/simulated/floor/outdoors/snow{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "ho" = ( /obj/structure/table/woodentable, /obj/random/maintenance, @@ -1132,55 +1128,55 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome) +/area/redgate/eggnogtown/cavehome) "hr" = ( /obj/structure/table/rack, /obj/random/maintenance, /obj/random/maintenance, /turf/simulated/floor/tiled/techmaint, -/area/gateway/eggnogtown/dining/storage) +/area/redgate/eggnogtown/dining/storage) "hy" = ( /obj/structure/bonfire, /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/dining) +/area/redgate/eggnogtown/dining) "hC" = ( /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere/bedroom) +/area/redgate/eggnogtown/stokeswashere/bedroom) "hF" = ( /obj/structure/bed/chair/comfy/black{ dir = 1 }, /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "hG" = ( /turf/simulated/wall/shull, -/area/gateway/eggnogtown/gateway) +/area/redgate/eggnogtown/telecomms) "hO" = ( /turf/simulated/floor/carpet/turcarpet, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "hR" = ( /obj/structure/simple_door/wood, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome) +/area/redgate/eggnogtown/cavehome) "hS" = ( /obj/item/weapon/reagent_containers/glass/bucket/wood, /turf/simulated/floor/outdoors/grass{ outdoors = 0 }, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "if" = ( /obj/machinery/alarm/alarms_hidden{ dir = 4; pixel_x = -21 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge/room2) +/area/redgate/eggnogtown/visitorlounge/room2) "ig" = ( /obj/structure/bed/chair/sofa/black{ dir = 8 @@ -1190,34 +1186,34 @@ trader_type = /obj/trader/general }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "iq" = ( /obj/structure/grille, /obj/structure/window/reinforced/full, /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "iw" = ( /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge/room1) +/area/redgate/eggnogtown/visitorlounge/room1) "ix" = ( /obj/structure/table/wooden_reinforced, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/bedroom) +/area/redgate/eggnogtown/kitchihome/bedroom) "iz" = ( /obj/structure/table/fancyblack, /obj/machinery/chemical_dispenser/bar_coffee/full, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "iU" = ( /obj/structure/flora/pottedplant/minitree, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "iZ" = ( /obj/structure/simple_door/gold, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "jb" = ( /obj/structure/table/fancyblack, /obj/item/device/flashlight/lantern{ @@ -1225,31 +1221,28 @@ pixel_y = 12 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/guestroom) +/area/redgate/eggnogtown/kitchihome/guestroom) "jd" = ( /turf/simulated/wall/log, -/area/gateway/eggnogtown/kitchihome/diningroom) +/area/redgate/eggnogtown/kitchihome/diningroom) "jp" = ( /obj/structure/grille, /obj/structure/window/reinforced/full, /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/dining) +/area/redgate/eggnogtown/dining) "js" = ( -/obj/machinery/gateway{ - dir = 9 - }, /obj/effect/floor_decal/industrial/warning{ dir = 9 }, /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/gateway) +/area/redgate/eggnogtown/telecomms) "jt" = ( /obj/structure/fans/tiny, /obj/structure/simple_door/iron, /turf/simulated/floor/bmarble, -/area/gateway/eggnogtown/arturoswolfden) +/area/redgate/eggnogtown/arturoswolfden) "jy" = ( /obj/item/weapon/stool/padded{ dir = 8 @@ -1257,7 +1250,7 @@ /turf/simulated/floor/outdoors/newdirt{ outdoors = 0 }, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "jB" = ( /obj/structure/table/woodentable, /obj/item/toy/plushie/black_fox, @@ -1265,10 +1258,10 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead) +/area/redgate/eggnogtown/houserhomestead) "jK" = ( /turf/simulated/wall/wood, -/area/gateway/eggnogtown/arturoswolfden) +/area/redgate/eggnogtown/arturoswolfden) "jO" = ( /obj/machinery/light_switch{ on = 0; @@ -1277,55 +1270,52 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "jP" = ( /turf/simulated/wall/wood, -/area/gateway/eggnogtown/cavehome) +/area/redgate/eggnogtown/cavehome) "jV" = ( /obj/structure/table/woodentable, /obj/random/drinkbottle, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "kb" = ( /obj/machinery/portable_atmospherics/hydroponics/soil, /obj/machinery/light{ dir = 8 }, /turf/simulated/floor/outdoors/grass/forest, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "kG" = ( -/obj/machinery/telecomms/relay, +/obj/structure/redgate/away, /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/gateway) +/area/redgate/eggnogtown/bar) "kI" = ( -/obj/machinery/gateway{ - dir = 1 - }, /obj/effect/floor_decal/industrial/warning{ dir = 1 }, /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/gateway) +/area/redgate/eggnogtown/telecomms) "kL" = ( /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead) +/area/redgate/eggnogtown/houserhomestead) "kO" = ( /obj/random/junk, -/turf/simulated/mineral/floor/ignore_cavegen{ +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "kQ" = ( /obj/structure/fans/tiny, /obj/structure/simple_door/iron, /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/eastcaveland) +/area/redgate/eggnogtown/eastcaveland) "kX" = ( /obj/structure/bed/chair/sofa/left{ dir = 8 @@ -1333,46 +1323,46 @@ /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "ld" = ( /obj/machinery/light/small{ dir = 1 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/dining) +/area/redgate/eggnogtown/dining) "lg" = ( /turf/simulated/wall/snowbrick, -/area/gateway/eggnogtown/caves) +/area/redgate/eggnogtown/caves) "lo" = ( /obj/structure/table/fancyblack, /obj/random/awayloot, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/diningroom) +/area/redgate/eggnogtown/kitchihome/diningroom) "lB" = ( /obj/item/weapon/stool/padded, /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "lF" = ( /obj/structure/simple_door/wood, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/diningroom) +/area/redgate/eggnogtown/kitchihome/diningroom) "lI" = ( /obj/structure/closet/secure_closet/freezer/meat, /obj/machinery/light/small{ dir = 1 }, /turf/simulated/floor/tiled/techmaint, -/area/gateway/eggnogtown/dining/storage) +/area/redgate/eggnogtown/dining/storage) "lK" = ( /obj/item/weapon/bedsheet/yellowdouble, /obj/structure/curtain/black, /obj/structure/bed/double/padded, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/guestroom) +/area/redgate/eggnogtown/kitchihome/guestroom) "lL" = ( /obj/machinery/light, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "lO" = ( /obj/structure/bed/chair/wood{ dir = 8 @@ -1380,20 +1370,20 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead) +/area/redgate/eggnogtown/houserhomestead) "lR" = ( /obj/structure/fans/tiny, /obj/machinery/door/airlock/freezer{ name = "Automatic Door" }, /turf/simulated/floor/tiled/steel_ridged, -/area/gateway/eggnogtown/dining) +/area/redgate/eggnogtown/dining) "lS" = ( /obj/structure/bed/chair/sofa/right/black{ dir = 1 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad/bedroom) +/area/redgate/eggnogtown/alipad/bedroom) "lT" = ( /obj/effect/decal/writing{ message = "Stokes Was Here" @@ -1405,12 +1395,12 @@ pixel_y = -26 }, /turf/simulated/floor/tiled, -/area/gateway/eggnogtown/stokeswashere/bathroom) +/area/redgate/eggnogtown/stokeswashere/bathroom) "mc" = ( /obj/structure/table/marble, /obj/machinery/reagentgrinder, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "mf" = ( /obj/structure/bed/chair/sofa/corner{ dir = 1 @@ -1418,13 +1408,13 @@ /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "mp" = ( /obj/machinery/light{ dir = 4 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/hall/north) +/area/redgate/eggnogtown/hall/north) "mt" = ( /obj/structure/table/woodentable, /obj/item/weapon/material/ashtray, @@ -1432,11 +1422,11 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "mv" = ( /obj/structure/bed/chair/sofa/corner/black, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "mw" = ( /obj/structure/closet, /obj/item/device/camera, @@ -1446,13 +1436,13 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere/bedroom) +/area/redgate/eggnogtown/stokeswashere/bedroom) "mx" = ( /obj/structure/bed/chair/comfy/black{ dir = 4 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/diningroom) +/area/redgate/eggnogtown/kitchihome/diningroom) "mC" = ( /obj/structure/table/rack, /obj/random/maintenance, @@ -1465,7 +1455,7 @@ /turf/simulated/floor/tiled/techmaint{ temperature = 258.15 }, -/area/gateway/eggnogtown/storage) +/area/redgate/eggnogtown/storage) "mK" = ( /obj/structure/railing/grey{ dir = 1 @@ -1473,7 +1463,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "mM" = ( /obj/structure/table/rack, /obj/random/snack, @@ -1487,7 +1477,7 @@ /obj/random/snack, /obj/random/snack, /turf/simulated/floor/tiled/techmaint, -/area/gateway/eggnogtown/dining/storage) +/area/redgate/eggnogtown/dining/storage) "mP" = ( /obj/structure/table/fancyblack, /obj/item/device/flashlight/lantern{ @@ -1499,32 +1489,32 @@ pixel_x = -21 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/diningroom) +/area/redgate/eggnogtown/kitchihome/diningroom) "mZ" = ( /turf/simulated/floor/outdoors/snow{ temperature = 258.15 }, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "nd" = ( /obj/structure/bed/double, /obj/structure/lattice, /obj/structure/curtain/black, /turf/simulated/open, -/area/gateway/eggnogtown/houserhomestead) +/area/redgate/eggnogtown/houserhomestead) "ne" = ( /turf/simulated/wall/wood, -/area/gateway/eggnogtown/storage) +/area/redgate/eggnogtown/storage) "ng" = ( /obj/machinery/light/small{ dir = 1 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "nj" = ( /turf/simulated/open{ temperature = 303.15 }, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "nt" = ( /obj/structure/table/woodentable, /obj/random/maintenance, @@ -1532,27 +1522,27 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/eastcaveland) +/area/redgate/eggnogtown/eastcaveland) "nE" = ( /obj/machinery/light/small{ dir = 8 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/guestroom) +/area/redgate/eggnogtown/kitchihome/guestroom) "nI" = ( /obj/structure/toilet, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/diningroom) +/area/redgate/eggnogtown/kitchihome/diningroom) "nJ" = ( /obj/structure/table/darkglass, /obj/random/awayloot, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "nN" = ( /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "nQ" = ( /obj/item/weapon/material/minihoe, /obj/item/device/analyzer/plant_analyzer, @@ -1562,7 +1552,7 @@ /obj/item/weapon/material/minihoe, /obj/structure/closet, /turf/simulated/floor/tiled/monotile, -/area/gateway/eggnogtown/dining/botany) +/area/redgate/eggnogtown/dining/botany) "nZ" = ( /obj/structure/grille, /obj/structure/window/reinforced/polarized/full{ @@ -1572,16 +1562,16 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/visitorlounge/room2) +/area/redgate/eggnogtown/visitorlounge/room2) "oc" = ( /obj/machinery/light{ dir = 1 }, /turf/simulated/floor/bmarble, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "os" = ( /turf/simulated/wall/iron, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "ot" = ( /obj/machinery/camera/network/civilian{ c_tag = "Heart's Hearth West"; @@ -1590,7 +1580,7 @@ /turf/simulated/floor/outdoors/snow{ temperature = 258.15 }, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "ou" = ( /obj/machinery/alarm/alarms_hidden{ dir = 1; @@ -1599,7 +1589,7 @@ /turf/simulated/floor/tiled/asteroid_steel/outdoors{ outdoors = 0 }, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "oz" = ( /obj/item/trash/candle, /obj/structure/cable/yellow{ @@ -1609,7 +1599,7 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "oC" = ( /obj/machinery/light/small{ dir = 8 @@ -1617,33 +1607,33 @@ /turf/simulated/floor/outdoors/snow{ temperature = 258.15 }, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "oJ" = ( /obj/machinery/portable_atmospherics/hydroponics, /obj/machinery/light{ dir = 1 }, /turf/simulated/floor/tiled/monotile, -/area/gateway/eggnogtown/dining/botany) +/area/redgate/eggnogtown/dining/botany) "oN" = ( /turf/simulated/floor/tiled/asteroid_steel/outdoors{ outdoors = 0 }, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "oQ" = ( /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/caves) +/area/redgate/eggnogtown/caves) "pa" = ( /obj/structure/simple_door/wood, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/den) +/area/redgate/eggnogtown/kitchihome/den) "pj" = ( -/turf/simulated/mineral/floor/ignore_cavegen{ +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/teshnest) +/area/redgate/eggnogtown/teshnest) "pw" = ( /obj/machinery/door/airlock/freezer{ name = "Automatic Door" @@ -1652,79 +1642,79 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "pL" = ( /turf/simulated/floor/bmarble, -/area/gateway/eggnogtown/hall) +/area/redgate/eggnogtown/hall) "pM" = ( /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/hall/north) +/area/redgate/eggnogtown/hall/north) "pN" = ( /obj/structure/sink{ pixel_y = 21 }, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "pP" = ( /obj/structure/table/woodentable, /obj/random/maintenance, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/eastcaveland) +/area/redgate/eggnogtown/eastcaveland) "pT" = ( /turf/simulated/floor/outdoors/snow{ temperature = 258.15 }, -/area/gateway/eggnogtown/arturoswolfden) +/area/redgate/eggnogtown/arturoswolfden) "pV" = ( /obj/effect/floor_decal/spline/plain{ dir = 10 }, /turf/simulated/floor/lino, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "pY" = ( /turf/simulated/wall/wood, -/area/gateway/eggnogtown/houserhomestead) +/area/redgate/eggnogtown/houserhomestead) "qc" = ( /obj/machinery/alarm/alarms_hidden{ pixel_y = 21 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/guestroom) +/area/redgate/eggnogtown/kitchihome/guestroom) "qn" = ( /obj/effect/floor_decal/spline/plain{ dir = 8 }, /turf/simulated/floor/lino, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "qA" = ( /obj/machinery/light/small{ dir = 1 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/diningroom) +/area/redgate/eggnogtown/kitchihome/diningroom) "qB" = ( /obj/structure/grille, /obj/structure/window/reinforced/full, /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "qC" = ( /obj/structure/closet, /obj/random/awayloot, /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "qD" = ( /obj/machinery/light/small{ dir = 4 }, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/diningroom) +/area/redgate/eggnogtown/kitchihome/diningroom) "qJ" = ( /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/kitchihome/den) +/area/redgate/eggnogtown/kitchihome/den) "qN" = ( /obj/structure/bed/chair/sofa/black{ dir = 8 @@ -1733,16 +1723,13 @@ dir = 4 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "rd" = ( -/obj/machinery/gateway{ - dir = 5 - }, /obj/effect/floor_decal/industrial/warning{ dir = 5 }, /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/gateway) +/area/redgate/eggnogtown/telecomms) "rh" = ( /obj/structure/railing/grey{ dir = 8 @@ -1753,7 +1740,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "rk" = ( /obj/structure/railing, /obj/structure/railing{ @@ -1769,23 +1756,23 @@ /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "rm" = ( /obj/effect/floor_decal/spline/plain{ dir = 6 }, /turf/simulated/floor/lino, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "rr" = ( /obj/machinery/light_switch{ on = 0; pixel_y = 27 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "rv" = ( /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/guestroom) +/area/redgate/eggnogtown/kitchihome/guestroom) "rz" = ( /obj/item/trash/candle, /obj/structure/cable/yellow{ @@ -1794,12 +1781,12 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "rL" = ( /turf/simulated/floor/outdoors/newdirt_nograss{ temperature = 258.15 }, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "rN" = ( /obj/structure/sink/kitchen{ dir = 4; @@ -1807,7 +1794,7 @@ pixel_y = 10 }, /turf/simulated/floor/tiled/monotile, -/area/gateway/eggnogtown/dining/botany) +/area/redgate/eggnogtown/dining/botany) "rQ" = ( /obj/structure/table/standard, /obj/item/weapon/material/kitchen/utensil/spoon, @@ -1815,7 +1802,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "rS" = ( /obj/structure/bed/chair/sofa/black{ dir = 4 @@ -1823,22 +1810,19 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/eastcaveland) +/area/redgate/eggnogtown/eastcaveland) "sb" = ( /obj/random/awayloot, -/turf/simulated/mineral/floor/ignore_cavegen{ +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/teshnest) +/area/redgate/eggnogtown/teshnest) "sp" = ( /obj/machinery/door/airlock/glass, /obj/structure/fans/tiny, /turf/simulated/floor/tiled/steel_ridged, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "sr" = ( -/obj/machinery/gateway{ - dir = 8 - }, /obj/effect/floor_decal/industrial/warning{ dir = 8 }, @@ -1846,18 +1830,18 @@ dir = 8 }, /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/gateway) +/area/redgate/eggnogtown/telecomms) "su" = ( /obj/machinery/appliance/cooker/fryer, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "sv" = ( /obj/machinery/light, /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "sD" = ( /turf/simulated/wall/iron, -/area/gateway/eggnogtown/alipad/bedroom) +/area/redgate/eggnogtown/alipad/bedroom) "sE" = ( /obj/structure/bed/chair/sofa/left/black{ dir = 8 @@ -1865,7 +1849,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/eastcaveland) +/area/redgate/eggnogtown/eastcaveland) "sF" = ( /obj/structure/bed/chair/sofa/right/black{ dir = 1 @@ -1873,7 +1857,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead) +/area/redgate/eggnogtown/houserhomestead) "sH" = ( /obj/structure/grille, /obj/structure/window/reinforced/polarized/full{ @@ -1883,7 +1867,7 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/visitorlounge/room1) +/area/redgate/eggnogtown/visitorlounge/room1) "sI" = ( /obj/machinery/camera/network/civilian{ c_tag = "Hearth's Heart East"; @@ -1892,7 +1876,7 @@ /turf/simulated/floor/outdoors/snow{ temperature = 258.15 }, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "sK" = ( /obj/structure/railing/grey{ dir = 8 @@ -1901,28 +1885,28 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/kitchihome/den) +/area/redgate/eggnogtown/kitchihome/den) "sN" = ( /obj/structure/table/steel_reinforced, /obj/machinery/microwave, /turf/simulated/floor/tiled/eris/cafe, -/area/gateway/eggnogtown/dining/kitchen) +/area/redgate/eggnogtown/dining/kitchen) "sP" = ( /turf/simulated/wall/snowbrick, -/area/gateway/eggnogtown/sigloo) +/area/redgate/eggnogtown/sigloo) "sR" = ( /obj/item/toy/plushie/red_fox, /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "sS" = ( /obj/machinery/light_switch{ on = 0; pixel_y = 27 }, /turf/simulated/floor/tiled/techmaint, -/area/gateway/eggnogtown/dining/storage) +/area/redgate/eggnogtown/dining/storage) "tc" = ( /obj/item/weapon/stool/padded{ dir = 4 @@ -1930,29 +1914,29 @@ /turf/simulated/floor/outdoors/newdirt{ outdoors = 0 }, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "te" = ( -/obj/machinery/gateway/centeraway, +/obj/machinery/telecomms/relay/preset/station, /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/gateway) +/area/redgate/eggnogtown/telecomms) "tj" = ( /obj/structure/grille, /obj/structure/window/reinforced/full, /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "tp" = ( /obj/machinery/smartfridge/drying_rack, /turf/simulated/floor/tiled/techmaint, -/area/gateway/eggnogtown/dining/storage) +/area/redgate/eggnogtown/dining/storage) "ty" = ( /obj/structure/reagent_dispensers/watertank, /turf/simulated/floor/tiled/monotile, -/area/gateway/eggnogtown/dining/botany) +/area/redgate/eggnogtown/dining/botany) "tA" = ( /turf/simulated/wall/log, -/area/gateway/eggnogtown/kitchihome/den) +/area/redgate/eggnogtown/kitchihome/den) "tB" = ( /obj/machinery/light_switch{ dir = 4; @@ -1960,7 +1944,7 @@ pixel_x = -25 }, /turf/simulated/floor/tiled/eris/cafe, -/area/gateway/eggnogtown/dining/kitchen) +/area/redgate/eggnogtown/dining/kitchen) "tC" = ( /obj/structure/table/marble, /obj/item/weapon/reagent_containers/glass/rag, @@ -1968,31 +1952,28 @@ /obj/item/weapon/book/manual/barman_recipes, /obj/random/awayloot, /turf/simulated/floor/lino, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "tE" = ( /turf/simulated/wall/wood, -/area/gateway/eggnogtown/visitorlounge/room2) +/area/redgate/eggnogtown/visitorlounge/room2) "tG" = ( /obj/structure/closet/wardrobe, /obj/random/maintenance, /obj/random/maintenance, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/guestroom) +/area/redgate/eggnogtown/kitchihome/guestroom) "tU" = ( /obj/structure/simple_door/wood, /turf/simulated/floor/tiled/steel_ridged, -/area/gateway/eggnogtown/dining/kitchen) +/area/redgate/eggnogtown/dining/kitchen) "tX" = ( /obj/structure/closet/wardrobe, /obj/random/awayloot, /obj/random/maintenance, /obj/random/maintenance, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/guestroom) +/area/redgate/eggnogtown/kitchihome/guestroom) "tY" = ( -/obj/machinery/gateway{ - dir = 4 - }, /obj/effect/floor_decal/industrial/warning{ dir = 4 }, @@ -2000,17 +1981,17 @@ dir = 4 }, /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/gateway) +/area/redgate/eggnogtown/telecomms) "ua" = ( /obj/machinery/light{ dir = 8 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/hall/north) +/area/redgate/eggnogtown/hall/north) "uf" = ( /obj/structure/lattice, /turf/simulated/open, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "uh" = ( /obj/machinery/portable_atmospherics/hydroponics/soil, /obj/machinery/light{ @@ -2020,7 +2001,7 @@ pixel_y = 21 }, /turf/simulated/floor/outdoors/grass/forest, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "uk" = ( /obj/machinery/light_switch{ dir = 4; @@ -2030,13 +2011,13 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome/office) +/area/redgate/eggnogtown/cavehome/office) "uw" = ( /turf/simulated/floor/bmarble, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "uM" = ( /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "uT" = ( /obj/structure/grille, /obj/structure/window/reinforced{ @@ -2048,7 +2029,7 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "uX" = ( /obj/structure/table/steel_reinforced, /obj/item/weapon/material/kitchen/rollingpin, @@ -2058,7 +2039,7 @@ }, /obj/item/weapon/reagent_containers/glass/bucket, /turf/simulated/floor/tiled/eris/cafe, -/area/gateway/eggnogtown/dining/kitchen) +/area/redgate/eggnogtown/dining/kitchen) "uY" = ( /obj/structure/closet, /obj/random/mre, @@ -2073,19 +2054,19 @@ /obj/random/mre, /obj/machinery/light/small, /turf/simulated/floor/tiled/techmaint, -/area/gateway/eggnogtown/dining/storage) +/area/redgate/eggnogtown/dining/storage) "va" = ( /obj/machinery/shower{ pixel_y = 10 }, /obj/structure/curtain/open/shower, /turf/simulated/floor/tiled, -/area/gateway/eggnogtown/stokeswashere/bathroom) +/area/redgate/eggnogtown/stokeswashere/bathroom) "vb" = ( -/turf/simulated/mineral/floor/ignore_cavegen{ +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/nigloo) +/area/redgate/eggnogtown/nigloo) "vc" = ( /obj/structure/table/rack/shelf/steel, /obj/item/weapon/material/knife/butch, @@ -2093,44 +2074,41 @@ dir = 1 }, /turf/simulated/floor/tiled/eris/cafe, -/area/gateway/eggnogtown/dining/kitchen) +/area/redgate/eggnogtown/dining/kitchen) "vn" = ( /obj/structure/table/standard, /obj/item/weapon/material/ashtray, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/arturoswolfden) +/area/redgate/eggnogtown/arturoswolfden) "vq" = ( /obj/machinery/light_switch{ dir = 1; pixel_y = -23 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad) +/area/redgate/eggnogtown/alipad) "vy" = ( /obj/machinery/light/small, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "vz" = ( -/obj/machinery/gateway{ - dir = 10 - }, /obj/effect/floor_decal/industrial/warning{ dir = 10 }, /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/gateway) +/area/redgate/eggnogtown/telecomms) "vE" = ( /obj/item/trash/candle, /obj/structure/cable/yellow, /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "vH" = ( /turf/simulated/floor/wood, -/area/gateway/eggnogtown/hall/north) +/area/redgate/eggnogtown/hall/north) "vL" = ( /obj/random/snack, /obj/random/snack, @@ -2144,22 +2122,22 @@ /obj/random/snack, /obj/structure/table/rack/shelf, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "vP" = ( /obj/machinery/door/airlock/glass, /obj/structure/fans/tiny, /turf/simulated/floor/tiled/steel_ridged, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "vQ" = ( /obj/machinery/portable_atmospherics/hydroponics/soil, /obj/machinery/light{ dir = 1 }, /turf/simulated/floor/outdoors/grass/forest, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "wj" = ( /turf/simulated/wall/wood, -/area/gateway/eggnogtown/dining/storage) +/area/redgate/eggnogtown/dining/storage) "wn" = ( /obj/structure/bookcase, /obj/machinery/light/small{ @@ -2168,17 +2146,13 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome/office) +/area/redgate/eggnogtown/cavehome/office) "wp" = ( /turf/simulated/wall/snowbrick, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "wt" = ( /turf/simulated/floor/outdoors/grass/forest, -/area/gateway/eggnogtown/greenhouse) -"wu" = ( -/obj/machinery/vending/coffee, -/turf/simulated/floor/wood, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/greenhouse) "wx" = ( /obj/structure/cable/yellow{ d1 = 4; @@ -2188,7 +2162,7 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "wN" = ( /obj/fiftyspawner/log, /obj/fiftyspawner/log, @@ -2197,7 +2171,7 @@ pixel_x = -28 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/dining) +/area/redgate/eggnogtown/dining) "wP" = ( /obj/item/weapon/deck/cards, /obj/item/weapon/storage/dicecup, @@ -2207,7 +2181,7 @@ /obj/item/weapon/deck/tarot, /obj/structure/closet, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "wR" = ( /obj/structure/bed/chair/sofa/right/black{ dir = 4 @@ -2215,31 +2189,31 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/eastcaveland) +/area/redgate/eggnogtown/eastcaveland) "wT" = ( /obj/machinery/door/airlock/freezer{ name = "Automatic Door" }, /obj/structure/fans/tiny, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad) +/area/redgate/eggnogtown/alipad) "xk" = ( /obj/structure/toilet{ dir = 4 }, /turf/simulated/floor/tiled, -/area/gateway/eggnogtown/stokeswashere/bathroom) +/area/redgate/eggnogtown/stokeswashere/bathroom) "xn" = ( /obj/structure/table/glass, /obj/item/device/flashlight/lamp/green, /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "xq" = ( /obj/structure/bed/chair/sofa/corner/beige{ dir = 8 }, /turf/simulated/floor/wmarble, -/area/gateway/eggnogtown/arturoswolfden) +/area/redgate/eggnogtown/arturoswolfden) "xy" = ( /obj/structure/railing{ dir = 4 @@ -2248,7 +2222,7 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "xA" = ( /obj/machinery/light/small{ dir = 1 @@ -2256,15 +2230,15 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome) +/area/redgate/eggnogtown/cavehome) "xN" = ( -/turf/simulated/mineral/floor/ignore_cavegen{ +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/gateway) +/area/redgate/eggnogtown/telecomms) "xS" = ( /turf/simulated/wall/wood, -/area/gateway/eggnogtown/alipad) +/area/redgate/eggnogtown/alipad) "xU" = ( /obj/structure/closet/wardrobe, /obj/random/maintenance, @@ -2273,7 +2247,7 @@ /obj/random/maintenance, /obj/random/maintenance, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/bedroom) +/area/redgate/eggnogtown/kitchihome/bedroom) "yb" = ( /obj/machinery/light/small{ dir = 8 @@ -2281,49 +2255,49 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome) +/area/redgate/eggnogtown/cavehome) "ym" = ( -/obj/machinery/vending/snack, +/obj/random/vendorfood, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "ys" = ( /obj/structure/bed/chair/sofa/corner/beige, /turf/simulated/floor/wmarble, -/area/gateway/eggnogtown/arturoswolfden) +/area/redgate/eggnogtown/arturoswolfden) "yt" = ( /obj/structure/table/woodentable, /obj/random/awayloot, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome) +/area/redgate/eggnogtown/cavehome) "yv" = ( /obj/effect/floor_decal/spline/plain{ dir = 4 }, /turf/simulated/floor/lino, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "yD" = ( /obj/structure/simple_door/wood, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere/bedroom) +/area/redgate/eggnogtown/stokeswashere/bedroom) "yG" = ( /obj/machinery/vending/wallmed1/public{ dir = 4; pixel_x = -22 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "yL" = ( /obj/machinery/door/airlock/external, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "yN" = ( /obj/structure/closet, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad) +/area/redgate/eggnogtown/alipad) "yR" = ( /obj/structure/bed/chair/bay/comfy/red{ dir = 1 @@ -2331,46 +2305,46 @@ /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "zh" = ( /obj/machinery/light/small, /obj/item/clothing/suit/storage/hooded/wintercoat/solgov/fleet, /obj/structure/table/rack/shelf/steel, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "zo" = ( /obj/structure/bonfire, -/turf/simulated/mineral/floor/ignore_cavegen{ +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/sigloo) +/area/redgate/eggnogtown/sigloo) "zr" = ( /obj/structure/bed/chair/sofa/right/black, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome) +/area/redgate/eggnogtown/cavehome) "zx" = ( /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "zG" = ( /obj/structure/bed/chair/wood/wings{ dir = 4 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/dining) +/area/redgate/eggnogtown/dining) "zJ" = ( /obj/structure/table/woodentable, /obj/item/device/flashlight/lamp, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "zK" = ( /turf/simulated/wall/log_sif, -/area/gateway/eggnogtown/teshnest) +/area/redgate/eggnogtown/teshnest) "zR" = ( /obj/structure/closet/walllocker_double{ dir = 1; @@ -2379,26 +2353,26 @@ /obj/fiftyspawner/log, /obj/fiftyspawner/log, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "zU" = ( /obj/structure/bed/chair/sofa/left/black{ dir = 4 }, /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/kitchihome/den) +/area/redgate/eggnogtown/kitchihome/den) "zV" = ( /obj/machinery/alarm/alarms_hidden{ dir = 8; pixel_x = 20 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge/room1) +/area/redgate/eggnogtown/visitorlounge/room1) "zZ" = ( /obj/structure/bed/chair/sofa/left{ dir = 8 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad) +/area/redgate/eggnogtown/alipad) "Aa" = ( /obj/structure/bed/chair/wood{ dir = 1 @@ -2406,21 +2380,21 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead) +/area/redgate/eggnogtown/houserhomestead) "Ae" = ( /obj/structure/lattice, /turf/simulated/open, -/area/gateway/eggnogtown/caves) +/area/redgate/eggnogtown/caves) "Af" = ( /turf/simulated/floor/tiled, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "At" = ( /obj/structure/bed/chair/comfy/black, /obj/machinery/light/small{ dir = 1 }, /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "Ax" = ( /obj/structure/bed/chair/wood{ dir = 4 @@ -2428,11 +2402,11 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead) +/area/redgate/eggnogtown/houserhomestead) "AE" = ( /obj/machinery/gibber, /turf/simulated/floor/tiled/techmaint, -/area/gateway/eggnogtown/dining/storage) +/area/redgate/eggnogtown/dining/storage) "AM" = ( /obj/machinery/button/windowtint{ id = "winterwindowb"; @@ -2443,24 +2417,24 @@ range = 10 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge/room2) +/area/redgate/eggnogtown/visitorlounge/room2) "AO" = ( /obj/structure/fans/tiny, /obj/machinery/door/airlock/freezer{ name = "Automatic Door" }, /turf/simulated/floor/tiled/steel_ridged, -/area/gateway/eggnogtown/hall) +/area/redgate/eggnogtown/hall) "AS" = ( /obj/machinery/vending/dinnerware{ dir = 1 }, /turf/simulated/floor/tiled/eris/cafe, -/area/gateway/eggnogtown/dining/kitchen) +/area/redgate/eggnogtown/dining/kitchen) "AT" = ( /obj/structure/bed/chair/comfy/black, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad) +/area/redgate/eggnogtown/alipad) "AV" = ( /obj/machinery/light/small{ dir = 1 @@ -2471,13 +2445,13 @@ pixel_x = -25 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge/room1) +/area/redgate/eggnogtown/visitorlounge/room1) "AY" = ( /obj/structure/bed/chair/sofa/corner, /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "AZ" = ( /obj/structure/table/fancyblack, /obj/item/device/flashlight/lantern{ @@ -2485,24 +2459,24 @@ pixel_y = 12 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/bedroom) +/area/redgate/eggnogtown/kitchihome/bedroom) "Bb" = ( /obj/structure/simple_door/wood, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome/bedroom) +/area/redgate/eggnogtown/cavehome/bedroom) "Bd" = ( /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "Bf" = ( /obj/structure/railing, /turf/simulated/floor/bmarble, -/area/gateway/eggnogtown/hall) +/area/redgate/eggnogtown/hall) "Bh" = ( /obj/structure/curtain, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/arturoswolfden) +/area/redgate/eggnogtown/arturoswolfden) "Bn" = ( /obj/machinery/light_switch{ dir = 4; @@ -2510,19 +2484,19 @@ pixel_x = -25 }, /turf/simulated/floor/bmarble, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "BD" = ( /obj/machinery/light/small, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "BG" = ( /obj/structure/bed/chair/sofa/beige{ dir = 8 }, /turf/simulated/floor/wmarble, -/area/gateway/eggnogtown/arturoswolfden) +/area/redgate/eggnogtown/arturoswolfden) "BO" = ( /obj/machinery/light/small{ dir = 1 @@ -2530,11 +2504,11 @@ /turf/simulated/floor/outdoors/snow{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "BR" = ( /obj/item/weapon/stool/baystool, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "BW" = ( /obj/structure/grille, /obj/structure/window/titanium, @@ -2551,34 +2525,34 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "BY" = ( /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome/bedroom) +/area/redgate/eggnogtown/cavehome/bedroom) "Cc" = ( /obj/machinery/light/small{ dir = 4 }, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "Cd" = ( /obj/structure/fans/tiny, /obj/machinery/door/airlock/freezer{ name = "Automatic Door" }, /turf/simulated/floor/tiled/steel_ridged, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "Co" = ( /turf/simulated/floor/wood, -/area/gateway/eggnogtown/cavehome) +/area/redgate/eggnogtown/cavehome) "Cs" = ( /turf/simulated/floor/tiled/techmaint, -/area/gateway/eggnogtown/dining/storage) +/area/redgate/eggnogtown/dining/storage) "Cx" = ( /turf/simulated/wall/wood, -/area/gateway/eggnogtown/dining/botany) +/area/redgate/eggnogtown/dining/botany) "CC" = ( /obj/machinery/light_switch{ dir = 1; @@ -2586,7 +2560,7 @@ pixel_y = -23 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/guestroom) +/area/redgate/eggnogtown/kitchihome/guestroom) "CD" = ( /obj/structure/noticeboard{ pixel_x = -32 @@ -2597,41 +2571,41 @@ /turf/simulated/floor/outdoors/snow{ temperature = 258.15 }, -/area/gateway/eggnogtown/arturoswolfden) +/area/redgate/eggnogtown/arturoswolfden) "CL" = ( /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "CO" = ( /obj/structure/simple_door/wood, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/bedroom) +/area/redgate/eggnogtown/kitchihome/bedroom) "CP" = ( /obj/structure/bed/chair/sofa/left/black{ dir = 1 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad/bedroom) +/area/redgate/eggnogtown/alipad/bedroom) "Dd" = ( /obj/machinery/light/small, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/dining) +/area/redgate/eggnogtown/dining) "Df" = ( /turf/simulated/wall/log, -/area/gateway/eggnogtown/teshnest) +/area/redgate/eggnogtown/teshnest) "Dj" = ( /obj/structure/table/darkglass, /obj/item/weapon/deck/cards, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "DG" = ( /obj/structure/bonfire/sifwood, /turf/simulated/floor/beach/sand{ outdoors = 1; temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead) +/area/redgate/eggnogtown/houserhomestead) "DH" = ( /obj/structure/table/marble, /obj/machinery/microwave/advanced, @@ -2639,18 +2613,18 @@ dir = 1 }, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "DK" = ( /obj/structure/bed/chair/sofa/beige{ dir = 4 }, /turf/simulated/floor/wmarble, -/area/gateway/eggnogtown/arturoswolfden) +/area/redgate/eggnogtown/arturoswolfden) "DM" = ( /turf/simulated/floor/outdoors/newdirt_nograss{ temperature = 258.15 }, -/area/gateway/eggnogtown/hall) +/area/redgate/eggnogtown/hall) "DP" = ( /obj/machinery/light_switch{ dir = 4; @@ -2658,41 +2632,41 @@ pixel_x = -25 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge/room2) +/area/redgate/eggnogtown/visitorlounge/room2) "DR" = ( /obj/structure/bed/chair/sofa/left/black{ dir = 8 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "DS" = ( /obj/structure/table/woodentable, /obj/random/maintenance, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome/office) +/area/redgate/eggnogtown/cavehome/office) "DW" = ( /obj/machinery/light/small{ dir = 4 }, /turf/simulated/floor/tiled, -/area/gateway/eggnogtown/stokeswashere/bathroom) +/area/redgate/eggnogtown/stokeswashere/bathroom) "Er" = ( /obj/structure/bonfire, /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome) +/area/redgate/eggnogtown/cavehome) "Ew" = ( /obj/structure/table/marble, /obj/item/weapon/storage/box/donkpockets, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "Ey" = ( /obj/structure/bookcase, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/arturoswolfden) +/area/redgate/eggnogtown/arturoswolfden) "Ez" = ( /obj/structure/fans/tiny, /obj/machinery/door/airlock/freezer{ @@ -2701,63 +2675,63 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/sigloo) +/area/redgate/eggnogtown/sigloo) "EC" = ( /obj/structure/table/marble, /obj/item/weapon/storage/fancy/egg_box, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "EI" = ( /obj/structure/bed/double/padded, /obj/item/weapon/bedsheet/purpledouble, /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/kitchihome/bedroom) +/area/redgate/eggnogtown/kitchihome/bedroom) "EK" = ( /obj/structure/bonfire, /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/hall) +/area/redgate/eggnogtown/hall) "ES" = ( /obj/structure/bed/chair/sofa/left/black, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "EZ" = ( /obj/structure/bed/chair/sofa, /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "Fd" = ( /obj/structure/bonfire/permanent, /turf/simulated/floor/outdoors/newdirt{ outdoors = 0 }, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "Fe" = ( /turf/simulated/wall/wood, -/area/gateway/eggnogtown/dining) +/area/redgate/eggnogtown/dining) "Fj" = ( -/obj/machinery/vending/cola/soft, +/obj/random/vendordrink, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "Fk" = ( /obj/structure/bed/chair/sofa/black, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "Fm" = ( /obj/machinery/cell_charger, /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "Fo" = ( /obj/move_trader_landmark{ dir = 8; trader_type = /obj/trader/general }, /turf/simulated/floor/bmarble, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "Fs" = ( /obj/move_trader_landmark{ dir = 4; @@ -2766,20 +2740,20 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "Ft" = ( /turf/simulated/floor/tiled/monotile, -/area/gateway/eggnogtown/dining/botany) +/area/redgate/eggnogtown/dining/botany) "Fu" = ( /obj/structure/simple_door/wood, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/diningroom) +/area/redgate/eggnogtown/kitchihome/diningroom) "FF" = ( /turf/simulated/floor/beach/sand{ outdoors = 1; temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead) +/area/redgate/eggnogtown/houserhomestead) "FH" = ( /obj/structure/bed/chair/sofa/beige{ dir = 8 @@ -2787,7 +2761,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "FL" = ( /obj/structure/bed/chair/sofa/left/black{ dir = 4 @@ -2795,7 +2769,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/eastcaveland) +/area/redgate/eggnogtown/eastcaveland) "FQ" = ( /obj/structure/closet/walllocker_double{ pixel_y = 28 @@ -2806,55 +2780,55 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead) +/area/redgate/eggnogtown/houserhomestead) "FR" = ( /obj/structure/table/fancyblack, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/diningroom) +/area/redgate/eggnogtown/kitchihome/diningroom) "FY" = ( /obj/structure/fans/tiny, /obj/machinery/door/airlock/freezer{ name = "Automatic Door" }, /turf/simulated/floor/tiled/steel_ridged, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "Ga" = ( /obj/structure/table/woodentable, /obj/random/maintenance, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "Gh" = ( /obj/machinery/chem_master/condimaster, /turf/simulated/floor/tiled/eris/cafe, -/area/gateway/eggnogtown/dining/kitchen) +/area/redgate/eggnogtown/dining/kitchen) "Gl" = ( /turf/simulated/wall/r_wall, -/area/gateway/eggnogtown/kitchihome/den) +/area/redgate/eggnogtown/kitchihome/den) "Gq" = ( /obj/structure/table/marble, /obj/machinery/microwave, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "Gz" = ( /obj/structure/table/woodentable, /obj/random/maintenance, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad) +/area/redgate/eggnogtown/alipad) "GA" = ( /obj/effect/decal/remains/ribcage, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/eastcaveland) +/area/redgate/eggnogtown/eastcaveland) "GG" = ( /turf/simulated/wall/iron, -/area/gateway/eggnogtown/stokeswashere/bedroom) +/area/redgate/eggnogtown/stokeswashere/bedroom) "GL" = ( /obj/structure/bookcase, /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "GQ" = ( /obj/structure/barricade/cutout, /obj/structure/cable/yellow{ @@ -2875,39 +2849,39 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "GW" = ( /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "GY" = ( /obj/structure/closet/secure_closet/freezer/meat, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "Hj" = ( /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/alipad/bedroom) +/area/redgate/eggnogtown/alipad/bedroom) "Hl" = ( /obj/structure/bookcase, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/bedroom) +/area/redgate/eggnogtown/kitchihome/bedroom) "Hr" = ( /turf/simulated/wall/log, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "Hw" = ( /turf/simulated/floor/wood, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "HC" = ( /obj/structure/bed/chair/comfy/black{ dir = 8 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/diningroom) +/area/redgate/eggnogtown/kitchihome/diningroom) "HG" = ( /obj/structure/railing{ dir = 8 }, /turf/simulated/floor/bmarble, -/area/gateway/eggnogtown/hall) +/area/redgate/eggnogtown/hall) "HJ" = ( /obj/structure/table/woodentable, /obj/random/maintenance, @@ -2916,24 +2890,23 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/eastcaveland) +/area/redgate/eggnogtown/eastcaveland) "HK" = ( /obj/structure/table/woodentable, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "HM" = ( /obj/structure/bed/chair/sofa/beige{ dir = 1 }, /turf/simulated/floor/wmarble, -/area/gateway/eggnogtown/arturoswolfden) +/area/redgate/eggnogtown/arturoswolfden) "HP" = ( -/obj/machinery/gateway, /obj/effect/floor_decal/industrial/warning, /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/gateway) +/area/redgate/eggnogtown/telecomms) "HR" = ( /obj/machinery/light_switch{ dir = 8; @@ -2942,7 +2915,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome) +/area/redgate/eggnogtown/cavehome) "HT" = ( /obj/structure/railing{ dir = 4 @@ -2950,48 +2923,48 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/sigloo) +/area/redgate/eggnogtown/sigloo) "Ie" = ( /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "If" = ( /obj/structure/railing{ dir = 4 }, /turf/simulated/floor/bmarble, -/area/gateway/eggnogtown/hall) +/area/redgate/eggnogtown/hall) "Iq" = ( /turf/simulated/floor/outdoors/newdirt_nograss{ temperature = 258.15 }, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "It" = ( /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/alipad) +/area/redgate/eggnogtown/alipad) "Iw" = ( /turf/simulated/floor/bmarble, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "IA" = ( /obj/machinery/alarm/alarms_hidden{ dir = 4; pixel_x = -21 }, /turf/simulated/floor/bmarble, -/area/gateway/eggnogtown/hall) +/area/redgate/eggnogtown/hall) "II" = ( /obj/item/weapon/stool/padded, /obj/effect/floor_decal/spline/plain{ dir = 4 }, /turf/simulated/floor/lino, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "IJ" = ( /obj/structure/table/standard, /obj/machinery/microwave, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "IO" = ( /obj/machinery/vending/hydronutrients{ dir = 1 @@ -2999,7 +2972,7 @@ /turf/simulated/floor/tiled/asteroid_steel/outdoors{ outdoors = 0 }, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "IR" = ( /obj/structure/closet, /obj/random/awayloot, @@ -3009,11 +2982,11 @@ /obj/random/maintenance, /obj/random/maintenance, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/arturoswolfden) +/area/redgate/eggnogtown/arturoswolfden) "IW" = ( /obj/structure/bed/chair/sofa/left/black, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "Jc" = ( /obj/structure/table/rack, /obj/item/weapon/reagent_containers/spray/cleaner, @@ -3022,23 +2995,23 @@ /obj/item/weapon/reagent_containers/spray/cleaner, /obj/item/weapon/reagent_containers/spray/cleaner, /turf/simulated/floor/tiled/techmaint, -/area/gateway/eggnogtown/dining/storage) +/area/redgate/eggnogtown/dining/storage) "Jk" = ( /obj/machinery/biogenerator, /turf/simulated/floor/tiled/monotile, -/area/gateway/eggnogtown/dining/botany) +/area/redgate/eggnogtown/dining/botany) "Jm" = ( /turf/simulated/floor/outdoors/newdirt{ outdoors = 0 }, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "Jp" = ( /obj/machinery/door/airlock{ id_tag = "winterb"; name = "Automatic Door" }, /turf/simulated/floor/tiled/steel_ridged, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "JE" = ( /obj/structure/table/standard, /obj/item/trash/bowl, @@ -3046,24 +3019,24 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "JF" = ( /turf/simulated/floor/beach/sand{ outdoors = 1; temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "JM" = ( /obj/structure/fans/tiny, /obj/machinery/door/airlock/freezer{ name = "Automatic Door" }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "JT" = ( /obj/structure/bed/chair/comfy/black, /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "JW" = ( /obj/structure/closet/secure_closet/freezer/fridge, /obj/random/meat, @@ -3082,7 +3055,7 @@ /obj/random/meat, /obj/random/meat, /turf/simulated/floor/tiled/eris/cafe, -/area/gateway/eggnogtown/dining/kitchen) +/area/redgate/eggnogtown/dining/kitchen) "JX" = ( /obj/machinery/light_switch{ dir = 4; @@ -3090,33 +3063,33 @@ pixel_x = -25 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad/bedroom) +/area/redgate/eggnogtown/alipad/bedroom) "Ka" = ( /obj/structure/table/rack/shelf/steel, /obj/random/drinkbottle, /obj/random/drinkbottle, /obj/random/drinkbottle, /turf/simulated/floor/tiled/eris/cafe, -/area/gateway/eggnogtown/dining/kitchen) +/area/redgate/eggnogtown/dining/kitchen) "Kb" = ( /obj/machinery/light/flamp, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "Kf" = ( /obj/structure/bed/chair/comfy/black{ dir = 1 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad) +/area/redgate/eggnogtown/alipad) "Kj" = ( /turf/simulated/wall/wood, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "Kl" = ( /obj/structure/simple_door/wood, /turf/simulated/floor/tiled/steel_ridged, -/area/gateway/eggnogtown/dining/botany) +/area/redgate/eggnogtown/dining/botany) "Ky" = ( /obj/structure/bed/chair/comfy{ dir = 8 @@ -3124,7 +3097,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "KE" = ( /obj/structure/bed/chair/sofa/black{ dir = 4 @@ -3134,7 +3107,7 @@ trader_type = /obj/trader/general }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "KI" = ( /obj/structure/bed/chair/sofa/left/black{ dir = 1 @@ -3150,7 +3123,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead) +/area/redgate/eggnogtown/houserhomestead) "KN" = ( /obj/structure/grille, /obj/structure/window/reinforced, @@ -3163,7 +3136,7 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "KS" = ( /obj/structure/railing{ dir = 1 @@ -3171,27 +3144,27 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/sigloo) +/area/redgate/eggnogtown/sigloo) "La" = ( /obj/machinery/light/small{ dir = 8 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/diningroom) +/area/redgate/eggnogtown/kitchihome/diningroom) "Lb" = ( /turf/simulated/wall/wood, -/area/gateway/eggnogtown/dining/kitchen) +/area/redgate/eggnogtown/dining/kitchen) "Lg" = ( /obj/structure/table/rack/steel, /obj/random/awayloot, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/hall/north) +/area/redgate/eggnogtown/hall/north) "LJ" = ( /obj/machinery/light/small{ dir = 1 }, /turf/simulated/floor/bmarble, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "LL" = ( /obj/random/drinkbottle, /obj/random/drinkbottle, @@ -3204,11 +3177,11 @@ /obj/random/drinksoft, /obj/random/drinksoft, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "LT" = ( /obj/machinery/light/small, /turf/simulated/floor/bmarble, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "LX" = ( /obj/structure/table/wooden_reinforced, /obj/machinery/button/remote/airlock{ @@ -3218,60 +3191,60 @@ specialfunctions = 4 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge/room2) +/area/redgate/eggnogtown/visitorlounge/room2) "Mf" = ( -/turf/simulated/mineral/floor/ignore_cavegen{ +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/caves) +/area/redgate/eggnogtown/caves) "Mg" = ( /obj/structure/grille, /obj/structure/window/reinforced/full, /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/hall/north) +/area/redgate/eggnogtown/hall/north) "Mi" = ( /turf/simulated/floor/bmarble, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "Ml" = ( /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "Mn" = ( /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/sigloo) +/area/redgate/eggnogtown/sigloo) "Mp" = ( /obj/structure/railing{ dir = 4 }, /obj/structure/bonfire/sifwood, /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/alipad) +/area/redgate/eggnogtown/alipad) "Mr" = ( /obj/structure/table/marble, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "Mx" = ( /obj/structure/flora/tree/pine, /turf/simulated/floor/outdoors/snow{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "My" = ( /obj/machinery/light_switch{ pixel_x = 22; pixel_y = 26 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "MA" = ( /obj/machinery/light/small, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/diningroom) +/area/redgate/eggnogtown/kitchihome/diningroom) "MB" = ( /obj/structure/bed/chair/sofa/black{ dir = 8 @@ -3279,12 +3252,12 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/eastcaveland) +/area/redgate/eggnogtown/eastcaveland) "MD" = ( /obj/structure/railing, /obj/structure/bonfire/sifwood, /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/alipad/bedroom) +/area/redgate/eggnogtown/alipad/bedroom) "MH" = ( /obj/machinery/light_switch{ dir = 8; @@ -3293,11 +3266,11 @@ pixel_y = -26 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/diningroom) +/area/redgate/eggnogtown/kitchihome/diningroom) "MI" = ( /obj/structure/bed/chair/sofa/right/black, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "MN" = ( /obj/structure/railing{ dir = 4 @@ -3305,48 +3278,48 @@ /turf/simulated/open{ temperature = 303.15 }, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "MO" = ( /turf/simulated/wall/log, -/area/gateway/eggnogtown/kitchihome/bedroom) +/area/redgate/eggnogtown/kitchihome/bedroom) "MV" = ( /obj/structure/bed/pod, /obj/structure/curtain/open/bed, /obj/item/weapon/bedsheet/purple, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge/room1) +/area/redgate/eggnogtown/visitorlounge/room1) "MZ" = ( /turf/simulated/wall/iron, -/area/gateway/eggnogtown/hall) +/area/redgate/eggnogtown/hall) "Na" = ( /obj/structure/bed/chair/wood/wings{ dir = 8 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/dining) +/area/redgate/eggnogtown/dining) "Nc" = ( /obj/structure/simple_door/wood, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome/office) +/area/redgate/eggnogtown/cavehome/office) "Nd" = ( /turf/simulated/wall/iron, -/area/gateway/eggnogtown/hall/north) +/area/redgate/eggnogtown/hall/north) "Nl" = ( /obj/machinery/hologram/holopad, /turf/simulated/floor/lino, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "Nm" = ( /turf/simulated/floor/wood, -/area/gateway/eggnogtown/dining) +/area/redgate/eggnogtown/dining) "Nr" = ( /obj/machinery/door/airlock/freezer{ name = "Automatic Door" }, /obj/structure/fans/tiny, /turf/simulated/floor/bmarble, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "Nt" = ( /obj/structure/noticeboard{ pixel_y = 32 @@ -3358,28 +3331,28 @@ outdoors = 1; temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead) +/area/redgate/eggnogtown/houserhomestead) "Nw" = ( /turf/simulated/wall/iron, -/area/gateway/eggnogtown/stokeswashere/bathroom) +/area/redgate/eggnogtown/stokeswashere/bathroom) "Nz" = ( /obj/machinery/appliance/cooker/grill, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "NA" = ( /turf/simulated/wall/iron, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "NI" = ( /obj/machinery/appliance/cooker/fryer, /obj/machinery/light{ dir = 1 }, /turf/simulated/floor/tiled/eris/cafe, -/area/gateway/eggnogtown/dining/kitchen) +/area/redgate/eggnogtown/dining/kitchen) "NX" = ( /obj/structure/bed/chair/bay/chair/padded/red/bignest, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "Og" = ( /obj/machinery/light/small{ dir = 1 @@ -3387,26 +3360,26 @@ /turf/simulated/floor/outdoors/snow{ temperature = 258.15 }, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "Ok" = ( /obj/item/clothing/shoes/boots/winter/climbing, /obj/structure/table/rack/shelf/steel, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "Oq" = ( /obj/structure/bed/chair/sofa/right/black{ dir = 4 }, /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/kitchihome/den) +/area/redgate/eggnogtown/kitchihome/den) "Ov" = ( /obj/structure/table/woodentable, /obj/random/maintenance, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/arturoswolfden) +/area/redgate/eggnogtown/arturoswolfden) "OC" = ( /turf/simulated/wall/log, -/area/gateway/eggnogtown/kitchihome/guestroom) +/area/redgate/eggnogtown/kitchihome/guestroom) "OD" = ( /obj/structure/railing/grey{ dir = 4 @@ -3414,17 +3387,17 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "OF" = ( /obj/structure/table/standard, /obj/random/maintenance, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/arturoswolfden) +/area/redgate/eggnogtown/arturoswolfden) "OH" = ( /turf/simulated/floor/outdoors/snow{ temperature = 258.15 }, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "OM" = ( /obj/structure/closet/walllocker_double{ dir = 1; @@ -3433,7 +3406,7 @@ /obj/fiftyspawner/log, /obj/fiftyspawner/log, /turf/simulated/floor/bmarble, -/area/gateway/eggnogtown/hall) +/area/redgate/eggnogtown/hall) "ON" = ( /obj/item/trash/candle, /obj/structure/cable/yellow{ @@ -3443,79 +3416,79 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "OO" = ( /obj/machinery/appliance/cooker/oven, /turf/simulated/floor/tiled/eris/cafe, -/area/gateway/eggnogtown/dining/kitchen) +/area/redgate/eggnogtown/dining/kitchen) "Pa" = ( /obj/structure/simple_door/wood, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "Pc" = ( /obj/structure/table/standard, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "Pe" = ( /obj/structure/bonfire, /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "Pi" = ( /obj/machinery/alarm/alarms_hidden{ dir = 4; pixel_x = -21 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "Po" = ( /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/kitchihome/bedroom) +/area/redgate/eggnogtown/kitchihome/bedroom) "Ps" = ( /obj/machinery/door/airlock/freezer{ name = "Automatic Door" }, /turf/simulated/floor/tiled/steel_ridged, -/area/gateway/eggnogtown/dining/botany) +/area/redgate/eggnogtown/dining/botany) "Pt" = ( /obj/machinery/alarm/alarms_hidden{ dir = 4; pixel_x = -21 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "Pu" = ( /turf/simulated/wall/iron, -/area/gateway/eggnogtown/alipad) +/area/redgate/eggnogtown/alipad) "Px" = ( /obj/machinery/light_switch{ pixel_x = 28; pixel_y = 26 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/den) +/area/redgate/eggnogtown/kitchihome/den) "Py" = ( /obj/machinery/light/small{ dir = 4 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/guestroom) +/area/redgate/eggnogtown/kitchihome/guestroom) "PB" = ( /obj/machinery/light{ dir = 8 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad) +/area/redgate/eggnogtown/alipad) "PD" = ( /obj/structure/fans/tiny, /obj/structure/simple_door/iron, /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead) +/area/redgate/eggnogtown/houserhomestead) "PJ" = ( /obj/structure/railing/grey{ dir = 4 @@ -3526,7 +3499,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "PM" = ( /obj/structure/closet, /obj/random/maintenance, @@ -3538,17 +3511,17 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome/bedroom) +/area/redgate/eggnogtown/cavehome/bedroom) "PN" = ( /obj/structure/bed/chair/comfy/black{ dir = 4 }, /turf/simulated/floor/tiled, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "PO" = ( /obj/structure/closet/secure_closet/freezer/fridge, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "PP" = ( /obj/structure/cable/yellow{ icon_state = "0-6" @@ -3565,10 +3538,10 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "PU" = ( /turf/simulated/wall/wood, -/area/gateway/eggnogtown/caves) +/area/redgate/eggnogtown/caves) "PV" = ( /obj/machinery/button/remote/airlock{ id = "wintera"; @@ -3577,7 +3550,7 @@ specialfunctions = 4 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge/room1) +/area/redgate/eggnogtown/visitorlounge/room1) "PX" = ( /obj/structure/sink{ dir = 4; @@ -3588,15 +3561,15 @@ pixel_y = 5 }, /turf/simulated/floor/tiled, -/area/gateway/eggnogtown/stokeswashere/bathroom) +/area/redgate/eggnogtown/stokeswashere/bathroom) "PY" = ( /obj/structure/table/darkglass, /obj/item/weapon/storage/pill_bottle/dice_nerd, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "Qh" = ( /turf/simulated/wall/iron, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "Qr" = ( /obj/structure/cable/yellow{ icon_state = "2-5" @@ -3604,42 +3577,39 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "QD" = ( /obj/effect/landmark/map_data/eggnogtown, /turf/unsimulated/mineral{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "QL" = ( /obj/structure/table/woodentable, /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/hall/north) +/area/redgate/eggnogtown/hall/north) "QM" = ( /obj/structure/simple_door/wood, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad) +/area/redgate/eggnogtown/alipad) "QT" = ( /turf/simulated/wall/iron, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "QV" = ( -/obj/machinery/gateway{ - dir = 6 - }, /obj/effect/floor_decal/industrial/warning{ dir = 6 }, /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/gateway) +/area/redgate/eggnogtown/telecomms) "QW" = ( /obj/structure/bed/chair/sofa{ dir = 8 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad) +/area/redgate/eggnogtown/alipad) "QY" = ( /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "Rd" = ( /obj/structure/table/marble, /obj/item/weapon/material/kitchen/rollingpin, @@ -3648,21 +3618,21 @@ /obj/item/weapon/reagent_containers/food/condiment/spacespice, /obj/item/weapon/reagent_containers/food/condiment/yeast, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "Ri" = ( /obj/machinery/light_switch{ on = 0; pixel_y = 27 }, /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "Rn" = ( /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/diningroom) +/area/redgate/eggnogtown/kitchihome/diningroom) "Rq" = ( /obj/effect/floor_decal/spline/plain, /turf/simulated/floor/lino, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "Ru" = ( /obj/structure/bed/chair/comfy/beige{ dir = 1 @@ -3670,15 +3640,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere) -"RD" = ( -/obj/structure/fans/tiny, -/obj/machinery/door/airlock/hatch{ - name = "Telecomms Access"; - req_one_access = list() - }, -/turf/simulated/floor/tiled/steel_ridged, -/area/gateway/eggnogtown/gateway) +/area/redgate/eggnogtown/stokeswashere) "RM" = ( /obj/structure/bed/chair/sofa/black{ dir = 4 @@ -3687,18 +3649,18 @@ dir = 8 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "RN" = ( /obj/structure/bed/double/padded, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad/bedroom) +/area/redgate/eggnogtown/alipad/bedroom) "RU" = ( /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge/room2) +/area/redgate/eggnogtown/visitorlounge/room2) "Sa" = ( /obj/item/weapon/stool/padded, /turf/simulated/floor/lino, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "Sd" = ( /obj/structure/bed/chair/comfy/black{ dir = 4 @@ -3706,21 +3668,21 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome/office) +/area/redgate/eggnogtown/cavehome/office) "Sj" = ( /turf/simulated/floor/outdoors/snow{ temperature = 258.15 }, -/area/gateway/eggnogtown/hall) +/area/redgate/eggnogtown/hall) "SA" = ( /obj/machinery/light/small{ dir = 4 }, /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/kitchihome/bedroom) +/area/redgate/eggnogtown/kitchihome/bedroom) "SF" = ( /turf/simulated/floor/lino, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "SG" = ( /obj/machinery/light/small{ dir = 8 @@ -3728,11 +3690,11 @@ /turf/simulated/floor/outdoors/snow{ temperature = 258.15 }, -/area/gateway/eggnogtown/hall) +/area/redgate/eggnogtown/hall) "SP" = ( /obj/structure/table/woodentable, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/arturoswolfden) +/area/redgate/eggnogtown/arturoswolfden) "SS" = ( /obj/machinery/light_switch{ dir = 4; @@ -3742,77 +3704,77 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome/bedroom) +/area/redgate/eggnogtown/cavehome/bedroom) "SU" = ( /obj/structure/closet/secure_closet/freezer/kitchen, /obj/machinery/light/small{ dir = 4 }, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "SX" = ( /obj/machinery/appliance/cooker/oven, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "SY" = ( /turf/simulated/wall/log, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "Ta" = ( /obj/structure/window/basic/full, /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/alipad) +/area/redgate/eggnogtown/alipad) "Td" = ( /obj/structure/bed/chair/bay/chair/padded/red/bignest, /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "Tf" = ( /obj/machinery/light/small, /turf/simulated/floor/outdoors/snow{ temperature = 258.15 }, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "Th" = ( /obj/structure/table/marble, /turf/simulated/floor/lino, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "Tn" = ( /turf/simulated/floor/wood, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "Tv" = ( /turf/simulated/floor/tiled/monotile, -/area/gateway/eggnogtown/dining) +/area/redgate/eggnogtown/dining) "Tz" = ( /obj/structure/table/woodentable, /obj/random/awayloot, /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "TD" = ( /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "TH" = ( /obj/structure/bed/chair/sofa/right/black, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "TI" = ( /obj/structure/grille, /obj/structure/window/reinforced/full, /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "TL" = ( /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/eastcaveland) +/area/redgate/eggnogtown/eastcaveland) "TN" = ( /obj/machinery/door/airlock/maintenance, /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "TR" = ( /obj/structure/table/rack, /obj/random/awayloot, @@ -3821,21 +3783,21 @@ /turf/simulated/floor/tiled/techmaint{ temperature = 258.15 }, -/area/gateway/eggnogtown/storage) +/area/redgate/eggnogtown/storage) "TV" = ( /obj/structure/closet/secure_closet/freezer/meat, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "TZ" = ( /obj/structure/simple_door/wood, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/cavehome) +/area/redgate/eggnogtown/cavehome) "Ua" = ( /obj/structure/flora/pottedplant/xmas, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/dining) +/area/redgate/eggnogtown/dining) "Uk" = ( /obj/structure/railing{ dir = 1 @@ -3843,106 +3805,109 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead) +/area/redgate/eggnogtown/houserhomestead) "Um" = ( /obj/structure/railing, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/sigloo) +/area/redgate/eggnogtown/sigloo) "Un" = ( /obj/structure/table/woodentable, /obj/item/clothing/head/helmet/space/santahat, /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "Uu" = ( /obj/machinery/door/airlock/freezer{ name = "Automatic Door" }, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "UK" = ( /obj/item/weapon/material/minihoe, /obj/item/weapon/material/knife/machete/hatchet, /turf/simulated/floor/outdoors/grass{ outdoors = 0 }, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "UL" = ( /obj/machinery/portable_atmospherics/hydroponics, /turf/simulated/floor/tiled/monotile, -/area/gateway/eggnogtown/dining/botany) +/area/redgate/eggnogtown/dining/botany) "UO" = ( /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/diningroom) +/area/redgate/eggnogtown/kitchihome/diningroom) "UR" = ( /obj/machinery/light{ dir = 4 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad) +/area/redgate/eggnogtown/alipad) "US" = ( /obj/structure/bed/double/padded, /obj/item/weapon/bedsheet/iandouble, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere/bedroom) +/area/redgate/eggnogtown/stokeswashere/bedroom) "UV" = ( /obj/structure/table/rack/steel, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/hall/north) +/area/redgate/eggnogtown/hall/north) "UW" = ( /obj/structure/table/woodentable, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad/bedroom) +/area/redgate/eggnogtown/alipad/bedroom) "UX" = ( /obj/structure/flora/pottedplant/minitree, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/hall/north) +/area/redgate/eggnogtown/hall/north) "UY" = ( /obj/structure/bed/chair/wood, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead) +/area/redgate/eggnogtown/houserhomestead) "Ve" = ( /turf/simulated/wall/snowbrick, -/area/gateway/eggnogtown/nigloo) +/area/redgate/eggnogtown/nigloo) "Vi" = ( /obj/structure/table/wooden_reinforced, /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/kitchihome/den) +/area/redgate/eggnogtown/kitchihome/den) "Vm" = ( /obj/machinery/light_switch{ pixel_x = 22; pixel_y = 26 }, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "Vq" = ( /obj/structure/fans/tiny, -/obj/machinery/door/airlock/glass, +/obj/machinery/door/airlock/hatch{ + name = "Telecomms Access"; + req_one_access = list() + }, /turf/simulated/floor/tiled/steel_ridged, -/area/gateway/eggnogtown/gateway) +/area/redgate/eggnogtown/telecomms) "Vx" = ( /turf/simulated/floor/outdoors/snow{ temperature = 258.15 }, -/area/gateway/eggnogtown/alipad) +/area/redgate/eggnogtown/alipad) "Vz" = ( /obj/structure/bookcase, /obj/machinery/light{ dir = 4 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad/bedroom) +/area/redgate/eggnogtown/alipad/bedroom) "VC" = ( /obj/structure/bookcase, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "VJ" = ( /obj/structure/closet, /obj/item/weapon/cell/hyper, @@ -3950,86 +3915,86 @@ /obj/random/maintenance, /obj/random/maintenance, /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "VM" = ( /turf/simulated/floor/wood, -/area/gateway/eggnogtown/arturoswolfden) +/area/redgate/eggnogtown/arturoswolfden) "VP" = ( /obj/machinery/light/small, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "VQ" = ( /obj/structure/railing, /turf/simulated/floor/tiled, -/area/gateway/eggnogtown/cavehome) +/area/redgate/eggnogtown/cavehome) "VZ" = ( /turf/simulated/floor/tiled/eris/cafe, -/area/gateway/eggnogtown/dining/kitchen) +/area/redgate/eggnogtown/dining/kitchen) "Wd" = ( /obj/structure/table/marble, /obj/item/weapon/tape_roll, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "Wf" = ( /turf/simulated/wall/iron, -/area/gateway/eggnogtown/cavehome) +/area/redgate/eggnogtown/cavehome) "Wr" = ( /turf/simulated/floor/outdoors/newdirt_nograss{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "Ww" = ( /obj/structure/table/fancyblack, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/dining) +/area/redgate/eggnogtown/dining) "WF" = ( /obj/structure/bed/double/padded, /obj/item/weapon/bedsheet/bluedouble, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead) +/area/redgate/eggnogtown/houserhomestead) "WH" = ( /obj/structure/window/basic/full, /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/eastcaveland) +/area/redgate/eggnogtown/eastcaveland) "WM" = ( /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "WS" = ( /obj/structure/simple_door/wood, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad/bedroom) +/area/redgate/eggnogtown/alipad/bedroom) "Xb" = ( -/turf/simulated/mineral/ignore_cavegen{ +/turf/simulated/mineral/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/caves) +/area/redgate/eggnogtown/caves) "Xc" = ( /obj/structure/flora/pottedplant/xmas, /obj/machinery/light/small{ dir = 1 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "Xh" = ( /turf/simulated/wall/wood, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "Xm" = ( /obj/structure/bed/chair/sofa/left/black, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome) +/area/redgate/eggnogtown/cavehome) "Xp" = ( /turf/simulated/floor/outdoors/snow{ temperature = 258.15 }, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "Xq" = ( /obj/structure/table/glass, /obj/machinery/light_switch{ @@ -4039,13 +4004,13 @@ }, /obj/item/clothing/head/hardhat, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "Xx" = ( /obj/structure/bed/chair/wood{ dir = 1 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad/bedroom) +/area/redgate/eggnogtown/alipad/bedroom) "XA" = ( /obj/structure/grille, /obj/structure/window/reinforced{ @@ -4060,56 +4025,56 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "XB" = ( /obj/machinery/appliance/cooker/grill, /turf/simulated/floor/tiled/eris/cafe, -/area/gateway/eggnogtown/dining/kitchen) +/area/redgate/eggnogtown/dining/kitchen) "XE" = ( /obj/machinery/portable_atmospherics/hydroponics/soil, /obj/machinery/light{ dir = 4 }, /turf/simulated/floor/outdoors/grass/forest, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "XF" = ( /turf/simulated/wall/wood, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "XK" = ( /obj/effect/map_effect/perma_light/gateway{ light_color = "#fc8c03"; light_power = .5 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "XU" = ( /obj/structure/bed/chair/backed_grey{ dir = 1 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge) +/area/redgate/eggnogtown/visitorlounge) "Yb" = ( /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad/bedroom) +/area/redgate/eggnogtown/alipad/bedroom) "Yc" = ( /turf/simulated/wall/iron, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "Yd" = ( /turf/simulated/floor/tiled, -/area/gateway/eggnogtown/cavehome) +/area/redgate/eggnogtown/cavehome) "Ym" = ( /obj/machinery/light/small{ dir = 1 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/visitorlounge/room2) +/area/redgate/eggnogtown/visitorlounge/room2) "Yo" = ( /obj/machinery/light_switch{ on = 0; pixel_y = 27 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/dining) +/area/redgate/eggnogtown/dining) "Yq" = ( /obj/structure/bed/chair/sofa/beige{ dir = 8 @@ -4118,13 +4083,13 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/sigloo) +/area/redgate/eggnogtown/sigloo) "Yr" = ( /obj/machinery/vending/dinnerware{ dir = 8 }, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "Yv" = ( /obj/machinery/light_switch{ on = 0; @@ -4133,43 +4098,43 @@ /turf/simulated/floor/tiled/techmaint{ temperature = 258.15 }, -/area/gateway/eggnogtown/storage) +/area/redgate/eggnogtown/storage) "Yw" = ( /turf/simulated/wall/wood, -/area/gateway/eggnogtown/alipad/bedroom) +/area/redgate/eggnogtown/alipad/bedroom) "YB" = ( /obj/structure/bed/chair/sofa/black, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/cavehome) +/area/redgate/eggnogtown/cavehome) "YD" = ( /obj/structure/bed/chair/sofa/corner/black{ dir = 1 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "YE" = ( /turf/simulated/floor/wood, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "YO" = ( /turf/simulated/floor/reinforced, -/area/gateway/eggnogtown) +/area/redgate/eggnogtown) "YP" = ( /obj/structure/bed/chair/sofa/corner/beige{ dir = 4 }, /turf/simulated/floor/wmarble, -/area/gateway/eggnogtown/arturoswolfden) +/area/redgate/eggnogtown/arturoswolfden) "YS" = ( /obj/structure/bed/chair/sofa/beige, /turf/simulated/floor/wmarble, -/area/gateway/eggnogtown/arturoswolfden) +/area/redgate/eggnogtown/arturoswolfden) "YZ" = ( /turf/simulated/floor/outdoors/grass{ outdoors = 0 }, -/area/gateway/eggnogtown/greenhouse) +/area/redgate/eggnogtown/greenhouse) "Zh" = ( /obj/machinery/light/small{ dir = 1 @@ -4177,7 +4142,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/stokeswashere) +/area/redgate/eggnogtown/stokeswashere) "Zl" = ( /obj/structure/table/marble, /obj/item/weapon/reagent_containers/food/condiment/ketchup, @@ -4185,7 +4150,7 @@ /obj/item/weapon/reagent_containers/food/condiment/enzyme, /obj/item/weapon/reagent_containers/food/condiment/soysauce, /turf/simulated/floor/tiled/eris/white/monofloor, -/area/gateway/eggnogtown/kitchihome/kitchen) +/area/redgate/eggnogtown/kitchihome/kitchen) "Zm" = ( /obj/structure/bed/chair/comfy{ dir = 4 @@ -4193,12 +4158,12 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "Zo" = ( /obj/structure/table/marble, /obj/item/weapon/storage/firstaid, /turf/simulated/floor/lino, -/area/gateway/eggnogtown/bar) +/area/redgate/eggnogtown/bar) "Zr" = ( /obj/structure/bed/chair/wood/wings{ dir = 8 @@ -4208,19 +4173,19 @@ pixel_x = 20 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/dining) +/area/redgate/eggnogtown/dining) "Zs" = ( /obj/structure/railing{ dir = 1 }, /turf/simulated/floor/bmarble, -/area/gateway/eggnogtown/hall) +/area/redgate/eggnogtown/hall) "ZE" = ( /obj/structure/bed/chair/sofa/right{ dir = 8 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/alipad) +/area/redgate/eggnogtown/alipad) "ZG" = ( /obj/machinery/light_switch{ dir = 4; @@ -4229,7 +4194,7 @@ pixel_y = -24 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/kitchihome/bedroom) +/area/redgate/eggnogtown/kitchihome/bedroom) "ZJ" = ( /obj/structure/table/fancyblack, /obj/item/weapon/reagent_containers/food/condiment/small/peppermill{ @@ -4239,28 +4204,28 @@ pixel_x = -3 }, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/dining) +/area/redgate/eggnogtown/dining) "ZM" = ( /obj/structure/table/fancyblack, /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/kitchihome) +/area/redgate/eggnogtown/kitchihome) "ZO" = ( /obj/structure/bed/chair/bay/chair/padded/red/bignest, /turf/simulated/floor/wood, -/area/gateway/eggnogtown/arturoswolfden) +/area/redgate/eggnogtown/arturoswolfden) "ZS" = ( /turf/simulated/wall, -/area/gateway/eggnogtown/loniabode) +/area/redgate/eggnogtown/loniabode) "ZU" = ( /obj/structure/table/woodentable, /turf/simulated/floor/carpet/bcarpet, -/area/gateway/eggnogtown/hall/south) +/area/redgate/eggnogtown/hall/south) "ZW" = ( /obj/structure/table/bench/wooden, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/eastcaveland) +/area/redgate/eggnogtown/eastcaveland) (1,1,1) = {" hj @@ -11697,8 +11662,8 @@ hG hG hG hG -RD -hG +Xb +Xb Xp Xp Xp @@ -11838,9 +11803,9 @@ Xb Xb Xb Xb -hG -kG -hG +Xb +Xb +Xb Xb Xb Xp @@ -11980,9 +11945,9 @@ Xb Xb Xb Xb -hG -hG -hG +Xb +Xb +Xb Xb Xb Xb @@ -13125,7 +13090,7 @@ Xp Xp Xp fb -bA +ym Pi Hw av @@ -13267,7 +13232,7 @@ Xp Xp Xp fb -wu +Fj Hw Hw Hw @@ -14131,7 +14096,7 @@ Hw XK aO aO -aO +kG aO aO WM diff --git a/maps/gateway_vr/eggnogtownunderground.dmm b/maps/redgate/eggnogtownunderground.dmm similarity index 92% rename from maps/gateway_vr/eggnogtownunderground.dmm rename to maps/redgate/eggnogtownunderground.dmm index 27968bf04c..07dc098d4d 100644 --- a/maps/gateway_vr/eggnogtownunderground.dmm +++ b/maps/redgate/eggnogtownunderground.dmm @@ -1,171 +1,133 @@ //MAP CONVERTED BY dmm2tgm.py THIS HEADER COMMENT PREVENTS RECONVERSION, DO NOT REMOVE "aa" = ( -/turf/simulated/mineral/floor/ignore_cavegen{ - nitrogen = 82.1472; - oxygen = 21.8366; +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/underground) +/area/redgate/eggnogtown/underground) "ab" = ( -/turf/simulated/mineral/ignore_cavegen{ - nitrogen = 82.1472; - oxygen = 21.8366; +/turf/simulated/mineral/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/underground) +/area/redgate/eggnogtown/underground) "ac" = ( /obj/random/mob/semirandom_mob_spawner/vore/retaliate, -/turf/simulated/mineral/floor/ignore_cavegen{ - nitrogen = 82.1472; - oxygen = 21.8366; +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/underground) +/area/redgate/eggnogtown/underground) "ad" = ( /obj/machinery/light/small, -/turf/simulated/mineral/floor/ignore_cavegen{ - nitrogen = 82.1472; - oxygen = 21.8366; +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) "ae" = ( /obj/random/mob/semirandom_mob_spawner/vore/retaliate/b, -/turf/simulated/mineral/floor/ignore_cavegen{ - nitrogen = 82.1472; - oxygen = 21.8366; +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/underground) +/area/redgate/eggnogtown/underground) "af" = ( -/turf/simulated/mineral/floor/ignore_cavegen{ - nitrogen = 82.1472; - oxygen = 21.8366; +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 303.15 }, -/area/gateway/eggnogtown/underground) +/area/redgate/eggnogtown/underground) "ag" = ( /obj/random/mob/semirandom_mob_spawner/vore/retaliate/c, -/turf/simulated/mineral/floor/ignore_cavegen{ - nitrogen = 82.1472; - oxygen = 21.8366; +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/underground) +/area/redgate/eggnogtown/underground) "ah" = ( /obj/random/mob/semirandom_mob_spawner/vore/retaliate, -/turf/simulated/mineral/floor/ignore_cavegen{ - nitrogen = 82.1472; - oxygen = 21.8366; +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 303.15 }, -/area/gateway/eggnogtown/underground) +/area/redgate/eggnogtown/underground) "ai" = ( /obj/random/mob/semirandom_mob_spawner/vore/retaliate/c, -/turf/simulated/mineral/floor/ignore_cavegen{ - nitrogen = 82.1472; - oxygen = 21.8366; +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 303.15 }, -/area/gateway/eggnogtown/underground) +/area/redgate/eggnogtown/underground) "aj" = ( /obj/random/mob/semirandom_mob_spawner/vore/retaliate/b, -/turf/simulated/mineral/floor/ignore_cavegen{ - nitrogen = 82.1472; - oxygen = 21.8366; +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 303.15 }, -/area/gateway/eggnogtown/underground) +/area/redgate/eggnogtown/underground) "ak" = ( /obj/machinery/light/small{ dir = 8 }, -/turf/simulated/mineral/floor/ignore_cavegen{ - nitrogen = 82.1472; - oxygen = 21.8366; +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 303.15 }, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "al" = ( /obj/machinery/light/small{ dir = 4 }, -/turf/simulated/mineral/floor/ignore_cavegen{ - nitrogen = 82.1472; - oxygen = 21.8366; +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 303.15 }, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "am" = ( /obj/machinery/light/small{ dir = 8 }, -/turf/simulated/mineral/floor/ignore_cavegen{ - nitrogen = 82.1472; - oxygen = 21.8366; +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/underground) +/area/redgate/eggnogtown/underground) "an" = ( /obj/machinery/camera/network/civilian{ dir = 8 }, -/turf/simulated/mineral/floor/ignore_cavegen{ - nitrogen = 82.1472; - oxygen = 21.8366; +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/underground) +/area/redgate/eggnogtown/underground) "ao" = ( /obj/random/mob/semirandom_mob_spawner/vore/hostile, -/turf/simulated/mineral/floor/ignore_cavegen{ - nitrogen = 82.1472; - oxygen = 21.8366; +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 303.15 }, -/area/gateway/eggnogtown/underground) +/area/redgate/eggnogtown/underground) "ap" = ( /obj/random/awayloot, -/turf/simulated/mineral/floor/ignore_cavegen{ - nitrogen = 82.1472; - oxygen = 21.8366; +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 303.15 }, -/area/gateway/eggnogtown/underground) +/area/redgate/eggnogtown/underground) "aq" = ( /obj/machinery/camera/network/civilian{ dir = 5 }, -/turf/simulated/mineral/floor/ignore_cavegen{ - nitrogen = 82.1472; - oxygen = 21.8366; +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/underground) +/area/redgate/eggnogtown/underground) "ar" = ( /obj/machinery/light/small{ dir = 4 }, -/turf/simulated/mineral/floor/ignore_cavegen{ - nitrogen = 82.1472; - oxygen = 21.8366; +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/underground) +/area/redgate/eggnogtown/underground) "as" = ( -/turf/simulated/mineral/ignore_cavegen{ - nitrogen = 82.1472; - oxygen = 21.8366; +/turf/simulated/mineral/ignore_cavegen/cave{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "ba" = ( /obj/structure/table/wooden_reinforced, /obj/machinery/chemical_dispenser/bar_alc/full, /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "bX" = ( /obj/structure/railing, /obj/structure/railing{ @@ -180,12 +142,12 @@ /obj/structure/catwalk, /obj/structure/bonfire, /turf/simulated/floor/plating, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) "cb" = ( /turf/simulated/floor/bmarble{ temperature = 303.15 }, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "de" = ( /obj/structure/closet/walllocker{ dir = 1; @@ -196,14 +158,14 @@ /turf/simulated/floor/bmarble{ temperature = 303.15 }, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "dn" = ( /obj/machinery/turretid/stun{ ailock = 1; check_arrest = 0; check_down = 0; check_records = 0; - control_area = /area/gateway/eggnogtown/houserhomestead/basement; + control_area = /area/redgate/eggnogtown/houserhomestead/basement; desc = "A firewall prevents AIs from interacting with this device."; lethal_is_configurable = 0; name = "DEATH RAY CONTROL"; @@ -213,13 +175,13 @@ /turf/simulated/floor/plating{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead/basement) +/area/redgate/eggnogtown/houserhomestead/basement) "eo" = ( /obj/structure/bed/chair/sofa/corner, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) "eK" = ( /obj/structure/bed/chair/bay/comfy/black{ dir = 8 @@ -227,14 +189,14 @@ /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "eY" = ( /obj/structure/table/borosilicate, /obj/random/awayloot, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "fV" = ( /obj/structure/closet/walllocker{ dir = 1; @@ -244,7 +206,7 @@ /turf/simulated/floor/bmarble{ temperature = 303.15 }, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "gf" = ( /obj/structure/bed/chair/bay/comfy/black{ dir = 1 @@ -252,50 +214,58 @@ /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "gA" = ( /turf/simulated/floor/beach/water{ name = "hot spring"; temperature = 303.15 }, -/area/gateway/eggnogtown/underground) +/area/redgate/eggnogtown/underground) "gE" = ( /obj/structure/bed/chair/bay/comfy/black, /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "gF" = ( /obj/machinery/porta_turret, /turf/simulated/floor/tiled{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead/basement) +/area/redgate/eggnogtown/houserhomestead/basement) "gP" = ( /obj/structure/closet, /obj/random/awayloot, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) +"hh" = ( +/obj/random/vendorfood{ + dir = 1 + }, +/turf/simulated/floor/bmarble{ + temperature = 303.15 + }, +/area/redgate/eggnogtown/hotsprings) "hM" = ( /obj/structure/curtain, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "iu" = ( /obj/structure/table/wooden_reinforced, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "iB" = ( /obj/structure/stairs/spawner/east, /turf/simulated/floor/bmarble{ temperature = 303.15 }, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "iV" = ( /obj/structure/closet/walllocker{ pixel_y = 26 @@ -304,10 +274,10 @@ /turf/simulated/floor/bmarble{ temperature = 303.15 }, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "kA" = ( /turf/simulated/wall/iron, -/area/gateway/eggnogtown/underground) +/area/redgate/eggnogtown/underground) "kF" = ( /obj/structure/closet/walllocker{ dir = 1; @@ -317,36 +287,36 @@ /turf/simulated/floor/bmarble{ temperature = 303.15 }, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "kK" = ( /obj/structure/fans/tiny, /obj/machinery/door/airlock/freezer{ name = "Automatic Door" }, /turf/simulated/floor/tiled/steel_ridged, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "kS" = ( /obj/structure/bed/chair/sofa/right/black, /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "lo" = ( /obj/structure/bed/chair/sofa/right, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) "lq" = ( /turf/unsimulated/mineral{ temperature = 258.15 }, -/area/gateway/eggnogtown/underground) +/area/redgate/eggnogtown/underground) "lz" = ( /turf/unsimulated/wall/planetary/normal{ temperature = 258.15 }, -/area/gateway/eggnogtown/underground) +/area/redgate/eggnogtown/underground) "lX" = ( /obj/structure/table/woodentable, /obj/item/device/flashlight/lamp, @@ -354,7 +324,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "ma" = ( /obj/machinery/light/small{ dir = 8 @@ -363,23 +333,23 @@ name = "hot spring"; temperature = 303.15 }, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "mf" = ( /obj/structure/simple_door/silver, /turf/simulated/floor/tiled/steel_ridged, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) "nh" = ( /obj/structure/bed/chair/sofa/corner/black, /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "nD" = ( /obj/structure/table/glass, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) "pn" = ( /obj/structure/bed/chair/bay/comfy/red{ dir = 1 @@ -387,7 +357,7 @@ /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "qb" = ( /obj/machinery/light/small{ dir = 4 @@ -395,13 +365,13 @@ /turf/simulated/floor/bmarble{ temperature = 303.15 }, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "qr" = ( /obj/item/weapon/stool/padded, /turf/simulated/floor/tiled/dark{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "qv" = ( /obj/structure/musician/piano{ dir = 4 @@ -409,12 +379,12 @@ /turf/simulated/floor/tiled{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead/basement) +/area/redgate/eggnogtown/houserhomestead/basement) "rj" = ( /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "rZ" = ( /obj/structure/bed/chair/bay/comfy/red{ dir = 4 @@ -422,20 +392,20 @@ /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "sc" = ( /obj/random/mob/semirandom_mob_spawner/vore/passive, /turf/simulated/floor/beach/water{ name = "hot spring"; temperature = 303.15 }, -/area/gateway/eggnogtown/underground) +/area/redgate/eggnogtown/underground) "sj" = ( /obj/structure/table/gamblingtable, /turf/simulated/floor/reinforced{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "sm" = ( /obj/structure/bed/chair/bay/chair/padded/red/bignest, /obj/machinery/light_switch{ @@ -445,7 +415,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) "sq" = ( /obj/machinery/vending/boozeomat{ dir = 4; @@ -454,33 +424,33 @@ /turf/simulated/floor/tiled{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead/basement) +/area/redgate/eggnogtown/houserhomestead/basement) "su" = ( /obj/structure/table/bench/padded, /turf/simulated/floor/carpet/bcarpet{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "tf" = ( /turf/simulated/floor/carpet/bcarpet{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "tI" = ( /turf/simulated/floor/tiled/dark{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "uh" = ( /turf/simulated/wall/wood, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) "up" = ( /obj/structure/railing, /obj/structure/table/wooden_reinforced, /turf/simulated/floor/tiled/dark{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "uG" = ( /obj/structure/table/bench/wooden, /obj/machinery/light/small{ @@ -489,7 +459,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) "uM" = ( /obj/structure/bed/chair/sofa/left{ dir = 8 @@ -497,18 +467,18 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) "vg" = ( /turf/simulated/floor/tiled{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead/basement) +/area/redgate/eggnogtown/houserhomestead/basement) "vv" = ( /obj/machinery/media/jukebox, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "vJ" = ( /obj/structure/grille, /obj/structure/window/reinforced, @@ -516,21 +486,21 @@ dir = 1 }, /turf/simulated/floor/plating, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) "vR" = ( /obj/structure/table/steel, /obj/random/awayloot, /turf/simulated/floor/tiled{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead/basement) +/area/redgate/eggnogtown/houserhomestead/basement) "vW" = ( /obj/structure/table/borosilicate, /obj/item/device/flashlight/lamp/green, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "ws" = ( /obj/structure/railing, /obj/structure/railing{ @@ -539,13 +509,13 @@ /turf/simulated/floor/tiled/dark{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "wu" = ( /obj/structure/bed/chair/bay/chair/padded/red/smallnest, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "xk" = ( /obj/structure/bed/chair/comfy/red{ dir = 4 @@ -553,30 +523,30 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "xA" = ( /obj/structure/table/steel, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) "xH" = ( /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) "yM" = ( /obj/structure/table/bench/wooden, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) "zz" = ( /obj/structure/railing, /turf/simulated/floor/tiled/dark{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "Aw" = ( /obj/structure/bed/chair/sofa/corner/black{ dir = 8 @@ -584,15 +554,15 @@ /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "AJ" = ( /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "Ce" = ( /turf/simulated/wall/iron, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "Ds" = ( /obj/structure/closet/walllocker{ pixel_y = 26 @@ -601,7 +571,7 @@ /turf/simulated/floor/bmarble{ temperature = 303.15 }, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "DZ" = ( /obj/structure/railing, /obj/structure/table/wooden_reinforced, @@ -610,13 +580,19 @@ /turf/simulated/floor/tiled/dark{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) +"FJ" = ( +/obj/random/vendordrink, +/turf/simulated/floor/bmarble{ + temperature = 303.15 + }, +/area/redgate/eggnogtown/hotsprings) "Gq" = ( /obj/structure/bed/chair/bay/comfy/red, /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "Gs" = ( /obj/structure/table/wooden_reinforced, /obj/machinery/light_switch{ @@ -627,24 +603,24 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "GR" = ( /turf/simulated/wall/iron, -/area/gateway/eggnogtown/houserhomestead/basement) +/area/redgate/eggnogtown/houserhomestead/basement) "Hk" = ( /obj/item/weapon/bedsheet/mimedouble, /obj/structure/bed/double/padded, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "HV" = ( /obj/structure/fans/tiny, /obj/machinery/door/airlock/freezer{ name = "Automatic Door" }, /turf/simulated/floor/tiled/steel_ridged, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) "Jv" = ( /obj/structure/table/wooden_reinforced, /obj/item/weapon/material/ashtray, @@ -653,7 +629,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "Jz" = ( /obj/machinery/vending/boozeomat{ req_access = list() @@ -661,7 +637,7 @@ /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "Ki" = ( /obj/structure/railing{ dir = 4 @@ -669,10 +645,10 @@ /turf/simulated/floor/tiled/dark{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "Kk" = ( /turf/simulated/wall/iron, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "KY" = ( /obj/structure/bed/chair/sofa/black{ dir = 8 @@ -680,24 +656,22 @@ /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "Mb" = ( /obj/structure/table/steel, /turf/simulated/floor/tiled{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead/basement) +/area/redgate/eggnogtown/houserhomestead/basement) "MG" = ( /obj/move_trader_landmark{ dir = 8; trader_type = /obj/trader/general }, -/turf/simulated/mineral/floor/ignore_cavegen{ - nitrogen = 82.1472; - oxygen = 21.8366; +/turf/simulated/mineral/floor/ignore_cavegen/cave{ temperature = 303.15 }, -/area/gateway/eggnogtown/underground) +/area/redgate/eggnogtown/underground) "Oa" = ( /obj/structure/bed/chair/bay/comfy/black{ dir = 4 @@ -705,7 +679,7 @@ /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "Ot" = ( /obj/structure/bed/chair/bay/comfy/red{ dir = 8 @@ -713,7 +687,7 @@ /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "Ou" = ( /obj/structure/grille, /obj/structure/window/reinforced, @@ -724,7 +698,7 @@ dir = 8 }, /turf/simulated/floor/plating, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) "Oy" = ( /obj/structure/bed/chair/comfy/red{ dir = 4 @@ -732,7 +706,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) "OL" = ( /obj/structure/bed/chair/comfy/red{ dir = 8 @@ -740,41 +714,41 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) "Pb" = ( /obj/item/weapon/bedsheet/piratedouble, /obj/structure/bed/double/padded, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "Pc" = ( /obj/structure/table/bench/steel, /turf/simulated/floor/bmarble{ temperature = 303.15 }, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "QL" = ( /obj/effect/map_effect/interval/effect_emitter/steam, /turf/simulated/floor/beach/water{ name = "hot spring"; temperature = 303.15 }, -/area/gateway/eggnogtown/underground) +/area/redgate/eggnogtown/underground) "Rv" = ( /obj/structure/railing, /obj/structure/bonfire, /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "Tx" = ( /obj/structure/table/wooden_reinforced, /obj/item/device/flashlight/lamp/green, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "TN" = ( /obj/structure/grille, /obj/structure/window/reinforced, @@ -785,13 +759,13 @@ dir = 4 }, /turf/simulated/floor/plating, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) "TU" = ( /obj/machinery/light/flamp, /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "UJ" = ( /obj/machinery/light/small{ dir = 1 @@ -799,13 +773,13 @@ /turf/simulated/floor/tiled{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead/basement) +/area/redgate/eggnogtown/houserhomestead/basement) "UX" = ( /obj/structure/table/bench/padded, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "Va" = ( /obj/structure/table/steel, /obj/machinery/chemical_dispenser/bar_soft/full{ @@ -814,20 +788,20 @@ /turf/simulated/floor/tiled{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead/basement) +/area/redgate/eggnogtown/houserhomestead/basement) "We" = ( /obj/structure/table/woodentable, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) "Wr" = ( /obj/structure/table/borosilicate, /obj/item/device/flashlight/lamp/green, /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "Xm" = ( /obj/machinery/light_switch{ dir = 4; @@ -837,14 +811,14 @@ /turf/simulated/floor/tiled{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead/basement) +/area/redgate/eggnogtown/houserhomestead/basement) "Xs" = ( /obj/structure/table/steel, /obj/fiftyspawner/log, /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) "XC" = ( /obj/structure/bed/chair/sofa{ dir = 8 @@ -852,7 +826,7 @@ /turf/simulated/floor/wood{ temperature = 258.15 }, -/area/gateway/eggnogtown/hotspring) +/area/redgate/eggnogtown/hotspring) "XJ" = ( /obj/structure/bed/chair/wood{ dir = 8 @@ -860,7 +834,7 @@ /turf/simulated/floor/tiled{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead/basement) +/area/redgate/eggnogtown/houserhomestead/basement) "XV" = ( /obj/structure/table/steel, /obj/machinery/chemical_dispenser/bar_alc/full{ @@ -869,13 +843,13 @@ /turf/simulated/floor/tiled{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead/basement) +/area/redgate/eggnogtown/houserhomestead/basement) "YF" = ( /obj/item/weapon/stool/padded, /turf/simulated/floor/tiled{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead/basement) +/area/redgate/eggnogtown/houserhomestead/basement) "YH" = ( /obj/machinery/light/small{ dir = 4 @@ -887,7 +861,7 @@ /turf/simulated/floor/tiled{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead/basement) +/area/redgate/eggnogtown/houserhomestead/basement) "YK" = ( /obj/structure/table/steel, /obj/item/weapon/storage/box/glasses/mug, @@ -899,13 +873,13 @@ /turf/simulated/floor/tiled{ temperature = 258.15 }, -/area/gateway/eggnogtown/houserhomestead/basement) +/area/redgate/eggnogtown/houserhomestead/basement) "YM" = ( /obj/structure/curtain/black, /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) "YO" = ( /obj/structure/closet/walllocker{ pixel_y = 26 @@ -915,7 +889,7 @@ /turf/simulated/floor/bmarble{ temperature = 303.15 }, -/area/gateway/eggnogtown/hotsprings) +/area/redgate/eggnogtown/hotsprings) "ZR" = ( /obj/structure/bed/chair/sofa/left/black{ dir = 1 @@ -923,7 +897,7 @@ /turf/simulated/floor/plating/eris/under{ temperature = 258.15 }, -/area/gateway/eggnogtown/vibeout) +/area/redgate/eggnogtown/vibeout) (1,1,1) = {" lq @@ -3542,13 +3516,13 @@ ab ab ab Kk -cb +FJ cb Kk Kk Kk cb -cb +hh Kk ab ab @@ -6955,7 +6929,7 @@ ab ab ab ab -ab +aa aa ab ab @@ -7098,7 +7072,7 @@ aa aa aa aa -ab +aa ab ab ab diff --git a/maps/redgate/hotsprings.dmm b/maps/redgate/hotsprings.dmm new file mode 100644 index 0000000000..69ba2d4cd8 --- /dev/null +++ b/maps/redgate/hotsprings.dmm @@ -0,0 +1,402 @@ +"as" = (/turf/simulated/floor/water{name = "hotspring"; temperature = 310},/area/redgate/hotsprings/outdoors) +"aY" = (/obj/random/maintenance/morestuff,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"be" = (/obj/structure/table/rack/shelf,/obj/item/device/slow_sizegun,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/outdoors) +"bt" = (/obj/machinery/light/poi{dir = 1},/obj/structure/salvageable/computer_os,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"bF" = (/obj/structure/bed/chair/sofa/right/purp{dir = 4},/turf/simulated/floor/carpet/gaycarpet,/area/redgate/hotsprings/house) +"bL" = (/obj/machinery/door/airlock/glass,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"cv" = (/obj/structure/table/woodentable,/obj/machinery/chemical_dispenser/bar_soft/full,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"cw" = (/obj/structure/fence/corner{dir = 5},/turf/simulated/floor/outdoors/snow{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"cx" = (/obj/structure/toilet{dir = 4},/turf/simulated/floor/tiled,/area/redgate/hotsprings/house) +"dc" = (/obj/structure/railing/grey,/obj/effect/floor_decal/shuttles,/turf/simulated/floor/tiled/steel{nitrogen = 93.7835; outdoors = 1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"dq" = (/obj/structure/prop/warmrocks{dir = 8},/turf/simulated/floor/outdoors/rocks{outdoors = -1},/area/redgate/hotsprings/westcave) +"ds" = (/obj/structure/fans/tiny,/obj/structure/simple_door/wood,/turf/simulated/floor/wood,/area/redgate/hotsprings/house/hotspringhouse) +"dA" = (/obj/item/clothing/suit/storage/hooded/wintercoat,/obj/item/clothing/suit/storage/hooded/wintercoat,/obj/item/clothing/head/hood/winter,/obj/item/clothing/head/hood/winter,/obj/item/clothing/shoes/boots/winter,/obj/item/clothing/shoes/boots/winter,/obj/structure/closet,/obj/random/firstaid,/obj/item/device/flashlight/maglight,/obj/item/device/flashlight/maglight,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"dC" = (/obj/item/weapon/pickaxe,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"dQ" = (/obj/structure/bed/chair/comfy/blue{dir = 1},/turf/simulated/floor/carpet/sblucarpet,/area/redgate/hotsprings/house/dorm1) +"dT" = (/turf/simulated/floor/water{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"ea" = (/turf/simulated/mineral/ignore_cavegen{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"ej" = (/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"eq" = (/obj/structure/prop/warmrocks{dir = 8},/turf/simulated/floor/outdoors/rocks,/area/redgate/hotsprings/outdoors) +"ex" = (/turf/simulated/mineral/ignore_cavegen{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/house/lovercave) +"eD" = (/obj/structure/flora/grass/green,/turf/simulated/floor/outdoors/snow{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"fa" = (/obj/structure/bed/chair/office/light{dir = 1},/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"fB" = (/obj/structure/table/rack/shelf,/obj/item/key/snowmobile,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/outdoors) +"fJ" = (/obj/structure/railing/grey,/obj/structure/railing/grey{dir = 8},/turf/simulated/floor/tiled/steel{nitrogen = 93.7835; outdoors = 1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"fT" = (/obj/machinery/door/airlock{id_tag = "hotspringdorm1"; name = "Bedroom Door"},/turf/simulated/floor/carpet/sblucarpet,/area/redgate/hotsprings/house/dorm1) +"gr" = (/obj/structure/prop/warmrocks{dir = 4},/turf/simulated/floor/outdoors/rocks{outdoors = -1},/area/redgate/hotsprings/westcave) +"gL" = (/obj/machinery/light/flamp,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"hg" = (/obj/vehicle/train/engine/quadbike/snowmobile,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"hr" = (/obj/structure/fence,/turf/simulated/floor/outdoors/snow{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"hv" = (/obj/structure/closet/crate/wooden,/obj/item/weapon/reagent_containers/food/drinks/bottle/goldschlager,/obj/item/weapon/reagent_containers/food/drinks/bottle/jager,/obj/item/weapon/reagent_containers/food/drinks/bottle/peppermintschnapps,/obj/item/weapon/reagent_containers/food/drinks/bottle/sake,/obj/item/weapon/reagent_containers/food/drinks/bottle/small/space_mountain_wind,/obj/item/weapon/reagent_containers/food/drinks/bottle/vodka,/obj/item/weapon/reagent_containers/food/drinks/bottle/wine,/obj/item/weapon/reagent_containers/food/drinks/cans/waterbottle,/obj/item/weapon/reagent_containers/food/drinks/bottle/tequilla,/obj/item/weapon/reagent_containers/food/drinks/bottle/small/beer/meteor,/obj/item/weapon/reagent_containers/food/drinks/bottle/redeemersbrew,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"hA" = (/obj/structure/table/wooden_reinforced,/obj/item/toy/rock,/turf/simulated/floor/carpet/sblucarpet,/area/redgate/hotsprings/house/dorm2) +"hO" = (/obj/item/toy/bouquet,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/house/lovercave) +"hR" = (/obj/structure/table/rack/shelf,/obj/item/weapon/storage/toolbox/mechanical,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/outdoors) +"hX" = (/obj/structure/table/woodentable,/obj/item/weapon/toy/snowglobe/snowvillage,/turf/simulated/floor/wood,/area/redgate/hotsprings/house) +"ic" = (/obj/random/tool/alien,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/house/succcave) +"ie" = (/obj/structure/table/rack,/obj/item/weapon/towel/random,/turf/simulated/floor/tiled,/area/redgate/hotsprings/house) +"iE" = (/obj/item/weapon/paper/card/heart,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/house/lovercave) +"iF" = (/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/outdoors) +"iK" = (/obj/structure/table/standard,/obj/item/weapon/material/knife/butch,/obj/item/weapon/material/kitchen/rollingpin,/turf/simulated/floor/tiled/freezer,/area/redgate/hotsprings/house) +"iV" = (/obj/structure/table/rack/shelf,/obj/random/tool,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/outdoors) +"iX" = (/turf/simulated/floor/outdoors/ice{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"ji" = (/turf/simulated/floor/water{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"jp" = (/turf/simulated/wall/durasteel,/area/redgate/hotsprings/redgate) +"jG" = (/obj/machinery/light/poi{dir = 8},/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"jK" = (/obj/structure/bed/double/padded,/obj/item/weapon/bedsheet/rainbowdouble,/turf/simulated/floor/wood,/area/redgate/hotsprings/house/hotspringhouse) +"kf" = (/obj/random/mob/semirandom_mob_spawner/vore/retaliate/c,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"ki" = (/obj/structure/bed/chair/sofa/purp{dir = 4},/turf/simulated/floor/carpet/gaycarpet,/area/redgate/hotsprings/house) +"ko" = (/obj/item/weapon/stool/padded,/obj/item/weapon/stool/padded{pixel_y = 10},/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"kt" = (/obj/structure/redgate/away,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"kR" = (/obj/structure/railing/grey{dir = 4},/obj/effect/floor_decal/industrial/warning/color/yellow,/turf/simulated/floor/tiled/steel{nitrogen = 93.7835; outdoors = 1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"lb" = (/turf/simulated/floor/tiled,/area/redgate/hotsprings/house) +"lp" = (/obj/machinery/light/poi{dir = 8},/turf/simulated/floor/wood,/area/redgate/hotsprings/house) +"me" = (/turf/simulated/mineral/cave{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"mn" = (/obj/structure/trash_pile,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"mr" = (/obj/structure/table/standard,/obj/item/weapon/paper_bin{pixel_x = 1; pixel_y = 9},/obj/item/weapon/pen,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"mv" = (/obj/effect/floor_decal/shuttle/handicap,/turf/simulated/floor/tiled/steel{nitrogen = 93.7835; outdoors = 1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"mA" = (/obj/item/weapon/bedsheet/purpledouble{pixel_x = 4},/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/house/lovercave) +"mN" = (/obj/structure/flora/ausbushes/stalkybush,/turf/simulated/floor/outdoors/grass/sif{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15; tree_chance = 0},/area/redgate/hotsprings/outdoors) +"mR" = (/obj/structure/flora/mushroom,/turf/simulated/floor/outdoors/snow{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"na" = (/obj/machinery/light/poi{dir = 1},/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"nd" = (/obj/structure/filingcabinet/chestdrawer,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"nV" = (/obj/machinery/portable_atmospherics/canister/phoron,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/outdoors) +"oa" = (/obj/structure/railing/grey{dir = 4},/turf/simulated/floor/tiled/steel{nitrogen = 93.7835; outdoors = 1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"ol" = (/turf/simulated/wall/durasteel,/area/redgate/hotsprings/outdoors) +"oC" = (/obj/random/medical/pillbottle,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"oQ" = (/obj/structure/bonfire,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"oR" = (/obj/structure/railing/grey{dir = 1},/turf/simulated/floor/tiled/steel{nitrogen = 93.7835; outdoors = 1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"oY" = (/obj/structure/closet/crate/wooden,/obj/item/clothing/under/swimsuit/black,/obj/item/clothing/under/swimsuit/blue,/obj/item/clothing/under/swimsuit/cowbikini,/obj/item/clothing/under/swimsuit/earth,/obj/item/clothing/under/swimsuit/risque,/obj/item/clothing/under/swimsuit/stripper/mankini,/obj/item/clothing/under/shorts/green,/obj/item/clothing/under/shorts/blue,/obj/item/clothing/under/shorts/black,/obj/item/weapon/towel/random,/obj/item/weapon/towel/random,/obj/item/weapon/towel/random,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"pE" = (/turf/simulated/mineral/ignore_cavegen{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"pK" = (/turf/simulated/wall/log,/area/redgate/hotsprings/house/dorm1) +"pR" = (/obj/item/weapon/broken_bottle,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"pT" = (/obj/item/clothing/suit/storage/hooded/wintercoat/aformal,/obj/item/clothing/head/hood/winter/aformal,/obj/item/clothing/shoes/boots/winter,/obj/structure/closet,/obj/random/firstaid,/obj/item/device/flashlight/maglight,/obj/item/device/flashlight/maglight,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"pU" = (/obj/structure/table/bench/wooden,/turf/simulated/floor/carpet/gaycarpet,/area/redgate/hotsprings/house) +"pV" = (/obj/effect/fake_sun/cool,/turf/simulated/floor/beach/water/ocean{nitrogen = 93.7835; outdoors = 1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"qf" = (/obj/structure/flora/log2,/turf/simulated/floor/water{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"qk" = (/obj/machinery/button/windowtint{id = "hotspringdormW1"; layer = 3.3; name = "Window Tint Control"; pixel_x = 23; pixel_y = 4; range = 10},/obj/structure/table/wooden_reinforced,/obj/item/device/flashlight/lamp/green{pixel_y = 2},/turf/simulated/floor/carpet/sblucarpet,/area/redgate/hotsprings/house/dorm1) +"qt" = (/obj/item/weapon/stool/padded{pixel_y = 10},/obj/item/weapon/stool/padded,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"qJ" = (/obj/structure/salvageable/autolathe,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/outdoors) +"qQ" = (/turf/simulated/mineral/ignore_cavegen{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"rs" = (/turf/simulated/floor/carpet/sblucarpet,/area/redgate/hotsprings/house/dorm1) +"sd" = (/obj/structure/prop/rock/crystal_dust,/turf/simulated/floor/outdoors/ice{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"sk" = (/obj/structure/fuel_port/empty{pixel_y = 28},/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/outdoors) +"sL" = (/obj/structure/grille,/obj/structure/window/reinforced/full,/turf/simulated/floor/plating{temperature = 258.15},/area/redgate/hotsprings/redgate) +"sX" = (/obj/random/contraband,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"tb" = (/turf/simulated/wall/wood,/area/redgate/hotsprings/house/dorm2) +"tg" = (/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"tH" = (/obj/random/coin,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/house/succcave) +"tL" = (/obj/structure/closet/walllocker_double{dir = 8; pixel_x = -28},/obj/structure/sink{dir = 8; pixel_x = -12; pixel_y = -5},/turf/simulated/floor/tiled,/area/redgate/hotsprings/house) +"tO" = (/turf/simulated/floor/weird_things/dark{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"tV" = (/obj/structure/simple_door/wood,/turf/simulated/floor/tiled,/area/redgate/hotsprings/house) +"tZ" = (/turf/simulated/floor/water{name = "hotspring"; nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 310},/area/redgate/hotsprings/house/hotspringhouse) +"um" = (/obj/item/weapon/reagent_containers/food/drinks/shaker{pixel_x = 7; pixel_y = -5},/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"un" = (/obj/random/multiple/ore_pile,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"uu" = (/turf/simulated/floor/wmarble,/area/redgate/hotsprings/house) +"uC" = (/obj/structure/railing/grey{dir = 8},/obj/effect/floor_decal/industrial/warning/color/yellow,/turf/simulated/floor/tiled/steel{nitrogen = 93.7835; outdoors = 1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"uD" = (/obj/structure/undies_wardrobe,/turf/simulated/floor/tiled,/area/redgate/hotsprings/house) +"uT" = (/obj/machinery/vending/coffee,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"uU" = (/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/house/lovercave) +"uW" = (/obj/random/mob/semirandom_mob_spawner/vore/retaliate,/turf/simulated/floor/outdoors/snow{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"uZ" = (/obj/structure/prop/warmrocks{dir = 4},/turf/simulated/floor/outdoors/rocks,/area/redgate/hotsprings/outdoors) +"vb" = (/mob/living/simple_mob/shadekin/yellow/retaliate/dark,/turf/simulated/floor/weird_things/dark{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"vi" = (/obj/structure/grille,/obj/structure/window/reinforced/full,/turf/simulated/floor/plating{temperature = 258.15},/area/redgate/hotsprings/house) +"vm" = (/obj/structure/prop/rock/crystal,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"vo" = (/mob/living/simple_mob/vore/alienanimals/teppi,/turf/simulated/floor/outdoors/snow{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"vA" = (/obj/item/weapon/reagent_containers/food/drinks/cans/beercan{pixel_x = 11; pixel_y = 4},/obj/item/weapon/reagent_containers/food/drinks/cans/beercan,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/house/lovercave) +"vE" = (/obj/structure/flora/sif/frostbelle,/turf/simulated/floor/outdoors/grass/sif{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15; tree_chance = 0},/area/redgate/hotsprings/outdoors) +"vO" = (/turf/simulated/floor/water{name = "hotspring"; nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 310},/area/redgate/hotsprings/westcave) +"vP" = (/obj/machinery/shower{pixel_y = 19},/obj/structure/curtain/open/shower,/obj/effect/floor_decal/borderfloorwhite/shifted{dir = 10},/turf/simulated/floor/tiled,/area/redgate/hotsprings/house) +"vZ" = (/obj/structure/bed/chair/sofa/bench/right{dir = 1},/turf/simulated/floor/outdoors/snow{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"wL" = (/obj/structure/bed/double,/obj/item/weapon/bedsheet/hopdouble,/turf/simulated/floor/carpet/sblucarpet,/area/redgate/hotsprings/house/dorm1) +"wX" = (/turf/simulated/mineral/ignore_cavegen{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/house/succcave) +"xd" = (/turf/simulated/wall/log,/area/redgate/hotsprings/house/dorm2) +"xq" = (/obj/structure/bed/chair/sofa/left/purp,/turf/simulated/floor/carpet/gaycarpet,/area/redgate/hotsprings/house) +"xs" = (/obj/structure/fence{dir = 4},/turf/simulated/floor/outdoors/snow{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"xY" = (/obj/structure/table/glass,/obj/item/weapon/paper_bin{pixel_x = 1; pixel_y = 9},/obj/item/weapon/folder/white,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"yp" = (/obj/structure/snowman,/turf/simulated/floor/outdoors/snow{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"yt" = (/obj/item/weapon/reagent_containers/food/drinks/bottle/champagne,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"yu" = (/turf/simulated/floor/outdoors/ice{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"yG" = (/obj/structure/railing/grey,/obj/structure/railing/grey{dir = 4},/obj/machinery/portable_atmospherics/canister/empty,/turf/simulated/floor/tiled/steel{nitrogen = 93.7835; outdoors = 1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"yM" = (/obj/structure/table/woodentable,/obj/item/trash/candy/cb06,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"yU" = (/obj/structure/bonfire,/turf/simulated/floor/wmarble,/area/redgate/hotsprings/house) +"yW" = (/obj/structure/bookcase,/turf/simulated/floor/wood,/area/redgate/hotsprings/house) +"yZ" = (/obj/machinery/light/poi{dir = 4},/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"zu" = (/obj/random/mob/semirandom_mob_spawner/vore/retaliate/c,/turf/simulated/floor/outdoors/ice{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"zv" = (/turf/simulated/floor/beach/water/ocean{nitrogen = 93.7835; outdoors = 1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"zx" = (/obj/random/mob/semirandom_mob_spawner/vore/retaliate/b,/turf/simulated/floor/outdoors/snow{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"zB" = (/obj/structure/bed/double,/obj/item/weapon/bedsheet/hopdouble,/turf/simulated/floor/carpet/sblucarpet,/area/redgate/hotsprings/house/dorm2) +"zI" = (/obj/item/weapon/storage/toolbox/lunchbox/filled,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/house/lovercave) +"zM" = (/obj/structure/fence/door,/turf/simulated/floor/outdoors/snow{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"zP" = (/obj/structure/table/wooden_reinforced,/turf/simulated/floor/carpet/sblucarpet,/area/redgate/hotsprings/house/dorm1) +"zR" = (/obj/item/trash/coffee,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"zU" = (/obj/random/plushie,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"Aj" = (/obj/item/capture_crystal/random,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"At" = (/obj/structure/bonfire,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/house/lovercave) +"AM" = (/obj/structure/bed/chair/sofa/corner/purp{dir = 1},/turf/simulated/floor/carpet/gaycarpet,/area/redgate/hotsprings/house) +"AV" = (/obj/structure/table/rack/shelf,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/outdoors) +"AY" = (/obj/structure/table/standard,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"Be" = (/obj/structure/dirtybed,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"BM" = (/obj/structure/table/glass,/obj/item/weapon/pen,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"Ci" = (/obj/machinery/light/poi{dir = 4},/turf/simulated/floor/wood,/area/redgate/hotsprings/house) +"Cu" = (/obj/structure/flora/pottedplant/overgrown,/turf/simulated/floor/wood,/area/redgate/hotsprings/house) +"CL" = (/obj/item/weapon/tool/screwdriver/brass,/obj/item/weapon/tool/wrench/brass{pixel_x = 5; pixel_y = -5},/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"CM" = (/obj/structure/prop/warmrocks{dir = 1},/turf/simulated/floor/outdoors/rocks{outdoors = -1},/area/redgate/hotsprings/westcave) +"CO" = (/obj/random/mouseray,/obj/random/cash/huge,/obj/item/clothing/ears/earring/dangle/diamond,/obj/item/clothing/gloves/ring/material/diamond,/obj/structure/closet/grave/dirthole,/obj/random/coin,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"CZ" = (/obj/structure/fence{dir = 8},/turf/simulated/floor/outdoors/snow{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"Df" = (/obj/item/trash/beef,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"Dq" = (/obj/random/mob/semirandom_mob_spawner/vore/retaliate/c,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"Dt" = (/obj/structure/simple_door/wood,/obj/structure/atmospheric_retention_field/underdoors,/turf/simulated/floor/tiled/freezer,/area/redgate/hotsprings/house) +"Dv" = (/obj/structure/prop/warmrocks,/turf/simulated/floor/outdoors/rocks,/area/redgate/hotsprings/outdoors) +"DA" = (/obj/structure/closet/crate/freezer,/obj/item/weapon/storage/box/donkpockets/berry,/obj/item/weapon/storage/box/donkpockets/berry,/obj/item/weapon/storage/box/donkpockets/berry,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"DD" = (/turf/simulated/floor/water/deep{name = "deep hotspring"; temperature = 310},/area/redgate/hotsprings/outdoors) +"DN" = (/turf/simulated/floor/carpet/gaycarpet,/area/redgate/hotsprings/house) +"DO" = (/obj/structure/grille,/obj/structure/window/reinforced/polarized/full{id = "hotspringdormW2"; name = "Tintable Window"},/turf/simulated/floor/plating{temperature = 258.15},/area/redgate/hotsprings/house/dorm2) +"DS" = (/obj/machinery/button/windowtint{id = "hotspringdormW2"; layer = 3.3; name = "Window Tint Control"; pixel_x = 23; pixel_y = 4; range = 10},/obj/structure/table/wooden_reinforced,/obj/item/device/flashlight/lamp/green{pixel_y = 2},/turf/simulated/floor/carpet/sblucarpet,/area/redgate/hotsprings/house/dorm2) +"Ea" = (/obj/structure/reagent_dispensers/fueltank,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"Eg" = (/obj/structure/railing{dir = 1},/turf/simulated/floor/wmarble,/area/redgate/hotsprings/house) +"Et" = (/obj/structure/prop/warmrocks{invisibility = 101},/turf/simulated/floor/water{name = "hotspring"; nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 310},/area/redgate/hotsprings/westcave) +"EJ" = (/obj/machinery/light/poi,/turf/simulated/floor/wood,/area/redgate/hotsprings/house) +"EN" = (/obj/random/coin,/obj/item/weapon/storage/mre,/obj/item/trash/beans{pixel_x = -9},/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"EO" = (/obj/machinery/light/floortube{dir = 1},/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/outdoors) +"EQ" = (/obj/machinery/light/flicker,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"ES" = (/obj/structure/undies_wardrobe,/turf/simulated/floor/carpet/sblucarpet,/area/redgate/hotsprings/house/dorm1) +"Fn" = (/obj/random/coin,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"FR" = (/turf/simulated/floor/wood{nitrogen = 93.7835; oxygen = 20.7263; temperature = 310},/area/redgate/hotsprings/house/hotspringhouse) +"Gb" = (/obj/item/weapon/bluespace_crystal{pixel_x = -7; pixel_y = 1},/obj/item/weapon/bluespace_crystal{pixel_x = 6; pixel_y = 4},/obj/item/weapon/bluespace_crystal,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"Ge" = (/obj/structure/undies_wardrobe,/turf/simulated/floor/carpet/sblucarpet,/area/redgate/hotsprings/house/dorm2) +"Gs" = (/obj/structure/table/woodentable,/turf/simulated/floor/carpet/gaycarpet,/area/redgate/hotsprings/house) +"GP" = (/turf/simulated/wall/log,/area/redgate/hotsprings/house/hotspringhouse) +"Hm" = (/obj/structure/table/woodentable,/obj/machinery/chemical_dispenser/bar_alc,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"Hn" = (/obj/structure/prop/rock/crystal,/turf/simulated/floor/outdoors/ice{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"Ht" = (/turf/simulated/wall/snowbrick,/area/redgate/hotsprings/house) +"Hw" = (/turf/simulated/floor/tiled/freezer,/area/redgate/hotsprings/house) +"HD" = (/obj/random/tool,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/outdoors) +"HI" = (/obj/structure/flora/tree/pine,/turf/simulated/floor/outdoors/snow{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"Ik" = (/obj/structure/railing/grey,/obj/structure/prop/poicanister,/turf/simulated/floor/tiled/steel{nitrogen = 93.7835; outdoors = 1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"In" = (/mob/living/simple_mob/vore/alienanimals/succlet,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/house/succcave) +"Ix" = (/obj/structure/sign/warning/cold,/turf/simulated/wall/durasteel,/area/redgate/hotsprings/redgate) +"Iy" = (/turf/simulated/floor/outdoors/rocks{outdoors = -1},/area/redgate/hotsprings/westcave) +"IE" = (/obj/structure/bed/chair/comfy/blue{dir = 1},/turf/simulated/floor/carpet/sblucarpet,/area/redgate/hotsprings/house/dorm2) +"IN" = (/obj/machinery/light/poi,/turf/simulated/floor/tiled/freezer,/area/redgate/hotsprings/house) +"IZ" = (/obj/machinery/door/airlock{id_tag = "hotspringdorm2"; name = "Bedroom Door"},/turf/simulated/floor/carpet/sblucarpet,/area/redgate/hotsprings/house/dorm2) +"Jq" = (/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"Ju" = (/obj/machinery/door/airlock/glass,/obj/structure/atmospheric_retention_field/underdoors,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/outdoors) +"Kb" = (/obj/structure/table/woodentable,/obj/item/clothing/accessory/gaiter/snow,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"Kt" = (/obj/structure/table/woodentable,/obj/item/trash/chips/snv,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"KB" = (/mob/living/simple_mob/vore/pakkun,/turf/simulated/floor/water{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"La" = (/obj/structure/grille,/obj/structure/window/reinforced/full,/turf/simulated/floor/plating{temperature = 258.15},/area/redgate/hotsprings/outdoors) +"Lm" = (/obj/machinery/light/bigfloorlamp,/turf/simulated/floor/outdoors/snow{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"Ly" = (/obj/effect/floor_decal/industrial/warning/color/yellow,/turf/simulated/floor/tiled/steel{nitrogen = 93.7835; outdoors = 1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"LJ" = (/obj/structure/flora/grass/brown,/turf/simulated/floor/outdoors/snow{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"LM" = (/obj/structure/bed/chair/office{dir = 8},/turf/simulated/floor/wood,/area/redgate/hotsprings/house) +"LQ" = (/obj/machinery/door/airlock/freezer{name = "Automatic Door"},/obj/structure/atmospheric_retention_field/underdoors,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"Mp" = (/obj/structure/bonfire/permanent,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"Mr" = (/obj/structure/table/wooden_reinforced,/obj/item/clothing/suit/storage/snowsuit/medical,/turf/simulated/floor/carpet/sblucarpet,/area/redgate/hotsprings/house/dorm1) +"MX" = (/obj/structure/table/woodentable,/obj/random/snack,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"MY" = (/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/house/succcave) +"Nf" = (/obj/structure/railing/grey,/obj/effect/floor_decal/shuttles/right,/turf/simulated/floor/tiled/steel{nitrogen = 93.7835; outdoors = 1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"Nl" = (/obj/fiftyspawner/log,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"Nw" = (/obj/structure/table/rack/shelf,/obj/item/weapon/reagent_containers/food/drinks/bottle/absinthe,/obj/item/weapon/reagent_containers/food/drinks/bottle/absinthe,/obj/item/weapon/reagent_containers/food/drinks/bottle/absinthe,/obj/item/weapon/reagent_containers/food/drinks/bottle/absinthe,/obj/item/weapon/reagent_containers/food/drinks/bottle/absinthe,/obj/item/weapon/reagent_containers/food/drinks/bottle/absinthe,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"ND" = (/obj/structure/barricade/planks,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"NI" = (/obj/structure/table/standard,/obj/machinery/microwave{pixel_y = 5},/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"NR" = (/obj/structure/railing/grey{dir = 8},/turf/simulated/floor/tiled/steel{nitrogen = 93.7835; outdoors = 1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"NY" = (/turf/simulated/wall/wood,/area/redgate/hotsprings/house/dorm1) +"Oc" = (/turf/simulated/wall/wood,/area/redgate/hotsprings/house) +"Oz" = (/obj/structure/railing/grey,/turf/simulated/floor/tiled/steel{nitrogen = 93.7835; outdoors = 1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"OT" = (/obj/machinery/light/small/poi{dir = 1},/turf/simulated/floor/tiled,/area/redgate/hotsprings/house) +"Pt" = (/obj/item/clothing/suit/storage/snowsuit,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"PL" = (/turf/simulated/mineral/cave{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"PX" = (/obj/structure/table/rack/shelf,/obj/item/weapon/reagent_containers/food/drinks/bottle/gin,/obj/item/weapon/reagent_containers/food/drinks/bottle/gin,/obj/item/weapon/reagent_containers/food/drinks/bottle/gin,/obj/item/weapon/reagent_containers/food/drinks/bottle/gin,/obj/item/weapon/reagent_containers/food/drinks/bottle/gin,/obj/item/weapon/reagent_containers/food/drinks/bottle/gin,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"Qq" = (/obj/machinery/light/floortube,/turf/simulated/floor/tiled/steel{nitrogen = 93.7835; outdoors = 1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"Qu" = (/obj/structure/table/rack/shelf,/obj/item/weapon/reagent_containers/food/drinks/bottle/small/ale,/obj/item/weapon/reagent_containers/food/drinks/bottle/small/ale,/obj/item/weapon/reagent_containers/food/drinks/bottle/small/ale,/obj/item/weapon/reagent_containers/food/drinks/bottle/small/ale,/obj/item/weapon/reagent_containers/food/drinks/bottle/small/ale,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"Qz" = (/obj/machinery/light/poi,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"QB" = (/obj/structure/dogbed,/turf/simulated/floor/wood,/area/redgate/hotsprings/house) +"Rc" = (/obj/structure/undies_wardrobe,/turf/simulated/floor/wood,/area/redgate/hotsprings/house/hotspringhouse) +"Rp" = (/obj/machinery/light/floortube,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/outdoors) +"RF" = (/obj/structure/flora/ausbushes/leafybush,/turf/simulated/floor/outdoors/grass/sif{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15; tree_chance = 0},/area/redgate/hotsprings/outdoors) +"RO" = (/turf/simulated/floor/wood,/area/redgate/hotsprings/house/hotspringhouse) +"RS" = (/obj/structure/prop/warmrocks{dir = 1},/turf/simulated/floor/outdoors/rocks,/area/redgate/hotsprings/outdoors) +"RW" = (/obj/structure/table/standard,/turf/simulated/floor/tiled/freezer,/area/redgate/hotsprings/house) +"RX" = (/obj/machinery/button/remote/airlock{dir = 8; id = "hotspringdorm1"; name = "Door Lock"; pixel_x = -25; specialfunctions = 4},/turf/simulated/floor/carpet/sblucarpet,/area/redgate/hotsprings/house/dorm1) +"Ta" = (/obj/structure/railing/grey{dir = 4},/obj/structure/railing/grey{dir = 1},/turf/simulated/floor/tiled/steel{nitrogen = 93.7835; outdoors = 1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"Td" = (/mob/living/simple_mob/vore/greatwolf,/turf/simulated/floor/outdoors/snow{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"Tn" = (/obj/structure/simple_door/wood,/turf/simulated/floor/tiled/freezer,/area/redgate/hotsprings/house) +"Ty" = (/obj/machinery/computer/security/telescreen{pixel_x = 30},/turf/simulated/floor/wood,/area/redgate/hotsprings/house) +"Tz" = (/obj/structure/flora/ausbushes/lavendergrass,/turf/simulated/floor/outdoors/grass/sif{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15; tree_chance = 0},/area/redgate/hotsprings/outdoors) +"TA" = (/obj/random/contraband,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/eastcave) +"TL" = (/obj/machinery/space_heater,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"TM" = (/mob/living/simple_mob/vore/alienanimals/succlet/big,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/house/succcave) +"Ud" = (/obj/structure/curtain/open/bed,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/house/lovercave) +"Uk" = (/obj/structure/filingcabinet{pixel_x = -9},/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"Uu" = (/obj/structure/table/standard,/obj/random/coin,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"UB" = (/turf/simulated/floor/wood,/area/redgate/hotsprings/house) +"UH" = (/obj/structure/prop/warmrocks,/turf/simulated/floor/outdoors/rocks{outdoors = -1},/area/redgate/hotsprings/westcave) +"UI" = (/turf/simulated/floor/tiled/steel{nitrogen = 93.7835; outdoors = 1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"UM" = (/turf/simulated/floor/carpet/sblucarpet,/area/redgate/hotsprings/house/dorm2) +"UW" = (/obj/structure/flora/grass/both,/turf/simulated/floor/outdoors/snow{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"Vk" = (/obj/structure/bed/chair/sofa/bench/left{dir = 1},/turf/simulated/floor/outdoors/snow{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"Vx" = (/obj/structure/table/wooden_reinforced,/turf/simulated/floor/carpet/sblucarpet,/area/redgate/hotsprings/house/dorm2) +"VJ" = (/obj/machinery/light/poi{dir = 1},/obj/machinery/telecomms/relay/preset/station{name = "redgate telecomms relay"},/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"VU" = (/obj/structure/table/standard,/obj/structure/sink/countertop{dir = 8},/turf/simulated/floor/tiled/freezer,/area/redgate/hotsprings/house) +"VV" = (/obj/structure/simple_door/wood,/obj/structure/atmospheric_retention_field/underdoors,/turf/simulated/floor/wood,/area/redgate/hotsprings/house) +"Wc" = (/obj/structure/bed/chair/office/dark,/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/redgate) +"Wo" = (/obj/machinery/button/remote/airlock{dir = 8; id = "hotspringdorm2"; name = "Door Lock"; pixel_x = -25; specialfunctions = 4},/turf/simulated/floor/carpet/sblucarpet,/area/redgate/hotsprings/house/dorm2) +"Wq" = (/obj/structure/fence/corner{dir = 8},/turf/simulated/floor/outdoors/snow{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"WF" = (/obj/structure/table/standard,/obj/machinery/microwave,/turf/simulated/floor/tiled/freezer,/area/redgate/hotsprings/house) +"Xh" = (/obj/structure/table/woodentable,/obj/item/clothing/suit/storage/snowsuit/security,/turf/simulated/floor/wood,/area/redgate/hotsprings/house) +"Xq" = (/obj/vehicle/boat{dir = 4},/turf/simulated/floor/beach/water/ocean{nitrogen = 93.7835; outdoors = 1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"XD" = (/obj/structure/closet/secure_closet/freezer/fridge,/obj/item/weapon/reagent_containers/food/condiment/carton/flour,/obj/item/weapon/reagent_containers/food/condiment/carton/flour,/obj/item/weapon/reagent_containers/food/condiment/carton/flour,/obj/item/weapon/reagent_containers/food/condiment/carton/flour,/obj/item/weapon/reagent_containers/food/condiment/carton/flour,/obj/item/weapon/reagent_containers/food/condiment/carton/flour,/obj/item/weapon/storage/fancy/egg_box,/obj/item/weapon/storage/fancy/egg_box,/obj/item/weapon/storage/fancy/egg_box,/obj/item/weapon/storage/fancy/egg_box,/obj/item/weapon/storage/fancy/egg_box,/obj/random/meat,/obj/random/meat,/obj/random/meat,/obj/random/meat,/obj/random/meat,/turf/simulated/floor/tiled/freezer,/area/redgate/hotsprings/house) +"XI" = (/obj/structure/table/woodentable,/obj/machinery/chemical_dispenser/bar_coffee,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"XM" = (/turf/simulated/floor/outdoors/grass/sif{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15; tree_chance = 0},/area/redgate/hotsprings/outdoors) +"Ya" = (/turf/simulated/floor/outdoors/snow{nitrogen = 93.7835; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"Yf" = (/obj/machinery/appliance/cooker/oven,/turf/simulated/floor/tiled/freezer,/area/redgate/hotsprings/house) +"Ym" = (/obj/structure/table/wooden_reinforced,/obj/item/device/flashlight/lamp/green{pixel_y = 2},/turf/simulated/floor/wood,/area/redgate/hotsprings/house/hotspringhouse) +"Yy" = (/mob/living/simple_mob/animal/passive/fish/icebass,/turf/simulated/floor/beach/water/ocean{nitrogen = 93.7835; outdoors = 1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"YB" = (/obj/effect/floor_decal/shuttle/loading,/turf/simulated/floor/tiled/steel{nitrogen = 93.7835; outdoors = 1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/outdoors) +"Zk" = (/obj/structure/table/woodentable,/turf/simulated/floor/outdoors/dirt{nitrogen = 93.7835; outdoors = -1; oxygen = 20.7263; temperature = 243.15},/area/redgate/hotsprings/westcave) +"Zm" = (/obj/structure/grille,/obj/structure/window/reinforced/polarized/full{id = "hotspringdormW1"; name = "Tintable Window"},/turf/simulated/floor/plating{temperature = 258.15},/area/redgate/hotsprings/house/dorm1) +"ZC" = (/obj/machinery/portable_atmospherics/canister/phoron{start_pressure = 0},/turf/simulated/floor/tiled/steel,/area/redgate/hotsprings/outdoors) +"ZF" = (/turf/simulated/wall/log,/area/redgate/hotsprings/house) + +(1,1,1) = {" +eaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQ +eaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeatgtgtgtgtgtgtgeaeaeaeaeaeaeatgtgtgtgtgtgeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQ +eaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeatgtgeaeatgtgtgtgeaeatgtgeaeakftgeaeaeatgtgeaeaeatgtgtgtgeaeaeaeaPttgCOsXeaeaeaeaeaeaeaeaeaeaeameeamemememeeaeameeaeaeaqQPLPLPLqQPLqQPLPLqQqQPLPLPLPLPLPLJqJqJqPLPLqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQ +eaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeatgtgtgeaeaeaeaeatgtgtgtgtgtgtgtgeaeaeaeaeatgeaeatgtgeaeatgeaeaeakftgtgtgtgeaeaeaeaeaeaeamememeeamemememememememememememePLPLPLPLPLPLPLPLPLPLPLPLPLPLPLJqJqJqtOFnJqqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQiXiXiXjijijijiqQqQqQqQqQqQqQqQqQqQ +eaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeatgtgtgtgtgtgeaeaeaNltgtgtgeaeaeaeaeaeaeaeaeatgtgtgtgeaeaeatgtgtgtgtgtgtgtgeaeaeaeaeaeaeamememememememememememememememememePLPLqQPLPLPLPLPLPLPLPLPLqQPLPLFntOtOtOJqJqqQqQqQqQqQJqJqJqJqJqJqJqJqqQqQqQiXiXiXiXHniXiXiXjijijijijiqQqQqQqQqQqQqQ +eaeaeaeatgtgtgtgeaeaeaeaeaeaeaeamntgtgtgtgtgtgeaeatgtgtgtgeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeatgeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeamememememememememememememememememePLPLPLqQPLPLPLPLPLqQPLPLPLPLPLJqtOvbtOJqJqqQqQqQqQJqJqqQqQqQqQJqJqiXiXiXiXiXiXiXiXiXiXiXiXiXjijijijijijiqQqQqQqQqQ +eaeaeaoYtgeaeatgtgeaeaeaeatgtgtgtgtgtgtgtgtgeaeaeaeaeatgtgtgeaeaeaeaeaeaeaeaeaeaeaeaeaeaeatgtgeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeameeamemememememememememememememePLPLPLPLPLPLqQPLPLPLPLPLPLPLPLJqJqtOJqJqqQqQqQqQJqJqqQqQqQqQqQJqJqiXiXiXiXiXHniXiXiXiXiXiXiXiXiXjijijijijiqQqQqQqQ +eaeaeatgtgtgeaeatgtgeaeatgtgtgtgtgtgtgtgtgeaeaeaeaeaeaeatgtgtgeaeaeaeaeaeaoQoQeaeaeaeaeaeaeatgeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeamememememememememememememememePLPLPLPLPLPLPLPLPLPLPLPLPLPLPLJqJqJqJqFnqQqQqQvmJqJqvmqQqQqQqQJqJqiXiXiXiXiXiXiXiXiXiXiXiXiXiXiXiXiXjijijiqQqQqQqQ +eaeaCMgrUHdqeaeaeatgtgtgtgtgtgtgeaeaeatgtgNleaeaeaeaeaeaeatgtgtgeaeaNltgtgtgtgXIcvHmeaeaeatgtgeaeaeaeaeaeaeaEtEtEtEtEtEteaeaeaeaeaeaeamememememeeamemememememememememePLPLPLPLPLqQPLPLPLPLPLPLqQqQqQqQqQJqJqJqqQqQqQJqJqJqJqqQqQqQqQJqJqJqJqiXiXiXsdiXiXiXiXHniXiXiXiXiXiXiXjijiqQqQqQqQ +eaeadqvOvOgreaeaeaeaeatgtgtgeaeaeaeaeaeatgtgsXpReaeaeaeaeaeatgtgeatgtgtgMXtgzRZktgtgpReaeatgtgeaeaeaeaeaeaEtvOvOvOvOvOvOEtEteaeaeaeaeamemememememememememememememememePLPLqQPLPLPLPLPLPLqQqQqQqQqQqQqQqQJqqQqQqQqQqQiXGbJqJqJqqQqQqQJqJqJqJqiXiXiXiXiXiXiXiXiXiXiXiXiXiXiXiXiXiXqQqQqQqQ +eaeaIyvOvOdqeaeaeaeaeatgtgtgeaeaeaeaeaNwtgtgtgtgmneaeaeaeaeatgtgtgtgtgtgKttgtgZktgtgtgeaeaeatgtgeaeaeaeaCMvOvOvOvOvOvOvOvOvOEteaeaeaeamemememememememememememememememeqQPLPLPLPLPLPLqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQiXiXiXJqvmqQqQqQJqJqDqJqJqiXiXiXiXiXiXiXiXiXiXiXiXHniXiXiXqQqQqQqQqQ +eaeaIyvOvOIyeaeaeaeatgtgtgtgeaeaeaeaeaPXpRtgtghveaeaeaeatgtgtgtgtgtgtgtgtgtgtgyMZkKbtgeaeaeaeatgtgtgeaeadqgrCMvOvOvOvOvOvOvOvOEteaeaeamemememememememememememememeeamePLPLPLPLPLqQqQqQqQqQqQqQqQJqundCqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQJqJqJqJqJqiXiXiXiXiXiXiXiXiXiXiXiXiXiXiXqQqQqQqQqQ +eaeaeaIyIyeaeaeaeaeatgtgkftgeaeaeaeaeaQutgmnyteaeaeaeatgtgeaeatgtgtgtgtgtgtgtgtgtgtgtgeaeaeaeaeaeatgtgtgtgtgUHCMgrUHgrUHvOvOvOvOdqeamememememememememememememememememePLPLPLPLqQqQqQqQqQqQqQJqJqJqJqunqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQJqJqJqJqJqiXiXiXiXiXiXiXiXiXiXzuiXiXiXqQqQqQqQqQ +eaeaeaeaeaeaeaeaeaeatgtgtgtgNleaeaeaeaeaeaeaeaeaeaeaeaTLeaeaeaNltgtgeaeakokokoqtDfumeaeaeaeaeaeaeaeaeaeatgtgtgtgtgtgtgdqgrCMUHCMIyeameeamememememememeeamememememememePLPLqQqQqQqQqQqQqQqQqQJqqQJqJqAjqQqQqQqQqQqQqQqQqQFnqQqQqQqQqQqQqQqQJqJqJqJqiXiXiXiXiXiXiXiXiXiXiXiXiXqQqQqQqQqQqQ +eaeaeaeaeaeaeaeatgeatgtgtgeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeatgtgeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeatgtgtgtgtgtgtgtgtgtgtgtgtgmememeeamemememememememememeeamemeqQqQqQqQqQqQqQqQqQqQJqJqqQqQqQqQqQqQqQqQqQqQqQqQqQJqqQqQqQqQqQqQqQqQqQJqJqJqJqiXiXiXiXiXHniXiXiXiXiXiXqQqQqQqQqQqQ +eaeaeaeaeaeaeaeaeatgtgtgeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaYaYaYaYaYaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeatgtgtgtgtgtgtgtgtgtgtgtgeaeaeamemememememememeeamemememeeaeaqQqQqQqQqQqQqQqQqQqQYaqQqQqQqQqQqQqQqQqQqQqQqQqQqQJqJqJqqQqQqQqQqQqQqQJqJqJqJqJqiXiXiXiXiXiXiXiXiXiXiXqQqQqQqQqQqQ +eaeaeaeaeaeaeaeaeatgtgeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaeaeaeaeaeaeaeaeatgtgtgtgtgtgtgtgMptgtgtgeaeaeamemememememememememememeeaeaeaqQqQqQqQYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQqQqQqQqQqQJqJqTAJqqQqQqQqQqQJqJqJqJqJqiXiXiXiXiXiXiXiXiXiXJqJqJqTAqQqQ +eaeaeaeaeaeaeaeamntgtgeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaeaeaeaeaeaeatgtgtgtgtgtgtgtgtgtgtgeaeaeaeamemememememememememeeaeaeaeaeaqQqQYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQqQqQJqJqJqJqJqqQqQqQqQqQJqJqJqJqJqJqJqiXiXiXiXiXiXiXqQqQqQNDqQqQ +eaeaeaeatgeaeaeatgtgtgeaeaeaeatgzUNleaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaeaeaeaeaeaeatgtgtgtgtgtgtgtgtgtgeaeaeaeaeamememememememeeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQqQJqJqJqJqqQqQqQqQqQJqJqJqJqJqJqJqiXiXiXiXiXiXqQqQqQJqJqqQ +eaeaeaeaeaeaeaeaNltgtgtgeaeatgtgeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaeaeaeaeaeaeatgtgtgtgeatgtgtgtgeaeaeaeaeamemeeameeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQJqJqJqJqJqqQqQqQqQqQqQqQJqJqJqJqJqiXiXiXiXiXqQqQqQqQJqqQ +eaeaeaeaeaeaeaeaeatgtgtgtgeatgtgeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaeaeaeaeaeatgtgtgeaeaeaeaeaeaeaeaeaeaeamememeeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYauWYaYaYapEpEpEpEpEpEpEYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQJqDqJqJqqQqQqQqQqQqQqQJqJqJqJqiXiXiXiXiXqQqQqQqQJqqQ +eaeaeaeaeaeaeaeaeaeatgtgtgtgtgeaeaeaeaeaYaYaYaHIYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaeaeaeatgtgeaeaeaeaeaeaeaeaeaeaeaeamemeeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYapEpEpEpEpEpEpEpEpEpEpEYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQJqJqJqJqJqqQqQqQqQqQJqJqJqiXiXiXiXqQqQqQqQENJqqQ +eaeaeaeaeaeaeaeaeaeaeatgtgtgtgeaeaeaeaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaeaeatgtgeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYapEpEpEpEpEpEpEpEpEpEpEpEYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQJqJqqQJqJqJqqQqQqQqQJqJqiXiXHniXqQqQqQCLJqJqqQ +eaeaeaeaeaeaeaeaeaeaeaeaeatgtgeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaeaeaeaeaeatgtgeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYapEpEpEpEpEpEpEpEpEpEpEpEpEpEYaYaYaYaYaYaYaYaYaqQqQqQqQqQJqJqqQqQJqJqqQqQqQqQJqJqiXHniXiXqQqQqQJqhgJqqQ +eaeaeaeaeaeaeaeaeaeaeaeaeatgtgeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeatgtgeaeaeaeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYapEpEpEpEpEpEpEpEpEpEpEpEpEpEYaYaYaYaYaYaYaYaYaYaYaqQqQqQJqJqqQqQqQJqJqqQqQqQJqiXiXiXiXqQqQqQqQEaoCBeqQ +eaeaeaeaeaeaeaeaeaeaeaeaeatgtgeaYaYaYaYaYaYaYaHIYaYaYaHIYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYapEpEpEpEpEpEpEpEpEpEpEpEpEpEYaYaYaYaYaYaYaYaYaYaYaYaqQqQJqJqqQqQqQqQJqJqJqJqJqiXiXiXqQqQqQqQqQqQqQqQqQ +eaeaeaeaeaeaeaeaeaeaeaeaeatgYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaXMYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYapEpEpEpEpEpEpEpEpEpEpEpEpEYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQJqJqqQqQqQqQJqJqJqJqJqiXHnqQqQqQqQqQqQqQqQqQ +eaeaeaeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaXMYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYapEpEpEpEpEpEpEpEpEpEYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQJqqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQ +eaeaeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaXMXMYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYapEpEpEpEpEYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQJqJqqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQ +eaeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaXMXMYaYaXMXMYaXMXMYaYaYaXMYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQJqJqJqqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQ +eaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaXMXMYaXMXMXMXMTzXMXMXMXMYaXMYaYaXMYaYaYaYaYaHIYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYapEpEpEYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQaYJqJqJqqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQqQ +eaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaXMXMYaXMXMvEXMmNTzTzTzXMXMTzXMXMYaYaXMXMYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYapEpEpEpEpEpEpEYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQJqJqJqJqqQqQqQqQqQqQqQqQqQqQqQqQqQqQ +eaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaXMXMXMXMmNDvequZRSDvRSTzXMvEXMXMXMYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYapEpEpEpEpEpEpEYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQJqJqJqqQqQqQqQqQqQqQqQqQqQqQqQqQ +eaeaeaeaeaeaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaXMTzTzuZRSasasasasasasuZmNTzXMYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYapEpEpEpEYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQJqJqJqqQqQqQqQqQqQqQqQqQqQqQqQ +eaeaeaeaeaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaXMTzTzDvasasasasasasasasDvXMTzTzYaXMXMHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQYaqQqQqQqQqQqQqQqQqQqQqQqQ +eaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaXMYaYaXMXMTzRSasasDDDDDDasasasRSXMTzXMYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQqQqQqQqQqQ +eaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaXMXMXMuZasasasDDDDasasasuZXMXMXMYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQqQqQqQqQ +eaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaXMXMeqasasasasasasaseqXMXMRFYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQqQqQqQ +eaeaYaYaYaYazxYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaXMXMequZRSasasasuZRSDvXMXMRFUWXMXMYaYaYaYaHIYaYaYaYaYaYaYaYaeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQqQqQqQ +eaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaXMXMXMmNXMuZDvRSeqTzTzXMXMXMeDUWYaXMYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQqQqQ +eaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaXMXMXMmNXMXMXMXMXMXMXMXMXMYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaeaeaeaeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQqQqQ +eaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaXMYaYaYaXMXMXMXMXMXMYaYaYaYaXMYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQqQqQ +eaeaeaeaeaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaXMXMXMXMYaYaXMXMYaYaYaXMXMYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQqQqQ +eaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaXMYaXMYaYaYaYaYaYaXMYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYatgtgeaeaeaeaeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQqQqQ +eaeaeaeaeaeaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeatgtgtgeaeaeaeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQqQqQ +eaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaeaeaeaeatgtgeaeaeaeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQqQ +eaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaeaeatgtgeaeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQqQ +eaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaeatgtgtgtgeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQ +eaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaeaeaeaeaeaeatgtgtgtgeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYauWYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQ +eaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaHIYaYaYaYaHIYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaeatgtgtgtgeaeaeaeaeaGPGPGPGPGPGPYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQ +eaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaeatgtgtgeaeaeaeaeaeaGPtZtZFRjKGPYaYaYaYaYaYaYaYaYaYaYaYauWYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQqQ +eaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeatgtgeaeaeaeaeaeaeaGPtZtZROYmGPYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQ +eaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeatgtgtgUHtggLeaeaeaGPRORORORcGPYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQqQqQqQ +eaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeatgtggrvOCMtgtgeaeaGPGPGPdsGPGPYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaololLaLaLaololYaYaYaqQqQqQqQ +eaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaeatgdqvOvOvOgrtgeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaoliFiFiFiFqJolYaYaYaqQqQqQqQ +eaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaeagLtgCMvOvOdqtgeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaoliFhRfBAViFololYaYaYaqQqQqQ +eaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaeatgtggrUHgLeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaoliFEOiFEOiFskolYaYaYaqQqQqQ +eaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaJuiFiFiFiFiFZColYaYaYaqQqQqQ +eaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaoliFRpiFRpiFnVolYaYaYaYaqQqQ +exexexexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaoliFAVbeiViFololYaYaYaYaqQqQ +exexexexexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaoliFiFiFiFHDolYaYaYaYaYaqQqQ +exexexexexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeaeaeaeaeaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaololLaLaLaololYaYaYaYaYaqQqQ +exexexexexexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQ +exexexexexexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaqQqQ +exexexexexexexexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwX +exexexexexexexexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwX +exexexexexexexexexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwX +exexexexexexexexexexexexYaYaYaYaYaYaYaYaYaYaYazxYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYauWYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwX +exexexexexexuUuUexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwX +exexexexvAzIuUiEexexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwXwX +exexexexmAuUhOuUexexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwXwXwX +exexexexuUuUAtuUexexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwXwXwX +exexexexexuUuUuUuUexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwXwXwXwX +exexexexexuUuUuUuUexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwXwXwXwX +exexexexexexexUdexexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYauWYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwXtHMYwXwX +exexexexexexexuUuUuUexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXMYInicMYwX +exexexexexexexexexuUuUuUYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXMYMYMYMYwX +exexexexexexexexexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXInMYMYInwX +exexexexexexexexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXMYTMMYMYwX +exexexexexexexexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXMYMYMYMYwX +exexexexexexexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXMYMYMYInwX +exexexexexexexexexYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaoRoRoRoRoRoRoRoRoRoRoRTaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXMYMYwXwX +exexexexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaUIUIUIUIUIUIUIUIUIUIUIoaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXMYwXwX +exexexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaUIUIUIUIUIUIUIUIUIUIUIUIoaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXMYwXwX +exexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaUIUIUIUIUIUIUIUIUIUIUIUIoaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXMYMYwXwX +exexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaUIUIUIYaUIUIUIUIUIUIUIUIUIUIoaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaMYMYMYwXwXwX +exexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeDYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaUIUIYaYaUIUIUIUIUIUIUIUIUIUIoaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwXwX +exexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaNRUIUIUIUIUIUIUIUIUIUIUIUIUIUIoaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwXwX +exexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeDeDYaYaeDYaeDYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaNRUIUIUIUIUIUIUIUIUIUIUIUIUIUIoaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwXwX +exexexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeDUWYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaNRUIUIUIUIUIUIUIUIUIUIUIUIUIUIoaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwXwX +exexexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeDYaUWUWYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYauCLyLyLyLyLyLyLyLyLyLyLyLyLyLykRYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwXwX +exexexexexexYaYaHIYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaLJHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaNRUIYBmvUIUIUIYBYBUIUIUIYBYBUIoaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwXwX +exexexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaLJYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaNRUIUIQqUIUIUIUIUIUIUIUIQqUIUIoaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwXwX +exexexexexYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaLJYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYafJOzOzOzOzOzdcNfUIdcNfOzOzOzIkyGYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwXwX +exexexexYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwXwX +exYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaUIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwXwX +YaYaYaYaYaYaYaYaYaeDHIYaHIYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaUIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwXwX +YaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeDHIYawXwXwXwXwXwX +YaYaYaYaYaYaYaYaeDYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaUIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwXwX +YaYaYaYaHIYaYaHIYaYaHIYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaUIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeDYaYawXwXwXwXwX +YaHIYaYaYaHIYaYaeDYaeDeDYaYaHIYaHIYaeDYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaWqCZzMxsxsxsxsxscwYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaUIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwX +YaYaYaYaYaYaeDYaYaYaYaYaeDYaeDYaYaYaeDHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYahrYaYaYaYaypYaYahrYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwX +YaYaYaHIYaeDYaYaYaYaLJYaYaYaYaYaHIeDeDYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYahrYaYaYaYaYaYaYahrYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYajpjpIxLQIxjpjpYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwX +HIYaYaYaYaYaYaYaHIYaYaHIYaYaYaeDYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYahrYaYaYaVkvZLmHtHtHtYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYajpjpjpjpdAnaejnadAjpjpjpjpYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwX +YaYaYaYaYaYaYaYaYaeDYaYaYaUWHIYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaZFZFZFDtZFZFZFZFHtyUHtZFpKpKZmZmpKYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYajpBMxYjppTejejejdAjpejuTjpYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYawXwXwXwXwX +YaYaYaYaeDYaHITdmRYaYaHIYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaZFXDHwHwHwYfOcyWuuEguuyWNYESrsqkpKYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYasLfaejjpdAejejejdAjpejUusLYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwX +YaYaHIYaYaYaYaUWYaYaYaYaYaYaYazxHIUWUWYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaviiKHwHwHwVUOcUBpUGspUUBNYRXrswLpKYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYasLejyZjpjpjpbLjpjpjpjGNIsLYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYawXwXwXwXwX +YaYaYaYaYaUWYaeDYaHIUWTdHIYaYaUWYaLJYaYaYaUWYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaviWFHwHwHwRWOcUBpUGspUUBfTrsrsrspKYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYajpUkejjpbtejejejVJjpejDAjpYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwX +YaYaYaYaHIYaYaYaYaYaYaYaYaYaLJYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaZFRWHwINHwHwTnUBpUGspUUBNYdQMrzPpKYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYajpjpbLjpejejejejejjpbLjpjpYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwXwX +YaHIYaYaYaYaYaYaYaUWYaYaYaHIYaUWYaYaYaHIYaYaYaYaYaYaHIYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaZFOcOcOcOcOcOclpDNDNDNCiNYNYNYNYpKYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYajpndejbLejejktejejbLejndjpYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeDYaYaYaYaeDYaYaYaYaYaYaYawXwXwXwX +YaYaYaUWYaYaLJHIYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaZFieOTvPOchXLMUBDNAMxqUBtbGeUMDSxdYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYasLejyZjpEQejejejQzjpjGejsLYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYawXwXwXwX +YaYaUWLJHIUWYaLJLJYaHIYaHIYaYamRYaHIYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaZFtLlblbOcXhUBUBDNkiDNTytbWoUMzBxdYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYasLejejjpjpsLsLsLjpjpejejsLYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYavoeDYaYaYaYaYaYaYaYaYawXwXwX +YaLJYaYaYaYaLJYaLJYaLJYaYaYaHIYaYaLJYaYaHIYaLJLJLJHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaZFcxlblbtVUBUBUBDNbFDNUBIZUMUMUMxdYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYasLejejejnaejWcejnaejejejsLYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeDYaYaYawXwXwX +YaYaLJLJYaYaYaYaYaYaYaYaYaLJYaYaYaYaYaYaYaYaYaLJLJYaYaYaLJYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaZFlblbuDOcCuQBUBEJUBUBCutbIEVxhAxdYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYajpejejejejAYAYmrejejejejjpYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaeDYaYaYaYaYaYaYavoYaYaYaYawXwX +YaLJYaYaYaYaYaYaYaLJYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaZFZFviZFZFZFZFVVZFviviZFxdxdDODOxdYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYajpjpjpejejejejejejejjpjpjpYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaUWYaHIYaYaYaYaYaYaYawXwX +YaYaYaHIYaYaHIHILJYaYaHIYaYaYaYaTdLJHIYaLJYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaXMYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYajpjpjpejejejjpjpjpYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaeDYaYaYaYaUWYaYaYawXwX +YaYaYaYaLJYaYaYaYaYaYaYaHIYaHIYaYaLJYaLJYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaXMYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYajpIxLQIxjpYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaUWYaYaYaYaYaYaYaYaYaYaYaYaYaYawX +YaYaYaYaYaYaHIUWYaYaYaLJYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaLJYaYaYaLJYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaXMYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaHIYaUWYaYaYaYaYawX +YaYaYaHIYaYaYaYaYaYaYaYaLJYaHIYaYaYaYaYaYaHIYaYaHIYaYaYaYaYaYaYaYaYaYaLJYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaXMYaXMYaXMXMYaYaYaYaXMYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaXMYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaLJYaYaYaYaYaYaYaYaYaYaYawX +YaHIYaYaYaYaYaYaYaYaYaYaYaYaYaUWYaHIYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaLJYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaXMXMYaXMYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaLJYaYaYaYaYaYaYaHIYaYaYawX +YaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaHIYaYaLJYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaLJYaYaYaYaYaYaHIYaYaYavoYaYaLJYawX +YaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaLJYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYayuyuyuYaYaYaYaYayuYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYayuyuyuyuYaYaYaYaYaYaYaYaYaXMYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaHIYaYaYaYaYaYaYaYaLJYaYaYawX +YaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYayuyuyuyuyuyuyuYaYaYayuyuYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYayuyuyuyuyuyuyuYaYaYaYaYaYaYaYaYayuyuyuyuyuyuYaYaYaYaYaYaYaYayuyuyuyuYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYaYayuyu +YaYaYaYaYaYaYayuyuyuyuyuyuyuyuyuyuyuYaYaYaYaYaYaYaYaYaYaYaYaYayuyuyuyuyuyuyuyuyuYaYaYaYaYaYaYaYaYaYayuyuyuyuyuyuyuyuyuYayuyuyuyuYaYaYaYaYayuyuYayuyuyuyuyuyuyuyuyuYaYaYayuyuyuyuyuyuyuyuyuyuyuYaYaYaYayuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuYaYaYaYaYaYaYaYaYaYaYaYaYaYayuyuyuyuyuyu +YaYaYaYaYayuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuYaYaYaYaYaYayuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuYayuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuYaYayuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuYaYaYaYaYaYayuyuyuyuyuyuyuyuyuyuyu +yuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyu +yuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyudTdTdTdTyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyu +yuyuyuyuyuyuyuyuyuyuyuyudTdTyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyudTdTdTyuyudTdTdTdTdTdTdTyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyudTdTdT +yuyuyuyuyuyuyuyuyudTdTdTdTdTdTdTdTdTdTdTyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyudTyuyuyuyuyuyuyuyuyuyuyuyuyudTdTdTdTyuyudTdTdTdTdTdTdTdTdTyuyuyuyuyuyuyuyuyuyuyuyuyuyudTdTdTdTyuyuyuyudTyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyudTdTdTdTdT +yuyuyuyuyuyuyuyuyudTdTdTdTdTdTdTdTdTdTdTqfdTyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyudTdTdTyuyuyuyuyuyuyuyuyuyuyudTdTdTdTdTdTdTdTdTdTdTdTKBdTdTdTyuyuyuyuyudTyuyuyuyuyuyuyuyudTdTdTdTyuyuyudTdTdTdTdTyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyudTdTdTdTdTdTdT +yuyuyuyuyuyuyuyudTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyudTdTdTdTdTyuyuyuyuyuyudTyuyudTdTdTdTdTyuyuyuyuyuyudTdTdTdTdTdTdTyuyuyudTdTdTyuyuyuyuyuyudTdTdTdTdTdTyudTdTdTdTdTdTdTdTdTyuyuyuyuyuyuyuyuyuyuyuyuyudTdTdTdTdTdTdTdTKBdTdT +yuyuyuyuyudTdTdTdTdTdTdTdTdTdTdTdTKBdTdTdTdTdTdTdTyuyuyuyuyuyuyuyuyudTdTdTyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyuyudTdTzvdTdTdTdTyuyuyuyudTdTdTdTdTdTyuyuyuyuyuyuyuyudTdTdTdTdTdTdTyuyudTdTdTdTdTyuyuyuyuyudTdTdTdTdTdTyudTdTdTdTdTdTdTdTdTyuyuyuyuyuyuyuyuyudTyuyudTdTdTdTdTdTdTdTdTdTdTzv +yuyuyuyudTdTdTdTdTzvzvzvzvzvzvzvzvdTdTdTdTdTdTdTdTdTyuyuyuyuyuyudTdTqfdTdTdTyuyuyuyuyuyuyuyuyuyuyuyuyudTdTdTdTdTdTzvzvzvdTKBdTdTyuyuyudTdTdTdTdTyuyuyuyuyuyuyuyuyuyudTdTdTdTdTdTdTdTdTdTdTdTdTdTyuyuyuyudTdTdTdTdTKBdTdTdTdTdTdTdTdTdTdTdTyuyuyuyuyuyuyudTdTyuyudTdTdTdTdTdTdTzvzvzvzvzv +yuyuyudTdTdTzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvdTdTdTdTdTdTdTdTdTdTdTdTdTzvzvdTdTyuyuyuyuyuyuyuyuyuyuyudTdTzvzvzvzvzvzvzvzvzvzvdTdTyuyuyudTdTzvdTdTyuyuyuyuyuyuyuyuyuyudTdTdTdTdTdTdTdTdTdTzvzvdTdTdTdTyuyudTdTdTzvzvzvdTdTdTzvzvzvzvzvzvdTdTyuyuyuyuyuyuyudTdTdTdTdTdTdTzvzvzvzvzvzvzvzvzv +yuyuyuzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvdTdTdTdTdTdTzvzvzvzvzvzvzvdTdTyuyuyuyuyuyuyuyuyudTdTzvzvzvzvzvzvzvzvzvzvzvzvdTdTyuyudTzvzvdTdTdTyuyuyuyuyuyuyuyuyudTdTdTzvzvzvzvzvzvzvzvzvzvzvzvdTdTdTdTzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvdTdTyuyuyuyudTdTdTzvzvzvzvzvzvzvzvzvzvzvzvzvzvzv +yuyuzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvyuzvzvyuyuyuyudTzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvdTdTyuyuyuyuyuyuyuyudTdTdTzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvYyzvzvzvzvzvzvzvzvzvzvzvyuyuyudTdTzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzv +yuyuzvzvzvzvzvzvzvzvzvzvzvYyzvzvzvzvzvzvzvzvzvzvzvzvYyzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvyuyuzvzvzvzvzvzvzvzvzvzvYyzvzvzvzvzvzvzvzvzvzvzvzvzvdTdTyuyuyuyuyuyudTdTdTzvzvzvzvzvzvzvzvzvzvYyzvzvzvzvzvzvzvzvzvzvzvzvzvzvYyzvzvzvzvzvzvzvzvzvzvyuyuzvzvzvzvzvzvzvzvzvzvzvzvzvYyzvzvzvzvzv +zvzvzvzvzvzvzvzvYyzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvXqzvzvzvzvyuzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvYyzvzvzvzvzvzvzvzvyuyuyuyudTzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvyuyuzvzvzvzvYyzvzvzvzvzvzvzvzvzvzvzvzvzvzv +zvpVzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvYyzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvyuyuyuyuzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzv +zvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvYyzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzvzv +"} diff --git a/maps/redgate/innland.dmm b/maps/redgate/innland.dmm index c9a377fb74..367d6f01db 100644 --- a/maps/redgate/innland.dmm +++ b/maps/redgate/innland.dmm @@ -290,7 +290,7 @@ "dg" = ( /obj/structure/sink/kitchen{ name = "sink"; - pixel_y = 28 + pixel_y = 20 }, /turf/simulated/floor/plating, /area/redgate/structure/powered) @@ -345,6 +345,9 @@ /obj/item/weapon/grenade/chem_grenade/cleaner, /obj/item/weapon/reagent_containers/spray/cleaner, /obj/item/weapon/reagent_containers/spray/cleaner, +/obj/machinery/light/small{ + dir = 4 + }, /turf/simulated/floor/plating, /area/redgate/structure/powered) "dt" = ( @@ -911,6 +914,7 @@ /obj/machinery/light/small{ dir = 1 }, +/obj/machinery/telecomms/relay/preset/station, /turf/simulated/floor/carpet/purcarpet, /area/redgate/structure/powered) "lb" = ( diff --git a/maps/redgate/stardog.dmm b/maps/redgate/stardog.dmm new file mode 100644 index 0000000000..6556d35a21 --- /dev/null +++ b/maps/redgate/stardog.dmm @@ -0,0 +1,20446 @@ +//MAP CONVERTED BY dmm2tgm.py THIS HEADER COMMENT PREVENTS RECONVERSION, DO NOT REMOVE +"ac" = ( +/turf/simulated/floor/flesh/mover{ + dir = 4 + }, +/area/redgate/stardog/flesh_abyss/s_int) +"aj" = ( +/obj/structure/table/alien/blue, +/turf/simulated/floor/lino, +/area/redgate/stardog/lounge) +"aP" = ( +/obj/effect/dog_teleporter/reciever/invisible, +/turf/simulated/floor/flesh, +/area/redgate/stardog/flesh_abyss/no_spawn) +"bl" = ( +/turf/simulated/floor/flesh, +/area/redgate/stardog/flesh_abyss/l_int) +"bM" = ( +/obj/machinery/computer/ship/navigation/telescreen{ + pixel_x = -32 + }, +/obj/effect/floor_decal/spline/fancy{ + dir = 1 + }, +/turf/simulated/floor/wood, +/area/redgate/stardog/lounge) +"cf" = ( +/turf/simulated/floor/flesh/mover{ + dir = 6 + }, +/area/redgate/stardog/flesh_abyss/l_int) +"cg" = ( +/obj/structure/bed/chair/sofa/corp/left{ + dir = 1 + }, +/turf/simulated/floor/lino, +/area/redgate/stardog/lounge) +"cp" = ( +/turf/simulated/floor/flesh/mover{ + dir = 9 + }, +/area/redgate/stardog/flesh_abyss/stomach) +"cB" = ( +/turf/simulated/floor/flesh, +/area/redgate/stardog/flesh_abyss) +"cW" = ( +/obj/machinery/computer/ship/navigation/telescreen{ + pixel_y = -32 + }, +/obj/structure/bed/chair/sofa/corp/right{ + dir = 1 + }, +/turf/simulated/floor/lino, +/area/redgate/stardog/lounge) +"cZ" = ( +/obj/effect/dog_teleporter/mouth_return, +/turf/simulated/floor/flesh, +/area/redgate/stardog/flesh_abyss/no_spawn) +"dX" = ( +/obj/structure/auto_flesh_door, +/turf/simulated/floor/flesh/mover{ + dir = 4; + movechance = 1 + }, +/area/redgate/stardog/flesh_abyss/no_spawn) +"el" = ( +/obj/effect/map_effect/portal/line/side_b{ + dir = 4 + }, +/turf/simulated/floor/outdoors/fur/woof/no_trees, +/area/redgate/stardog/outside) +"ex" = ( +/turf/simulated/flesh, +/area/redgate/stardog/flesh_abyss/l_int) +"eB" = ( +/obj/random/vendordrink, +/turf/simulated/floor/wood, +/area/redgate/stardog/lounge) +"fF" = ( +/turf/simulated/floor/flesh/mover{ + dir = 8 + }, +/area/redgate/stardog/flesh_abyss/digestive_tract) +"gb" = ( +/turf/simulated/floor/flesh, +/area/redgate/stardog/flesh_abyss/no_spawn) +"gG" = ( +/obj/effect/map_effect/portal/line/side_b{ + dir = 1 + }, +/turf/simulated/floor/outdoors/fur/woof/no_trees, +/area/redgate/stardog/outside) +"hg" = ( +/turf/simulated/floor/flesh/mover, +/area/redgate/stardog/flesh_abyss/l_int) +"hP" = ( +/turf/simulated/floor/flesh/mover{ + dir = 6 + }, +/area/redgate/stardog/flesh_abyss/s_int) +"hS" = ( +/turf/simulated/floor/outdoors/fur/woof/no_trees, +/area/redgate/stardog/outside) +"if" = ( +/obj/effect/dog_nose{ + pixel_x = -16 + }, +/turf/simulated/floor/outdoors/fur/woof/no_trees, +/area/redgate/stardog/outside) +"iF" = ( +/obj/structure/bed/chair/sofa/corp/left{ + dir = 1 + }, +/obj/machinery/light/small{ + dir = 4 + }, +/turf/simulated/floor/lino, +/area/redgate/stardog/lounge) +"jf" = ( +/obj/structure/bed/chair/sofa/corp{ + dir = 1 + }, +/turf/simulated/floor/lino, +/area/redgate/stardog/lounge) +"jD" = ( +/turf/simulated/floor/reinforced, +/area/redgate/stardog/lounge) +"jM" = ( +/obj/effect/floor_decal/spline/fancy{ + dir = 1 + }, +/turf/simulated/floor/wood, +/area/redgate/stardog/lounge) +"jP" = ( +/obj/structure/bed/chair/sofa/corp/left, +/turf/simulated/floor/lino, +/area/redgate/stardog/lounge) +"jZ" = ( +/turf/simulated/floor/flesh/mover{ + dir = 10 + }, +/area/redgate/stardog/flesh_abyss/l_int) +"kE" = ( +/obj/structure/bed/chair/sofa/corp/right{ + dir = 1 + }, +/obj/machinery/light/small{ + dir = 8 + }, +/turf/simulated/floor/lino, +/area/redgate/stardog/lounge) +"mo" = ( +/turf/simulated/flesh, +/area/redgate/stardog/flesh_abyss/s_int) +"mp" = ( +/turf/simulated/floor/flesh/mover{ + dir = 4 + }, +/area/redgate/stardog/flesh_abyss/l_int) +"mq" = ( +/turf/simulated/floor/flesh, +/area/redgate/stardog/flesh_abyss/s_int) +"nd" = ( +/obj/effect/map_effect/portal/master/side_a{ + dir = 8; + portal_id = "stardog_east" + }, +/turf/simulated/floor/outdoors/fur/woof/no_trees, +/area/redgate/stardog/outside) +"ol" = ( +/turf/simulated/flesh, +/area/redgate/stardog/outside) +"oO" = ( +/obj/structure/bed/chair/sofa/corp/right, +/turf/simulated/floor/lino, +/area/redgate/stardog/lounge) +"oU" = ( +/turf/simulated/floor/flesh/mover{ + dir = 4 + }, +/area/redgate/stardog/flesh_abyss/no_spawn) +"oZ" = ( +/turf/simulated/floor/outdoors/fur/woof/no_trees, +/area/redgate/stardog/eyes) +"pp" = ( +/obj/effect/landmark/area_gatherer, +/turf/simulated/flesh, +/area/redgate/stardog/flesh_abyss/s_int) +"pI" = ( +/turf/simulated/floor/flesh/mover{ + dir = 1 + }, +/area/redgate/stardog/flesh_abyss/digestive_tract) +"qF" = ( +/turf/simulated/floor/flesh/mover{ + dir = 8 + }, +/area/redgate/stardog/flesh_abyss/l_int) +"sk" = ( +/obj/structure/auto_flesh_door, +/turf/simulated/floor/flesh/mover{ + dir = 4; + movechance = 1 + }, +/area/redgate/stardog/flesh_abyss/digestive_tract) +"sr" = ( +/obj/machinery/computer/ship/navigation/telescreen{ + pixel_y = 32 + }, +/obj/structure/bed/chair/sofa/corp/right, +/turf/simulated/floor/lino, +/area/redgate/stardog/lounge) +"sI" = ( +/obj/machinery/door/airlock/glass{ + name = "Redgate Lounge" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/redgate/stardog/lounge) +"sW" = ( +/turf/simulated/floor/water/digestive_enzymes, +/area/redgate/stardog/flesh_abyss/s_int) +"tA" = ( +/obj/structure/bed/chair/sofa/corp/right{ + dir = 1 + }, +/turf/simulated/floor/lino, +/area/redgate/stardog/lounge) +"ud" = ( +/obj/item/weapon/pickaxe/hand, +/turf/simulated/floor/flesh, +/area/redgate/stardog/flesh_abyss/stomach) +"uQ" = ( +/obj/structure/redgate/away, +/turf/simulated/floor/reinforced, +/area/redgate/stardog/lounge) +"vg" = ( +/obj/effect/map_effect/portal/line/side_b{ + dir = 8 + }, +/turf/simulated/floor/outdoors/fur/woof/no_trees, +/area/redgate/stardog/outside) +"wg" = ( +/turf/simulated/floor/flesh/mover, +/area/redgate/stardog/flesh_abyss/digestive_tract) +"ww" = ( +/turf/simulated/floor/flesh/mover{ + dir = 6 + }, +/area/redgate/stardog/flesh_abyss/no_spawn) +"wL" = ( +/turf/simulated/floor/flesh/mover{ + dir = 1 + }, +/area/redgate/stardog/flesh_abyss/stomach) +"xy" = ( +/turf/simulated/floor/outdoors/fur/woof/wall, +/area/redgate/stardog/outside) +"xZ" = ( +/turf/simulated/floor/flesh/mover{ + dir = 4 + }, +/area/redgate/stardog/flesh_abyss/digestive_tract) +"yi" = ( +/obj/effect/landmark/area_gatherer, +/turf/simulated/flesh, +/area/redgate/stardog/flesh_abyss/l_int) +"ys" = ( +/turf/simulated/floor/flesh/mover{ + dir = 9 + }, +/area/redgate/stardog/flesh_abyss/l_int) +"yB" = ( +/turf/unsimulated/floor/dark, +/area/redgate/stardog/flesh_abyss/node) +"yM" = ( +/turf/simulated/floor/wood, +/area/redgate/stardog/lounge) +"AS" = ( +/turf/simulated/floor/water/digestive_enzymes, +/area/redgate/stardog/flesh_abyss/digestive_tract) +"Br" = ( +/obj/structure/bed/chair/sofa/corp/left, +/obj/machinery/light/small{ + dir = 4 + }, +/turf/simulated/floor/lino, +/area/redgate/stardog/lounge) +"BO" = ( +/obj/effect/map_effect/interval/effect_emitter/steam/less_frequent, +/turf/simulated/floor/water/digestive_enzymes, +/area/redgate/stardog/flesh_abyss/stomach) +"Cv" = ( +/obj/effect/dog_teleporter/exit, +/turf/simulated/floor/flesh, +/area/redgate/stardog/flesh_abyss/no_spawn) +"Cw" = ( +/turf/simulated/floor/flesh, +/area/redgate/stardog/flesh_abyss/node) +"CR" = ( +/obj/structure/grille, +/obj/structure/window/reinforced/full, +/turf/simulated/floor, +/area/redgate/stardog/lounge) +"CV" = ( +/obj/structure/bed/chair/sofa/corp/right, +/obj/machinery/light/small{ + dir = 8 + }, +/turf/simulated/floor/lino, +/area/redgate/stardog/lounge) +"Ej" = ( +/turf/simulated/floor/tiled/monotile, +/area/redgate/stardog/lounge) +"Ew" = ( +/obj/effect/fake_sun, +/turf/simulated/flesh, +/area/redgate/stardog/flesh_abyss) +"Fb" = ( +/turf/simulated/floor/flesh/mover{ + dir = 5 + }, +/area/redgate/stardog/flesh_abyss/digestive_tract) +"Fu" = ( +/obj/effect/map_effect/portal/line/side_a{ + dir = 4 + }, +/turf/simulated/floor/outdoors/fur/woof/no_trees, +/area/redgate/stardog/outside) +"Fz" = ( +/obj/random/vendorfood, +/turf/simulated/floor/wood, +/area/redgate/stardog/lounge) +"Gw" = ( +/obj/effect/map_effect/portal/master/side_b{ + dir = 1; + portal_id = "stardog_north" + }, +/turf/simulated/floor/outdoors/fur/woof/no_trees, +/area/redgate/stardog/outside) +"GK" = ( +/turf/simulated/floor/flesh/mover{ + dir = 9 + }, +/area/redgate/stardog/flesh_abyss/digestive_tract) +"GW" = ( +/turf/simulated/floor/flesh/mover{ + dir = 8 + }, +/area/redgate/stardog/flesh_abyss/stomach) +"HJ" = ( +/turf/simulated/floor/flesh/mover{ + dir = 10 + }, +/area/redgate/stardog/flesh_abyss/s_int) +"Im" = ( +/turf/simulated/floor/flesh/mover{ + dir = 9 + }, +/area/redgate/stardog/flesh_abyss/s_int) +"Iw" = ( +/obj/effect/dog_teleporter/food_gobbler, +/turf/simulated/floor/outdoors/fur/woof/no_trees, +/area/redgate/stardog/outside) +"Jp" = ( +/obj/effect/dog_eye, +/turf/simulated/floor/outdoors/fur/woof/no_trees, +/area/redgate/stardog/eyes) +"JJ" = ( +/turf/simulated/floor/flesh/mover{ + dir = 1 + }, +/area/redgate/stardog/flesh_abyss/l_int) +"Ki" = ( +/turf/simulated/floor/flesh, +/area/redgate/stardog/flesh_abyss/digestive_tract) +"Kk" = ( +/obj/effect/landmark/area_gatherer, +/turf/simulated/flesh, +/area/redgate/stardog/flesh_abyss/stomach) +"KF" = ( +/turf/simulated/floor/water/digestive_enzymes, +/area/redgate/stardog/flesh_abyss/stomach) +"KL" = ( +/turf/simulated/floor/flesh, +/area/redgate/stardog/flesh_abyss/stomach) +"KY" = ( +/obj/machinery/computer/ship/navigation/telescreen{ + pixel_x = 32 + }, +/obj/effect/floor_decal/spline/fancy{ + dir = 1 + }, +/turf/simulated/floor/wood, +/area/redgate/stardog/lounge) +"Ll" = ( +/turf/simulated/flesh, +/area/redgate/stardog/flesh_abyss/stomach) +"MH" = ( +/turf/simulated/floor/flesh/mover{ + dir = 5 + }, +/area/redgate/stardog/flesh_abyss/s_int) +"MT" = ( +/obj/effect/dog_teleporter/reciever/exit, +/turf/simulated/floor/outdoors/fur/woof/no_trees, +/area/redgate/stardog/outside) +"Nh" = ( +/obj/machinery/light, +/obj/machinery/telecomms/relay/preset/station, +/turf/simulated/floor/wood, +/area/redgate/stardog/lounge) +"Oa" = ( +/obj/effect/dog_teleporter/reciever/invisible/mouth_return, +/turf/simulated/floor/outdoors/fur/woof/no_trees, +/area/redgate/stardog/outside) +"Ob" = ( +/obj/effect/map_effect/portal/line/side_a{ + dir = 8 + }, +/turf/simulated/floor/outdoors/fur/woof/no_trees, +/area/redgate/stardog/outside) +"On" = ( +/obj/effect/map_effect/portal/master/side_b{ + dir = 8; + portal_id = "stardog_west" + }, +/turf/simulated/floor/outdoors/fur/woof/no_trees, +/area/redgate/stardog/outside) +"Pe" = ( +/obj/effect/map_effect/portal/master/side_a{ + portal_id = "stardog_north" + }, +/turf/simulated/floor/outdoors/fur/woof/no_trees, +/area/redgate/stardog/outside) +"Pg" = ( +/obj/structure/bed/chair/sofa/corp, +/turf/simulated/floor/lino, +/area/redgate/stardog/lounge) +"PI" = ( +/obj/effect/map_effect/portal/master/side_a{ + dir = 4; + portal_id = "stardog_west" + }, +/turf/simulated/floor/outdoors/fur/woof/no_trees, +/area/redgate/stardog/outside) +"QK" = ( +/turf/simulated/floor/flesh/mover, +/area/redgate/stardog/flesh_abyss/s_int) +"SA" = ( +/obj/machinery/computer/ship/navigation/telescreen{ + pixel_y = 32 + }, +/obj/structure/bed/chair/sofa/corp/left, +/turf/simulated/floor/lino, +/area/redgate/stardog/lounge) +"Tv" = ( +/turf/simulated/wall, +/area/redgate/stardog/lounge) +"TF" = ( +/turf/simulated/floor/flesh/mover{ + dir = 8 + }, +/area/redgate/stardog/flesh_abyss/s_int) +"Uf" = ( +/obj/structure/auto_flesh_door, +/turf/simulated/floor/flesh, +/area/redgate/stardog/flesh_abyss/node) +"Ur" = ( +/obj/machinery/light{ + dir = 1 + }, +/obj/trader/capture_crystal/cash, +/turf/simulated/floor/wood, +/area/redgate/stardog/lounge) +"UJ" = ( +/obj/machinery/computer/ship/navigation/telescreen/dog_eye{ + pixel_y = 16 + }, +/turf/unsimulated/floor/dark, +/area/redgate/stardog/flesh_abyss/node) +"UR" = ( +/obj/effect/map_effect/portal/master/side_b{ + dir = 4; + portal_id = "stardog_east" + }, +/turf/simulated/floor/outdoors/fur/woof/no_trees, +/area/redgate/stardog/outside) +"Vh" = ( +/obj/structure/auto_flesh_door, +/turf/simulated/floor/flesh/mover{ + dir = 1; + movechance = 1 + }, +/area/redgate/stardog/flesh_abyss/digestive_tract) +"Wj" = ( +/turf/unsimulated/floor/dark, +/area/redgate/stardog/flesh_abyss) +"Wu" = ( +/obj/effect/map_effect/interval/effect_emitter/steam/less_frequent, +/turf/simulated/floor/water/digestive_enzymes, +/area/redgate/stardog/flesh_abyss/s_int) +"WB" = ( +/turf/simulated/floor/flesh/mover{ + dir = 6 + }, +/area/redgate/stardog/flesh_abyss/stomach) +"WV" = ( +/turf/simulated/floor/flesh/mover{ + dir = 5 + }, +/area/redgate/stardog/flesh_abyss/stomach) +"Xb" = ( +/turf/simulated/floor/flesh/mover{ + dir = 1 + }, +/area/redgate/stardog/flesh_abyss/s_int) +"Xi" = ( +/turf/simulated/floor/flesh/mover{ + dir = 4 + }, +/area/redgate/stardog/flesh_abyss/stomach) +"Xt" = ( +/turf/simulated/floor/flesh/mover, +/area/redgate/stardog/flesh_abyss/no_spawn) +"Xv" = ( +/turf/simulated/floor/outdoors/fur/woof, +/area/redgate/stardog/outside) +"Yt" = ( +/turf/simulated/floor/flesh/mover{ + dir = 6 + }, +/area/redgate/stardog/flesh_abyss/digestive_tract) +"YF" = ( +/obj/machinery/computer/ship/navigation/telescreen{ + pixel_y = -32 + }, +/obj/structure/bed/chair/sofa/corp/left{ + dir = 1 + }, +/turf/simulated/floor/lino, +/area/redgate/stardog/lounge) +"YT" = ( +/obj/effect/overmap/visitable/ship/simplemob/stardog, +/turf/simulated/flesh, +/area/redgate/stardog/flesh_abyss) +"Zc" = ( +/obj/structure/auto_flesh_door, +/turf/simulated/floor/flesh, +/area/redgate/stardog/flesh_abyss) +"Zg" = ( +/obj/structure/control_pod, +/turf/unsimulated/floor/dark, +/area/redgate/stardog/flesh_abyss/node) +"Zh" = ( +/turf/simulated/flesh, +/area/redgate/stardog/flesh_abyss) +"Zn" = ( +/turf/simulated/floor/flesh/mover{ + dir = 5 + }, +/area/redgate/stardog/flesh_abyss/l_int) +"Zt" = ( +/obj/effect/map_effect/portal/line/side_a, +/turf/simulated/floor/outdoors/fur/woof/no_trees, +/area/redgate/stardog/outside) + +(1,1,1) = {" +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +Fu +Fu +Fu +Fu +PI +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +el +el +el +el +UR +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Ew +"} +(2,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +hS +hS +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +hS +hS +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +YT +"} +(3,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(4,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(5,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Zh +gb +gb +gb +gb +gb +gb +gb +gb +gb +KL +KL +KL +KF +KF +KF +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(6,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +cZ +aP +gb +gb +gb +gb +gb +gb +gb +gb +KL +KL +KL +KF +KF +KF +KF +KF +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(7,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +gb +gb +gb +gb +gb +KL +KL +KL +KF +KF +KF +KF +KF +KF +KF +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(8,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +KL +KL +KL +gb +gb +gb +KL +KL +KL +KF +KF +KF +KF +KF +KF +KF +KF +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(9,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +KL +KL +KL +KL +KL +gb +gb +gb +KL +KL +KL +KL +KF +KF +KF +BO +KF +AS +KF +KF +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(10,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +KL +KL +KL +KL +KL +gb +gb +gb +KL +KL +KL +KL +KL +KF +KF +KF +AS +AS +KF +KF +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(11,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +KL +KL +KL +KL +KL +KL +KL +gb +gb +gb +KL +KL +KL +KL +KL +KL +KF +AS +AS +KF +KF +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(12,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +KL +ud +KL +KL +KL +KL +KL +gb +gb +gb +gb +KL +KL +KL +KL +KL +KF +AS +AS +KF +KF +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(13,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +KL +KL +KL +KL +KL +KL +KL +gb +gb +gb +gb +KL +KL +KL +KL +KL +KF +AS +AS +KF +KF +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(14,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +KL +KL +KL +KL +KL +KL +KL +gb +gb +gb +gb +KL +KL +KL +KL +KL +KL +KF +AS +KF +KF +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(15,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +KL +KL +KL +KL +KL +KL +KL +gb +gb +gb +gb +KL +KL +KL +KL +KL +KF +KF +KF +KF +KF +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(16,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +KL +KL +KL +KL +KL +KL +KL +KL +gb +gb +gb +gb +KL +KL +KL +KL +KF +KF +KF +KF +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(17,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +KL +KL +KL +KL +KL +KL +KL +KL +KL +gb +gb +gb +KL +KL +KL +KL +KF +KF +KF +KF +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(18,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +KL +KL +KL +KL +KL +KL +KL +KL +KL +gb +gb +gb +KL +KL +KL +KF +KF +KF +KF +KF +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(19,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +KL +KL +KL +KL +KL +KL +KL +KL +gb +gb +KL +KL +KL +KF +KF +KF +KF +KF +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(20,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +Ll +KL +KL +KL +KL +KL +KL +gb +gb +KL +KL +KL +KF +KF +KF +KF +KF +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(21,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +Ll +Ll +KL +KL +KL +KL +KL +gb +gb +KL +KL +KL +KF +KF +KF +KF +KF +KF +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(22,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +Ll +Ll +Ll +KL +KL +KL +KL +gb +gb +KL +KL +KL +KF +KF +KF +KF +KF +KF +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(23,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +KL +KL +KL +gb +gb +KL +KL +KL +KF +KF +AS +AS +KF +KF +KF +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(24,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +KL +KL +KL +gb +gb +gb +KL +KL +KF +KF +KF +AS +AS +KF +KF +KF +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(25,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +MT +hS +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +KL +KL +KL +KL +gb +gb +KL +KL +KF +KF +KF +KF +AS +AS +KF +KF +KF +Ll +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(26,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +KL +KL +KL +KL +gb +gb +KL +KL +KF +KF +KF +BO +KF +AS +AS +KF +KF +KF +Ll +Ll +Ll +Ll +Ll +Zh +Zh +"} +(27,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +Ll +Ll +Ll +KL +KL +KL +KL +KL +gb +gb +gb +KL +KL +KF +KF +KF +KF +KF +AS +AS +KF +KF +KF +Ll +Ll +Ll +Ll +Ll +Zh +"} +(28,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +Ll +Ll +KF +KF +KL +KL +KL +KL +KL +gb +gb +KL +KL +KF +KF +KF +KF +KF +KF +AS +KF +KF +KF +KF +Ll +Ll +Ll +Ll +Zh +"} +(29,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +Ll +KF +KF +KF +KL +KL +KL +KL +KL +KL +gb +gb +KL +KL +KL +KF +KF +KF +KF +KF +KF +KF +KF +KL +KL +Ll +Ll +Ll +Zh +"} +(30,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +Ll +KF +KF +KF +KL +KL +KL +KL +KL +KL +KL +gb +gb +KL +KL +KL +KL +KF +KF +KF +KF +KF +KL +KL +KL +Ll +Ll +Ll +Zh +"} +(31,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +KF +KF +KF +KF +KL +KL +KL +KL +KL +KL +KL +KL +gb +gb +KL +KL +KL +KL +KL +KL +KL +KL +KL +KL +KL +Ll +Ll +Ll +Zh +"} +(32,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +KF +KF +KF +KF +KL +KL +KL +KL +KL +KF +KF +KL +KL +gb +gb +KL +KL +KL +KL +KL +KL +KL +KL +KL +Xi +Ll +Ll +Ll +Zh +"} +(33,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +KF +KF +BO +KF +KL +KL +KL +KL +KF +KF +KF +KF +KL +KL +gb +gb +gb +gb +gb +KL +KL +KL +KL +WB +Xi +Ll +Ll +Ll +Zh +"} +(34,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +KF +KF +KF +KF +KF +KL +KL +KF +KF +KF +BO +KF +KL +KL +KL +KL +KL +KL +gb +gb +gb +gb +gb +Xt +ww +oU +Ll +Ll +Zh +"} +(35,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +KF +AS +AS +KF +KF +KF +KF +KF +KF +KF +KF +KF +KF +KL +KL +KL +KL +KL +KL +KL +KL +KL +KL +Ll +Xt +oU +KL +Ll +Zh +"} +(36,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +KF +KF +AS +AS +KF +KF +KF +KF +KF +KF +KF +KF +KF +KL +KL +KL +KL +KL +KL +KL +KL +KL +KL +Ll +Ll +dX +Ll +Ll +Zh +"} +(37,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +KF +KF +KF +AS +AS +KF +KF +KF +KF +KF +KF +KF +KL +KL +KL +KL +KL +KL +KL +KL +KL +KL +KL +Ll +Xi +oU +Xi +Ll +Zh +"} +(38,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +KF +KF +KF +KF +AS +AS +KF +KF +KF +KF +KL +KL +KL +KL +KL +KL +KL +KL +KL +KL +KL +KL +Ll +Ll +Xi +WV +WV +Ll +Zh +"} +(39,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +Ll +KF +KF +KF +KF +AS +AS +KF +KF +KF +KF +KL +KL +KL +KL +KL +KL +KL +KL +KL +KL +Ll +Ll +Xi +WV +WV +WV +Ll +Zh +"} +(40,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +Ll +Ll +KF +KF +KF +KF +AS +AS +KF +KF +KF +KF +KL +KL +KL +KL +KF +KF +KF +KF +Ll +Ll +Xi +WV +WV +WV +WV +Ll +Zh +"} +(41,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +Ll +Ll +Ll +KF +KF +KF +KF +AS +AS +KF +BO +KF +KF +KF +KF +KF +KF +KF +KF +Ll +Ll +Xi +WV +WV +WV +WV +wL +Ll +Zh +"} +(42,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Ll +Ll +KF +KF +KF +KF +AS +KF +KF +KF +KF +KF +KF +KF +KF +KF +Ll +Ll +Xi +WV +WV +WV +WV +wL +Ll +Ll +Zh +"} +(43,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Ll +Ll +Ll +Ll +KF +KF +KF +KF +KF +KF +KF +KF +KF +KF +Ll +Ll +Ll +Xi +WV +WV +WV +WV +WV +WV +Ll +Ll +Zh +"} +(44,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +cB +cB +cB +cB +Zh +Zh +Zh +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Xi +WV +WV +WV +WV +WV +WV +WV +wL +Ll +Ll +Zh +"} +(45,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +cB +cB +cB +cB +cB +cB +cB +Zh +Zh +Zh +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Xi +WV +WV +WV +WV +WV +WV +WV +WV +wL +Ll +Ll +Ll +Zh +"} +(46,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +cB +Zh +Zh +Zh +Ll +Ll +Ll +Ll +Xi +WV +WV +WV +WV +wL +wL +wL +wL +wL +wL +wL +WV +wL +WV +wL +Ll +Ll +Ll +Ll +Zh +"} +(47,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +cB +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +Ll +Ll +xZ +Vh +pI +wL +wL +wL +wL +wL +wL +wL +wL +wL +wL +wL +wL +wL +wL +Ll +Ll +mo +mo +Zh +Zh +"} +(48,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +cB +Zh +Zh +Zh +cB +Zh +Zh +Zh +Zh +Zh +Ll +xZ +Fb +Ll +Ll +Ll +GW +cp +cp +wL +wL +wL +wL +wL +wL +wL +wL +Ll +Ll +Ll +mo +AS +AS +mo +Zh +"} +(49,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +cB +cB +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +Ll +xZ +pI +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +Ll +mo +AS +AS +AS +mo +Zh +"} +(50,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +cB +Zh +Zh +Zh +cB +cB +cB +cB +Zh +Zh +Zh +xZ +pI +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +AS +AS +AS +mo +Zh +"} +(51,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +Zh +Zh +cB +Zh +Zh +Zh +cB +cB +cB +cB +cB +Zh +Zh +xZ +mo +mo +mo +mo +mo +mo +mo +AS +AS +AS +AS +AS +AS +AS +AS +ac +mo +mo +mo +mo +AS +AS +mo +Zh +"} +(52,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +cB +cB +cB +cB +cB +Zh +Zh +Yt +xZ +mo +mo +QK +QK +AS +AS +AS +AS +AS +AS +AS +AS +AS +QK +QK +QK +Yt +xZ +mo +mo +mq +mo +Zh +"} +(53,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +Zh +Zh +wg +wg +QK +QK +HJ +TF +mo +mo +mo +mo +mo +mo +mo +mo +mo +QK +QK +QK +wg +Yt +xZ +mo +mq +mo +Zh +"} +(54,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +cB +cB +cB +cB +Zh +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +mo +mo +HJ +HJ +TF +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +xZ +xZ +mq +mq +mo +Zh +"} +(55,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +cB +cB +cB +cB +cB +cB +cB +Zh +Zh +Zh +Zh +cB +cB +cB +cB +cB +cB +cB +cB +cB +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +cB +Zh +Zh +mo +mo +mo +mo +mo +mo +ac +mo +AS +AS +mo +mo +mo +AS +AS +AS +AS +mo +mo +ac +ac +mo +mo +mo +Zh +"} +(56,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +cB +Zh +Zh +cB +cB +cB +Zh +Zh +cB +cB +Zh +Zh +cB +cB +cB +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +cB +cB +cB +cB +cB +cB +cB +cB +Zh +Zh +Zh +cB +Zh +Zh +mo +mo +mo +mo +mo +xZ +pI +AS +AS +AS +AS +mo +AS +AS +AS +AS +AS +mo +mo +ac +ac +ac +mo +mo +Zh +"} +(57,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +Zh +Zh +cB +cB +cB +Zh +cB +cB +cB +Zh +Zh +Zh +cB +cB +cB +cB +Zh +Zh +Zh +cB +cB +cB +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +cB +cB +cB +cB +cB +Zh +Zh +Zh +cB +Zh +Zh +cB +cB +Zh +Zh +mo +mo +mo +mo +xZ +pI +mo +AS +AS +AS +mo +mo +AS +AS +mo +mo +AS +AS +mo +hP +ac +ac +mo +mo +Zh +"} +(58,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +cB +cB +Zh +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +cB +Zh +Zh +Zh +mo +mo +ac +MH +Fb +mo +mo +mo +AS +AS +mo +mo +AS +AS +mo +mo +AS +fF +mo +QK +ac +ac +mo +mo +Zh +"} +(59,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +cB +cB +cB +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +cB +Zh +Zh +Zh +mo +ac +ac +MH +pI +mo +mo +AS +AS +AS +mo +mo +AS +AS +mo +mo +fF +fF +mo +mo +ac +MH +mo +mo +Zh +"} +(60,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +hS +hS +hS +hS +hS +hS +hS +hS +hS +hS +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +cB +cB +Zh +Zh +cB +Zh +Zh +Zh +cB +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +cB +Zh +Zh +Zh +Zh +cB +Zh +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +mo +ac +ac +ac +mo +mo +mo +AS +AS +TF +mo +mo +AS +AS +mo +mo +fF +fF +pI +Xb +ac +MH +mo +mo +Zh +"} +(61,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +Tv +Tv +CR +CR +Tv +Tv +Tv +CR +CR +Tv +Tv +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +Zh +Zh +Zh +cB +Zh +Zh +Zh +cB +cB +cB +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +mo +ac +ac +ac +mo +mo +mo +AS +TF +TF +mo +mo +AS +AS +mo +mo +mo +fF +GK +Xb +Xb +mq +mq +mo +Zh +"} +(62,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +CR +CV +aj +aj +kE +bM +CV +aj +aj +kE +CR +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Wj +Zh +Zh +Wj +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +Zh +Zh +Zh +cB +Zh +Zh +Zh +cB +cB +cB +cB +cB +Zh +Zh +Zh +cB +cB +cB +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +mo +ac +ac +ac +mq +mo +mo +fF +fF +mo +mo +mo +ac +AS +AS +mo +mo +mo +TF +Xb +Xb +mo +mq +mo +Zh +"} +(63,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +CR +Pg +aj +aj +jf +jM +Pg +aj +aj +jf +CR +hS +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +cB +Zh +Zh +Zh +cB +cB +cB +cB +cB +Zh +Zh +Zh +cB +cB +cB +cB +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +mo +ac +ac +ac +mo +mo +mo +fF +fF +pI +Xb +Xb +Xb +MH +AS +mo +mo +mo +mo +mo +mo +mo +mq +mo +Zh +"} +(64,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +Tv +Tv +SA +aj +aj +cg +jM +jP +aj +aj +YF +Tv +Tv +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +cB +cB +cB +cB +cB +cB +cB +Zh +Zh +Zh +cB +Zh +Zh +cB +cB +cB +cB +cB +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +mo +hP +ac +ac +mo +mo +mo +mo +fF +GK +Xb +Xb +Xb +Xb +mo +mo +AS +AS +AS +mo +mo +mo +mq +mo +Zh +"} +(65,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +Tv +Fz +yM +yM +yM +yM +yM +yM +yM +yM +yM +eB +Tv +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Zh +Zh +Zh +Wj +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +cB +Zh +Zh +cB +Zh +Zh +cB +Zh +Zh +Zh +cB +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +cB +cB +cB +Zh +cB +Zc +wg +hP +ac +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +AS +AS +AS +AS +AS +mq +mq +mo +Zh +"} +(66,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +CR +yM +yM +yM +Ej +Ej +jD +Ej +Ej +jM +yM +yM +CR +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +cB +cB +Zh +Zh +Zh +yB +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +cB +cB +Zh +Zh +cB +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +cB +cB +cB +cB +cB +Zh +mo +QK +xZ +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +AS +AS +AS +AS +AS +AS +mo +mo +Zh +"} +(67,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +CR +yM +yM +yM +jD +Ej +Ej +Ej +jD +jM +yM +yM +CR +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +Zh +Zh +cB +Zh +Zh +yB +Cw +Cw +Cw +yB +Zh +Zh +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +cB +Zh +Zh +Zh +cB +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +cB +Zh +Zh +Zh +cB +cB +cB +Zh +cB +cB +Zh +Zh +Zh +Zh +mo +mo +mo +xZ +MH +mq +mo +mo +mo +QK +QK +hP +ac +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +Zh +"} +(68,1,1) = {" +Pe +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +Tv +yM +yM +yM +Ej +Ej +jD +Ej +Ej +jM +yM +yM +Tv +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +Gw +xy +Zh +Zh +Zh +Zh +Zh +Wj +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +Zh +cB +cB +Zh +Zh +Cw +Cw +yB +Cw +Cw +Zh +Zh +cB +cB +Zh +Zh +cB +cB +Zh +Zh +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +cB +Zh +Zh +Zh +Zh +cB +cB +cB +cB +cB +Zh +Zh +Zh +Zh +mo +mo +mo +xZ +MH +mq +mo +mo +QK +QK +QK +QK +ac +mo +mo +mo +mo +mo +mo +QK +hP +ac +mo +mo +Zh +"} +(69,1,1) = {" +Zt +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +sI +yM +yM +yM +Ej +jD +jD +jD +Ej +jM +yM +yM +sI +hS +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +gG +xy +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +Zh +cB +Zh +Zh +Cw +Cw +yB +yB +yB +Cw +Cw +Zh +Zh +cB +Zh +Zh +cB +cB +Zh +Zh +cB +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +cB +cB +cB +cB +cB +cB +cB +Zh +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +mo +mo +ac +xZ +MH +mo +mo +mo +TF +AS +mo +mo +ac +mq +mo +mo +mo +QK +QK +QK +QK +hP +ac +mo +Zh +"} +(70,1,1) = {" +Zt +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +Tv +Ur +yM +yM +jD +jD +uQ +jD +jD +jM +yM +Nh +Tv +hS +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +gG +xy +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +Zh +cB +Zh +Zh +UJ +yB +yB +Zg +yB +yB +yB +Cw +Uf +cB +Zh +cB +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +cB +cB +cB +cB +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +mo +ac +MH +Xb +Xb +mo +mo +mo +AS +AS +mo +mo +ac +mq +mo +mo +QK +HJ +QK +QK +QK +QK +ac +mo +Zh +"} +(71,1,1) = {" +Zt +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +sI +yM +yM +yM +Ej +jD +jD +jD +Ej +jM +yM +yM +sI +hS +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +gG +xy +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +Zh +cB +Zh +Zh +Cw +Cw +yB +yB +yB +Cw +Cw +Zh +Zh +cB +cB +cB +cB +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +cB +cB +cB +cB +cB +cB +cB +cB +cB +cB +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +Zc +xZ +xZ +pI +mo +mo +mo +mo +AS +AS +AS +mo +mo +ac +mq +mo +mo +TF +HJ +mq +mo +mo +QK +ac +mq +Zh +"} +(72,1,1) = {" +Zt +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +Tv +yM +yM +yM +Ej +Ej +jD +Ej +Ej +jM +yM +yM +Tv +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +gG +xy +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +Zh +cB +cB +Zh +Zh +Cw +Cw +yB +Cw +Cw +Zh +Zh +cB +cB +Zh +cB +cB +cB +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +Zh +cB +cB +cB +cB +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +xZ +xZ +mo +mo +mo +mo +mo +AS +AS +AS +mo +hP +ac +mo +mo +mo +TF +TF +mo +mo +mo +mo +ac +mq +Zh +"} +(73,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +CR +yM +yM +yM +jD +Ej +Ej +Ej +jD +jM +yM +yM +CR +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Zh +Zh +Zh +Zh +Zh +Wj +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +Zh +Zh +cB +Zh +Zh +yB +Cw +Cw +Cw +yB +Zh +Zh +cB +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +cB +cB +Zh +Zh +cB +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +hP +hP +ac +mo +mo +mo +mo +AS +AS +AS +mo +hP +hP +ac +mo +mo +TF +TF +mo +mo +mo +mo +ac +mq +Zh +"} +(74,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +CR +yM +yM +yM +Ej +Ej +jD +Ej +Ej +jM +yM +yM +CR +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +cB +cB +Zh +Zh +Zh +yB +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +cB +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +QK +hP +hP +ac +mo +mo +AS +AS +AS +AS +mo +hP +hP +ac +mo +QK +TF +TF +mo +mo +mo +mo +ac +mq +Zh +"} +(75,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +Tv +eB +yM +yM +yM +yM +yM +yM +yM +yM +yM +Fz +Tv +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +cB +cB +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +cB +cB +Zh +Zh +Zh +Zh +mo +hP +hP +hP +QK +QK +AS +AS +AS +mo +mo +mq +hP +QK +QK +HJ +HJ +TF +mo +mo +mo +mo +ac +mq +Zh +"} +(76,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +Tv +Tv +sr +aj +aj +tA +jM +oO +aj +aj +cW +Tv +Tv +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Zh +Zh +Zh +Wj +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +cB +Zh +Zh +cB +cB +cB +cB +cB +cB +cB +cB +Zh +Zh +cB +cB +cB +cB +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +Zh +Zh +Zh +Zh +cB +cB +Zh +cB +cB +cB +Zh +Zh +Zh +mo +QK +QK +QK +QK +HJ +QK +AS +mo +mo +mo +mo +QK +QK +HJ +HJ +TF +mo +mo +mo +mo +AS +ac +mq +Zh +"} +(77,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +CR +Pg +aj +aj +jf +jM +Pg +aj +aj +jf +CR +hS +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +Zh +Zh +cB +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +cB +cB +cB +cB +Zh +cB +cB +Zh +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +cB +cB +cB +cB +cB +cB +Zh +Zh +cB +cB +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +mo +mo +mo +QK +QK +HJ +TF +mo +mo +AS +AS +mo +mo +mo +mq +mq +mo +mo +mo +AS +AS +AS +AS +mo +Zh +"} +(78,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +CR +Br +aj +aj +iF +KY +Br +aj +aj +iF +CR +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +cB +Zh +Zh +cB +cB +Zh +cB +cB +cB +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +cB +cB +cB +Zh +cB +cB +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +cB +cB +cB +cB +Zh +Zh +Zh +cB +cB +cB +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +mo +mo +mo +mo +mo +mo +mo +mo +AS +AS +AS +AS +mo +mq +mq +mo +mo +AS +AS +AS +AS +mo +mo +mo +Zh +"} +(79,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +Tv +Tv +CR +CR +Tv +Tv +Tv +CR +CR +Tv +Tv +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Wj +Zh +Zh +Wj +Zh +cB +cB +cB +cB +cB +Zh +Zh +Zh +cB +Zh +Zh +Zh +cB +cB +cB +cB +cB +Zh +cB +cB +cB +cB +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +cB +cB +Zh +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +Zh +Zh +Zh +Zh +Zh +mo +mo +mo +mo +mo +mo +mo +mo +AS +AS +AS +AS +AS +mq +mq +mo +AS +AS +AS +mo +mo +mo +mo +mo +Zh +"} +(80,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +hS +hS +hS +hS +hS +hS +hS +hS +hS +hS +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +Zh +Zh +Zh +Zh +Zh +Zh +cB +Zh +Zh +Zh +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +cB +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +AS +AS +mo +mo +mo +AS +AS +mo +Zh +"} +(81,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +cB +cB +cB +Zh +Zh +Zh +cB +cB +Zh +Zh +cB +cB +cB +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +mo +mo +mo +mo +ac +MH +Xb +mo +mo +mo +mo +mo +mq +mq +mo +mo +mo +mo +mo +AS +AS +mo +AS +AS +AS +AS +mo +Zh +"} +(82,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +cB +cB +cB +cB +cB +cB +cB +Zh +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +cB +cB +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +Zh +Zh +cB +cB +cB +cB +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +mo +mo +ac +ac +MH +Xb +Xb +Xb +mo +mo +ac +MH +MH +Xb +Xb +Xb +Xb +mo +mo +AS +AS +AS +AS +AS +mo +AS +mo +Zh +"} +(83,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +cB +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +Zh +Zh +cB +cB +cB +cB +cB +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +cB +cB +cB +Zh +mo +mo +mo +mo +mo +mo +ac +MH +Xb +Xb +Xb +Im +mo +mo +ac +MH +Xb +Xb +Xb +Im +Im +mo +mo +AS +AS +AS +AS +AS +mo +AS +mo +Zh +"} +(84,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +cB +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +Zh +Zh +Zh +cB +cB +cB +cB +cB +cB +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +cB +Zh +mo +sW +sW +sW +sW +mo +ac +ac +MH +mo +mo +TF +Im +mo +mo +ac +ac +mo +mo +mo +TF +Im +mo +mo +mo +mo +mo +mo +mo +mo +AS +mo +Zh +"} +(85,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +Zh +Zh +Zh +Zh +cB +cB +cB +cB +cB +cB +cB +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +mo +mo +sW +sW +sW +sW +mo +AS +ac +Xb +mo +mo +TF +TF +mo +mo +ac +ac +mo +mo +mo +mo +TF +Xb +mo +mo +AS +AS +mo +mo +AS +AS +mo +Zh +"} +(86,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Zh +Zh +Zh +cB +Zh +Zh +Zh +cB +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +cB +cB +cB +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +mo +sW +sW +sW +sW +sW +mo +mo +AS +AS +mo +mo +mo +TF +TF +mo +mo +hP +hP +ac +mo +mo +mo +TF +Im +Xb +mo +AS +AS +mo +AS +AS +AS +mo +Zh +"} +(87,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +Kk +Zh +Zh +cB +cB +cB +cB +cB +Zh +cB +cB +Zh +Zh +Zh +cB +cB +cB +cB +Zh +cB +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +mo +sW +sW +Wu +sW +sW +mo +mo +AS +AS +mo +mo +mq +TF +TF +mo +mo +QK +hP +hP +ac +mo +mo +TF +TF +Im +mo +AS +mo +mo +AS +AS +mo +mo +Zh +"} +(88,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +pp +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +cB +cB +cB +cB +cB +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +mo +mo +sW +sW +sW +sW +sW +mo +mo +AS +AS +mo +mo +mq +TF +TF +mo +mo +mo +QK +hP +ac +mq +mo +mo +TF +TF +mq +mq +mo +mo +AS +AS +mo +mo +Zh +"} +(89,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +ol +yi +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +mo +sW +sW +sW +sW +mq +mo +mo +AS +AS +mo +mo +mo +mq +TF +TF +mo +mo +mo +mo +ac +MH +mq +mo +mo +TF +TF +mo +mo +mo +ac +MH +AS +mo +mo +Zh +"} +(90,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +Zh +Zh +mo +sW +sW +sW +mq +mq +mo +mo +ac +ac +mo +mo +mo +mq +TF +AS +AS +mo +mo +mo +ac +Xb +mo +mo +mo +TF +TF +mo +ac +MH +MH +Xb +mo +mo +mo +Zh +"} +(91,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +mo +mq +mq +mq +mq +mo +mo +mo +ac +ac +mo +mo +mo +mo +AS +AS +AS +AS +AS +Xb +Xb +mo +mo +mo +mo +mo +TF +Xb +Xb +Xb +Xb +Xb +mo +mo +mo +Zh +"} +(92,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +mo +mq +mq +mq +mo +mo +mo +mq +ac +ac +mo +mo +mo +mo +mo +mo +AS +AS +AS +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +Zh +"} +(93,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +mo +mo +mq +mo +mo +mo +mq +mq +ac +ac +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +QK +QK +QK +QK +ac +mo +mo +mo +mo +mo +mo +mo +mo +mo +Zh +"} +(94,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +mo +mo +mq +mq +mo +mq +mq +mo +ac +ac +mo +mo +mo +mo +QK +QK +ac +mo +mo +mo +mq +HJ +QK +QK +QK +QK +hP +ac +mo +mo +mo +mq +Ki +Ki +Zh +Zh +"} +(95,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +mo +mo +mo +mq +mq +mq +mo +mo +ac +ac +mo +mo +mo +QK +TF +mo +QK +ac +mo +mo +mq +TF +TF +mo +mo +mo +QK +ac +mo +mo +QK +QK +wg +Yt +xZ +Zh +"} +(96,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +mo +mo +mo +mo +mo +mo +mo +mo +ac +ac +mo +mo +mo +TF +mo +mo +mo +ac +mq +mo +mo +TF +TF +mo +mo +mo +mo +ac +mo +mo +HJ +TF +Zh +wg +xZ +Zh +"} +(97,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +mo +mo +mo +mo +mo +mo +ac +ac +mo +mo +mo +TF +Xb +mo +mo +ac +mq +mo +mo +AS +TF +mo +mo +mo +mo +ac +mq +mo +TF +TF +Zh +Zh +xZ +Zh +"} +(98,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +mo +mo +mo +mo +mo +mo +ac +ac +mo +mo +mo +TF +Im +mo +mo +ac +ac +mo +mo +AS +AS +AS +mo +mo +mo +ac +mo +mo +TF +TF +Zh +Zh +xZ +Zh +"} +(99,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +mo +mo +mo +mo +mo +mo +ac +ac +mo +mo +mo +TF +Im +Xb +mo +ac +AS +mo +mo +AS +AS +mq +mo +mo +mo +ac +mo +mo +AS +mo +Zh +xZ +Fb +Zh +"} +(100,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +mo +mo +mo +mo +mo +mo +hP +ac +mo +mo +mo +mo +AS +TF +mo +AS +AS +mo +mo +AS +TF +mo +mo +mo +mq +ac +mo +mo +AS +mo +Zh +xZ +Fb +Zh +"} +(101,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +mo +mo +mo +mo +mo +mo +QK +ac +mo +mo +mo +mo +AS +AS +mo +AS +ac +mo +mo +TF +TF +mo +mo +mo +mq +ac +mo +mo +TF +mq +Zh +xZ +Fb +Zh +"} +(102,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +mo +mo +mo +mo +mo +mo +mo +hP +ac +mo +mo +AS +AS +TF +mo +ac +Xb +mo +mo +TF +TF +mo +mo +mo +mq +ac +mo +QK +TF +mq +Zh +xZ +pI +Zh +"} +(103,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +mo +mo +mo +mo +mo +mo +mo +QK +ac +mo +mo +TF +TF +TF +mo +ac +mo +mo +QK +TF +TF +mo +mo +mo +mq +QK +QK +HJ +TF +mo +Zh +xZ +Zh +Zh +"} +(104,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +mo +mo +mo +mo +mo +mo +mo +mo +QK +QK +QK +HJ +TF +mo +mo +QK +QK +QK +HJ +TF +mo +mo +mo +mo +mo +mq +mq +mq +mo +mo +xZ +pI +Zh +Zh +"} +(105,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +mo +mo +mo +mo +mo +mo +mo +mo +mo +mq +mq +mo +mo +mo +mo +mo +mq +mq +mq +mo +Zh +Zh +Zh +Zh +Zh +mo +mo +mo +mo +Zh +xZ +Zh +Zh +Zh +"} +(106,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +mo +Zh +xZ +pI +pI +pI +Zh +Zh +Zh +Zh +xZ +pI +pI +Zh +Zh +Zh +"} +(107,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +Zh +xZ +pI +Zh +Zh +fF +pI +pI +pI +pI +pI +Zh +Zh +Zh +Zh +Zh +"} +(108,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +ex +ex +ex +ex +ex +ex +bl +bl +bl +bl +bl +bl +ex +ex +ex +ex +ex +ex +ex +Zh +xZ +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +"} +(109,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +ex +ex +ex +ex +ex +bl +bl +bl +bl +bl +bl +ex +ex +ex +ex +ex +ex +ex +ex +Zh +sk +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +"} +(110,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +ex +ex +ex +ex +bl +bl +hg +hg +hg +cf +cf +cf +mp +ex +ex +ex +ex +ex +bl +bl +Yt +cf +hg +hg +cf +mp +ex +bl +ex +ex +ex +ex +ex +ex +Zh +"} +(111,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +ex +ex +ex +bl +bl +hg +jZ +jZ +hg +hg +cf +cf +mp +bl +ex +ex +ex +bl +bl +bl +bl +hg +hg +hg +hg +hg +cf +cf +cf +mp +ex +ex +ex +ex +Zh +"} +(112,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +ex +ex +bl +bl +hg +jZ +jZ +hg +hg +hg +hg +cf +mp +mp +ex +ex +ex +ex +ex +ex +ex +hg +hg +hg +hg +hg +cf +cf +cf +cf +mp +mp +ex +ex +Zh +"} +(113,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +hS +hS +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +ex +bl +bl +hg +jZ +jZ +jZ +hg +hg +hg +hg +cf +cf +cf +mp +bl +bl +bl +bl +ex +ex +ex +ex +hg +hg +hg +cf +cf +cf +cf +mp +mp +bl +ex +Zh +"} +(114,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +oZ +Jp +hS +hS +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +ex +ex +hg +jZ +jZ +jZ +qF +bl +bl +ex +bl +hg +cf +cf +cf +hg +hg +hg +cf +mp +ex +ex +ex +ex +hg +hg +cf +cf +cf +cf +mp +mp +bl +ex +Zh +"} +(115,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +hS +hS +hS +hS +hS +hS +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +ex +bl +hg +jZ +jZ +qF +bl +ex +ex +ex +bl +ex +hg +hg +hg +hg +hg +hg +cf +cf +mp +bl +ex +ex +ex +ex +bl +cf +cf +cf +mp +mp +bl +ex +Zh +"} +(116,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +hS +hS +hS +if +Iw +Oa +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +ex +bl +jZ +jZ +qF +ex +ex +ex +ex +ex +ex +ex +ex +bl +bl +bl +bl +hg +cf +cf +cf +mp +bl +ex +ex +ex +ex +bl +mp +cf +mp +mp +bl +ex +Zh +"} +(117,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +hS +hS +hS +hS +hS +hS +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +ex +bl +qF +jZ +bl +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +hg +cf +cf +cf +mp +bl +ex +ex +ex +ex +mp +mp +mp +mp +bl +ex +Zh +"} +(118,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +oZ +Jp +hS +hS +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +ex +bl +qF +qF +ex +ex +ex +ex +ex +bl +bl +bl +bl +bl +ex +ex +ex +ex +bl +bl +hg +cf +cf +mp +bl +ex +ex +bl +mp +mp +mp +mp +bl +ex +Zh +"} +(119,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +hS +hS +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +ex +bl +qF +qF +ex +ex +ex +ex +bl +bl +hg +hg +hg +hg +bl +ex +ex +ex +ex +bl +bl +mp +mp +mp +bl +ex +ex +bl +mp +mp +mp +mp +bl +ex +Zh +"} +(120,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +bl +bl +qF +qF +bl +ex +ex +bl +bl +jZ +hg +hg +hg +hg +hg +bl +ex +ex +ex +ex +bl +mp +mp +mp +bl +ex +ex +ex +mp +mp +mp +mp +bl +ex +Zh +"} +(121,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +bl +bl +qF +qF +bl +ex +ex +ex +bl +jZ +hg +hg +hg +hg +cf +bl +ex +ex +ex +ex +ex +mp +mp +mp +bl +ex +ex +ex +mp +mp +mp +mp +bl +ex +Zh +"} +(122,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +bl +bl +qF +qF +bl +ex +ex +ex +bl +qF +qF +ex +bl +bl +bl +gb +gb +ex +ex +ex +bl +mp +mp +mp +bl +ex +ex +ex +mp +mp +mp +mp +bl +ex +Zh +"} +(123,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +bl +bl +qF +qF +bl +ex +ex +ex +bl +qF +qF +ex +ex +ex +bl +gb +gb +gb +ex +ex +ex +mp +mp +mp +bl +ex +ex +ex +mp +mp +mp +mp +bl +ex +Zh +"} +(124,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +bl +bl +qF +qF +ex +ex +ex +ex +bl +qF +qF +bl +bl +ex +ex +gb +gb +Cv +ex +ex +ex +mp +mp +mp +bl +ex +ex +bl +mp +mp +mp +mp +ex +ex +Zh +"} +(125,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +bl +bl +qF +qF +bl +bl +ex +ex +ex +qF +qF +JJ +bl +ex +ex +ex +ex +ex +ex +ex +ex +mp +Zn +mp +ex +ex +ex +bl +mp +mp +mp +mp +bl +ex +Zh +"} +(126,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +bl +bl +qF +qF +bl +bl +ex +ex +ex +qF +qF +ys +JJ +bl +bl +ex +ex +ex +ex +ex +mp +Zn +Zn +Zn +ex +ex +ex +bl +mp +mp +mp +mp +ex +ex +Zh +"} +(127,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +bl +bl +qF +qF +bl +bl +ex +ex +bl +qF +qF +ys +ys +JJ +JJ +JJ +JJ +JJ +JJ +JJ +Zn +Zn +Zn +JJ +ex +ex +ex +bl +mp +mp +mp +mp +ex +ex +Zh +"} +(128,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +bl +bl +qF +qF +bl +bl +ex +ex +ex +bl +qF +ys +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +bl +ex +ex +ex +bl +mp +mp +mp +mp +ex +ex +Zh +"} +(129,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +bl +bl +qF +ys +JJ +bl +bl +ex +ex +ex +qF +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +ex +ex +ex +ex +ex +ex +bl +mp +Zn +Zn +Zn +ex +ex +Zh +"} +(130,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +ex +bl +qF +ys +ys +bl +bl +ex +ex +ex +ex +ex +bl +ex +ex +bl +bl +bl +bl +bl +ex +ex +ex +ex +ex +ex +bl +mp +Zn +Zn +Zn +Zn +ex +ex +Zh +"} +(131,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +ex +bl +qF +ys +ys +JJ +bl +ex +ex +ex +ex +ex +ex +ex +ex +bl +bl +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +mp +Zn +Zn +Zn +JJ +ex +ex +Zh +"} +(132,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +ex +bl +qF +qF +ys +ys +JJ +bl +ex +ex +ex +ex +bl +ex +ex +ex +ex +ex +ex +bl +ex +ex +ex +bl +bl +bl +bl +Zn +Zn +Zn +Zn +ex +ex +ex +Zh +"} +(133,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +ex +bl +bl +qF +ys +ys +ys +JJ +bl +bl +bl +bl +bl +ex +mp +Zn +Zn +Zn +Zn +Zn +Zn +Zn +JJ +JJ +JJ +JJ +JJ +Zn +Zn +Zn +JJ +ex +ex +ex +Zh +"} +(134,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +ex +bl +bl +bl +qF +ys +ys +ys +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +Zn +JJ +JJ +JJ +ex +ex +ex +ex +Zh +"} +(135,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +ex +bl +bl +bl +bl +qF +ys +ys +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +ex +ex +ex +ex +ex +ex +ex +Zh +"} +(136,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +ex +ex +bl +bl +bl +ex +qF +ys +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +JJ +ex +ex +ex +ex +ex +ex +ex +ex +Zh +"} +(137,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +ex +ex +ex +ex +ex +ex +ex +bl +bl +bl +bl +bl +bl +bl +bl +bl +bl +ex +bl +bl +bl +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +Zh +"} +(138,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +ex +Zh +"} +(139,1,1) = {" +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +hS +hS +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +xy +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +hS +hS +hS +hS +hS +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +Xv +xy +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +"} +(140,1,1) = {" +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +Ob +Ob +Ob +Ob +nd +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +vg +vg +vg +vg +On +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +xy +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +Zh +"} diff --git a/maps/redgate/teppiranch.dmm b/maps/redgate/teppiranch.dmm index 3dddf437cf..6d8468b7eb 100644 --- a/maps/redgate/teppiranch.dmm +++ b/maps/redgate/teppiranch.dmm @@ -292,8 +292,9 @@ /turf/simulated/floor/tiled/eris/cafe, /area/redgate/structure/powered/teppi_ranch) "uX" = ( -/turf/simulated/mineral/ignore_cavegen/cave, -/area/redgate/wilds) +/obj/machinery/telecomms/relay/preset/station, +/turf/simulated/floor/carpet, +/area/redgate/structure/powered/teppi_ranch) "vv" = ( /turf/simulated/floor/outdoors/grass/seasonal{ snow_chance = 50 @@ -966,122 +967,122 @@ rr "} (2,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Qc Qc Qc @@ -1108,122 +1109,122 @@ JP "} (3,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Qc Qc Qc @@ -1250,125 +1251,125 @@ JP "} (4,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX Qc Qc -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Qc Qc Qc @@ -1392,125 +1393,125 @@ JP "} (5,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX Qc Qc -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Qc Qc Qc @@ -1534,125 +1535,125 @@ JP "} (6,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX Qc Qc -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc mn mn mn @@ -1676,122 +1677,122 @@ JP "} (7,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Qc Qc mn @@ -1818,122 +1819,122 @@ JP "} (8,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Qc Qc mn @@ -1960,122 +1961,122 @@ JP "} (9,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Qc Qc mn @@ -2102,122 +2103,122 @@ JP "} (10,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg -uX +Qc Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Qc Qc mn @@ -2244,49 +2245,49 @@ JP "} (11,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -2295,15 +2296,15 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -2315,22 +2316,22 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -2343,23 +2344,23 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg -uX -uX -uX -uX +Qc +Qc +Qc +Qc Qc Qc Qc @@ -2386,17 +2387,17 @@ JP "} (12,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -2405,10 +2406,10 @@ Jg Jg Jg Jg -uX -uX -uX -uX +Qc +Qc +Qc +Qc Jg Jg Jg @@ -2417,17 +2418,17 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -2437,13 +2438,13 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -2458,18 +2459,18 @@ Jg Jg Jg Jg -uX +Qc Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -2486,13 +2487,13 @@ Jg Jg Jg Jg -uX -uX -uX -uX +Qc +Qc +Qc +Qc Jg -uX -uX +Qc +Qc Jg Jg Jg @@ -2500,8 +2501,8 @@ Jg Jg Jg Jg -uX -uX +Qc +Qc Qc Qc Qc @@ -2528,17 +2529,17 @@ JP "} (13,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -2548,12 +2549,12 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Zw @@ -2561,11 +2562,11 @@ Zw Zw Zw Zw -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -2582,7 +2583,7 @@ Jg Jg Jg Jg -uX +Qc Jg Jg Jg @@ -2605,11 +2606,11 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -2629,8 +2630,8 @@ Jg Jg Jg Jg -uX -uX +Qc +Qc Jg Jg Jg @@ -2642,8 +2643,8 @@ Jg Jg Jg Jg -uX -uX +Qc +Qc Qc Qc Qc @@ -2670,16 +2671,16 @@ JP "} (14,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -2689,14 +2690,14 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Zw Zw Zw @@ -2749,7 +2750,7 @@ Jg Jg Jg Jg -uX +Qc Jg Jg Jg @@ -2785,7 +2786,7 @@ Jg Jg Jg Jg -uX +Qc Qc Qc Qc @@ -2812,16 +2813,16 @@ JP "} (15,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -2829,15 +2830,15 @@ Jg Df Df Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Df Df Df @@ -2954,16 +2955,16 @@ JP "} (16,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -2972,12 +2973,12 @@ Df Df Df Df -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc Df Df Df @@ -3096,16 +3097,16 @@ JP "} (17,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -3115,10 +3116,10 @@ Df Df Df Df -uX -uX -uX -uX +Qc +Qc +Qc +Qc Df Df Df @@ -3238,16 +3239,16 @@ JP "} (18,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -3380,17 +3381,17 @@ JP "} (19,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -3522,18 +3523,18 @@ JP "} (20,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Df @@ -3664,21 +3665,21 @@ JP "} (21,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg -uX +Qc Df Df VD @@ -3806,21 +3807,21 @@ JP "} (22,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Df Df VD @@ -3948,21 +3949,21 @@ JP "} (23,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Df Df Df @@ -4090,22 +4091,22 @@ JP "} (24,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Df Df Df @@ -4232,22 +4233,22 @@ JP "} (25,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Zw Df Df @@ -4374,22 +4375,22 @@ JP "} (26,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Zw Df Df @@ -4516,22 +4517,22 @@ JP "} (27,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Zw Df Df @@ -4658,22 +4659,22 @@ JP "} (28,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Zw Zw Df @@ -4800,22 +4801,22 @@ JP "} (29,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc Zw Zw Df @@ -4942,22 +4943,22 @@ JP "} (30,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg -uX -uX -uX -uX +Qc +Qc +Qc +Qc Zw Zw Df @@ -5084,21 +5085,21 @@ JP "} (31,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg Jg -uX -uX +Qc +Qc Jg Jg Zw @@ -5226,14 +5227,14 @@ JP "} (32,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -5368,13 +5369,13 @@ JP "} (33,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -5510,13 +5511,13 @@ JP "} (34,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -5652,13 +5653,13 @@ JP "} (35,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -5794,13 +5795,13 @@ JP "} (36,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -5936,13 +5937,13 @@ JP "} (37,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -6078,13 +6079,13 @@ JP "} (38,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -6220,13 +6221,13 @@ JP "} (39,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -6362,14 +6363,14 @@ JP "} (40,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -6504,14 +6505,14 @@ JP "} (41,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -6627,34 +6628,34 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (42,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -6769,34 +6770,34 @@ vv Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (43,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -6912,34 +6913,34 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (44,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -7054,35 +7055,35 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (45,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -7196,35 +7197,35 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (46,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -7339,33 +7340,33 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (47,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -7480,34 +7481,34 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc lN -uX -uX -uX -uX +Qc +Qc +Qc +Qc JP "} (48,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -7622,34 +7623,34 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc lN lN -uX -uX -uX -uX +Qc +Qc +Qc +Qc JP "} (49,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -7763,35 +7764,35 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc lN lN lN -uX -uX -uX -uX +Qc +Qc +Qc +Qc JP "} (50,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -7903,38 +7904,38 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc lN lN lN lN -uX -uX -uX -uX +Qc +Qc +Qc +Qc JP "} (51,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -8044,39 +8045,39 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc lN lN lN lN -uX -uX -uX -uX +Qc +Qc +Qc +Qc JP "} (52,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -8186,40 +8187,40 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc lN lN -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc JP "} (53,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -8328,40 +8329,40 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc lN lN lN -uX -uX -uX -uX +Qc +Qc +Qc +Qc JP "} (54,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -8471,40 +8472,40 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc lN lN -uX -uX -uX -uX +Qc +Qc +Qc +Qc JP "} (55,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -8614,40 +8615,40 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc lN lN lN lN -uX -uX -uX +Qc +Qc +Qc JP "} (56,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -8762,35 +8763,35 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc lN lN -uX -uX -uX +Qc +Qc +Qc JP "} (57,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -8904,35 +8905,35 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc lN lN -uX -uX -uX +Qc +Qc +Qc JP "} (58,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -9047,34 +9048,34 @@ Jg Jg Jg Jg -uX -uX -uX -uX +Qc +Qc +Qc +Qc lN lN -uX -uX -uX +Qc +Qc +Qc JP "} (59,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -9189,34 +9190,34 @@ Jg Jg Jg Jg -uX -uX -uX +Qc +Qc +Qc lN lN lN -uX -uX -uX +Qc +Qc +Qc JP "} (60,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -9331,33 +9332,33 @@ Jg Jg Jg Jg -uX -uX -uX -uX +Qc +Qc +Qc +Qc lN lN -uX -uX -uX +Qc +Qc +Qc JP "} (61,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -9472,34 +9473,34 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (62,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -9614,34 +9615,34 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (63,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -9755,34 +9756,34 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (64,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -9897,33 +9898,33 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (65,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -10038,32 +10039,32 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (66,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -10178,34 +10179,34 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (67,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -10318,36 +10319,36 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (68,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -10458,38 +10459,38 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (69,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -10600,38 +10601,38 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (70,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -10683,7 +10684,7 @@ Ta Ta Ta Ta -Ta +uX fX jf yM @@ -10742,38 +10743,38 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (71,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -10886,36 +10887,36 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (72,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -11029,34 +11030,34 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (73,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -11172,34 +11173,34 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (74,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -11314,34 +11315,34 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (75,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -11456,34 +11457,34 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc lN lN -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc JP "} (76,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -11598,34 +11599,34 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc lN lN -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc JP "} (77,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -11740,34 +11741,34 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc lN lN lN -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc JP "} (78,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -11883,39 +11884,39 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc lN -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc JP "} (79,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg Jg Jg -uX +Qc Jg Jg Jg @@ -12025,39 +12026,39 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (80,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg -uX -uX -uX -uX +Qc +Qc +Qc +Qc Jg Jg Jg @@ -12166,42 +12167,42 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (81,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc Jg Zw Zw @@ -12308,43 +12309,43 @@ Jg Jg Jg Jg -uX +Qc Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (82,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc Zw Zw Df @@ -12453,40 +12454,40 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (83,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc Zw Df Df @@ -12594,40 +12595,40 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (84,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc Df Df Df @@ -12738,38 +12739,38 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (85,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc Df Df RW @@ -12879,39 +12880,39 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (86,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg Jg -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc Df Df Df @@ -13021,39 +13022,39 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (87,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc Df Df Df @@ -13165,36 +13166,36 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (88,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg -uX -uX -uX +Qc +Qc +Qc Df Df Df @@ -13306,37 +13307,37 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (89,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg Jg -uX -uX +Qc +Qc Df RW Df @@ -13448,31 +13449,31 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (90,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -13589,32 +13590,32 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (91,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -13730,33 +13731,33 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (92,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -13871,34 +13872,34 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (93,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -14012,35 +14013,35 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (94,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -14154,41 +14155,41 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (95,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg -uX -uX +Qc +Qc Jg Jg Jg @@ -14296,42 +14297,42 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (96,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg -uX -uX -uX +Qc +Qc +Qc Jg Jg vv @@ -14348,9 +14349,9 @@ Df Df Df Df -uX -uX -uX +Qc +Qc +Qc Jg Jg Jg @@ -14439,41 +14440,41 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (97,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg Jg -uX -uX +Qc +Qc Jg Jg Jg @@ -14490,11 +14491,11 @@ Df Df Df Jg -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -14580,42 +14581,42 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (98,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg Jg -uX -uX +Qc +Qc Jg Jg Jg @@ -14633,11 +14634,11 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -14721,43 +14722,43 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (99,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg Jg Jg -uX +Qc Jg Jg vv @@ -14776,10 +14777,10 @@ Jg Jg Jg Jg -uX -uX -uX -uX +Qc +Qc +Qc +Qc Jg Jg Jg @@ -14863,37 +14864,37 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (100,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -14919,9 +14920,9 @@ Jg Jg Jg Jg -uX -uX -uX +Qc +Qc +Qc Jg Jg Jg @@ -15007,38 +15008,38 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (101,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -15150,38 +15151,38 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (102,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -15293,37 +15294,37 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (103,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -15435,38 +15436,38 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (104,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -15578,37 +15579,37 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (105,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -15719,38 +15720,38 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (106,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -15860,40 +15861,40 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (107,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -16001,41 +16002,41 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (108,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg -uX -uX -uX -uX +Qc +Qc +Qc +Qc Jg Jg Jg @@ -16143,41 +16144,41 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (109,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg -uX -uX -uX -uX +Qc +Qc +Qc +Qc Jg Jg Jg @@ -16285,42 +16286,42 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (110,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg -uX -uX -uX -uX +Qc +Qc +Qc +Qc Jg Jg Jg @@ -16427,41 +16428,41 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (111,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg -uX -uX +Qc +Qc Jg Jg Jg @@ -16569,36 +16570,36 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (112,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -16612,7 +16613,7 @@ Jg Jg Jg Jg -uX +Qc Jg Jg Jg @@ -16711,36 +16712,36 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (113,1,1) = {" JP -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc lN -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -16753,9 +16754,9 @@ Jg Jg Jg Jg -uX -uX -uX +Qc +Qc +Qc Jg Jg Jg @@ -16853,36 +16854,36 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (114,1,1) = {" JP -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc lN lN -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -16893,11 +16894,11 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -16995,37 +16996,37 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (115,1,1) = {" JP -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc lN -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Yu @@ -17035,12 +17036,12 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -17137,37 +17138,37 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (116,1,1) = {" JP -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc lN -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -17177,13 +17178,13 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -17279,38 +17280,38 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (117,1,1) = {" JP -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc lN lN -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -17320,10 +17321,10 @@ Yu Jg Jg Jg -uX -uX -uX -uX +Qc +Qc +Qc +Qc Jg Jg Jg @@ -17352,7 +17353,7 @@ vv Jg Jg Jg -uX +Qc Jg Jg Jg @@ -17421,38 +17422,38 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (118,1,1) = {" JP -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc lN -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -17463,9 +17464,9 @@ Jg Jg Jg Jg -uX -uX -uX +Qc +Qc +Qc Jg Jg Jg @@ -17494,7 +17495,7 @@ Jg Jg Jg Jg -uX +Qc Jg Jg Jg @@ -17564,37 +17565,37 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (119,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -17605,7 +17606,7 @@ Jg Jg Jg Jg -uX +Qc Jg Jg Jg @@ -17613,9 +17614,9 @@ Jg Jg Jg Jg -uX -uX -uX +Qc +Qc +Qc Jg Jg Jg @@ -17635,8 +17636,8 @@ Jg Jg Jg Jg -uX -uX +Qc +Qc Jg Jg Jg @@ -17709,34 +17710,34 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (120,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -17755,10 +17756,10 @@ Jg Jg Jg Jg -uX -uX -uX -uX +Qc +Qc +Qc +Qc Jg Jg Jg @@ -17777,13 +17778,13 @@ Jg Jg Jg Jg -uX -uX -uX +Qc +Qc +Qc Jg Jg Jg -uX +Qc Jg Jg Jg @@ -17844,40 +17845,40 @@ Jg Jg Jg Jg -uX -uX -uX +Qc +Qc +Qc Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (121,1,1) = {" JP -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc lN -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Yu @@ -17895,13 +17896,13 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -17919,15 +17920,15 @@ Jg Jg Jg Jg -uX -uX -uX +Qc +Qc +Qc Jg Jg Jg -uX -uX -uX +Qc +Qc +Qc Jg Jg Jg @@ -17985,42 +17986,42 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc Jg ZL Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (122,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -18036,15 +18037,15 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -18061,17 +18062,17 @@ Jg Jg Jg Jg -uX -uX -uX +Qc +Qc +Qc Jg Jg -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -18126,43 +18127,43 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (123,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -18174,19 +18175,19 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -18203,14 +18204,14 @@ Jg Jg Jg Jg -uX -uX +Qc +Qc Jg Jg Jg Jg Jg -uX +Qc Jg Jg Jg @@ -18267,44 +18268,44 @@ Jg Jg Jg Jg -uX -uX -uX +Qc +Qc +Qc lN lN -uX -uX +Qc +Qc Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (124,1,1) = {" JP -uX -uX -uX -uX +Qc +Qc +Qc +Qc lN -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -18312,24 +18313,24 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -18345,8 +18346,8 @@ Jg Jg Jg Jg -uX -uX +Qc +Qc Jg Jg Jg @@ -18409,68 +18410,68 @@ Jg Jg Jg Jg -uX -uX -uX +Qc +Qc +Qc lN -uX -uX -uX +Qc +Qc +Qc Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (125,1,1) = {" JP -uX -uX -uX -uX +Qc +Qc +Qc +Qc lN lN -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -18478,16 +18479,16 @@ Jg Jg Jg Jg -uX +Qc Jg -uX -uX -uX -uX +Qc +Qc +Qc +Qc Jg Jg Jg -uX +Qc Jg Jg Jg @@ -18503,10 +18504,10 @@ Jg Jg Jg Jg -uX -uX -uX -uX +Qc +Qc +Qc +Qc Jg Jg Jg @@ -18551,104 +18552,104 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (126,1,1) = {" JP -uX -uX -uX +Qc +Qc +Qc lN lN -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg -uX -uX +Qc +Qc Jg -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg -uX +Qc Jg Jg Jg -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -18686,111 +18687,111 @@ Jg Jg Jg Jg -uX -uX -uX +Qc +Qc +Qc Jg Jg Jg Jg Jg -uX -uX -uX -uX +Qc +Qc +Qc +Qc Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (127,1,1) = {" JP -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc lN -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -18826,12 +18827,12 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -18843,96 +18844,96 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (128,1,1) = {" JP -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc lN lN lN -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -18955,8 +18956,8 @@ Jg Jg Jg Jg -uX -uX +Qc +Qc Jg Jg Jg @@ -18967,14 +18968,14 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg ZL @@ -18984,98 +18985,98 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (129,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc lN lN lN -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -19096,134 +19097,134 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (130,1,1) = {" JP -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc lN lN lN lN -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg -uX -uX -uX +Qc +Qc +Qc Jg Jg Jg @@ -19238,135 +19239,135 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (131,1,1) = {" JP -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc lN lN -uX -uX +Qc +Qc lN lN lN -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -19380,138 +19381,138 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (132,1,1) = {" JP -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc lN lN -uX +Qc lN lN lN lN lN -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc Jg Jg Jg @@ -19520,1044 +19521,1044 @@ Jg Jg Jg Jg -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (133,1,1) = {" JP -uX -uX -uX +Qc +Qc +Qc lN lN lN -uX +Qc lN lN -uX +Qc lN -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc lN -uX +Qc lN lN lN -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (134,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc lN -uX -uX -uX +Qc +Qc +Qc lN lN -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (135,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc lN lN -uX +Qc lN -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (136,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (137,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (138,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (139,1,1) = {" JP -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX -uX +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc +Qc JP "} (140,1,1) = {" diff --git a/maps/stellar_delight/stellar_delight1.dmm b/maps/stellar_delight/stellar_delight1.dmm index 698bdefdcd..d5a56d023a 100644 --- a/maps/stellar_delight/stellar_delight1.dmm +++ b/maps/stellar_delight/stellar_delight1.dmm @@ -785,6 +785,7 @@ /obj/structure/cable/green{ icon_state = "0-4" }, +/obj/effect/landmark/stardog, /turf/simulated/floor, /area/maintenance/stellardelight/deck1/starboardcent) "bA" = ( @@ -2457,6 +2458,10 @@ }, /turf/simulated/floor, /area/maintenance/stellardelight/substation/exploration) +"ey" = ( +/obj/effect/landmark/stardog, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck1/portfore) "ez" = ( /obj/structure/table/reinforced, /obj/item/clothing/gloves/sterile/latex, @@ -5214,6 +5219,7 @@ /obj/machinery/atmospherics/unary/vent_pump/on{ dir = 4 }, +/obj/effect/landmark/stardog, /turf/simulated/floor, /area/maintenance/stellardelight/deck1/portcent) "kn" = ( @@ -10649,6 +10655,7 @@ /area/security/security_lockerroom) "wf" = ( /obj/machinery/alarm/angled, +/obj/effect/landmark/stardog, /turf/simulated/floor, /area/maintenance/security_port) "wg" = ( @@ -11180,6 +11187,7 @@ /obj/machinery/atmospherics/unary/vent_pump/on{ dir = 8 }, +/obj/effect/landmark/stardog, /turf/simulated/floor, /area/maintenance/stellardelight/deck1/starboardfore) "xs" = ( @@ -18650,6 +18658,10 @@ }, /turf/simulated/floor/tiled/dark, /area/security/lobby) +"NO" = ( +/obj/effect/landmark/stardog, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck1/exploration) "NP" = ( /turf/simulated/wall/bay/r_wall/steel, /area/maintenance/stellardelight/deck1/portaft) @@ -19826,6 +19838,7 @@ color = "#42038a"; icon_state = "1-4" }, +/obj/effect/landmark/stardog, /turf/simulated/floor, /area/maintenance/stellardelight/deck1/starboardaft) "QA" = ( @@ -30543,7 +30556,7 @@ BP Cc gw xw -vT +NO DX ra bD @@ -31479,7 +31492,7 @@ dS kx Zz Bb -cB +ey cB cB Dj diff --git a/maps/stellar_delight/stellar_delight3.dmm b/maps/stellar_delight/stellar_delight3.dmm index fddeb0f20e..d3f16acdfd 100644 --- a/maps/stellar_delight/stellar_delight3.dmm +++ b/maps/stellar_delight/stellar_delight3.dmm @@ -1,1689 +1,34442 @@ -"aa" = (/obj/effect/landmark{name = "morphspawn"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/aftstarroom) -"ab" = (/obj/structure/railing/grey{dir = 8},/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/commandhall) -"ac" = (/obj/effect/landmark{name = "morphspawn"},/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/forestarroomb) -"ad" = (/turf/simulated/wall/bay/r_wall/blue,/area/tcommsat/chamber) -"ae" = (/obj/structure/railing/grey{dir = 4},/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/commandhall) -"af" = (/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"ag" = (/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/aft) -"ah" = (/obj/structure/sign/directions/stairs_down{pixel_x = 32; pixel_y = 18},/obj/structure/sign/directions/medical{pixel_x = 32; pixel_y = 12},/obj/structure/sign/directions/engineering{pixel_x = 32; pixel_y = 6},/obj/structure/sign/directions/cargo{pixel_x = 32},/obj/structure/railing/grey{dir = 4},/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/aft) -"ai" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/stellardelight/deck3/portdock) -"aj" = (/obj/effect/landmark/free_ai_shell,/turf/simulated/floor/carpet/turcarpet,/area/ai) -"ak" = (/obj/structure/sign/directions/stairs_down{pixel_x = -32; pixel_y = 18},/obj/structure/sign/directions/medical{pixel_x = -32; pixel_y = 12},/obj/structure/sign/directions/engineering{pixel_x = -32; pixel_y = 6},/obj/structure/sign/directions/cargo{pixel_x = -32},/obj/structure/railing/grey{dir = 8},/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/aft) -"al" = (/obj/machinery/power/terminal{dir = 8},/obj/structure/cable{icon_state = "0-4"},/turf/simulated/floor,/area/maintenance/stellardelight/substation/command) -"am" = (/obj/machinery/door/airlock/angled_bay/hatch{dir = 4; name = "maintenance access"; stripe_color = "#454545"},/obj/machinery/door/firedoor/glass,/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor/tiled/steel_ridged,/area/maintenance/stellardelight/deck3/forestarrooma) -"an" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"ao" = (/obj/machinery/computer/HolodeckControl{dir = 4},/obj/item/device/radio/intercom{dir = 8; pixel_x = -24},/turf/simulated/floor/tiled,/area/holodeck_control) -"ap" = (/obj/machinery/vending/altevian,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarroomb) -"aq" = (/obj/structure/closet/walllocker_double/emergency_engi/south,/turf/simulated/floor,/area/stellardelight/deck2/fore) -"ar" = (/obj/structure/closet/walllocker_double/command/ce{dir = 4; pixel_x = 32},/turf/simulated/floor/tiled,/area/crew_quarters/heads/chief) -"as" = (/obj/structure/closet/walllocker_double/command/cmo{dir = 8; pixel_x = -32},/turf/simulated/floor/tiled/eris/white/cargo,/area/crew_quarters/heads/cmo) -"at" = (/obj/structure/table/darkglass,/turf/simulated/floor/tiled/dark,/area/lawoffice) -"au" = (/obj/item/weapon/book/manual/command_guide,/obj/item/weapon/book/manual/standard_operating_procedure,/obj/item/weapon/book/manual/security_space_law,/obj/structure/closet/walllocker_double/command/hos{dir = 4; pixel_x = 32},/turf/simulated/floor/tiled/dark,/area/crew_quarters/heads/hos) -"av" = (/obj/item/device/taperecorder{pixel_x = -3},/obj/item/weapon/circuitboard/aicore{pixel_x = -2; pixel_y = 4},/obj/item/weapon/circuitboard/teleporter,/obj/structure/closet/walllocker_double/command/rd{dir = 8; pixel_x = -32},/turf/simulated/floor/tiled/techfloor,/area/crew_quarters/heads/hor) -"aw" = (/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/aftstarroom) -"ax" = (/obj/item/weapon/book/manual/command_guide,/obj/item/weapon/book/manual/command_guide,/obj/item/weapon/book/manual/standard_operating_procedure,/obj/item/weapon/book/manual/standard_operating_procedure,/obj/item/weapon/book/manual/security_space_law,/obj/item/weapon/book/manual/security_space_law,/obj/structure/closet/walllocker_double/command/iaa{dir = 4; pixel_x = 32},/turf/simulated/floor/tiled/dark,/area/lawoffice) -"ay" = (/obj/item/weapon/book/manual/command_guide,/obj/item/weapon/book/manual/command_guide,/obj/item/weapon/book/manual/standard_operating_procedure,/obj/item/weapon/book/manual/standard_operating_procedure,/obj/item/weapon/book/manual/security_space_law,/obj/item/weapon/book/manual/security_space_law,/obj/structure/closet/walllocker_double/command/iaa{dir = 8; pixel_x = -32},/turf/simulated/floor/tiled/dark,/area/lawoffice) -"az" = (/obj/item/device/megaphone,/obj/item/weapon/book/manual/standard_operating_procedure,/obj/item/weapon/book/manual/command_guide,/obj/structure/table/reinforced,/obj/item/weapon/folder/red,/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 8},/obj/structure/closet/walllocker_double/command/north,/turf/simulated/floor/carpet,/area/crew_quarters/heads/hop) -"aA" = (/turf/simulated/wall/bay/r_wall/steel,/area/stellardelight/deck3/transitgateway) -"aB" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"aC" = (/obj/structure/lattice,/obj/structure/closet/walllocker_double/emergency_engi/east,/turf/simulated/open,/area/stellardelight/deck2/starboard) -"aD" = (/obj/structure/table/steel,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarrooma) -"aE" = (/obj/structure/lattice,/obj/structure/closet/walllocker_double/emergency_engi/south,/turf/simulated/open,/area/stellardelight/deck2/port) -"aF" = (/obj/structure/lattice,/obj/structure/disposalpipe/segment{dir = 4},/obj/structure/cable/green{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/structure/closet/walllocker_double/emergency_engi/south,/turf/simulated/open,/area/stellardelight/deck2/port) -"aG" = (/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 8},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"aH" = (/obj/machinery/account_database{dir = 8},/obj/structure/sign/painting/library_secure{pixel_x = 30},/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"aJ" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/stellardelight/deck2/starboard) -"aK" = (/obj/structure/cable/blue{icon_state = "1-4"},/obj/machinery/camera/network/command{dir = 10},/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"aM" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 10},/turf/simulated/floor,/area/stellardelight/deck2/central) -"aN" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 8},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 4},/obj/structure/cable/blue{icon_state = "1-2"},/turf/simulated/open,/area/stellardelight/deck2/starboard) -"aP" = (/obj/structure/bed/chair/shuttle{dir = 1},/obj/structure/closet/emergsuit_wall{dir = 1; pixel_y = -32},/obj/machinery/alarm{dir = 4; pixel_x = -28},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"aQ" = (/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"aS" = (/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarrooma) -"aX" = (/obj/structure/sign/deck3{pixel_x = 32},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"ba" = (/obj/machinery/atmospherics/unary/vent_pump/on,/obj/effect/landmark/vines,/turf/simulated/open,/area/stellardelight/deck2/fore) -"bb" = (/obj/effect/floor_decal/techfloor/orange{dir = 8},/obj/machinery/atmospherics/unary/vent_pump/on,/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/transitgateway) -"bd" = (/obj/structure/closet,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"be" = (/obj/machinery/door/firedoor/glass/hidden/shuttle,/obj/machinery/door/blast/shuttle/open{dir = 4; id = "shuttleshutter"},/obj/structure/window/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/reinforced/airless,/area/shuttle/sdboat/fore{base_turf = /turf/simulated/floor/reinforced/airless}) -"bg" = (/obj/machinery/door/firedoor/glass,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/door/airlock/angled_bay/standard/color{dir = 4; door_color = "#323d80"; fill_color = "#313866"; id_tag = "hopdoor"; name = "Head of Personnel"; req_access = list(57); stripe_color = "#a3d1d1"},/turf/simulated/floor/tiled/steel_ridged,/area/crew_quarters/heads/hop) -"bh" = (/obj/structure/cable{icon_state = "4-8"},/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/hatch{dir = 4; door_color = "#e6ab22"; name = "Command Substation"; req_one_access = list(10); stripe_color = "#e6ab22"},/turf/simulated/floor/tiled/steel_ridged,/area/maintenance/stellardelight/deck3/starboardfore) -"bj" = (/obj/structure/flora/pottedplant/stoutbush,/turf/simulated/floor/tiled/dark,/area/lawoffice) -"bl" = (/obj/structure/lattice,/obj/structure/cable/green{icon_state = "32-2"},/obj/machinery/door/firedoor/glass,/turf/simulated/open,/area/maintenance/stellardelight/deck3/portcent) -"bm" = (/obj/structure/cable{icon_state = "4-8"},/obj/structure/cable{icon_state = "1-4"},/turf/simulated/floor,/area/maintenance/stellardelight/substation/command) -"bn" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 1},/turf/simulated/open,/area/stellardelight/deck2/fore) -"bp" = (/obj/effect/floor_decal/industrial/warning{dir = 4},/obj/structure/cable/green{icon_state = "2-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"br" = (/obj/structure/lattice,/obj/structure/cable{icon_state = "32-2"},/obj/structure/disposalpipe/down,/obj/machinery/door/firedoor/glass,/turf/simulated/open,/area/maintenance/stellardelight/deck3/starboardcent) -"bs" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 9},/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"bx" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/carpet/purcarpet,/area/crew_quarters/heads/hor) -"by" = (/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/deck3/starboardaft) -"bB" = (/obj/structure/cable{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"bC" = (/obj/structure/closet/crate,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance/medical,/obj/random/maintenance/medical,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"bE" = (/turf/simulated/floor/glass/reinforced,/area/stellardelight/deck3/commandhall) -"bI" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 1},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 1},/obj/structure/cable/blue{icon_state = "2-4"},/turf/simulated/open,/area/stellardelight/deck2/fore) -"bJ" = (/obj/structure/table/steel,/obj/item/weapon/flame/candle,/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/forestarrooma) -"bK" = (/obj/machinery/camera/network/command,/turf/simulated/floor/bluegrid,/area/ai) -"bL" = (/obj/machinery/media/jukebox/hacked,/obj/machinery/status_display{pixel_y = 32},/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"bM" = (/obj/effect/floor_decal/emblem/nt1,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_upload) -"bO" = (/obj/structure/table/darkglass,/obj/item/weapon/clipboard,/obj/machinery/atmospherics/unary/vent_pump/on{dir = 1},/turf/simulated/floor/tiled/dark,/area/lawoffice) -"bP" = (/obj/machinery/atmospherics/pipe/manifold/hidden,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"bQ" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 1},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"bS" = (/obj/structure/cable{icon_state = "2-4"},/obj/structure/disposalpipe/segment{dir = 4; icon_state = "pipe-c"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 6},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 6},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"bT" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor,/area/stellardelight/deck2/central) -"bU" = (/turf/simulated/wall/bay{desc = "It has a blue stripe! A huge chunk of metal used to seperate rooms."; stripe_color = "#2e2aa1"},/area/stellardelight/deck3/commandhall) -"bV" = (/obj/machinery/alarm/angled,/turf/simulated/open,/area/crew_quarters/bar) -"bW" = (/obj/structure/table/standard,/obj/item/toy/plushie/ipc/toaster,/obj/machinery/atmospherics/unary/vent_pump/on,/turf/simulated/floor/bluegrid,/area/ai_cyborg_station) -"bY" = (/obj/structure/table/woodentable,/obj/machinery/door/blast/shutters{dir = 4; id = "cafe"; layer = 3.1; name = "Cafe Shutters"},/turf/simulated/floor/lino,/area/stellardelight/deck3/cafe) -"bZ" = (/obj/machinery/ntnet_relay,/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"ca" = (/obj/structure/lattice,/obj/machinery/atmospherics/unary/vent_pump/on{dir = 1},/obj/effect/landmark/vines,/turf/simulated/open,/area/crew_quarters/bar) -"cb" = (/turf/simulated/wall/bay/r_wall/blue,/area/crew_quarters/heads/chief) -"cc" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 6},/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"ch" = (/obj/machinery/vending/wardrobe/mimedrobe,/turf/simulated/floor/carpet/bcarpet,/area/stellardelight/deck3/clownmimeoffice) -"ci" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/door/airlock/angled_bay/secure{dir = 4; name = "Robotic Storage"; req_access = list(16)},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor/tiled/steel_ridged,/area/ai_cyborg_station) -"ck" = (/obj/structure/cable/green{icon_state = "2-8"},/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 2; icon_state = "pipe-c"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 10},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 10},/obj/structure/sign/painting/public{pixel_y = 30},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 1},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"cm" = (/obj/machinery/exonet_node{anchored = 1},/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"cn" = (/obj/structure/cable/green{icon_state = "2-8"},/obj/structure/cable/green{icon_state = "4-8"},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"cp" = (/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/obj/machinery/light/small,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"cq" = (/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"cs" = (/obj/structure/bed/chair{dir = 8},/turf/simulated/floor/glass/reinforced,/area/stellardelight/deck3/aft) -"ct" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/door/airlock/angled_bay/secure{dir = 4; name = "AI Storage"; req_access = list(16)},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor/tiled/steel_ridged,/area/ai_cyborg_station) -"cu" = (/obj/structure/sign/directions/evac{pixel_x = -32},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/obj/structure/flora/pottedplant/smalltree,/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"cw" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_upload) -"cx" = (/obj/machinery/computer/timeclock/premade/north,/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 1},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"cy" = (/obj/machinery/recharge_station,/obj/structure/closet/emergsuit_wall{pixel_y = 29},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"cz" = (/obj/structure/cable{icon_state = "1-8"},/turf/simulated/wall/bay/r_wall/blue,/area/ai_cyborg_station) -"cA" = (/obj/structure/bed/chair{dir = 8},/obj/machinery/light,/turf/simulated/floor/glass/reinforced,/area/stellardelight/deck3/aft) -"cH" = (/obj/machinery/power/apc/angled{dir = 8; name = "night shift APC"; nightshift_setting = 2},/obj/structure/cable/green{icon_state = "0-4"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportroomb) -"cI" = (/obj/effect/floor_decal/techfloor{dir = 8},/obj/structure/cable/green{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/cryo) -"cK" = (/obj/structure/cable/green{icon_state = "2-4"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"cL" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/structure/cable/blue{icon_state = "2-4"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardfore) -"cO" = (/obj/machinery/holoplant,/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 8},/obj/machinery/status_display{pixel_x = 32},/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"cP" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"cS" = (/obj/machinery/atmospherics/unary/vent_pump/on{dir = 8},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"cW" = (/obj/machinery/atmospherics/unary/vent_pump{external_pressure_bound = 140; external_pressure_bound_default = 140; icon_state = "map_vent_out"; pressure_checks = 0; pressure_checks_default = 0; use_power = 1},/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"cY" = (/obj/machinery/telecomms/broadcaster/preset_right/sd,/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"cZ" = (/obj/machinery/light/small{dir = 8},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportrooma) -"db" = (/obj/structure/lattice,/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 8},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 4},/turf/simulated/open,/area/stellardelight/deck2/starboard) -"df" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"dh" = (/obj/effect/floor_decal/industrial/warning/corner{dir = 8},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"dj" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 1},/obj/effect/floor_decal/steeldecal/steel_decals_central5{dir = 1; pixel_y = 1},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"dk" = (/obj/machinery/atmospherics/unary/vent_pump/high_volume{dir = 4; frequency = 1379; id_tag = "starmaint_airpump"},/obj/machinery/camera/network/civilian,/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/starboardcent) -"dn" = (/obj/item/device/radio/intercom{dir = 8; pixel_x = -24},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_server_room) -"do" = (/obj/machinery/papershredder,/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"dr" = (/obj/machinery/light{dir = 4},/obj/machinery/atmospherics/unary/vent_pump/on{dir = 8},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"du" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/hatch{dir = 4; name = "maintenance access"; stripe_color = "#454545"},/obj/structure/cable/blue{icon_state = "4-8"},/turf/simulated/floor/tiled/steel_ridged,/area/maintenance/stellardelight/deck3/forestarrooma) -"dw" = (/obj/structure/cable/green{icon_state = "1-8"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"dx" = (/turf/simulated/wall/bay/steel,/area/maintenance/stellardelight/deck3/forestarroomb) -"dy" = (/obj/effect/floor_decal/industrial/warning,/obj/structure/cable/blue{icon_state = "2-8"},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 4},/obj/machinery/atmospherics/pipe/manifold4w/hidden/supply,/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"dB" = (/obj/effect/floor_decal/industrial/warning/corner{dir = 4},/obj/structure/cable/green{icon_state = "1-4"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"dD" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 6},/turf/simulated/floor/carpet,/area/crew_quarters/heads/hos) -"dE" = (/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"dF" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/effect/floor_decal/emblem/nt1,/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"dH" = (/obj/structure/table/steel_reinforced,/obj/machinery/recharger{pixel_y = 4},/obj/machinery/light,/turf/simulated/floor/tiled/dark,/area/crew_quarters/heads/hos) -"dL" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/table/steel,/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportroomb) -"dM" = (/obj/structure/closet/firecloset,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"dN" = (/obj/machinery/door/firedoor/glass,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/door/airlock/angled_bay/hatch{name = "maintenance access"; stripe_color = "#454545"},/turf/simulated/floor/tiled/steel_ridged,/area/crew_quarters/bar) -"dQ" = (/obj/machinery/door/firedoor/glass/hidden/shuttle,/obj/machinery/door/blast/shuttle/open{id = "shuttleshutter"},/obj/structure/window/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/reinforced/airless,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"dS" = (/obj/machinery/camera/network/command{dir = 4},/obj/machinery/atmospherics/unary/vent_pump/on{dir = 4},/turf/simulated/floor/carpet/turcarpet,/area/ai) -"dT" = (/obj/machinery/light/small{dir = 8},/turf/simulated/open,/area/stellardelight/deck2/port) -"dU" = (/turf/simulated/wall/bay/blue,/area/lawoffice) -"dV" = (/obj/effect/floor_decal/industrial/warning/corner{dir = 8},/obj/machinery/holoplant,/obj/machinery/atmospherics/unary/vent_pump/on{dir = 8},/obj/machinery/light_switch{dir = 8; pixel_x = 24},/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"dY" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/carpet,/area/crew_quarters/heads/hos) -"dZ" = (/obj/machinery/light_switch{dir = 8; pixel_x = 24; pixel_y = 24},/turf/simulated/floor/tiled/dark,/area/lawoffice) -"ea" = (/obj/structure/table/bench/padded,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/wood,/area/stellardelight/deck3/cafe) -"eb" = (/obj/machinery/atmospherics/unary/vent_pump/high_volume{dir = 4; frequency = 1379; id_tag = "starmaint_airpump"},/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/starboardcent) -"ed" = (/obj/structure/closet,/obj/random/firstaid,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"eg" = (/obj/machinery/porta_turret/ai_defense,/obj/structure/cable/blue{icon_state = "1-2"},/turf/simulated/floor/bluegrid,/area/ai) -"eh" = (/obj/structure/cable/green{icon_state = "2-8"},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 8},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"ei" = (/obj/machinery/light{dir = 4},/turf/simulated/floor/tiled/steel_grid,/area/stellardelight/deck3/aft) -"ej" = (/obj/effect/floor_decal/techfloor/orange{dir = 1},/obj/structure/closet/emergsuit_wall{pixel_y = 29},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/transitgateway) -"ek" = (/obj/machinery/camera/network/halls{dir = 8},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 8},/obj/structure/cable{icon_state = "1-8"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"el" = (/obj/machinery/pda_multicaster/prebuilt,/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"em" = (/obj/structure/cable/blue{icon_state = "4-8"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarrooma) -"en" = (/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"eo" = (/obj/machinery/power/apc/angled{dir = 4},/obj/structure/cable/blue{icon_state = "0-2"},/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"ep" = (/obj/structure/cable{icon_state = "2-4"},/turf/simulated/floor,/area/ai_cyborg_station) -"et" = (/obj/effect/floor_decal/industrial/warning{dir = 8},/obj/machinery/light/small,/turf/simulated/floor/airless,/area/stellardelight/deck3/portdock) -"eu" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/bluegrid,/area/ai) -"ev" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/door/airlock/angled_bay/standard/color{dir = 4; door_color = "#323d80"; fill_color = "#313866"; id_tag = "rddoor"; name = "Research Director"; req_access = list(30); stripe_color = "#5a19a8"},/turf/simulated/floor/tiled/steel_ridged,/area/crew_quarters/heads/hor) -"ew" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/cable/green{icon_state = "2-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"ex" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/light{dir = 8},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"ey" = (/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportroomb) -"ez" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/double{name = "maintenance access"; stripe_color = "#454545"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardfore) -"eC" = (/obj/machinery/telecomms/receiver/preset_right/sd,/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"eD" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 5},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 5},/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"eE" = (/obj/machinery/alarm/angled{dir = 4},/obj/structure/table/rack,/obj/random/maintenance,/obj/random/drinkbottle,/obj/random/snack,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarroomb) -"eF" = (/obj/structure/table/rack,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance/clean,/obj/random/maintenance/clean,/obj/random/maintenance/engineering,/obj/random/maintenance/medical,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"eI" = (/obj/structure/cable/green{icon_state = "1-4"},/turf/simulated/wall/bay/r_wall/steel,/area/crew_quarters/bar) -"eJ" = (/turf/simulated/wall/fancy_shuttle/nondense{fancy_shuttle_tag = "sdboat"},/area/shuttle/sdboat/fore{base_turf = /turf/simulated/floor/reinforced/airless}) -"eK" = (/obj/machinery/atmospherics/unary/vent_pump{external_pressure_bound = 0; external_pressure_bound_default = 0; icon_state = "map_vent_in"; initialize_directions = 1; internal_pressure_bound = 4000; internal_pressure_bound_default = 4000; pressure_checks = 2; pressure_checks_default = 2; pump_direction = 0; use_power = 1},/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"eL" = (/obj/machinery/atmospherics/unary/vent_pump/on{dir = 4},/obj/machinery/camera/network/command{dir = 4},/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"eN" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"eP" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/standard/color/common{dir = 4; name = "Holodeck"},/turf/simulated/floor/tiled/steel_ridged,/area/holodeck_control) -"eQ" = (/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 1},/turf/simulated/open,/area/stellardelight/deck2/starboard) -"eR" = (/obj/structure/table/steel,/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/forestarrooma) -"eS" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"eU" = (/obj/structure/table/woodentable,/obj/machinery/door/blast/shutters{dir = 2; id = "cafe"; layer = 3.1; name = "Cafe Shutters"},/turf/simulated/floor/lino,/area/stellardelight/deck3/cafe) -"eV" = (/obj/structure/lattice,/obj/machinery/atmospherics/unary/vent_pump/on{dir = 8},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/open,/area/crew_quarters/bar) -"eX" = (/obj/structure/cable/green{icon_state = "1-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"eY" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/open,/area/stellardelight/deck2/starboard) -"fa" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/carpet/oracarpet,/area/crew_quarters/heads/chief) -"fb" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_server_room) -"fd" = (/obj/item/weapon/reagent_containers/food/drinks/cup{pixel_x = 8; pixel_y = 8},/obj/item/weapon/reagent_containers/food/drinks/cup{pixel_x = -4; pixel_y = 8},/obj/item/weapon/reagent_containers/food/drinks/cup{pixel_x = 8; pixel_y = -4},/obj/item/weapon/reagent_containers/food/drinks/cup{pixel_x = -4; pixel_y = -4},/obj/item/weapon/reagent_containers/food/drinks/cup{pixel_x = 8},/obj/item/weapon/reagent_containers/food/drinks/cup{pixel_x = -4},/obj/item/weapon/reagent_containers/food/drinks/cup{pixel_x = 8; pixel_y = 12},/obj/item/weapon/reagent_containers/food/drinks/cup{pixel_x = -4; pixel_y = 12},/obj/structure/table/woodentable,/obj/item/weapon/hand_labeler,/obj/machinery/alarm/angled,/obj/machinery/status_display{pixel_x = -32},/turf/simulated/floor/lino,/area/stellardelight/deck3/cafe) -"ff" = (/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/hatch{dir = 4; name = "maintenance access"; stripe_color = "#454545"},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor/tiled/steel_ridged,/area/maintenance/stellardelight/deck3/starboardaft) -"fg" = (/obj/structure/handrail{dir = 1},/obj/machinery/alarm{dir = 1; pixel_y = -28},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"fh" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/cable/green{icon_state = "2-8"},/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportroomb) -"fj" = (/obj/structure/table/woodentable,/obj/item/toy/figure/clown,/obj/item/weapon/pen/crayon/marker/rainbow,/obj/item/weapon/pen/crayon/rainbow,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/unary/vent_pump/on{dir = 4},/turf/simulated/floor/carpet/gaycarpet,/area/stellardelight/deck3/clownmimeoffice) -"fk" = (/obj/machinery/telecomms/server/presets/common,/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"fs" = (/obj/structure/cable/green{icon_state = "2-8"},/turf/simulated/wall/bay/r_wall/steel,/area/crew_quarters/bar) -"fv" = (/obj/machinery/holoplant,/obj/machinery/power/apc/angled{dir = 4},/obj/structure/cable/blue{icon_state = "0-8"},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_upload) -"fz" = (/obj/effect/floor_decal/techfloor/orange,/obj/effect/landmark{name = "JoinLateGateway"},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/transitgateway) -"fD" = (/obj/structure/table/rack,/obj/random/maintenance,/obj/random/maintenance/engineering,/obj/random/maintenance/engineering,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarroomb) -"fE" = (/obj/structure/lattice,/obj/structure/cable{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 1},/obj/machinery/atmospherics/pipe/manifold/hidden/supply,/turf/simulated/open,/area/stellardelight/deck2/starboard) -"fG" = (/obj/structure/cable/green{icon_state = "1-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 9},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 9},/obj/machinery/atmospherics/pipe/manifold/hidden{dir = 1},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"fM" = (/obj/machinery/power/terminal{dir = 8},/obj/structure/cable,/turf/simulated/floor,/area/ai_cyborg_station) -"fO" = (/obj/structure/cable/blue{icon_state = "2-4"},/obj/machinery/light{dir = 1},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"fP" = (/obj/machinery/space_heater,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"fS" = (/turf/simulated/wall/bay/steel,/area/crew_quarters/heads/hop) -"fT" = (/obj/machinery/light_switch{dir = 4; pixel_x = -24; pixel_y = 24},/turf/simulated/floor/tiled/dark,/area/lawoffice) -"fW" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"gb" = (/obj/structure/table/steel_reinforced,/obj/item/weapon/folder/red_hos,/turf/simulated/floor/carpet,/area/crew_quarters/heads/hos) -"gc" = (/obj/machinery/atmospherics/unary/vent_pump/high_volume{dir = 4; frequency = 1379; id_tag = "portmaint_airpump"},/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/portcent) -"gg" = (/obj/structure/lattice,/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 8},/obj/effect/mouse_hole_spawner{dir = 4},/turf/simulated/open,/area/crew_quarters/bar) -"gh" = (/obj/machinery/telecomms/server/presets/command,/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"gi" = (/obj/machinery/atmospherics/pipe/simple/hidden/fuel,/turf/simulated/wall/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"gj" = (/obj/structure/table/rack/shelf,/obj/item/weapon/disk/nifsoft/compliance,/obj/random/contraband,/obj/random/contraband,/obj/random/contraband,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/obj/random/snack,/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportroomb) -"gk" = (/obj/structure/table/woodentable,/obj/random/paicard,/turf/simulated/floor/wood,/area/stellardelight/deck3/cafe) -"gl" = (/obj/structure/bed/chair/shuttle{dir = 1},/obj/structure/closet/emergsuit_wall{pixel_y = 32},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"gm" = (/obj/structure/lattice,/obj/structure/cable/blue{icon_state = "4-8"},/turf/simulated/open,/area/stellardelight/deck2/fore) -"gq" = (/obj/effect/floor_decal/spline/plain{dir = 4},/obj/structure/closet/hydrant{pixel_y = 28},/turf/simulated/floor/lino,/area/stellardelight/deck3/cafe) -"gs" = (/obj/machinery/requests_console/preset/rd{pixel_x = 30},/turf/simulated/floor/carpet/purcarpet,/area/crew_quarters/heads/hor) -"gw" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/cable/green{icon_state = "1-4"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"gy" = (/obj/structure/closet/secure_closet/engineering_chief,/obj/item/device/radio/intercom{dir = 1; name = "Station Intercom (General)"; pixel_y = 24},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/item/device/retail_scanner/engineering,/turf/simulated/floor/tiled,/area/crew_quarters/heads/chief) -"gA" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/structure/cable/green{icon_state = "1-4"},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 8},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"gB" = (/obj/machinery/power/pointdefense{id_tag = "sd_pd"},/obj/effect/floor_decal/industrial/warning/full,/obj/structure/cable/green{icon_state = "0-4"},/obj/structure/cable/green{icon_state = "0-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"gE" = (/obj/structure/table/darkglass,/obj/item/weapon/stamp/denied{pixel_x = 6; pixel_y = 6},/obj/item/weapon/stamp/internalaffairs,/turf/simulated/floor/carpet/blue2,/area/lawoffice) -"gG" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/open,/area/stellardelight/deck2/fore) -"gH" = (/turf/simulated/floor,/area/ai_cyborg_station) -"gJ" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/cable/green{icon_state = "2-8"},/obj/structure/cable/green{icon_state = "2-4"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"gL" = (/obj/item/weapon/bedsheet/hosdouble,/obj/structure/bed/double/padded,/obj/structure/curtain/black{color = "#631915"},/obj/effect/landmark/start/hos,/turf/simulated/floor/carpet,/area/crew_quarters/heads/hos) -"gM" = (/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/turf/simulated/wall/bay/r_wall/steel,/area/stellardelight/deck3/aft) -"gN" = (/obj/structure/cable/blue{icon_state = "2-8"},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 1},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 1},/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"gO" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/manifold/hidden/supply,/obj/structure/cable/blue{icon_state = "4-8"},/turf/simulated/open,/area/stellardelight/deck2/fore) -"gQ" = (/obj/machinery/power/smes/buildable{charge = 5e+006; input_attempt = 1; input_level = 200000; output_level = 200000},/obj/structure/window/reinforced{dir = 1},/obj/structure/window/reinforced{dir = 4},/obj/structure/cable/cyan{icon_state = "0-4"},/obj/machinery/light{dir = 8},/turf/simulated/floor/bluegrid,/area/ai) -"gR" = (/obj/effect/floor_decal/techfloor/orange{dir = 6},/obj/machinery/light{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/transitgateway) -"gS" = (/obj/structure/cable/cyan{icon_state = "2-8"},/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"gU" = (/obj/machinery/atmospherics/pipe/simple/hidden/black{dir = 5},/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"gV" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/double/glass{name = "glass airlock"},/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/aft) -"gW" = (/obj/machinery/atmospherics/pipe/simple/hidden/black{dir = 10},/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"hb" = (/obj/structure/cable/green{icon_state = "1-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor/wood,/area/stellardelight/deck3/cafe) -"hc" = (/obj/machinery/requests_console/preset/hos{pixel_x = -30},/turf/simulated/floor/carpet,/area/crew_quarters/heads/hos) -"hd" = (/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"he" = (/obj/machinery/button/remote/airlock{id = "readingroom1"; name = "Room 1 Lock"; pixel_y = 24; specialfunctions = 4},/obj/machinery/button/remote/blast_door{id = "readingroom1"; name = "Window Lockdown"; pixel_x = -10; pixel_y = 24},/turf/simulated/floor/carpet,/area/stellardelight/deck3/readingroom) -"hf" = (/obj/structure/sign/warning/docking_area{pixel_x = -32},/turf/simulated/floor/reinforced/airless,/area/stellardelight/deck3/exterior) -"hg" = (/obj/effect/fancy_shuttle/sd_shuttle{dir = 1; fancy_shuttle_tag = "sdboat"},/obj/effect/fancy_shuttle_floor_preview/sd_shuttle{dir = 1},/turf/simulated/wall/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"hj" = (/obj/machinery/portable_atmospherics/hydroponics,/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportroomb) -"hk" = (/obj/effect/floor_decal/industrial/warning,/obj/structure/sign/warning/docking_area{pixel_y = 32},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"hp" = (/obj/structure/table/glass,/obj/machinery/computer/med_data/laptop{dir = 4; pixel_y = 6},/turf/simulated/floor/carpet/tealcarpet,/area/crew_quarters/heads/cmo) -"hr" = (/obj/structure/cable{icon_state = "4-8"},/obj/machinery/light/small{dir = 1},/turf/simulated/floor,/area/maintenance/stellardelight/substation/command) -"ht" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_upload) -"hu" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/carpet/blue2,/area/lawoffice) -"hw" = (/obj/machinery/telecomms/processor/preset_one,/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"hy" = (/obj/machinery/atmospherics/pipe/simple/hidden,/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/starboardcent) -"hz" = (/obj/structure/cable/blue{icon_state = "1-2"},/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/forestarroomb) -"hB" = (/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"hC" = (/obj/machinery/light/small{dir = 4},/turf/simulated/open,/area/stellardelight/deck2/fore) -"hD" = (/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/deck3/foreportrooma) -"hE" = (/obj/structure/cable{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/door/firedoor/glass,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"hF" = (/obj/machinery/holoplant,/obj/machinery/light_switch{dir = 8; pixel_x = 24},/turf/simulated/floor/bluegrid,/area/ai_cyborg_station) -"hG" = (/obj/structure/sign/poster{dir = 4},/turf/simulated/floor,/area/stellardelight/deck2/port) -"hK" = (/obj/machinery/light{dir = 4},/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_upload) -"hN" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/stellardelight/deck3/portdock) -"hO" = (/obj/machinery/power/breakerbox/activated{RCon_tag = "Command Substation Bypass"},/turf/simulated/floor,/area/maintenance/stellardelight/substation/command) -"hP" = (/obj/structure/lattice,/obj/structure/cable{icon_state = "4-8"},/obj/structure/cable{icon_state = "2-4"},/obj/machinery/atmospherics/pipe/manifold/hidden/supply,/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers,/turf/simulated/open,/area/stellardelight/deck2/starboard) -"hQ" = (/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/deck3/aftstarroom) -"hR" = (/obj/structure/cable/green{icon_state = "1-8"},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"hT" = (/obj/structure/cable/blue{icon_state = "4-8"},/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/deck3/starboardfore) -"hU" = (/obj/structure/sign/painting/library_secure{pixel_x = 30},/turf/simulated/floor/carpet/purcarpet,/area/crew_quarters/heads/hor) -"hX" = (/turf/simulated/floor/carpet/oracarpet,/area/crew_quarters/heads/chief) -"hY" = (/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor,/area/stellardelight/deck2/port) -"hZ" = (/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/obj/structure/sign/vacuum{pixel_x = 32; plane = -34},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"ib" = (/obj/machinery/atmospherics/pipe/simple/hidden/black{dir = 9},/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"if" = (/obj/structure/cable{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"ii" = (/turf/simulated/floor,/area/maintenance/stellardelight/substation/command) -"ij" = (/obj/structure/bed/chair/office/dark{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 6},/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"il" = (/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportrooma) -"im" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/cable/green{icon_state = "1-8"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/effect/floor_decal/steeldecal/steel_decals4{dir = 9},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"in" = (/turf/simulated/wall/bay/r_wall/blue,/area/crew_quarters/heads/hop) -"ip" = (/obj/structure/cable{icon_state = "4-8"},/turf/simulated/floor/carpet/gaycarpet,/area/stellardelight/deck3/clownmimeoffice) -"ir" = (/obj/structure/cable/blue{icon_state = "4-8"},/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/forestarroomb) -"is" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/secure{name = "AI/Telecoms"; req_access = list(16)},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled/steel_ridged,/area/ai_upload) -"iv" = (/obj/machinery/alarm/angled{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 9},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"iw" = (/obj/structure/cable{icon_state = "4-8"},/obj/structure/cable/green{icon_state = "1-2"},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/obj/machinery/atmospherics/pipe/simple/hidden/fuel{dir = 4},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"iy" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/commandhall) -"iz" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/bed/chair/sofa/corp/right{dir = 4},/obj/effect/landmark{name = "morphspawn"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"iC" = (/obj/structure/cryofeed{dir = 4},/obj/effect/floor_decal/corner_techfloor_grid{dir = 5},/obj/effect/floor_decal/corner_techfloor_grid{dir = 10},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/cryo) -"iE" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/hatch{door_color = "#e6ab22"; name = "Shield Generator"; req_access = null; req_one_access = list(11,24); stripe_color = "#e6ab22"},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/commandhall) -"iI" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/structure/closet/emergsuit_wall{dir = 4; pixel_x = 27},/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"iJ" = (/obj/machinery/cryopod/robot,/obj/machinery/light{dir = 8},/turf/simulated/floor/bluegrid,/area/ai_cyborg_station) -"iK" = (/obj/machinery/power/terminal{dir = 1},/obj/structure/cable/blue{icon_state = "0-2"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 6},/obj/item/device/radio/intercom{dir = 8; pixel_x = -24},/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"iL" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"iN" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/open,/area/crew_quarters/bar) -"iP" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"iQ" = (/obj/machinery/light/small{dir = 8},/turf/simulated/open,/area/stellardelight/deck2/fore) -"iR" = (/obj/structure/cable/cyan{icon_state = "1-2"},/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"iS" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"iV" = (/obj/structure/railing/grey{dir = 4},/turf/simulated/open,/area/stellardelight/deck3/commandhall) -"iW" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/effect/floor_decal/steeldecal/steel_decals4{dir = 8},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"iY" = (/obj/machinery/power/pointdefense{id_tag = "sd_pd"},/obj/effect/floor_decal/industrial/warning/full,/obj/structure/cable/blue,/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"iZ" = (/obj/effect/floor_decal/industrial/warning{dir = 4},/obj/machinery/light/small,/turf/simulated/floor/airless,/area/stellardelight/deck3/starboarddock) -"ja" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 6},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/open,/area/crew_quarters/bar) -"jc" = (/obj/machinery/computer/ship/sensors/adv,/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/fore{base_turf = /turf/simulated/floor/reinforced/airless}) -"jd" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor/tiled,/area/stellardelight/deck3/transitgateway) -"jg" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/stellardelight/deck3/starboarddock) -"jh" = (/obj/structure/closet/secure_closet/hop2,/obj/machinery/atmospherics/unary/vent_pump/on{dir = 8},/obj/machinery/alarm/angled{dir = 8; pixel_x = 30},/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"jm" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/table/woodentable,/obj/machinery/door/blast/shutters{dir = 2; id = "cafe"; layer = 3.1; name = "Cafe Shutters"},/turf/simulated/floor/lino,/area/stellardelight/deck3/cafe) -"jn" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/door/airlock/angled_bay/standard/color{dir = 4; door_color = "#323d80"; fill_color = "#858585"; id_tag = "cedoor"; name = "Chief Engineer"; req_access = list(56); stripe_color = "#e6ab22"},/turf/simulated/floor/tiled/steel_ridged,/area/crew_quarters/heads/chief) -"jo" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/effect/mouse_hole_spawner{dir = 8},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"jp" = (/obj/structure/closet,/obj/random/contraband,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance/cargo,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/aftstarroom) -"jy" = (/obj/structure/window/bay/reinforced,/obj/structure/low_wall/bay/reinforced/steel,/obj/machinery/door/firedoor/glass,/obj/machinery/door/blast/angled/open{dir = 4; id = "clownmimeoffice"},/turf/simulated/floor,/area/stellardelight/deck3/clownmimeoffice) -"jC" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/open,/area/crew_quarters/bar) -"jD" = (/obj/structure/bed/double/padded,/obj/item/weapon/bedsheet/hopdouble,/obj/structure/curtain/black,/obj/effect/landmark/start/hop,/obj/machinery/requests_console{announcementConsole = 1; department = "Bridge"; departmentType = 5; name = "Bridge RC"; pixel_y = 28},/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"jE" = (/obj/machinery/light{dir = 1},/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"jK" = (/obj/machinery/alarm/angled{dir = 4},/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"jL" = (/obj/structure/lattice,/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 8},/turf/simulated/open,/area/stellardelight/deck2/port) -"jM" = (/obj/item/modular_computer/console/preset/command,/obj/structure/sign/poster{dir = 4},/obj/machinery/newscaster{pixel_y = 28},/turf/simulated/floor/tiled/techfloor,/area/crew_quarters/heads/hor) -"jO" = (/obj/machinery/station_map{dir = 4; pixel_x = -32},/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"jP" = (/obj/machinery/alarm/angled,/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 1},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"jT" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 8},/turf/simulated/open,/area/stellardelight/deck2/port) -"jV" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/light{dir = 4},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"jY" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/open,/area/stellardelight/deck2/central) -"ka" = (/obj/structure/table/darkglass,/obj/item/weapon/storage/briefcase{pixel_x = -2; pixel_y = -5},/turf/simulated/floor/tiled/dark,/area/lawoffice) -"kb" = (/obj/machinery/atmospherics/pipe/simple/hidden/black{dir = 4},/obj/structure/cable/blue{icon_state = "4-8"},/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"kc" = (/obj/machinery/telecomms/server/presets/medical,/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"ki" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"kj" = (/obj/structure/lattice,/obj/structure/cable{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 8},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 4},/turf/simulated/open,/area/stellardelight/deck2/starboard) -"kk" = (/obj/effect/floor_decal/industrial/warning/corner{dir = 4},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"kl" = (/obj/machinery/keycard_auth{pixel_y = 28},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 10},/obj/machinery/alarm/angled{dir = 8},/turf/simulated/floor/tiled,/area/crew_quarters/heads/chief) -"ko" = (/obj/structure/cable/green{icon_state = "2-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"kp" = (/obj/structure/cable{icon_state = "2-8"},/obj/machinery/alarm/angled,/turf/simulated/floor,/area/maintenance/stellardelight/substation/command) -"kr" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 8},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"ks" = (/obj/machinery/telecomms/server/presets/security,/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"kt" = (/obj/machinery/light{dir = 8},/turf/simulated/floor/tiled/steel_grid,/area/stellardelight/deck3/aft) -"ku" = (/obj/structure/barricade/cutout/mime,/turf/simulated/floor/carpet/bcarpet,/area/stellardelight/deck3/clownmimeoffice) -"kw" = (/obj/machinery/light{dir = 8},/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"kz" = (/obj/machinery/airlock_sensor/airlock_exterior/shuttle{dir = 6; pixel_x = 7; pixel_y = 26},/obj/effect/map_helper/airlock/sensor/ext_sensor,/obj/effect/map_helper/airlock/door/ext_door,/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/glass_external,/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/obj/machinery/atmospherics/pipe/simple/hidden/fuel{dir = 10},/obj/structure/cable{icon_state = "4-8"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"kB" = (/obj/machinery/porta_turret/ai_defense,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 5},/turf/simulated/floor/bluegrid,/area/ai) -"kF" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 10},/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"kN" = (/obj/structure/sign/painting/library_secure{pixel_x = 30},/obj/structure/closet/secure_closet/hop,/obj/item/clothing/glasses/omnihud,/obj/item/weapon/paper/dockingcodes/sd,/obj/item/device/retail_scanner/command,/obj/item/weapon/storage/box/PDAs,/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"kO" = (/obj/machinery/door/firedoor/glass,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor,/area/stellardelight/deck2/fore) -"kP" = (/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/deck3/portfore) -"kQ" = (/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/deck3/foreportrooma) -"kT" = (/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 1},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 10},/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"kU" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/open,/area/crew_quarters/bar) -"kV" = (/obj/structure/bed/chair/office/dark{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportroomb) -"kW" = (/obj/machinery/camera/network/halls{dir = 4},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"kX" = (/obj/structure/cable/blue{icon_state = "2-4"},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"kY" = (/obj/effect/floor_decal/techfloor{dir = 10},/obj/effect/landmark{name = "JoinLateCryo"},/obj/machinery/camera/network/civilian{dir = 1},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/cryo) -"kZ" = (/obj/structure/handrail{dir = 1},/obj/machinery/airlock_sensor{dir = 8; pixel_x = 29; pixel_y = 2},/obj/effect/map_helper/airlock/sensor/int_sensor,/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/obj/structure/closet/emergsuit_wall{dir = 1; pixel_y = -32},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"la" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/obj/effect/floor_decal/steeldecal/steel_decals4{dir = 9},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/effect/floor_decal/shuttles,/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"lc" = (/obj/structure/fuel_port{dir = 8; pixel_x = -32},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/obj/machinery/atmospherics/binary/pump/fuel{dir = 1},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"le" = (/obj/structure/railing/grey{dir = 8},/obj/structure/railing/grey,/turf/simulated/open,/area/maintenance/stellardelight/deck3/starboardaft) -"lh" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/hatch{dir = 4; name = "maintenance access"; stripe_color = "#454545"},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor/tiled/steel_ridged,/area/maintenance/stellardelight/deck3/foreportroomb) -"li" = (/obj/machinery/telecomms/hub/preset/sd,/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"lj" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 6},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 6},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/open,/area/stellardelight/deck2/fore) -"lk" = (/obj/structure/filingcabinet/medical,/obj/machinery/status_display{pixel_y = 32},/turf/simulated/floor/tiled/eris/white/cargo,/area/crew_quarters/heads/cmo) -"lm" = (/obj/machinery/light{dir = 8},/obj/machinery/atmospherics/unary/vent_pump/on{dir = 4},/obj/structure/closet/emcloset,/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"lo" = (/obj/machinery/telecomms/server/presets/engineering,/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"lq" = (/turf/simulated/floor,/area/maintenance/stellardelight/deck3/aftstarroom) -"lt" = (/obj/structure/bed/chair,/obj/machinery/atmospherics/unary/vent_pump/on,/obj/structure/sign/poster{dir = 1},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 1},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"lu" = (/obj/machinery/camera/network/command,/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 4},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"lv" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/light/small{dir = 1},/obj/effect/floor_decal/steeldecal/steel_decals4{dir = 1},/obj/effect/floor_decal/steeldecal/steel_decals4{dir = 6},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"lw" = (/obj/machinery/telecomms/server/presets/science,/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"lx" = (/obj/machinery/telecomms/processor/preset_two,/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"lA" = (/obj/structure/table/rack,/obj/random/contraband,/obj/random/maintenance,/obj/random/maintenance/engineering,/obj/random/maintenance/engineering,/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/forestarroomb) -"lB" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/glass,/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"lC" = (/obj/machinery/power/apc/angled{dir = 4},/obj/structure/cable/green{icon_state = "0-8"},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"lD" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/effect/landmark/start/bartender,/turf/simulated/floor/lino,/area/stellardelight/deck3/cafe) -"lE" = (/obj/machinery/telecomms/bus/preset_two/sd,/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"lF" = (/obj/machinery/atmospherics/pipe/simple/hidden/universal,/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"lH" = (/obj/machinery/telecomms/server/presets/service/sd,/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"lJ" = (/obj/structure/cable/green{icon_state = "2-4"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 8},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"lL" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/light{dir = 4},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"lP" = (/obj/structure/table/woodentable,/obj/item/device/radio/intercom{dir = 4; name = "Station Intercom (General)"; pixel_x = 24},/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 8},/turf/simulated/floor/carpet/turcarpet,/area/ai) -"lQ" = (/obj/machinery/light,/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"lT" = (/obj/effect/floor_decal/techfloor/orange{dir = 4},/obj/machinery/atmospherics/unary/vent_scrubber/on,/obj/machinery/alarm/angled{dir = 8},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/transitgateway) -"lU" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/standard/color{dir = 4; door_color = "#9c9c9c"; fill_color = "#5c5c5c"; id_tag = "readingroom1"; name = "Room 1"; stripe_color = "#89bd66"},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/readingroom) -"lV" = (/obj/machinery/light/small{dir = 8},/turf/simulated/floor/carpet/bcarpet,/area/stellardelight/deck3/clownmimeoffice) -"lY" = (/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 1},/turf/simulated/open,/area/stellardelight/deck2/central) -"ma" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/external/glass{dir = 4; frequency = 1379; id_tag = "portmaint_exterior"; locked = 1; name = "Exterior Airlock"},/turf/simulated/floor/tiled/steel_ridged,/area/maintenance/stellardelight/deck3/portcent) -"mb" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 9},/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"md" = (/obj/machinery/button/remote/airlock{id = "readingroom3"; name = "Room 3 Lock"; pixel_y = 24; specialfunctions = 4},/obj/machinery/button/remote/blast_door{id = "readingroom3"; name = "Window Lockdown"; pixel_x = -10; pixel_y = 24},/turf/simulated/floor/carpet,/area/stellardelight/deck3/readingroom) -"me" = (/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/deck3/starboardcent) -"mf" = (/obj/effect/shuttle_landmark/premade/sd/deck3/portairlock,/turf/space,/area/space) -"mg" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/open,/area/stellardelight/deck2/central) -"mh" = (/obj/structure/table/steel_reinforced,/obj/item/device/radio/intercom{dir = 4; pixel_x = 1; pixel_y = 1},/obj/structure/closet/emergsuit_wall{dir = 1; pixel_y = -32},/obj/machinery/alarm{pixel_y = 28},/obj/machinery/light{dir = 4},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/fore{base_turf = /turf/simulated/floor/reinforced/airless}) -"mi" = (/obj/machinery/shipsensors/fancy_shuttle,/turf/simulated/wall/fancy_shuttle/nondense{fancy_shuttle_tag = "sdboat"},/area/shuttle/sdboat/fore{base_turf = /turf/simulated/floor/reinforced/airless}) -"mj" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/structure/cable/blue{icon_state = "4-8"},/turf/simulated/open,/area/stellardelight/deck2/fore) -"mm" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers,/obj/structure/cable/green{icon_state = "1-8"},/turf/simulated/floor,/area/stellardelight/deck2/fore) -"mn" = (/obj/effect/floor_decal/techfloor{dir = 4},/obj/effect/landmark{name = "JoinLateCryo"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/cryo) -"mo" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/door/firedoor/glass,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/starboarddock) -"mp" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/manifold/hidden/supply,/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 1},/obj/structure/cable/blue{icon_state = "4-8"},/turf/simulated/open,/area/stellardelight/deck2/fore) -"mq" = (/obj/structure/bed/chair{dir = 4},/obj/machinery/alarm/angled{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"mr" = (/obj/structure/table/bench/padded,/obj/effect/landmark/start/visitor,/turf/simulated/floor/wood,/area/stellardelight/deck3/cafe) -"ms" = (/obj/structure/reagent_dispensers/watertank,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"mv" = (/obj/effect/map_helper/airlock/atmos/pump_out_external,/obj/machinery/atmospherics/unary/vent_pump/high_volume{dir = 1; frequency = 1380; id_tag = "sdboat_docker_pump_out_external"},/turf/simulated/wall/fancy_shuttle/low{fancy_shuttle_tag = "sdboat"},/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"mA" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 6},/turf/simulated/floor/bluegrid,/area/ai) -"mC" = (/obj/machinery/telecomms/server/presets/supply,/obj/machinery/atmospherics/pipe/simple/hidden/black,/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"mD" = (/obj/structure/table/steel_reinforced,/obj/machinery/photocopier/faxmachine{department = "Head of Security"},/turf/simulated/floor/tiled/dark,/area/crew_quarters/heads/hos) -"mF" = (/turf/simulated/floor/carpet/bcarpet,/area/stellardelight/deck3/clownmimeoffice) -"mI" = (/obj/structure/cable/blue{icon_state = "1-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 9},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/light_switch{dir = 4; pixel_x = -24; pixel_y = 24},/turf/simulated/floor/tiled/eris/white/cargo,/area/crew_quarters/heads/cmo) -"mK" = (/obj/structure/cable{icon_state = "1-2"},/obj/machinery/light/small{dir = 8},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 8},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"mM" = (/obj/structure/cable/green{icon_state = "1-4"},/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"mO" = (/obj/structure/table/alien{name = "fancy table"},/obj/machinery/computer/skills{dir = 4; pixel_y = 6},/turf/simulated/floor/carpet/purcarpet,/area/crew_quarters/heads/hor) -"mQ" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"mR" = (/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarrooma) -"mS" = (/obj/structure/lattice,/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/open,/area/stellardelight/deck2/starboard) -"mT" = (/obj/machinery/space_heater,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"mX" = (/obj/structure/bed/chair{dir = 4},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"na" = (/obj/machinery/door/firedoor/glass,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/structure/cable/blue{icon_state = "4-8"},/turf/simulated/floor,/area/stellardelight/deck2/fore) -"nd" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/light,/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"ne" = (/obj/machinery/light/small{dir = 1},/turf/simulated/open,/area/stellardelight/deck2/fore) -"nf" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/external/glass{dir = 4; frequency = 1379; id_tag = "starmaint_exterior"; locked = 1; name = "Exterior Airlock"},/turf/simulated/floor/tiled/steel_ridged,/area/maintenance/stellardelight/deck3/starboardcent) -"nh" = (/obj/effect/floor_decal/industrial/warning{dir = 8},/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"nj" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/door/airlock/angled_bay/hatch{dir = 4; name = "maintenance access"; stripe_color = "#454545"},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/cafe) -"nk" = (/obj/machinery/light,/obj/structure/table/bench/padded,/obj/effect/landmark/start/visitor,/turf/simulated/floor/wood,/area/stellardelight/deck3/cafe) -"nm" = (/obj/machinery/telecomms/server/presets/unused,/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"np" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/camera/network/command{dir = 4},/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"nr" = (/obj/effect/floor_decal/techfloor/orange{dir = 5},/obj/structure/closet/emergsuit_wall{pixel_y = 29},/obj/structure/closet/emergsuit_wall{dir = 4; pixel_x = 27},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/transitgateway) -"ns" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 6},/turf/simulated/floor/carpet/oracarpet,/area/crew_quarters/heads/chief) -"nt" = (/obj/machinery/status_display{pixel_x = 32},/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/commandhall) -"nu" = (/obj/structure/cable{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 4},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 4},/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/alarm/angled{dir = 8},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"nv" = (/obj/item/weapon/reagent_containers/glass/bucket/wood,/obj/structure/closet/crate,/obj/item/weapon/material/minihoe,/obj/item/seeds/reishimycelium,/obj/item/seeds/random,/obj/item/seeds/random,/obj/item/seeds/random,/obj/item/seeds/random,/obj/item/seeds/random,/obj/item/seeds/ambrosiavulgarisseed,/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportroomb) -"nw" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/double{dir = 8; name = "maintenance access"; stripe_color = "#454545"},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"nx" = (/turf/simulated/open,/area/stellardelight/deck2/central) -"nz" = (/obj/machinery/camera/network/civilian{dir = 1},/turf/simulated/floor/wood,/area/stellardelight/deck3/cafe) -"nB" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/external/glass{dir = 4; frequency = 1380; id_tag = null; locked = 1; name = "Docking Port Airlock"},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/obj/effect/map_helper/airlock/door/int_door,/obj/machinery/access_button{command = "cycle_interior"; dir = 4; frequency = 1380; master_tag = "sd_escape_starboard"; pixel_y = 32; req_one_access = list(13)},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/starboarddock) -"nC" = (/obj/machinery/telecomms/bus/preset_four,/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"nD" = (/obj/machinery/power/apc/angled{dir = 4; name = "night shift APC"; nightshift_setting = 2},/obj/structure/cable{icon_state = "0-8"},/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/table/rack,/obj/random/contraband,/obj/random/maintenance/clean,/obj/random/maintenance,/obj/random/maintenance/engineering,/obj/random/maintenance/engineering,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"nF" = (/obj/structure/table/woodentable,/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 1},/obj/item/device/radio/intercom{dir = 8; pixel_x = -24},/turf/simulated/floor/wood,/area/stellardelight/deck3/cafe) -"nH" = (/obj/structure/table/steel_reinforced,/obj/item/device/flashlight/lamp/green{pixel_x = -4; pixel_y = 12},/obj/item/weapon/stamp/hos,/obj/item/weapon/book/manual/sd_guide,/turf/simulated/floor/carpet,/area/crew_quarters/heads/hos) -"nL" = (/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/obj/machinery/item_bank{dir = 4; pixel_x = -26},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"nM" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/item/device/radio/intercom{dir = 8; pixel_x = -24},/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"nN" = (/obj/machinery/cryopod/robot,/turf/simulated/floor/bluegrid,/area/ai_cyborg_station) -"nO" = (/obj/structure/closet/crate,/obj/random/contraband,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportrooma) -"nP" = (/turf/simulated/wall/bay/purple,/area/crew_quarters/heads/hor) -"nS" = (/obj/machinery/hologram/holopad,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_server_room) -"nT" = (/obj/machinery/smartfridge/drinks,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/aftstarroom) -"nV" = (/obj/structure/table/rack,/obj/random/contraband,/obj/random/maintenance,/obj/random/maintenance,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"nW" = (/turf/simulated/wall/bay/steel,/area/stellardelight/deck3/cafe) -"nX" = (/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportroomb) -"nZ" = (/obj/machinery/door/firedoor/glass/hidden/steel{dir = 2},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 1},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"ob" = (/obj/structure/lattice,/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 1},/obj/machinery/atmospherics/pipe/manifold/hidden/supply,/turf/simulated/open,/area/stellardelight/deck2/port) -"od" = (/obj/machinery/atmospherics/unary/vent_pump/high_volume{dir = 8; frequency = 1379; id_tag = "starmaint_airpump"},/obj/machinery/light/small{dir = 1},/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/starboardcent) -"og" = (/obj/structure/bed/chair{dir = 4},/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportrooma) -"ok" = (/obj/structure/lattice,/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/open,/area/stellardelight/deck2/starboard) -"ol" = (/obj/structure/table/alien{name = "fancy table"},/obj/item/weapon/stamp/rd,/obj/item/weapon/book/manual/sd_guide,/turf/simulated/floor/carpet/purcarpet,/area/crew_quarters/heads/hor) -"op" = (/obj/structure/cable/green{icon_state = "1-4"},/obj/structure/cable/green{icon_state = "1-8"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"oq" = (/obj/effect/landmark/arrivals,/turf/simulated/floor/glass/reinforced,/area/stellardelight/deck3/aft) -"os" = (/obj/machinery/door/firedoor/glass,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 6},/obj/machinery/door/airlock/angled_bay/external/glass{frequency = 1380; id_tag = null; locked = 1; name = "Docking Port Airlock"},/obj/effect/map_helper/airlock/door/int_door,/obj/machinery/access_button{command = "cycle_interior"; dir = 1; frequency = 1380; master_tag = "sd_escape_center_right"; pixel_x = 32; req_one_access = list(13)},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/aft) -"ou" = (/obj/machinery/atmospherics/unary/vent_pump/high_volume{dir = 1; frequency = 1380; id_tag = null},/obj/machinery/embedded_controller/radio/airlock/docking_port_multi{dir = 8; frequency = 1380; id_tag = "sd_escape_center_right"; master_tag = "escape_dock"; pixel_x = 24; req_one_access = list(13); tag_airpump = null; tag_chamber_sensor = null; tag_exterior_door = null; tag_interior_door = null},/obj/machinery/airlock_sensor{dir = 4; frequency = 1380; id_tag = null; pixel_x = -25},/obj/effect/map_helper/airlock/atmos/chamber_pump,/obj/effect/map_helper/airlock/sensor/chamber_sensor,/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"ov" = (/obj/structure/closet/crate/bin{anchored = 1},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarroomb) -"ow" = (/turf/simulated/open,/area/stellardelight/deck2/starboard) -"oy" = (/obj/machinery/door/firedoor/glass/hidden/steel,/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"oA" = (/obj/machinery/telecomms/processor/preset_four,/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"oC" = (/obj/structure/cable{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/manifold/hidden/supply,/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"oD" = (/obj/item/modular_computer/console/preset/command,/obj/structure/sign/poster{dir = 4},/obj/machinery/newscaster{pixel_y = 28},/turf/simulated/floor/tiled/eris/white/cargo,/area/crew_quarters/heads/cmo) -"oE" = (/obj/machinery/hologram/holopad,/turf/simulated/floor/wood,/area/stellardelight/deck3/readingroom) -"oI" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/zpipe/down/scrubbers{dir = 4},/obj/machinery/atmospherics/pipe/zpipe/down/supply{dir = 4},/obj/machinery/door/firedoor/glass,/turf/simulated/open,/area/maintenance/stellardelight/deck3/portcent) -"oM" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/light/small{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"oN" = (/obj/machinery/teleport/hub{dir = 2},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"oO" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/portdock) -"oP" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/open,/area/crew_quarters/bar) -"oR" = (/obj/machinery/newscaster/security_unit{pixel_x = -32; pixel_y = 32},/obj/item/device/radio/intercom/locked/ai_private{dir = 4; pixel_x = 32},/obj/item/device/radio/intercom{broadcasting = 1; dir = 8; name = "Common Channel"; pixel_x = -21},/obj/item/device/radio/intercom{dir = 1; name = "Station Intercom (General)"; pixel_y = 21},/obj/machinery/requests_console/preset/ai{pixel_x = 32; pixel_y = 32},/obj/effect/landmark/start/ai,/turf/simulated/floor/bluegrid,/area/ai) -"oS" = (/obj/structure/cryofeed,/obj/effect/floor_decal/corner_techfloor_grid{dir = 5},/obj/effect/floor_decal/corner_techfloor_grid{dir = 10},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/cryo) -"oT" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 4},/obj/item/device/radio/intercom{dir = 4; pixel_x = 24},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"oU" = (/obj/machinery/atmospherics/unary/vent_pump/on{dir = 8},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"oV" = (/obj/machinery/atmospherics/unary/vent_pump/on{dir = 4},/obj/machinery/camera/network/halls{dir = 4},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"oW" = (/turf/simulated/open,/area/stellardelight/deck2/port) -"oX" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/structure/cable/blue{icon_state = "1-2"},/turf/simulated/open,/area/stellardelight/deck2/fore) -"oY" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/door/airlock/angled_bay/hatch{name = "Telecoms Control Room"; req_access = list(61)},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/tiled/steel_ridged,/area/tcommsat/computer) -"oZ" = (/turf/simulated/wall/bay/steel,/area/stellardelight/deck3/readingroom) -"pb" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/obj/effect/floor_decal/steeldecal/steel_decals4{dir = 5},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"pc" = (/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"pd" = (/obj/machinery/power/apc/angled{dir = 8},/obj/structure/cable/blue{icon_state = "0-2"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/tiled/eris/white/cargo,/area/crew_quarters/heads/cmo) -"pf" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/cable/green{icon_state = "1-8"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"pk" = (/obj/structure/table/steel,/obj/random/drinkbottle,/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportrooma) -"pl" = (/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/obj/item/device/radio/intercom{dir = 4; pixel_x = 24},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"pm" = (/obj/structure/table/darkglass,/obj/item/device/radio/intercom{dir = 1; name = "Station Intercom (General)"; pixel_y = 24},/obj/item/device/flashlight/lamp/green{pixel_x = -5; pixel_y = -5},/obj/item/weapon/paper_bin,/obj/item/weapon/pen/blade/red{pixel_x = -2; pixel_y = -2},/obj/item/weapon/pen,/obj/item/weapon/pen/blue{pixel_x = 2; pixel_y = 3},/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 8},/turf/simulated/floor/tiled/dark,/area/lawoffice) -"po" = (/obj/machinery/atmospherics/unary/vent_pump/on{dir = 4},/obj/structure/flora/pottedplant/decorative,/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"pp" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 1},/turf/simulated/floor/wood,/area/stellardelight/deck3/cafe) -"pq" = (/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarrooma) -"pt" = (/obj/structure/cable{icon_state = "1-8"},/obj/structure/cable{icon_state = "1-4"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 9},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 9},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"px" = (/obj/machinery/telecomms/processor/preset_three,/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"pz" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/hatch{name = "maintenance access"; stripe_color = "#454545"},/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor/tiled/steel_ridged,/area/maintenance/stellardelight/deck3/aftstarroom) -"pA" = (/obj/structure/bed/double/padded,/obj/item/weapon/bedsheet/cosmosdouble{icon_state = "dobulesheetcosmos"},/obj/machinery/camera/network/command,/turf/simulated/floor/carpet/turcarpet,/area/ai) -"pB" = (/obj/structure/bed/chair,/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 1},/obj/item/device/radio/intercom{dir = 1; pixel_y = 24},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"pC" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 9},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/obj/structure/sign/warning/evac{pixel_x = 32},/obj/effect/landmark{name = "lightsout"},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"pE" = (/obj/machinery/light/small{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/forestarrooma) -"pG" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/obj/effect/floor_decal/steeldecal/steel_decals4{dir = 4},/obj/effect/floor_decal/shuttles/right,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"pK" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"pL" = (/obj/structure/table/steel,/obj/random/snack,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarrooma) -"pN" = (/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportroomb) -"pO" = (/obj/machinery/power/apc/angled{dir = 4},/obj/structure/cable/blue{icon_state = "0-2"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/tiled/dark,/area/crew_quarters/heads/hos) -"pS" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/alarm/angled{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"pT" = (/obj/effect/floor_decal/industrial/warning{dir = 4},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"pV" = (/obj/machinery/keycard_auth{pixel_y = 28},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 6},/obj/machinery/alarm/angled{dir = 4},/turf/simulated/floor/tiled/techfloor,/area/crew_quarters/heads/hor) -"pW" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"pX" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable{icon_state = "1-2"},/obj/machinery/door/airlock/angled_bay/hatch{door_color = "#323d80"; name = "maintenance access"; req_one_access = list(16); stripe_color = "#323d80"},/turf/simulated/floor/tiled/steel_ridged,/area/ai_cyborg_station) -"pY" = (/obj/machinery/telecomms/bus/preset_three,/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"qb" = (/obj/machinery/power/pointdefense{id_tag = "sd_pd"},/obj/effect/floor_decal/industrial/warning/full,/obj/structure/cable/blue{icon_state = "0-2"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"qc" = (/obj/structure/table/bench/padded,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/wood,/area/stellardelight/deck3/cafe) -"qd" = (/obj/effect/landmark{name = "JoinLateCyborg"},/obj/effect/landmark/start/cyborg,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"qe" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/external/glass{dir = 4; frequency = 1380; id_tag = null; locked = 1; name = "Docking Port Airlock"},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/obj/effect/map_helper/airlock/door/int_door,/obj/machinery/access_button{command = "cycle_interior"; dir = 8; frequency = 1380; master_tag = "sd_escape_port"; pixel_y = 32; req_one_access = list(13)},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/portdock) -"qf" = (/obj/structure/cable{icon_state = "1-4"},/obj/structure/cable{icon_state = "4-8"},/obj/structure/cable{icon_state = "1-8"},/obj/structure/disposalpipe/segment{dir = 8; icon_state = "pipe-c"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"qg" = (/obj/structure/table/glass,/obj/machinery/light/small{dir = 4},/obj/random/contraband,/obj/random/snack,/turf/simulated/floor/wood,/area/stellardelight/deck3/readingroom) -"qi" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/open,/area/stellardelight/deck2/fore) -"qn" = (/obj/machinery/porta_turret/stationary,/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"qp" = (/turf/simulated/open,/area/crew_quarters/bar) -"qq" = (/turf/simulated/wall/bay/r_wall/blue,/area/tcommsat/computer) -"qs" = (/obj/structure/table/rack,/obj/random/maintenance/clean,/obj/random/maintenance/clean,/obj/random/maintenance/clean,/obj/random/maintenance/clean,/obj/random/maintenance/security,/obj/random/maintenance/security,/obj/random/maintenance/security,/obj/random/drinkbottle,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarrooma) -"qv" = (/obj/structure/cable/cyan{icon_state = "4-8"},/obj/machinery/door/airlock/angled_bay/hatch{dir = 4; door_color = "#323d80"; id_tag = "AICore"; id_tint = null; locked = 1; name = "AI Core"; req_one_access = list(16); stripe_color = "#323d80"},/turf/simulated/floor/tiled/steel_ridged,/area/ai) -"qx" = (/obj/structure/table/glass,/turf/simulated/floor/wood,/area/stellardelight/deck3/readingroom) -"qy" = (/obj/structure/cable/blue{icon_state = "4-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"qz" = (/turf/simulated/floor/reinforced{name = "Holodeck Projector Floor"},/area/holodeck/alphadeck) -"qA" = (/obj/machinery/turretid/stun{check_synth = 1; control_area = /area/ai; name = "AI Chamber turret control"; pixel_x = -30; pixel_y = -24},/obj/machinery/flasher{id = "AI"; pixel_x = -24; pixel_y = 25},/obj/machinery/hologram/holopad,/obj/structure/cable/cyan{icon_state = "2-8"},/turf/simulated/floor/bluegrid,/area/ai) -"qC" = (/obj/structure/table/glass,/turf/simulated/floor/carpet,/area/stellardelight/deck3/readingroom) -"qE" = (/obj/effect/floor_decal/industrial/warning{dir = 4},/obj/machinery/light/small{dir = 1},/turf/simulated/floor/airless,/area/stellardelight/deck3/starboarddock) -"qF" = (/turf/simulated/open,/area/stellardelight/deck2/fore) -"qK" = (/obj/effect/landmark{name = "lightsout"},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"qL" = (/obj/structure/sign/warning/docking_area{pixel_x = 32},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"qM" = (/obj/structure/table/steel,/obj/random/firstaid,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportrooma) -"qN" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/obj/effect/floor_decal/steeldecal/steel_decals4{dir = 8},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"qO" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/door/airlock/angled_bay/hatch{door_color = "#323d80"; name = "maintenance access"; req_one_access = list(16); stripe_color = "#323d80"},/turf/simulated/floor/tiled/steel_ridged,/area/ai_cyborg_station) -"qP" = (/obj/structure/lattice,/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/open,/area/stellardelight/deck2/port) -"qQ" = (/obj/machinery/porta_turret/stationary,/obj/structure/cable/blue{icon_state = "2-4"},/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"qS" = (/obj/machinery/light/small,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"qU" = (/obj/machinery/light{dir = 4},/obj/structure/cable/blue{icon_state = "1-8"},/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"qW" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/hatch{dir = 4; name = "maintenance access"; stripe_color = "#454545"},/obj/structure/cable/blue{icon_state = "4-8"},/turf/simulated/floor/tiled/steel_ridged,/area/maintenance/stellardelight/deck3/forestarroomb) -"qX" = (/obj/random/vendorfood,/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"qY" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 5},/obj/structure/reagent_dispensers/fueltank,/obj/machinery/alarm/angled{dir = 4},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"qZ" = (/obj/structure/filingcabinet/chestdrawer,/obj/machinery/power/apc/angled{dir = 4},/obj/structure/cable/blue{icon_state = "0-8"},/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"rb" = (/obj/effect/floor_decal/emblem/nt3,/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_upload) -"rc" = (/turf/simulated/wall/bay/r_wall/blue,/area/stellardelight/deck3/commandhall) -"rg" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/wood,/area/stellardelight/deck3/cafe) -"rh" = (/obj/machinery/cryopod{dir = 4},/obj/effect/floor_decal/corner_techfloor_grid{dir = 10},/obj/effect/floor_decal/corner_techfloor_grid{dir = 5},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/cryo) -"ri" = (/obj/structure/handrail,/obj/effect/map_helper/airlock/atmos/chamber_pump,/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/obj/machinery/atmospherics/unary/vent_pump/high_volume{dir = 4},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"rj" = (/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportroomb) -"rl" = (/obj/structure/sign/painting/library_secure{pixel_x = -30},/turf/simulated/floor/carpet/blue2,/area/lawoffice) -"rm" = (/obj/effect/floor_decal/techfloor{dir = 5},/obj/effect/landmark{name = "JoinLateCryo"},/obj/machinery/atmospherics/unary/vent_pump/on,/obj/machinery/computer/cryopod{pixel_x = 32; pixel_y = 32},/obj/item/device/radio/intercom{dir = 1; pixel_y = 24},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/cryo) -"rn" = (/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/transitgateway) -"rp" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/door/firedoor/glass,/obj/machinery/atmospherics/pipe/simple/hidden,/obj/machinery/access_button{command = "cycle_interior"; frequency = 1379; master_tag = "portmaint_airlock"; name = "interior access button"; pixel_x = 32; req_access = null; req_one_access = list(13)},/obj/machinery/door/airlock/angled_bay/external/glass{frequency = 1379; id_tag = "portmaint_interior"; locked = 1; name = "Exterior Airlock"},/turf/simulated/floor/tiled/steel_ridged,/area/maintenance/stellardelight/deck3/portcent) -"rq" = (/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/aftstarroom) -"rr" = (/obj/machinery/atmospherics/unary/vent_pump/high_volume{dir = 4; frequency = 1380; id_tag = null},/obj/machinery/embedded_controller/radio/airlock/docking_port_multi{frequency = 1380; id_tag = "sd_escape_starboard"; master_tag = "escape_dock"; pixel_y = 30; req_one_access = list(13); tag_airpump = null; tag_chamber_sensor = null; tag_exterior_door = null; tag_interior_door = null},/obj/machinery/airlock_sensor{frequency = 1380; id_tag = null; pixel_y = -25},/obj/effect/map_helper/airlock/atmos/chamber_pump,/obj/effect/map_helper/airlock/sensor/chamber_sensor,/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"rs" = (/obj/machinery/atmospherics/pipe/manifold/hidden/black{dir = 1},/obj/machinery/hologram/holopad,/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"rx" = (/turf/simulated/wall/bay/white,/area/crew_quarters/heads/cmo) -"rA" = (/obj/structure/table/reinforced,/obj/machinery/computer/skills,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"rB" = (/obj/machinery/door/airlock/angled_bay/hatch{dir = 4; door_color = "#323d80"; id_tag = "AICore"; id_tint = null; locked = 1; name = "AI Core"; req_one_access = list(16); stripe_color = "#323d80"},/turf/simulated/floor/tiled/steel_ridged,/area/ai) -"rH" = (/obj/structure/lattice,/obj/structure/cable/blue{icon_state = "32-8"},/obj/structure/disposalpipe/down{dir = 8},/obj/machinery/atmospherics/pipe/zpipe/down/supply,/obj/machinery/atmospherics/pipe/zpipe/down/scrubbers,/obj/machinery/door/firedoor/glass,/turf/simulated/open,/area/maintenance/stellardelight/deck3/starboardcent) -"rL" = (/turf/simulated/floor/lino,/area/stellardelight/deck3/cafe) -"rN" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 10},/turf/simulated/floor/bluegrid,/area/ai) -"rS" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/open,/area/stellardelight/deck2/port) -"rW" = (/obj/effect/mouse_hole_spawner{dir = 4},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"rX" = (/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/obj/machinery/light{dir = 1},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"rZ" = (/obj/machinery/atmospherics/unary/vent_pump/on{dir = 4},/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"sa" = (/obj/effect/map_helper/airlock/door/int_door,/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/glass_external,/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/obj/machinery/atmospherics/pipe/simple/hidden/fuel{dir = 4},/obj/structure/cable{icon_state = "4-8"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"sb" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/door/airlock/angled_bay/secure{name = "AI Storage"; req_access = list(16)},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled/steel_ridged,/area/ai_cyborg_station) -"sc" = (/turf/simulated/wall/bay/r_wall/blue,/area/ai) -"sd" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/structure/cable/blue{icon_state = "1-2"},/turf/simulated/open,/area/stellardelight/deck2/fore) -"sf" = (/obj/machinery/light{dir = 8},/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"si" = (/obj/structure/table/woodentable,/obj/machinery/chemical_dispenser/bar_coffee/full{pixel_y = 8},/obj/structure/sign/painting/library_secure{pixel_y = 30},/turf/simulated/floor/lino,/area/stellardelight/deck3/cafe) -"sj" = (/obj/machinery/power/apc/angled{dir = 4; name = "night shift APC"; nightshift_setting = 2},/obj/structure/closet,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/obj/structure/cable/blue{icon_state = "0-2"},/obj/random/snack,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarrooma) -"sl" = (/obj/machinery/atmospherics/unary/vent_pump{dir = 8; external_pressure_bound = 140; external_pressure_bound_default = 140; icon_state = "map_vent_out"; pressure_checks = 0; pressure_checks_default = 0; use_power = 1},/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"sn" = (/obj/structure/lattice,/obj/structure/cable{icon_state = "1-2"},/turf/simulated/open,/area/stellardelight/deck2/starboard) -"sr" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 6},/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"ss" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/external/glass{dir = 4; frequency = 1380; id_tag = null; locked = 1; name = "Docking Port Airlock"},/obj/effect/map_helper/airlock/door/int_door,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/obj/machinery/access_button{command = "cycle_interior"; dir = 4; frequency = 1380; master_tag = "sd_port_landing"; pixel_y = 32; req_one_access = list(13)},/obj/structure/cable{icon_state = "4-8"},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/portdock) -"st" = (/obj/structure/bed/chair/sofa/corp/right{dir = 8},/obj/machinery/light/small{dir = 4},/mob/living/simple_mob/animal/passive/fox/syndicate/aipet,/turf/simulated/floor/carpet/turcarpet,/area/ai) -"su" = (/obj/machinery/power/apc/angled{dir = 8},/obj/structure/cable/blue{icon_state = "0-4"},/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"sx" = (/obj/machinery/door/firedoor/glass,/turf/simulated/floor,/area/stellardelight/deck2/central) -"sz" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/hatch{dir = 4; door_color = "#e6ab22"; name = "Shield Generator"; req_access = null; req_one_access = list(11,24); stripe_color = "#e6ab22"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck2/central) -"sA" = (/obj/structure/bed/chair{dir = 4},/turf/simulated/floor/carpet/purcarpet,/area/crew_quarters/heads/hor) -"sC" = (/obj/machinery/computer/mecha{dir = 1},/turf/simulated/floor/tiled/techfloor,/area/crew_quarters/heads/hor) -"sE" = (/obj/effect/shuttle_landmark/premade/sd/deck3/starboardlanding,/turf/space,/area/space) -"sI" = (/obj/structure/table/standard,/obj/random/paicard,/obj/machinery/atmospherics/unary/vent_scrubber/on,/turf/simulated/floor/bluegrid,/area/ai_cyborg_station) -"sJ" = (/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 8},/turf/simulated/open,/area/stellardelight/deck2/fore) -"sK" = (/obj/machinery/atmospherics/pipe/simple/hidden/black{dir = 4},/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"sM" = (/turf/simulated/floor/reinforced/airless,/area/stellardelight/deck3/exterior) -"sN" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/structure/cable/green{icon_state = "1-4"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"sO" = (/turf/simulated/floor,/area/stellardelight/deck2/fore) -"sP" = (/obj/structure/cable/green{icon_state = "1-4"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"sQ" = (/obj/structure/table/standard,/obj/item/weapon/aiModule/reset,/obj/machinery/alarm{dir = 4; pixel_x = -28},/obj/structure/sign/warning/secure_area{pixel_y = 32},/turf/simulated/floor/bluegrid,/area/ai_cyborg_station) -"sR" = (/obj/structure/cable/blue{icon_state = "4-8"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarroomb) -"sU" = (/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 8},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"sX" = (/obj/structure/closet/crate,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance/security,/obj/random/maintenance/security,/obj/random/drinkbottle,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"sZ" = (/obj/structure/cable{icon_state = "1-2"},/turf/simulated/wall/bay/r_wall/blue,/area/maintenance/stellardelight/deck3/portaft) -"tb" = (/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/obj/effect/floor_decal/steeldecal/steel_decals_central5{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"tc" = (/obj/structure/cable/blue{icon_state = "1-4"},/obj/effect/mouse_hole_spawner{dir = 8},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardfore) -"tg" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/disposalpipe/junction{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"th" = (/turf/simulated/wall/bay/r_wall/blue,/area/ai_cyborg_station) -"tk" = (/obj/structure/cable{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"tn" = (/obj/machinery/light_switch{dir = 8; pixel_x = 24},/turf/simulated/floor/carpet/turcarpet,/area/ai) -"tp" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 10},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 10},/obj/random/trash_pile,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"tq" = (/obj/machinery/camera/network/command{dir = 9},/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"tu" = (/obj/machinery/light/small{dir = 4},/obj/structure/closet/crate,/obj/random/contraband,/obj/random/maintenance,/obj/random/maintenance/clean,/obj/random/maintenance/clean,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/aftstarroom) -"ty" = (/obj/machinery/computer/teleporter,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"tz" = (/obj/machinery/recharge_station,/turf/simulated/floor/bluegrid,/area/ai_upload) -"tC" = (/obj/structure/sign/vacuum,/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/deck3/starboardcent) -"tF" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/frame,/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/forestarrooma) -"tG" = (/obj/machinery/light,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/obj/effect/floor_decal/steeldecal/steel_decals5,/obj/structure/cable{icon_state = "4-8"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"tH" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 9},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor/tiled,/area/stellardelight/deck3/transitgateway) -"tJ" = (/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 8},/obj/machinery/light{dir = 1},/obj/structure/flora/pottedplant/decorative,/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"tK" = (/obj/effect/floor_decal/industrial/warning{dir = 4},/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/cable/green{icon_state = "1-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"tL" = (/obj/machinery/atmospherics/pipe/simple/hidden/black{dir = 4},/obj/structure/cable/blue{icon_state = "1-8"},/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"tO" = (/obj/structure/table/steel_reinforced,/obj/item/device/taperecorder{pixel_x = 10},/obj/item/weapon/reagent_containers/food/drinks/flask/barflask{pixel_x = -9; pixel_y = -2},/obj/item/device/radio/off,/turf/simulated/floor/tiled/dark,/area/crew_quarters/heads/hos) -"tQ" = (/obj/structure/table/standard,/obj/item/weapon/aiModule/freeform,/obj/machinery/light{dir = 1},/turf/simulated/floor/bluegrid,/area/ai_cyborg_station) -"tR" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/external/glass{dir = 4; frequency = 1380; id_tag = null; locked = 1; name = "Docking Port Airlock"},/obj/effect/map_helper/airlock/door/ext_door,/obj/machinery/access_button{command = "cycle_exterior"; dir = 4; frequency = 1380; master_tag = "sd_escape_port"; pixel_y = 32; req_one_access = list(13)},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/portdock) -"tT" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"tV" = (/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 1},/turf/simulated/open,/area/stellardelight/deck2/fore) -"tW" = (/obj/machinery/atmospherics/portables_connector{dir = 4},/obj/machinery/portable_atmospherics/canister/air/airlock{start_pressure = 4559.63},/turf/simulated/floor,/area/tcommsat/computer) -"tX" = (/obj/structure/bed/chair/sofa/corp/left{dir = 8},/turf/simulated/floor/bluegrid,/area/ai) -"tZ" = (/turf/simulated/floor/carpet/purcarpet,/area/crew_quarters/heads/hor) -"ub" = (/obj/item/modular_computer/console/preset/command,/obj/structure/sign/poster{dir = 8},/obj/machinery/newscaster/security_unit{pixel_y = 28},/turf/simulated/floor/tiled/dark,/area/crew_quarters/heads/hos) -"uc" = (/obj/machinery/teleport/station{dir = 2},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"uf" = (/obj/structure/lattice,/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/open,/area/stellardelight/deck2/port) -"ui" = (/obj/machinery/portable_atmospherics/canister/phoron,/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/obj/machinery/atmospherics/portables_connector/fuel{dir = 1},/obj/machinery/door/window/southleft{dir = 1; req_one_access = list(11,67)},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"uj" = (/turf/simulated/wall/bay/r_wall/blue,/area/crew_quarters/heads/hor) -"uk" = (/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/obj/item/device/radio/intercom{dir = 8; pixel_x = -24},/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"ul" = (/obj/structure/cable/blue{icon_state = "2-8"},/obj/structure/cable/blue{icon_state = "1-2"},/obj/structure/cable/blue{icon_state = "1-8"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardfore) -"un" = (/obj/structure/cable/green{icon_state = "2-4"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"uq" = (/turf/simulated/wall/bay/r_wall/steel,/area/stellardelight/deck3/starboarddock) -"ur" = (/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/deck3/starboardaft) -"us" = (/obj/machinery/light{dir = 4},/turf/simulated/floor/bluegrid,/area/ai) -"ut" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/unary/vent_pump/on{dir = 4},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"uv" = (/obj/machinery/atmospherics/pipe/manifold/hidden/black,/obj/structure/cable/blue{icon_state = "2-4"},/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"uw" = (/obj/machinery/atmospherics/pipe/manifold/hidden{dir = 1},/obj/structure/cable/blue{icon_state = "1-2"},/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"uz" = (/obj/effect/floor_decal/techfloor{dir = 4},/obj/effect/landmark{name = "JoinLateCryo"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/cryo) -"uB" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/machinery/atmospherics/pipe/simple/hidden/black,/obj/structure/low_wall/bay/reinforced/blue,/turf/simulated/floor,/area/tcommsat/computer) -"uD" = (/obj/structure/closet/firecloset,/obj/random/maintenance,/obj/random/maintenance/cargo,/obj/random/maintenance/clean,/obj/random/drinkbottle,/obj/random/drinkbottle,/obj/random/drinkbottle,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/aftstarroom) -"uE" = (/obj/structure/table/rack,/obj/random/contraband,/obj/random/maintenance,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarroomb) -"uH" = (/obj/structure/cable/blue{icon_state = "2-8"},/obj/structure/cable/blue{icon_state = "4-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"uI" = (/obj/structure/cable/blue{icon_state = "1-4"},/turf/simulated/floor/bluegrid,/area/ai) -"uJ" = (/obj/structure/closet/firecloset,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"uM" = (/obj/machinery/alarm/angled,/obj/structure/table/woodentable,/obj/item/device/flashlight/lamp/clown{pixel_x = -4; pixel_y = 6},/obj/item/weapon/bikehorn{pixel_x = -2; pixel_y = 2},/obj/item/weapon/stamp/clown{pixel_x = 6; pixel_y = 9},/turf/simulated/floor/wood,/area/stellardelight/deck3/clownmimeoffice) -"uQ" = (/obj/machinery/alarm/angled{dir = 8},/obj/machinery/computer/shuttle_control/explore/sdboat{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_server_room) -"uT" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/structure/cable/blue{icon_state = "2-8"},/turf/simulated/floor/tiled/techfloor,/area/ai_cyborg_station) -"uU" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/standard/color{dir = 4; door_color = "#9c9c9c"; fill_color = "#5c5c5c"; id_tag = "readingroom3"; name = "Room 3"; stripe_color = "#89bd66"},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/readingroom) -"uV" = (/obj/machinery/computer/robotics{dir = 1},/turf/simulated/floor/tiled/techfloor,/area/crew_quarters/heads/hor) -"uW" = (/obj/effect/floor_decal/corner_techfloor_grid{dir = 5},/obj/effect/floor_decal/corner_techfloor_grid{dir = 10},/obj/machinery/light/floortube{dir = 4; pixel_x = 2},/obj/structure/cable/green{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/cryo) -"uX" = (/obj/structure/cable{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor,/area/stellardelight/deck2/starboard) -"uY" = (/obj/structure/cable{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/manifold/hidden{dir = 8},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"uZ" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/camera/network/command{dir = 4},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_server_room) -"va" = (/obj/effect/floor_decal/industrial/warning{dir = 8},/obj/structure/cable/green{icon_state = "2-4"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"vb" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 10},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 9},/turf/simulated/floor/tiled/techfloor,/area/ai_cyborg_station) -"vf" = (/obj/structure/table/reinforced,/obj/machinery/photocopier/faxmachine{department = "Chief Engineer's Office"},/turf/simulated/floor/tiled,/area/crew_quarters/heads/chief) -"vh" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 1},/turf/simulated/floor/wood,/area/stellardelight/deck3/cafe) -"vi" = (/turf/simulated/floor/carpet/tealcarpet,/area/crew_quarters/heads/cmo) -"vo" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 5},/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"vq" = (/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/deck3/portaft) -"vr" = (/obj/machinery/atmospherics/pipe/simple/hidden/fuel{dir = 9},/turf/simulated/wall/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"vt" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/structure/cable{icon_state = "2-4"},/turf/simulated/floor,/area/stellardelight/deck2/central) -"vv" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/effect/floor_decal/emblem/nt2,/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers,/obj/machinery/atmospherics/pipe/manifold/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/obj/effect/landmark{name = "lightsout"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"vw" = (/obj/structure/sign/department/shield,/turf/simulated/wall/bay/r_wall/blue,/area/stellardelight/deck3/commandhall) -"vy" = (/obj/machinery/atmospherics/portables_connector{dir = 1},/obj/machinery/portable_atmospherics/canister/air/airlock,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"vA" = (/obj/machinery/power/apc/angled{dir = 1; name = "night shift APC"; nightshift_setting = 2},/obj/structure/cable/green{icon_state = "0-4"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"vE" = (/obj/effect/shuttle_landmark{base_area = /area/stellardelight/deck3/exterior; base_turf = /turf/simulated/floor/reinforced/airless; docking_controller = "sd_starboard_landing"; landmark_tag = "starboard_shuttlepad"; name = "Starboard Shuttlepad"},/turf/simulated/floor/reinforced/airless,/area/stellardelight/deck3/exterior) -"vF" = (/obj/structure/lattice,/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/open,/area/stellardelight/deck2/fore) -"vG" = (/obj/effect/floor_decal/steeldecal/steel_decals4{dir = 8},/obj/structure/cable{icon_state = "1-8"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"vI" = (/obj/structure/bed/chair{dir = 8},/obj/machinery/light{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"vJ" = (/obj/structure/bed/chair{dir = 8},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"vN" = (/obj/machinery/computer/telecomms/monitor{dir = 8; network = "tcommsat"},/obj/machinery/light{dir = 4},/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"vO" = (/obj/machinery/door/firedoor/glass,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/door/airlock/angled_bay/hatch{door_color = "#323d80"; name = "maintenance access"; req_one_access = list(19,38); stripe_color = "#323d80"},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/commandhall) -"vP" = (/obj/structure/bed/chair{dir = 8},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/obj/structure/sign/nanotrasen{pixel_x = 32},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"vQ" = (/obj/structure/cable/green{icon_state = "2-8"},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"vS" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/manifold/hidden/supply,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"vT" = (/obj/machinery/holoplant,/obj/machinery/status_display{pixel_x = -32},/turf/simulated/floor/bluegrid,/area/ai_cyborg_station) -"vX" = (/obj/structure/cable{icon_state = "4-8"},/obj/effect/map_helper/airlock/atmos/chamber_pump,/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/obj/machinery/atmospherics/unary/vent_pump/high_volume{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/fuel{dir = 4},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"wa" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/stellardelight/deck2/port) -"wc" = (/obj/machinery/atmospherics/unary/vent_pump/on{dir = 8},/obj/effect/landmark/vermin,/turf/simulated/open,/area/stellardelight/deck2/starboard) -"wd" = (/obj/structure/table/standard,/obj/item/weapon/aiModule/oxygen,/obj/item/weapon/aiModule/oneHuman,/obj/item/weapon/aiModule/purge,/obj/item/weapon/aiModule/antimov,/obj/item/weapon/aiModule/teleporterOffline,/obj/machinery/alarm/angled{dir = 8},/turf/simulated/floor/bluegrid,/area/ai_cyborg_station) -"we" = (/obj/machinery/power/pointdefense{id_tag = "sd_pd"},/obj/effect/floor_decal/industrial/warning/full,/obj/structure/cable/blue{icon_state = "0-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"wg" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/manifold/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"wm" = (/obj/machinery/atmospherics/unary/vent_pump/high_volume{dir = 8; frequency = 1380; id_tag = null},/obj/machinery/embedded_controller/radio/airlock/docking_port{frequency = 1380; id_tag = "sd_starboard_landing"; pixel_y = 29},/obj/effect/map_helper/airlock/atmos/chamber_pump,/obj/effect/map_helper/airlock/sensor/chamber_sensor,/obj/machinery/airlock_sensor{frequency = 1380; id_tag = null; pixel_y = -25},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"wo" = (/obj/structure/table/standard,/obj/item/weapon/aiModule/asimov,/obj/item/weapon/aiModule/freeformcore,/obj/item/weapon/aiModule/corp,/obj/item/weapon/aiModule/paladin,/obj/item/weapon/aiModule/robocop,/obj/structure/cable/blue,/obj/machinery/power/apc/angled{dir = 8},/turf/simulated/floor/bluegrid,/area/ai_cyborg_station) -"wq" = (/obj/structure/bed/chair{dir = 8},/turf/simulated/floor/carpet,/area/crew_quarters/heads/hos) -"wr" = (/obj/machinery/computer/ship/engines/adv,/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/fore{base_turf = /turf/simulated/floor/reinforced/airless}) -"wt" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/machinery/door/blast/angled/open{dir = 4; id = "readingroom2"},/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/stellardelight/deck3/readingroom) -"wv" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"ww" = (/obj/machinery/atmospherics/portables_connector{dir = 8},/obj/machinery/portable_atmospherics/canister/air/airlock,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"wy" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 8},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 4},/obj/structure/cable/blue{icon_state = "1-2"},/turf/simulated/open,/area/stellardelight/deck2/fore) -"wA" = (/obj/machinery/alarm/angled{dir = 4},/turf/simulated/floor/bluegrid,/area/ai_upload) -"wG" = (/obj/machinery/alarm/angled{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"wK" = (/obj/effect/floor_decal/techfloor/orange{dir = 1},/obj/item/device/radio/intercom{dir = 1; pixel_y = 24},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/transitgateway) -"wM" = (/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/starboardcent) -"wN" = (/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"wP" = (/obj/machinery/atmospherics/unary/vent_scrubber/on,/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 1},/obj/machinery/station_map{pixel_y = 32},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"wQ" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 4},/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"wR" = (/obj/structure/lattice,/obj/structure/cable{icon_state = "2-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 10},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 10},/turf/simulated/open,/area/stellardelight/deck2/starboard) -"wS" = (/obj/machinery/holoplant,/turf/simulated/floor/bluegrid,/area/ai) -"wV" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/structure/closet/emergsuit_wall{dir = 8; pixel_x = -27},/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"wW" = (/obj/structure/cable/green{icon_state = "1-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/camera/network/civilian{dir = 1},/turf/simulated/floor/tiled,/area/stellardelight/deck3/transitgateway) -"wY" = (/obj/machinery/light,/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"wZ" = (/obj/machinery/atmospherics/pipe/simple/hidden{dir = 6},/turf/simulated/wall/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"xb" = (/obj/machinery/light/small{dir = 4},/obj/structure/closet/crate,/obj/random/contraband,/obj/random/contraband,/obj/random/maintenance/clean,/obj/random/maintenance/clean,/obj/random/maintenance/clean,/obj/random/maintenance/engineering,/obj/random/maintenance/engineering,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportrooma) -"xd" = (/obj/structure/lattice,/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/open,/area/stellardelight/deck2/port) -"xe" = (/obj/machinery/light{dir = 4},/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_server_room) -"xf" = (/obj/structure/handrail{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden,/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"xg" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/disposalpipe/segment{dir = 4},/obj/structure/low_wall/bay/reinforced/blue,/turf/simulated/floor,/area/crew_quarters/heads/hop) -"xh" = (/obj/machinery/light{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/bluegrid,/area/ai) -"xi" = (/obj/structure/cable/green{icon_state = "1-4"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 5},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 5},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"xj" = (/obj/structure/table/standard,/obj/item/weapon/aiModule/consuming_eradicator,/obj/item/weapon/aiModule/guard_dog,/obj/item/weapon/aiModule/pleasurebot,/obj/item/weapon/aiModule/protective_shell,/obj/item/weapon/aiModule/scientific_pursuer,/obj/machinery/atmospherics/unary/vent_pump/on{dir = 1},/turf/simulated/floor/bluegrid,/area/ai_cyborg_station) -"xm" = (/obj/structure/cable/blue{icon_state = "1-2"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"xo" = (/obj/structure/cable{icon_state = "4-8"},/turf/simulated/floor/wood,/area/stellardelight/deck3/clownmimeoffice) -"xp" = (/turf/simulated/floor/wood,/area/stellardelight/deck3/clownmimeoffice) -"xu" = (/obj/machinery/door/airlock/angled_bay/external/glass{dir = 4; frequency = 1379; id_tag = "starmaint_exterior"; locked = 1; name = "Exterior Airlock"},/obj/machinery/door/firedoor/glass,/obj/machinery/access_button{command = "cycle_exterior"; frequency = 1379; master_tag = "starmaint_airlock"; name = "exterior access button"; pixel_y = 32; req_access = null; req_one_access = list(13)},/turf/simulated/floor/tiled/steel_ridged,/area/maintenance/stellardelight/deck3/starboardcent) -"xv" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/wood,/area/stellardelight/deck3/readingroom) -"xw" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/structure/cable/blue{icon_state = "1-2"},/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"xy" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 6},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 6},/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/commandhall) -"xz" = (/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/obj/machinery/atmospherics/unary/freezer{dir = 1; icon_state = "freezer_1"; set_temperature = 73; use_power = 1},/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"xA" = (/obj/structure/sign/warning/evac{pixel_x = 32; pixel_y = -32},/obj/effect/floor_decal/steeldecal/steel_decals5,/obj/structure/cable{icon_state = "4-8"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"xB" = (/obj/machinery/atmospherics/binary/passive_gate/on{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"xC" = (/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 8},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/obj/effect/landmark/vermin,/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"xE" = (/obj/structure/closet,/obj/random/firstaid,/obj/random/maintenance,/obj/random/maintenance/cargo,/obj/random/maintenance/cargo,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/aftstarroom) -"xH" = (/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"xI" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportroomb) -"xL" = (/turf/simulated/wall/fancy_shuttle/low{fancy_shuttle_tag = "sdboat"},/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"xM" = (/obj/structure/bed/chair/office/dark{dir = 4},/obj/effect/landmark/start/iaa,/turf/simulated/floor/carpet/blue2,/area/lawoffice) -"xN" = (/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/forestarrooma) -"xO" = (/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/obj/effect/floor_decal/steeldecal/steel_decals4{dir = 8},/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"xP" = (/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportroomb) -"xR" = (/obj/machinery/atmospherics/unary/vent_pump/on,/turf/simulated/open,/area/stellardelight/deck2/starboard) -"xS" = (/obj/structure/bed/chair/office/dark{dir = 4},/obj/effect/landmark/start/hos,/turf/simulated/floor/carpet,/area/crew_quarters/heads/hos) -"xT" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"xU" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"xW" = (/obj/machinery/door/firedoor/glass,/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/aft) -"xY" = (/turf/simulated/floor/carpet/blue2,/area/lawoffice) -"xZ" = (/turf/simulated/floor/wood,/area/stellardelight/deck3/cafe) -"ya" = (/obj/machinery/button/remote/blast_door{id = "shuttleshutter"; name = "Shutter Control"; pixel_x = 17; pixel_y = 27},/obj/structure/cable/green{icon_state = "2-8"},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/fore{base_turf = /turf/simulated/floor/reinforced/airless}) -"yb" = (/obj/structure/sign/deck3{pixel_x = 32},/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 1},/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/commandhall) -"yc" = (/obj/machinery/atmospherics/pipe/manifold/hidden,/obj/structure/cable/blue{icon_state = "1-2"},/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"yd" = (/obj/structure/cable/green{icon_state = "1-4"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"ye" = (/obj/structure/dogbed,/mob/living/simple_mob/animal/passive/dog/corgi/Lisa,/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"yf" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/double{dir = 8; name = "maintenance access"; stripe_color = "#454545"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"yi" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/structure/cable/blue,/obj/machinery/power/sensor{name = "Powernet Sensor - Command Subgrid"; name_tag = "Command Subgrid"},/obj/machinery/power/apc/angled{dir = 8},/turf/simulated/floor,/area/maintenance/stellardelight/substation/command) -"yj" = (/obj/machinery/atmospherics/pipe/simple/hidden{dir = 9},/turf/simulated/wall/bay/r_wall/steel,/area/stellardelight/deck3/aft) -"ym" = (/obj/structure/table/rack,/obj/random/maintenance,/obj/random/maintenance/clean,/obj/random/maintenance/engineering,/obj/random/maintenance/security,/obj/random/contraband,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardfore) -"yo" = (/obj/structure/cable/blue{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"yp" = (/obj/structure/cable/blue{icon_state = "1-8"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 9},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 9},/obj/machinery/computer/cryopod/robot{pixel_x = 32},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"yq" = (/obj/machinery/light/small{dir = 4},/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/wood,/area/stellardelight/deck3/readingroom) -"ys" = (/obj/machinery/atm{pixel_y = 30},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 1},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"yt" = (/obj/effect/floor_decal/steeldecal/steel_decals4{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"yw" = (/obj/effect/floor_decal/techfloor/orange{dir = 9},/obj/structure/closet/emergsuit_wall{pixel_y = 29},/obj/structure/closet/emergsuit_wall{dir = 8; pixel_x = -27},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/transitgateway) -"yy" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/cable/blue{icon_state = "4-8"},/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarroomb) -"yB" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/carpet/tealcarpet,/area/crew_quarters/heads/cmo) -"yC" = (/obj/machinery/power/apc/angled{dir = 4},/obj/structure/cable/blue,/turf/simulated/floor/tiled/dark,/area/lawoffice) -"yE" = (/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"yF" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/double/glass{name = "glass airlock"},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/portdock) -"yH" = (/obj/structure/cable{icon_state = "4-8"},/turf/simulated/wall/bay/r_wall/blue,/area/ai_cyborg_station) -"yI" = (/obj/item/weapon/folder{pixel_x = -4},/obj/item/weapon/folder/blue{pixel_x = 5},/obj/item/weapon/folder/red{pixel_y = 3},/obj/item/weapon/folder/yellow,/obj/structure/table/darkglass,/obj/machinery/light,/turf/simulated/floor/tiled/dark,/area/lawoffice) -"yJ" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 10},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 10},/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/commandhall) -"yM" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/standard/color{door_color = "#323d80"; fill_color = "#313866"; name = "Head of Personnel"; req_access = list(57); stripe_color = "#a3d1d1"},/turf/simulated/floor/tiled/steel_ridged,/area/crew_quarters/heads/hop) -"yP" = (/obj/structure/sign/warning/falling{pixel_x = 32},/turf/simulated/open,/area/stellardelight/deck2/starboard) -"yR" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"yS" = (/obj/machinery/door/firedoor/glass,/obj/machinery/access_button{command = "cycle_exterior"; dir = 4; frequency = 1380; master_tag = "sd_starboard_landing"; pixel_y = 32; req_one_access = list(13)},/obj/machinery/door/airlock/angled_bay/external/glass{dir = 4; frequency = 1380; id_tag = null; locked = 1; name = "Docking Port Airlock"},/obj/effect/map_helper/airlock/door/ext_door,/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/starboarddock) -"yV" = (/obj/machinery/light{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"yW" = (/obj/effect/floor_decal/industrial/warning{dir = 4},/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"yY" = (/obj/structure/table/steel,/obj/random/maintenance/clean,/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportroomb) -"yZ" = (/obj/machinery/door/airlock/angled_bay/hatch{name = "maintenance access"; stripe_color = "#454545"},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/readingroom) -"za" = (/obj/machinery/cryopod/robot/door/gateway,/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/transitgateway) -"zb" = (/obj/machinery/atmospherics/pipe/manifold4w/hidden/scrubbers,/obj/machinery/atmospherics/pipe/manifold4w/hidden/supply,/obj/structure/cable/blue{icon_state = "1-4"},/obj/structure/cable/blue{icon_state = "1-8"},/obj/structure/cable/blue{icon_state = "2-4"},/obj/structure/cable/blue{icon_state = "2-8"},/obj/structure/cable/blue{icon_state = "1-2"},/obj/structure/cable/blue{icon_state = "4-8"},/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"zf" = (/obj/structure/cable/blue{icon_state = "1-2"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardfore) -"zg" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_upload) -"zi" = (/obj/effect/floor_decal/emblem/nt2,/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 8},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 4},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_upload) -"zk" = (/obj/effect/landmark{name = "droppod_landing"},/turf/space,/area/space) -"zm" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/structure/table/reinforced,/obj/machinery/photocopier/faxmachine{department = "Head of Personnel's Office"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 8},/obj/machinery/alarm/angled,/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"zn" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/low_wall/bay/reinforced/blue,/turf/simulated/floor,/area/tcommsat/computer) -"zo" = (/obj/structure/bed/chair{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/carpet/blue2,/area/lawoffice) -"zp" = (/obj/machinery/light/small{dir = 8},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportroomb) -"zr" = (/obj/machinery/cryopod,/obj/effect/floor_decal/corner_techfloor_grid{dir = 5},/obj/effect/floor_decal/corner_techfloor_grid{dir = 10},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/cryo) -"zt" = (/obj/structure/table/steel,/obj/random/contraband,/obj/random/maintenance/clean,/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportroomb) -"zv" = (/obj/item/weapon/bedsheet/rddouble,/obj/structure/bed/double/padded,/obj/structure/curtain/black{color = "#361447"},/obj/effect/landmark/start/rd,/turf/simulated/floor/carpet/purcarpet,/area/crew_quarters/heads/hor) -"zw" = (/obj/machinery/embedded_controller/radio/airlock/airlock_controller{dir = 8; id_tag = "portmaint_airlock"; pixel_x = 24; req_access = null; req_one_access = list(13); tag_airpump = "portmaint_airpump"; tag_chamber_sensor = "portmaint_sensor"; tag_exterior_door = "portmaint_exterior"; tag_interior_door = "portmaint_interior"},/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/portcent) -"zy" = (/obj/machinery/camera/network/halls{dir = 8},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"zz" = (/turf/simulated/wall/bay/steel,/area/stellardelight/deck3/commandhall) -"zA" = (/obj/structure/cable{icon_state = "1-2"},/obj/structure/table/steel,/obj/random/maintenance/engineering,/obj/random/maintenance/security,/obj/random/maintenance/clean,/obj/random/maintenance,/obj/random/contraband,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardfore) -"zB" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/effect/landmark{name = "lightsout"},/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"zC" = (/obj/item/toy/figure/mime,/obj/item/weapon/pen/crayon/marker/mime,/obj/item/weapon/pen/crayon/mime,/obj/structure/table/woodentable,/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 4},/turf/simulated/floor/carpet/bcarpet,/area/stellardelight/deck3/clownmimeoffice) -"zD" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/effect/floor_decal/industrial/warning{dir = 1},/obj/structure/sign/warning/secure_area{pixel_x = -32},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_server_room) -"zE" = (/obj/structure/table/bench/padded,/obj/effect/landmark/start/commandsecretary,/turf/simulated/floor/wood,/area/stellardelight/deck3/cafe) -"zF" = (/obj/structure/cable{icon_state = "0-4"},/obj/machinery/power/apc/angled{dir = 8},/turf/simulated/floor/carpet/bcarpet,/area/stellardelight/deck3/clownmimeoffice) -"zH" = (/obj/structure/cable/green{icon_state = "2-8"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 4},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 4},/turf/simulated/floor,/area/stellardelight/deck2/port) -"zI" = (/obj/structure/cable/green{icon_state = "1-4"},/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/disposalpipe/segment{dir = 1; icon_state = "pipe-c"},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 8},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 6},/obj/effect/floor_decal/arrivals,/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"zJ" = (/obj/effect/floor_decal/techfloor{dir = 9},/obj/effect/landmark{name = "JoinLateCryo"},/obj/machinery/alarm/angled{pixel_x = -32; pixel_y = 19},/obj/structure/closet/emergsuit_wall{pixel_y = 29},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/cryo) -"zL" = (/obj/structure/cable{icon_state = "1-4"},/obj/structure/disposalpipe/segment{dir = 1; icon_state = "pipe-c"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 5},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 5},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"zM" = (/obj/effect/landmark{name = "JoinLateCyborg"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/effect/landmark/start/cyborg,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"zN" = (/turf/simulated/wall/bay/r_wall/blue,/area/crew_quarters/heads/hos) -"zQ" = (/obj/structure/table/steel,/obj/item/device/flashlight/lamp,/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportrooma) -"zS" = (/obj/structure/handrail{dir = 1},/obj/machinery/power/apc{pixel_y = -28; req_access = null; req_one_access = list(11,67)},/obj/structure/cable/green,/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"zV" = (/obj/structure/cable/green{icon_state = "1-4"},/obj/structure/closet/crate,/obj/random/contraband,/obj/random/maintenance,/obj/random/snack,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/aftstarroom) -"zW" = (/obj/structure/lattice,/obj/structure/sign/warning/falling{pixel_y = 32},/turf/simulated/open,/area/stellardelight/deck2/fore) -"zX" = (/turf/simulated/wall/bay/r_wall/steel,/area/stellardelight/deck3/readingroom) -"zY" = (/obj/machinery/atmospherics/pipe/simple/hidden/universal{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"Ae" = (/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"Af" = (/obj/structure/closet/crate/bin{anchored = 1},/obj/machinery/atmospherics/unary/vent_scrubber/on,/turf/simulated/floor/wood,/area/stellardelight/deck3/readingroom) -"Ai" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/effect/landmark{name = "maint_pred"},/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/forestarrooma) -"Aj" = (/obj/item/device/camera,/obj/item/device/camera_film,/obj/item/device/taperecorder,/obj/item/device/tape/random,/obj/item/device/tape/random,/obj/item/weapon/storage/secure/briefcase,/obj/structure/closet/walllocker_double/east,/turf/simulated/floor/carpet/blue2,/area/lawoffice) -"Al" = (/obj/machinery/power/apc/angled{dir = 4; name = "night shift APC"; nightshift_setting = 2},/obj/structure/cable/green{icon_state = "0-8"},/obj/structure/table/rack,/obj/random/maintenance,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/aftstarroom) -"Am" = (/obj/machinery/power/apc/angled{dir = 4; req_access = list(19,43,67)},/obj/structure/cable/green{icon_state = "0-2"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/unary/vent_pump/on,/turf/simulated/floor/wood,/area/stellardelight/deck3/readingroom) -"An" = (/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 10},/turf/simulated/floor/carpet,/area/crew_quarters/heads/hop) -"Ap" = (/obj/structure/cable{icon_state = "1-4"},/obj/structure/disposalpipe/segment{dir = 4; icon_state = "pipe-c"},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 8},/obj/structure/cable{icon_state = "4-8"},/turf/simulated/floor,/area/stellardelight/deck2/starboard) -"Aq" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 10},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"As" = (/obj/structure/cable{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 5},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"At" = (/obj/structure/table/glass,/obj/item/device/flashlight/lamp/green,/turf/simulated/floor/carpet,/area/stellardelight/deck3/readingroom) -"Av" = (/obj/effect/floor_decal/techfloor{dir = 6},/obj/effect/landmark{name = "JoinLateCryo"},/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 1},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/cryo) -"Aw" = (/obj/machinery/camera/network/command{dir = 9},/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"Ax" = (/obj/machinery/holoplant,/turf/simulated/floor/bluegrid,/area/ai_cyborg_station) -"Ay" = (/obj/structure/table/steel,/obj/random/maintenance/engineering,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarrooma) -"Az" = (/obj/item/weapon/camera_assembly,/obj/item/weapon/camera_assembly,/obj/item/weapon/camera_assembly,/obj/item/weapon/camera_assembly,/obj/item/weapon/camera_assembly,/obj/item/weapon/camera_assembly,/obj/structure/closet/crate{name = "Camera Assembly Crate"},/obj/machinery/light{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"AD" = (/obj/structure/handrail,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 10},/obj/machinery/embedded_controller/radio/airlock/docking_port{frequency = 1380; id_tag = "sdboat_docker"; pixel_x = 5; pixel_y = 25},/obj/machinery/airlock_sensor{dir = 8; frequency = 1380; id_tag = null; pixel_x = 25; pixel_y = 2},/obj/effect/map_helper/airlock/sensor/chamber_sensor,/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"AE" = (/obj/structure/table/glass,/obj/machinery/atmospherics/unary/vent_pump/on{dir = 1},/turf/simulated/floor/tiled/eris/white/cargo,/area/crew_quarters/heads/cmo) -"AH" = (/obj/structure/cable{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 4},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"AK" = (/obj/random/trash_pile,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"AP" = (/obj/machinery/power/apc/angled{dir = 4},/obj/structure/cable/blue{icon_state = "0-2"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/tiled,/area/crew_quarters/heads/chief) -"AQ" = (/obj/structure/closet/crate,/obj/random/contraband,/obj/random/contraband,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarrooma) -"AS" = (/obj/machinery/computer/telecomms/server{dir = 8; network = "tcommsat"},/obj/machinery/alarm/angled{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"AT" = (/obj/structure/cable{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/double{name = "maintenance access"; stripe_color = "#454545"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"AU" = (/obj/machinery/light/small,/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 1},/obj/structure/bed/chair{dir = 8},/turf/simulated/floor,/area/stellardelight/deck2/central) -"AX" = (/obj/structure/table/reinforced,/obj/machinery/recharger{pixel_y = 6},/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"AY" = (/obj/machinery/door/firedoor/glass/hidden/steel{dir = 8},/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"AZ" = (/obj/machinery/porta_turret,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_upload) -"Bb" = (/obj/structure/bed/chair/bay/comfy/blue{dir = 1},/obj/structure/panic_button/small{pixel_x = -29; pixel_y = 30},/obj/structure/cable/green{icon_state = "4-8"},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/fore{base_turf = /turf/simulated/floor/reinforced/airless}) -"Bd" = (/obj/machinery/alarm/angled{dir = 8},/obj/structure/bookcase,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/wood,/area/stellardelight/deck3/readingroom) -"Be" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/obj/effect/floor_decal/steeldecal/steel_decals_central5{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Bg" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable{icon_state = "4-8"},/obj/machinery/door/airlock/angled_bay/hatch{dir = 4; name = "maintenance access"; stripe_color = "#454545"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor/tiled/steel_ridged,/area/maintenance/stellardelight/deck3/starboardaft) -"Bj" = (/obj/machinery/message_server,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_server_room) -"Bk" = (/obj/machinery/computer/aiupload{dir = 4},/obj/machinery/light{dir = 8},/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 4},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_upload) -"Bl" = (/obj/machinery/atmospherics/unary/vent_pump/high_volume{dir = 8; id_tag = null},/obj/machinery/embedded_controller/radio/airlock/airlock_controller{frequency = 1380; id_tag = "tcommsairlock"; pixel_y = 24; req_one_access = list(61)},/obj/effect/map_helper/airlock/atmos/chamber_pump,/obj/effect/map_helper/airlock/sensor/chamber_sensor,/obj/machinery/airlock_sensor{dir = 8; pixel_x = 25},/turf/simulated/floor,/area/tcommsat/computer) -"Bm" = (/obj/structure/closet/emcloset,/obj/random/drinkbottle,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"Bn" = (/obj/effect/landmark{name = "maint_pred"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/aftstarroom) -"Bp" = (/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/substation/command) -"Bq" = (/obj/machinery/status_display{pixel_y = 32},/turf/simulated/floor/tiled/dark,/area/lawoffice) -"Br" = (/obj/structure/table/alien{name = "fancy table"},/obj/machinery/photocopier/faxmachine{department = "Research Director's Office"},/turf/simulated/floor/tiled/techfloor,/area/crew_quarters/heads/hor) -"Bs" = (/obj/machinery/computer/borgupload{dir = 8},/obj/machinery/light{dir = 4},/obj/machinery/atmospherics/unary/vent_pump/on{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_upload) -"Bt" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor/wood,/area/stellardelight/deck3/cafe) -"Bz" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/door/airlock/angled_bay/standard/color{dir = 4; door_color = "#323d80"; fill_color = "#313866"; id_tag = "cmodoor"; name = "Chief Medical Officer"; req_access = list(40); stripe_color = "#ffffff"},/turf/simulated/floor/tiled/steel_ridged,/area/crew_quarters/heads/cmo) -"BA" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/external/glass{dir = 4; frequency = 1380; id_tag = null; locked = 1; name = "Docking Port Airlock"},/obj/effect/map_helper/airlock/door/ext_door,/obj/machinery/access_button{command = "cycle_exterior"; dir = 8; frequency = 1380; master_tag = "sd_port_landing"; pixel_y = 32; req_one_access = list(13)},/obj/structure/cable{icon_state = "4-8"},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/portdock) -"BB" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/stellardelight/deck3/aft) -"BC" = (/obj/structure/disposalpipe/segment{dir = 4; icon_state = "pipe-c"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 6},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 1},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 6},/obj/structure/cable/green{icon_state = "2-4"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"BF" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/hatch{door_color = "#e6ab22"; name = "Command Substation"; req_one_access = list(10); stripe_color = "#e6ab22"},/turf/simulated/floor/tiled/steel_ridged,/area/maintenance/stellardelight/substation/command) -"BG" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/table/rack,/obj/random/maintenance/clean,/obj/random/maintenance,/obj/random/maintenance/engineering,/obj/random/maintenance/research,/obj/random/maintenance/research,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"BH" = (/turf/simulated/floor/carpet,/area/crew_quarters/heads/hos) -"BJ" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/double/glass{name = "glass airlock"},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/starboarddock) -"BK" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"BL" = (/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 1},/turf/simulated/open,/area/stellardelight/deck2/port) -"BM" = (/obj/structure/sign/painting/library_secure{pixel_x = -30},/turf/simulated/floor/carpet/oracarpet,/area/crew_quarters/heads/chief) -"BQ" = (/obj/structure/cable/blue{icon_state = "1-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 9},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/light_switch{dir = 4; pixel_x = -24; pixel_y = 24},/turf/simulated/floor/tiled/techfloor,/area/crew_quarters/heads/hor) -"BR" = (/obj/machinery/atmospherics/unary/vent_pump/high_volume{dir = 1; frequency = 1380; id_tag = null},/obj/machinery/embedded_controller/radio/airlock/docking_port_multi{dir = 4; frequency = 1380; id_tag = "sd_escape_center_left"; master_tag = "escape_dock"; pixel_x = -24; req_one_access = list(13); tag_airpump = null; tag_chamber_sensor = null; tag_exterior_door = null; tag_interior_door = null},/obj/machinery/airlock_sensor{dir = 8; frequency = 1380; id_tag = null; pixel_x = 25},/obj/effect/map_helper/airlock/atmos/chamber_pump,/obj/effect/map_helper/airlock/sensor/chamber_sensor,/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"BV" = (/obj/structure/bed/chair{dir = 8},/obj/machinery/alarm/angled{dir = 8},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"BW" = (/obj/machinery/power/terminal{dir = 1},/obj/structure/cable{icon_state = "0-4"},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/obj/machinery/atmospherics/pipe/manifold/hidden/fuel{dir = 1},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"BY" = (/obj/machinery/newscaster{layer = 3.3; pixel_x = -27},/turf/simulated/floor/carpet/blue2,/area/lawoffice) -"BZ" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/door/firedoor/glass,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"Cb" = (/obj/machinery/atmospherics/unary/vent_pump/on{dir = 4},/obj/effect/landmark/vermin,/turf/simulated/open,/area/stellardelight/deck2/fore) -"Cc" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/hatch{dir = 4; name = "maintenance access"; stripe_color = "#454545"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/aft) -"Cd" = (/obj/structure/table/woodentable,/obj/machinery/atmospherics/unary/vent_pump/on{dir = 1},/turf/simulated/floor/wood,/area/stellardelight/deck3/cafe) -"Ce" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/carpet/turcarpet,/area/ai) -"Cf" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable/green{icon_state = "4-8"},/obj/machinery/door/airlock/angled_bay/hatch{dir = 4; name = "maintenance access"; stripe_color = "#454545"},/turf/simulated/floor/tiled/steel_ridged,/area/maintenance/stellardelight/deck3/portcent) -"Cn" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 5},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 5},/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"Co" = (/obj/machinery/button/remote/airlock{id = "readingroom2"; name = "Room 2 Lock"; pixel_y = 24; specialfunctions = 4},/obj/machinery/button/remote/blast_door{id = "readingroom2"; name = "Window Lockdown"; pixel_x = -10; pixel_y = 24},/turf/simulated/floor/carpet,/area/stellardelight/deck3/readingroom) -"Cp" = (/obj/machinery/door/firedoor/glass,/turf/simulated/floor,/area/stellardelight/deck2/fore) -"Cu" = (/obj/machinery/power/apc/angled{dir = 1},/obj/structure/cable/green{icon_state = "0-8"},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 1},/obj/random/vendorfood,/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Cw" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 10},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 10},/obj/structure/cable/blue{icon_state = "2-8"},/obj/structure/cable/blue{icon_state = "2-4"},/turf/simulated/open,/area/stellardelight/deck2/fore) -"Cx" = (/obj/effect/shuttle_landmark{base_area = /area/stellardelight/deck3/exterior; base_turf = /turf/simulated/floor/reinforced/airless; docking_controller = "escape_dock"; landmark_tag = "escape_station"; name = "Ship Arrivals"},/turf/simulated/floor/reinforced/airless,/area/stellardelight/deck3/exterior) -"Cy" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/cable/green{icon_state = "1-8"},/obj/structure/cable/green{icon_state = "2-8"},/obj/structure/disposalpipe/segment{dir = 8; icon_state = "pipe-c"},/obj/machinery/atmospherics/pipe/manifold4w/hidden/supply,/obj/machinery/atmospherics/pipe/manifold4w/hidden/scrubbers,/obj/machinery/atmospherics/pipe/manifold/hidden{dir = 4},/obj/effect/floor_decal/arrivals/right,/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Cz" = (/obj/structure/lattice,/obj/structure/disposalpipe/segment{dir = 8; icon_state = "pipe-c"},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers,/obj/machinery/atmospherics/pipe/manifold/hidden/supply,/turf/simulated/open,/area/stellardelight/deck2/port) -"CA" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/machinery/door/blast/angled/open{dir = 2; id = "barlockdown"},/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/crew_quarters/bar) -"CC" = (/turf/simulated/wall/bay/r_wall/steel,/area/stellardelight/deck3/clownmimeoffice) -"CD" = (/obj/machinery/atmospherics/unary/vent_pump/high_volume{dir = 8; frequency = 1380; id_tag = null},/obj/machinery/embedded_controller/radio/airlock/docking_port_multi{frequency = 1380; id_tag = "sd_escape_port"; master_tag = "escape_dock"; pixel_y = 30; req_one_access = list(13); tag_airpump = null; tag_chamber_sensor = null; tag_exterior_door = null; tag_interior_door = null},/obj/machinery/airlock_sensor{frequency = 1380; id_tag = null; pixel_y = -25},/obj/effect/map_helper/airlock/atmos/chamber_pump,/obj/effect/map_helper/airlock/sensor/chamber_sensor,/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"CG" = (/obj/machinery/blackbox_recorder,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_server_room) -"CH" = (/obj/machinery/light/small{dir = 8},/obj/structure/cable{icon_state = "4-8"},/turf/simulated/floor,/area/stellardelight/deck2/starboard) -"CJ" = (/obj/structure/lattice,/obj/structure/cable{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/open,/area/stellardelight/deck2/starboard) -"CK" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"CO" = (/obj/effect/overmap/visitable/ship/stellar_delight,/turf/space,/area/space) -"CP" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/obj/effect/floor_decal/arrivals/right,/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"CR" = (/obj/structure/bed/chair{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 6},/obj/machinery/newscaster{pixel_y = 28},/turf/simulated/floor/carpet,/area/crew_quarters/heads/hop) -"CS" = (/obj/structure/lattice,/turf/simulated/open,/area/stellardelight/deck2/port) -"CT" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers,/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 1},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"CU" = (/obj/machinery/door/firedoor/glass,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor,/area/stellardelight/deck2/fore) -"CV" = (/obj/structure/bed/chair,/obj/structure/sign/painting/public{pixel_y = 30},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 1},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"CY" = (/obj/effect/floor_decal/techfloor{dir = 8},/obj/effect/landmark{name = "JoinLateCryo"},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/cryo) -"Dd" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/open,/area/crew_quarters/bar) -"De" = (/obj/structure/cable{icon_state = "2-4"},/turf/simulated/wall/bay/r_wall/blue,/area/ai_cyborg_station) -"Df" = (/obj/machinery/door/firedoor/glass,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/structure/cable/blue{icon_state = "1-2"},/turf/simulated/floor,/area/stellardelight/deck2/fore) -"Dh" = (/obj/machinery/computer/message_monitor{dir = 1},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_server_room) -"Di" = (/obj/effect/floor_decal/industrial/warning{dir = 1},/obj/structure/cable/green{icon_state = "2-4"},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"Dk" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/structure/reagent_dispensers/watertank,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"Dn" = (/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"Dp" = (/obj/random/trash_pile,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"Ds" = (/obj/machinery/hologram/holopad,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"Du" = (/obj/machinery/vending/wardrobe/clowndrobe,/turf/simulated/floor/carpet/gaycarpet,/area/stellardelight/deck3/clownmimeoffice) -"Dw" = (/obj/machinery/hologram/holopad,/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 1},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 1},/turf/simulated/floor/carpet/geo,/area/ai) -"Dy" = (/obj/machinery/atmospherics/pipe/simple/hidden/black,/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"DC" = (/turf/simulated/wall/bay/steel,/area/maintenance/stellardelight/deck3/foreportroomb) -"DD" = (/obj/machinery/door/firedoor/glass,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/door/airlock/angled_bay/standard/glass{name = "maintenance access"},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck2/port) -"DE" = (/obj/structure/cable{icon_state = "4-8"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"DH" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 5},/obj/structure/cable/green{icon_state = "1-4"},/turf/simulated/open,/area/crew_quarters/bar) -"DI" = (/obj/machinery/power/apc/angled{dir = 8},/obj/structure/cable/blue{icon_state = "0-2"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/tiled/techfloor,/area/crew_quarters/heads/hor) -"DL" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 1},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_server_room) -"DM" = (/obj/structure/table/steel,/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportrooma) -"DN" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 9},/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"DO" = (/obj/structure/closet/hydrant{pixel_y = 28},/obj/structure/dogbed{name = "catslug bed"},/mob/living/simple_mob/vore/alienanimals/catslug/tulidaan,/turf/simulated/floor/wood,/area/stellardelight/deck3/readingroom) -"DP" = (/obj/effect/floor_decal/industrial/warning/corner,/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"DQ" = (/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardfore) -"DT" = (/obj/structure/railing/grey,/obj/structure/railing/grey{dir = 4},/turf/simulated/open,/area/maintenance/stellardelight/deck3/portaft) -"DV" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/wall/bay/blue,/area/lawoffice) -"DW" = (/obj/structure/cable{icon_state = "1-2"},/obj/machinery/button/remote/blast_door{dir = 8; id = "clownmimeoffice"; name = "Window Lockdown"; pixel_x = 23; pixel_y = 7},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 10},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 10},/turf/simulated/floor/carpet/gaycarpet,/area/stellardelight/deck3/clownmimeoffice) -"DY" = (/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportrooma) -"DZ" = (/obj/structure/cable{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 4},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"Ec" = (/turf/simulated/wall/bay/steel,/area/stellardelight/deck3/clownmimeoffice) -"Ed" = (/turf/simulated/wall/bay/r_wall/steel,/area/stellardelight/deck3/aft) -"Ee" = (/obj/machinery/atmospherics/pipe/manifold/hidden/black{dir = 1},/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"Ef" = (/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/forestarroomb) -"Eg" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 9},/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/camera/network/halls{dir = 1},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"Eh" = (/obj/effect/floor_decal/techfloor{dir = 4},/obj/structure/cable/green{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 10},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 9},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/cryo) -"Ei" = (/obj/structure/cable/green{icon_state = "1-4"},/obj/random/trash_pile,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"El" = (/obj/effect/landmark{name = "carpspawn"},/turf/space,/area/space) -"En" = (/obj/effect/floor_decal/industrial/warning/corner{dir = 1},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"Es" = (/obj/effect/shuttle_landmark/premade/sd/deck3/portlanding,/turf/space,/area/space) -"Et" = (/obj/structure/closet/secure_closet/hos,/obj/item/device/radio/intercom{dir = 1; name = "Station Intercom (General)"; pixel_y = 24},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor/tiled/dark,/area/crew_quarters/heads/hos) -"Eu" = (/turf/simulated/wall/bay/r_wall/blue,/area/stellardelight/deck2/port) -"Ev" = (/obj/structure/cable/blue{icon_state = "1-4"},/obj/structure/cable/blue{icon_state = "1-2"},/obj/structure/disposalpipe/segment{dir = 4; icon_state = "pipe-c"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"Ex" = (/obj/structure/bed/chair/bay/comfy/blue{dir = 1},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/fore{base_turf = /turf/simulated/floor/reinforced/airless}) -"EE" = (/obj/structure/table/rack{dir = 8; layer = 2.9},/obj/item/weapon/rig/ce/equipped,/obj/item/clothing/mask/breath,/obj/item/clothing/shoes/magboots/adv,/turf/simulated/floor/tiled,/area/crew_quarters/heads/chief) -"EF" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"EH" = (/obj/structure/table/steel,/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportroomb) -"EI" = (/obj/machinery/atmospherics/unary/vent_pump/high_volume{dir = 8; frequency = 1379; id_tag = "portmaint_airpump"},/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/portcent) -"EJ" = (/turf/simulated/wall/bay/r_wall/blue,/area/crew_quarters/heads/cmo) -"EL" = (/obj/machinery/door/airlock/angled_bay/hatch{frequency = null; id_tag = null; locked = 1; name = "Telecoms Server Access"; req_access = list(61); stripe_color = "#ffd863"},/obj/machinery/door/firedoor/glass,/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/access_button{command = "cycle_exterior"; dir = 1; frequency = 1380; master_tag = "tcommsairlock"; pixel_x = -32; req_one_access = list(61)},/obj/effect/map_helper/airlock/door/ext_door,/turf/simulated/floor/tiled/steel_ridged,/area/tcommsat/computer) -"EN" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/obj/effect/floor_decal/steeldecal/steel_decals_central5{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"EO" = (/obj/structure/sign/nanotrasen{pixel_y = 30},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 6},/turf/simulated/floor/tiled/dark,/area/lawoffice) -"ER" = (/turf/simulated/floor/tiled/steel_grid,/area/stellardelight/deck3/aft) -"ET" = (/obj/structure/cable{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"EU" = (/obj/structure/cable/blue{icon_state = "2-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"EV" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/cable/green{icon_state = "2-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"EW" = (/obj/structure/cable/blue{icon_state = "1-4"},/obj/structure/cable/blue{icon_state = "1-8"},/obj/machinery/atmospherics/pipe/manifold/hidden/supply,/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers,/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"EX" = (/obj/machinery/atmospherics/pipe/simple/hidden/fuel{dir = 10},/turf/simulated/wall/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"EY" = (/obj/structure/table/reinforced,/obj/machinery/computer/skills{dir = 8; pixel_y = 6},/turf/simulated/floor/carpet/oracarpet,/area/crew_quarters/heads/chief) -"EZ" = (/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/deck3/forestarroomb) -"Fb" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/open,/area/crew_quarters/bar) -"Fe" = (/obj/machinery/hologram/holopad,/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_upload) -"Ff" = (/obj/structure/bed/chair,/obj/machinery/atmospherics/unary/vent_scrubber/on,/obj/machinery/alarm/angled,/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 1},/obj/effect/landmark/vermin,/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Fg" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/door/airlock/angled_bay/standard/color{dir = 4; door_color = "#323d80"; fill_color = "#854a44"; id_tag = "hosdoor"; name = "Head of Security"; req_access = list(58); stripe_color = "#d27428"},/turf/simulated/floor/tiled/steel_ridged,/area/crew_quarters/heads/hos) -"Fh" = (/turf/simulated/floor/tiled/techfloor/grid,/area/ai_server_room) -"Fj" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/manifold/hidden/supply,/obj/structure/cable/blue{icon_state = "4-8"},/turf/simulated/floor,/area/stellardelight/deck2/fore) -"Fm" = (/obj/machinery/atmospherics/unary/vent_pump/high_volume{dir = 8; frequency = 1379; id_tag = "portmaint_airpump"},/obj/machinery/camera/network/civilian,/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/portcent) -"Fr" = (/obj/structure/disposalpipe/segment{dir = 4; icon_state = "pipe-c"},/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/commandhall) -"Ft" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4; icon_state = "pipe-c"},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 8},/turf/simulated/floor,/area/stellardelight/deck2/port) -"Fv" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"Fy" = (/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/portcent) -"FC" = (/obj/machinery/alarm/angled{dir = 8},/obj/structure/cable/blue{icon_state = "2-4"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor/tiled/dark,/area/lawoffice) -"FD" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarroomb) -"FE" = (/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarroomb) -"FG" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 5},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"FH" = (/obj/machinery/power/pointdefense{id_tag = "sd_pd"},/obj/effect/floor_decal/industrial/warning/full,/obj/structure/cable/green{icon_state = "0-2"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"FI" = (/obj/effect/floor_decal/industrial/warning/corner{dir = 1},/obj/structure/cable/green{icon_state = "1-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"FL" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/structure/cable/blue{icon_state = "1-2"},/turf/simulated/open,/area/stellardelight/deck2/starboard) -"FM" = (/obj/structure/bed/chair/comfy/brown{dir = 1},/turf/simulated/floor/tiled/eris/white/cargo,/area/crew_quarters/heads/cmo) -"FO" = (/obj/structure/bed/psych{name = "couch"},/turf/simulated/floor/tiled/eris/white/cargo,/area/crew_quarters/heads/cmo) -"FR" = (/obj/effect/floor_decal/techfloor/orange,/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/transitgateway) -"FS" = (/obj/machinery/atmospherics/pipe/simple/hidden/universal{dir = 8},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"FU" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"FW" = (/obj/machinery/power/apc/angled{dir = 8; name = "night shift APC"; nightshift_setting = 2},/obj/structure/cable/green{icon_state = "0-2"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportrooma) -"FY" = (/obj/structure/closet,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportrooma) -"Ga" = (/obj/structure/cable/cyan{icon_state = "1-4"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/bluegrid,/area/ai) -"Gc" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 10},/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"Ge" = (/obj/structure/table/standard,/obj/item/weapon/aiModule/nanotrasen,/obj/machinery/camera/network/command,/obj/machinery/atmospherics/unary/vent_scrubber/on,/turf/simulated/floor/bluegrid,/area/ai_cyborg_station) -"Gf" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/machinery/atmospherics/unary/vent_scrubber/on,/obj/machinery/alarm/angled,/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 1},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Gg" = (/obj/structure/sink{dir = 8; pixel_x = -12; pixel_y = -3},/turf/simulated/floor/lino,/area/stellardelight/deck3/cafe) -"Gh" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/structure/cable/blue{icon_state = "2-4"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_upload) -"Gi" = (/obj/structure/table/rack,/obj/item/weapon/rig/hazmat/equipped,/obj/machinery/light,/turf/simulated/floor/tiled/techfloor,/area/crew_quarters/heads/hor) -"Gj" = (/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/commandhall) -"Gk" = (/turf/simulated/wall/bay/r_wall/blue,/area/maintenance/stellardelight/deck3/portaft) -"Gl" = (/obj/structure/bed/chair/office/dark{dir = 8},/obj/effect/landmark/start/cmo,/turf/simulated/floor/carpet/tealcarpet,/area/crew_quarters/heads/cmo) -"Gm" = (/obj/structure/cable/blue{icon_state = "0-2"},/obj/structure/cable/blue,/obj/machinery/power/smes/buildable{RCon_tag = "Substation - Command"; output_attempt = 0},/turf/simulated/floor,/area/maintenance/stellardelight/substation/command) -"Go" = (/obj/structure/cable/green{icon_state = "2-4"},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"Gq" = (/obj/structure/cable{icon_state = "2-8"},/obj/structure/disposalpipe/segment{dir = 2; icon_state = "pipe-c"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 10},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 10},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 10},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"Gv" = (/obj/structure/sign/deck3{pixel_x = -32},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"GB" = (/obj/item/weapon/reagent_containers/food/drinks/shaker,/obj/item/weapon/reagent_containers/glass/rag,/obj/structure/table/rack,/obj/random/donkpocketbox,/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/forestarroomb) -"GD" = (/obj/structure/cable/blue{icon_state = "1-4"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 5},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"GE" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/door/firedoor/glass,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/aft) -"GF" = (/obj/structure/cable/green{icon_state = "2-8"},/obj/machinery/atmospherics/pipe/simple/hidden,/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/portcent) -"GH" = (/obj/item/device/radio/intercom{dir = 8; pixel_x = -24},/turf/simulated/floor/wood,/area/stellardelight/deck3/readingroom) -"GJ" = (/obj/structure/cable/blue{icon_state = "1-4"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarrooma) -"GP" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/bluegrid,/area/ai) -"GQ" = (/turf/simulated/wall/bay/red,/area/crew_quarters/heads/hos) -"GR" = (/obj/machinery/requests_console/preset/cmo{pixel_x = 30},/turf/simulated/floor/carpet/tealcarpet,/area/crew_quarters/heads/cmo) -"GS" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/door/firedoor/glass,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"GT" = (/obj/effect/floor_decal/industrial/warning{dir = 8},/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/cable/green{icon_state = "1-4"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"GU" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_server_room) -"GW" = (/obj/structure/table/reinforced,/obj/item/weapon/book/manual/supermatter_engine,/obj/item/device/radio{pixel_x = -4},/obj/item/device/megaphone,/obj/machinery/light,/turf/simulated/floor/tiled,/area/crew_quarters/heads/chief) -"Ha" = (/obj/structure/bed/double/padded,/obj/item/weapon/bedsheet/cedouble,/obj/structure/curtain/black{color = "#945112"},/obj/effect/landmark/start/ce,/turf/simulated/floor/carpet/oracarpet,/area/crew_quarters/heads/chief) -"Hc" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/structure/cable/blue,/obj/machinery/power/sensor{name = "Powernet Sensor - AI/Telecomms Subgrid"; name_tag = "AI/Telecomms Subgrid"},/obj/machinery/power/apc/angled{dir = 8},/turf/simulated/floor,/area/ai_cyborg_station) -"Hd" = (/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 4},/obj/structure/closet/firecloset,/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"He" = (/obj/machinery/door/firedoor/glass,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor,/area/stellardelight/deck2/central) -"Hf" = (/obj/machinery/atmospherics/unary/vent_pump/on,/turf/simulated/open,/area/stellardelight/deck2/fore) -"Hg" = (/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/obj/structure/sign/vacuum{pixel_x = -32; plane = -34},/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"Hh" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/airlock_sensor{dir = 4; id_tag = "starmaint_sensor"; pixel_x = -24; req_access = list(13)},/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/starboardcent) -"Hi" = (/obj/machinery/atmospherics/unary/vent_pump/on{dir = 8},/obj/item/device/radio/intercom{dir = 4; pixel_x = 24},/obj/structure/closet/emergsuit_wall{pixel_y = 29},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Hk" = (/obj/machinery/alarm/angled{dir = 8},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"Hm" = (/obj/structure/closet/emcloset,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"Ho" = (/obj/structure/table/steel,/obj/random/contraband,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance/clean,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/aftstarroom) -"Hq" = (/obj/structure/sign/warning/falling{pixel_y = 32},/turf/simulated/open,/area/stellardelight/deck2/fore) -"Hs" = (/turf/simulated/wall/bay/orange,/area/crew_quarters/heads/chief) -"Ht" = (/obj/machinery/atmospherics/unary/vent_pump{dir = 4; external_pressure_bound = 0; external_pressure_bound_default = 0; icon_state = "map_vent_in"; initialize_directions = 1; internal_pressure_bound = 4000; internal_pressure_bound_default = 4000; pressure_checks = 2; pressure_checks_default = 2; pump_direction = 0; use_power = 1},/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"Hu" = (/obj/effect/floor_decal/industrial/warning{dir = 8},/obj/machinery/light/small{dir = 1},/turf/simulated/floor/airless,/area/stellardelight/deck3/portdock) -"Hv" = (/obj/structure/sign/painting/library_secure{pixel_x = 30},/turf/simulated/floor/carpet/blue2,/area/lawoffice) -"Hw" = (/obj/structure/sign/painting/public{pixel_y = 30},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 1},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Hx" = (/obj/structure/cable/green{icon_state = "1-8"},/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"HA" = (/obj/structure/cable/cyan,/obj/machinery/button/remote/blast_door{desc = "A remote control-switch for the AI core maintenance door."; dir = 4; id = "AICore"; name = "AI Maintenance Hatch"; pixel_x = -25; pixel_y = -5; req_access = list(16)},/obj/machinery/light,/obj/machinery/holoplant,/obj/machinery/power/apc/angled{dir = 4},/turf/simulated/floor/bluegrid,/area/ai) -"HB" = (/obj/effect/floor_decal/spline/plain{dir = 4},/obj/structure/table/bench/marble,/turf/simulated/floor/lino,/area/stellardelight/deck3/cafe) -"HF" = (/obj/structure/cable/green{icon_state = "2-4"},/obj/structure/table/rack,/obj/random/maintenance/clean,/obj/random/maintenance,/obj/random/maintenance,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"HH" = (/obj/structure/closet/emcloset,/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"HL" = (/obj/structure/cable{icon_state = "2-8"},/obj/structure/cable{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"HN" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/light{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"HO" = (/obj/structure/cable/green{icon_state = "1-4"},/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/deck3/foreportrooma) -"HP" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/stellardelight/deck3/starboarddock) -"HQ" = (/obj/machinery/door/airlock/angled_bay/standard/color{door_color = "#9c9c9c"; fill_color = "#5c5c5c"; id_tag = null; name = "Reading Rooms"; stripe_color = "#89bd66"},/obj/machinery/door/firedoor/glass,/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/readingroom) -"HR" = (/obj/structure/table/steel,/obj/random/contraband,/obj/machinery/chemical_dispenser/bar_coffee/full{pixel_y = 8},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportrooma) -"HS" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 9},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 9},/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"HT" = (/obj/structure/cable/blue{icon_state = "1-2"},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"HV" = (/obj/structure/cable/green{icon_state = "1-4"},/obj/effect/landmark{name = "morphspawn"},/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/forestarrooma) -"HW" = (/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 4},/obj/structure/cable/blue{icon_state = "1-2"},/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"HX" = (/obj/machinery/light{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"HY" = (/obj/structure/table/rack,/obj/random/contraband,/obj/random/maintenance,/obj/random/maintenance,/obj/random/snack,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"HZ" = (/obj/structure/lattice,/obj/structure/cable{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 5},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 1},/turf/simulated/open,/area/stellardelight/deck2/central) -"Ia" = (/turf/simulated/wall/fancy_shuttle/nondense{fancy_shuttle_tag = "sdboat"},/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"Ib" = (/obj/machinery/alarm/angled{dir = 4},/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/forestarrooma) -"Ie" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/manifold/hidden/supply,/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 1},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/open,/area/stellardelight/deck2/fore) -"Ig" = (/obj/structure/lattice,/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/open,/area/stellardelight/deck2/port) -"Ii" = (/turf/simulated/wall/bay/r_wall/steel,/area/holodeck_control) -"Ij" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/effect/landmark{name = "maint_pred"},/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportroomb) -"Il" = (/obj/machinery/photocopier,/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"Im" = (/obj/effect/landmark/tram,/turf/simulated/floor/glass/reinforced,/area/stellardelight/deck3/aft) -"In" = (/obj/structure/cable{icon_state = "1-8"},/obj/random/trash_pile,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"Io" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"Ir" = (/obj/structure/bed/chair/shuttle{dir = 1},/obj/machinery/light{dir = 4},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"It" = (/obj/effect/floor_decal/steeldecal/steel_decals4{dir = 5},/obj/structure/cable{icon_state = "2-4"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Iu" = (/obj/machinery/holoplant,/turf/simulated/floor/bluegrid,/area/ai_server_room) -"Iz" = (/obj/effect/floor_decal/industrial/warning,/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"IC" = (/obj/machinery/computer/station_alert/all,/obj/machinery/status_display{pixel_y = 32},/turf/simulated/floor/tiled,/area/crew_quarters/heads/chief) -"ID" = (/obj/machinery/atmospherics/unary/vent_pump/on{dir = 8},/obj/effect/landmark/vines,/turf/simulated/open,/area/stellardelight/deck2/fore) -"IG" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/structure/cable/blue{icon_state = "1-8"},/obj/structure/cable/blue{icon_state = "1-4"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"IH" = (/obj/structure/lattice,/obj/structure/cable/green{icon_state = "1-4"},/obj/structure/disposalpipe/segment{dir = 1; icon_state = "pipe-c"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 5},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 5},/turf/simulated/open,/area/stellardelight/deck2/port) -"II" = (/obj/structure/sign/nanotrasen{pixel_y = 30},/obj/machinery/camera/network/command,/obj/structure/flora/pottedplant/stoutbush,/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/commandhall) -"IK" = (/obj/effect/floor_decal/industrial/warning{dir = 1},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"IN" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/structure/cable/green{icon_state = "2-8"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"IO" = (/obj/structure/lattice,/obj/structure/cable/green{icon_state = "1-4"},/obj/structure/disposalpipe/segment{dir = 1; icon_state = "pipe-c"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 5},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 5},/obj/machinery/light/small,/turf/simulated/open,/area/stellardelight/deck2/port) -"IP" = (/obj/structure/table/steel,/obj/random/contraband,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"IQ" = (/obj/machinery/porta_turret/ai_defense,/turf/simulated/floor/bluegrid,/area/ai) -"IR" = (/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"IS" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable{icon_state = "1-2"},/obj/machinery/door/airlock/angled_bay/hatch{name = "Clown and Mime Office"; req_one_access = list(138,136); stripe_color = "#454545"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor,/area/stellardelight/deck3/clownmimeoffice) -"IU" = (/obj/machinery/hologram/holopad,/obj/structure/sign/warning/secure_area{pixel_y = 32},/turf/simulated/floor/bluegrid,/area/ai) -"IV" = (/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 4},/turf/simulated/open,/area/stellardelight/deck2/fore) -"IW" = (/obj/machinery/status_display{pixel_x = 32},/obj/structure/closet/emcloset,/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"IY" = (/obj/machinery/airlock_sensor{dir = 8; id_tag = "portmaint_sensor"; pixel_x = 24; req_access = list(13)},/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/portcent) -"IZ" = (/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Ja" = (/obj/machinery/door/airlock/angled_bay/external/glass{frequency = 1379; id_tag = "starmaint_interior"; locked = 1; name = "Exterior Airlock"},/obj/machinery/door/firedoor/glass,/obj/machinery/access_button{command = "cycle_interior"; frequency = 1379; master_tag = "starmaint_airlock"; name = "interior access button"; pixel_x = 32; req_access = null; req_one_access = list(13)},/obj/machinery/atmospherics/pipe/simple/hidden,/turf/simulated/floor/tiled/steel_ridged,/area/maintenance/stellardelight/deck3/starboardcent) -"Jc" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/effect/landmark{name = "morphspawn"},/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportroomb) -"Jd" = (/obj/structure/closet/lawcloset,/obj/structure/sign/poster{dir = 8},/obj/machinery/newscaster{pixel_y = 28},/turf/simulated/floor/tiled/dark,/area/lawoffice) -"Jg" = (/obj/machinery/light{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 6},/turf/simulated/floor/bluegrid,/area/ai) -"Jh" = (/turf/space,/area/space) -"Ji" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/cable/green{icon_state = "0-2"},/obj/machinery/power/apc/angled{dir = 8; name = "night shift APC"; nightshift_setting = 2},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"Jj" = (/obj/structure/sign/painting/library_secure{pixel_x = 30},/turf/simulated/floor/carpet/tealcarpet,/area/crew_quarters/heads/cmo) -"Jk" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor/tiled,/area/stellardelight/deck3/transitgateway) -"Jm" = (/obj/structure/barricade/cutout/clown,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor/wood,/area/stellardelight/deck3/clownmimeoffice) -"Jn" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/hatch{dir = 4; name = "maintenance access"; stripe_color = "#454545"},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor/tiled/steel_ridged,/area/maintenance/stellardelight/deck3/foreportrooma) -"Jo" = (/obj/machinery/light{dir = 4},/obj/structure/bed/chair{dir = 8},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"Js" = (/obj/structure/table/darkglass,/obj/item/device/radio/intercom{dir = 1; name = "Station Intercom (General)"; pixel_y = 24},/obj/item/device/flashlight/lamp/green{pixel_x = 5; pixel_y = -5},/obj/item/weapon/paper_bin,/obj/item/weapon/pen/blade/red{pixel_x = -2; pixel_y = -2},/obj/item/weapon/pen,/obj/item/weapon/pen/blue{pixel_x = 2; pixel_y = 3},/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 4},/turf/simulated/floor/tiled/dark,/area/lawoffice) -"Ju" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor,/area/stellardelight/deck2/port) -"Jv" = (/obj/machinery/computer/aifixer,/obj/machinery/status_display{pixel_y = 32},/turf/simulated/floor/tiled/techfloor,/area/crew_quarters/heads/hor) -"Jx" = (/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/deck3/forestarrooma) -"Jz" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/door/airlock/angled_bay/secure{name = "AI Core"; req_access = list(16)},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/tiled/steel_ridged,/area/ai) -"JA" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/external/glass{frequency = 1380; id_tag = null; locked = 1; name = "Docking Port Airlock"},/obj/effect/map_helper/airlock/door/ext_door,/obj/machinery/access_button{command = "cycle_exterior"; frequency = 1380; master_tag = "sd_escape_center_left"; pixel_x = -32; req_one_access = list(13)},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/aft) -"JE" = (/obj/machinery/power/apc/angled{dir = 1},/obj/structure/cable/green{icon_state = "0-2"},/obj/structure/table/woodentable,/obj/item/weapon/reagent_containers/food/drinks/glass2/square{pixel_x = 8; pixel_y = 8},/obj/item/weapon/reagent_containers/food/drinks/glass2/square{pixel_x = 8; pixel_y = 8},/obj/item/weapon/reagent_containers/food/drinks/glass2/square{pixel_x = 8; pixel_y = 8},/obj/item/weapon/reagent_containers/glass/rag,/turf/simulated/floor/lino,/area/stellardelight/deck3/cafe) -"JJ" = (/obj/machinery/computer/aifixer,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"JK" = (/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor,/area/ai_cyborg_station) -"JO" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"JP" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/door/airlock/angled_bay/secure{name = "AI Upload"; req_access = list(16)},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled/steel_ridged,/area/ai_upload) -"JQ" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/turretid/stun{control_area = /area/ai_upload; name = "AI Upload turret control"; pixel_x = -32; pixel_y = 30},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_upload) -"JR" = (/obj/machinery/light{dir = 8},/obj/structure/bed/chair{dir = 4},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/obj/structure/cable{icon_state = "2-4"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"JS" = (/obj/machinery/embedded_controller/radio/docking_port_multi{child_names_txt = "Port;Center Left;Center Right;Starboard"; child_tags_txt = "sd_escape_port;sd_escape_center_left;sd_escape_center_right;sd_escape_starboard"; dir = 1; frequency = 1380; id_tag = "escape_dock"; pixel_y = -18; req_one_access = list(13)},/obj/effect/landmark/arrivals,/turf/simulated/floor/glass/reinforced,/area/stellardelight/deck3/aft) -"JU" = (/obj/structure/table/reinforced,/obj/item/weapon/rcd,/obj/item/weapon/rcd_ammo,/obj/item/weapon/rcd_ammo,/obj/item/weapon/rcd_ammo,/obj/item/weapon/rcd_ammo,/turf/simulated/floor/tiled,/area/crew_quarters/heads/chief) -"JW" = (/obj/random/trash_pile,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"JY" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/bed/chair{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportroomb) -"JZ" = (/obj/effect/floor_decal/spline/plain,/obj/structure/table/bench/marble,/obj/machinery/light{dir = 8},/turf/simulated/floor/lino,/area/stellardelight/deck3/cafe) -"Kb" = (/obj/structure/bed/chair{dir = 4},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"Ke" = (/obj/machinery/atmospherics/pipe/simple/hidden/fuel{dir = 6},/turf/simulated/wall/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"Kf" = (/obj/machinery/atmospherics/unary/vent_pump/on{dir = 1},/obj/effect/floor_decal/steeldecal/steel_decals5,/obj/machinery/camera/network/halls{dir = 1},/obj/structure/cable{icon_state = "4-8"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Kg" = (/obj/structure/cable/green{icon_state = "2-4"},/obj/structure/bed/chair/sofa/corp/left{dir = 4},/obj/structure/cable/green{icon_state = "1-2"},/obj/move_trader_landmark{dir = 4; trader_type = /obj/trader/general},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"Ki" = (/obj/machinery/computer/ship/navigation/telescreen{pixel_x = 32},/obj/machinery/power/shield_generator/charged,/obj/structure/cable,/turf/simulated/floor,/area/stellardelight/deck2/central) -"Kj" = (/obj/machinery/computer/shuttle_control/explore/sdboat{dir = 4},/obj/machinery/light{dir = 8},/obj/machinery/power/apc{pixel_y = -28; req_access = null; req_one_access = list(11,67)},/obj/structure/cable/green{icon_state = "0-4"},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/fore{base_turf = /turf/simulated/floor/reinforced/airless}) -"Kk" = (/obj/structure/table/steel,/obj/random/maintenance/clean,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/aftstarroom) -"Ko" = (/obj/effect/landmark/tram,/obj/machinery/camera/network/halls{dir = 1},/turf/simulated/floor/glass/reinforced,/area/stellardelight/deck3/aft) -"Kq" = (/obj/structure/table/rack,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance/engineering,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardfore) -"Kr" = (/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/deck3/forestarrooma) -"Ks" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor,/area/stellardelight/deck2/starboard) -"Kt" = (/obj/machinery/atmospherics/pipe/simple/hidden/universal,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"Kv" = (/obj/structure/bed/chair{dir = 4},/obj/structure/closet/emergsuit_wall{dir = 8; pixel_x = -27},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"Kw" = (/obj/machinery/light{dir = 4},/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 8},/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"Kx" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"Ky" = (/obj/structure/bed/chair{dir = 4},/obj/machinery/light,/turf/simulated/floor/glass/reinforced,/area/stellardelight/deck3/aft) -"Kz" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/structure/closet/emcloset,/obj/random/contraband,/obj/random/maintenance/research,/obj/random/maintenance/research,/obj/random/maintenance/research,/obj/random/maintenance/research,/obj/random/maintenance/research,/obj/random/maintenance/research,/obj/random/maintenance/cargo,/obj/random/mre,/obj/random/mre,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"KD" = (/obj/machinery/atmospherics/pipe/manifold/hidden{dir = 1},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"KF" = (/obj/machinery/atmospherics/unary/vent_pump/on{dir = 8},/turf/simulated/open,/area/stellardelight/deck2/fore) -"KG" = (/obj/structure/table/alien{name = "fancy table"},/obj/item/weapon/cartridge/signal/science,/obj/item/weapon/cartridge/signal/science,/obj/item/clothing/glasses/welding/superior,/obj/machinery/atmospherics/unary/vent_pump/on{dir = 1},/turf/simulated/floor/tiled/techfloor,/area/crew_quarters/heads/hor) -"KH" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/camera/network/command{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"KI" = (/turf/simulated/floor/wood,/area/stellardelight/deck3/readingroom) -"KJ" = (/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"KL" = (/obj/machinery/power/apc/angled{dir = 8},/obj/structure/cable/green{icon_state = "0-4"},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"KM" = (/obj/machinery/alarm/angled{dir = 4},/turf/simulated/floor/carpet/turcarpet,/area/ai) -"KQ" = (/obj/structure/cable/green{icon_state = "2-8"},/obj/structure/reagent_dispensers/fueltank,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"KS" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/structure/cable/blue{icon_state = "1-4"},/obj/machinery/atmospherics/pipe/manifold4w/hidden/scrubbers,/obj/machinery/atmospherics/pipe/manifold4w/hidden/supply,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_upload) -"KT" = (/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 4},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"KU" = (/obj/machinery/camera/network/command,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"KV" = (/obj/structure/table/steel,/obj/random/contraband,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarrooma) -"KW" = (/obj/machinery/door/firedoor/glass,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"KY" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 5},/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"Lb" = (/obj/structure/cable{icon_state = "1-8"},/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor,/area/ai_cyborg_station) -"Ld" = (/obj/machinery/atmospherics/portables_connector{dir = 4},/obj/machinery/portable_atmospherics/canister/air/airlock,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"Le" = (/obj/machinery/atmospherics/unary/vent_scrubber/on,/obj/structure/flora/pottedplant/minitree,/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Lf" = (/obj/structure/sign/warning/falling{pixel_x = -32},/turf/simulated/open,/area/stellardelight/deck2/starboard) -"Lh" = (/obj/machinery/hologram/holopad,/obj/structure/cable/blue{icon_state = "4-8"},/obj/structure/cable/blue{icon_state = "1-4"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/camera/network/telecom{dir = 1},/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"Li" = (/obj/move_trader_landmark{dir = 8; trader_type = /obj/trader/general},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"Lm" = (/obj/random/paicard,/obj/structure/table/glass,/obj/machinery/camera/network/civilian{dir = 8},/obj/random/coin/sometimes,/turf/simulated/floor/wood,/area/stellardelight/deck3/readingroom) -"Ln" = (/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardfore) -"Lo" = (/obj/effect/mouse_hole_spawner{dir = 4},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"Lr" = (/obj/effect/shuttle_landmark/premade/sd/deck3/starboardairlock,/turf/space,/area/space) -"Lv" = (/obj/structure/bed/chair{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/carpet/blue2,/area/lawoffice) -"Lw" = (/obj/effect/floor_decal/spline/plain,/obj/structure/table/bench/marble,/turf/simulated/floor/lino,/area/stellardelight/deck3/cafe) -"Lx" = (/obj/effect/landmark{name = "JoinLateCyborg"},/obj/machinery/camera/network/command{dir = 10},/obj/effect/landmark/start/cyborg,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"Ly" = (/obj/structure/cable{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 5},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"Lz" = (/obj/machinery/newscaster{pixel_x = 30},/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"LC" = (/obj/machinery/holoplant,/obj/structure/sign/warning/secure_area{pixel_y = 32},/obj/machinery/camera/network/command{dir = 9},/turf/simulated/floor/bluegrid,/area/ai_upload) -"LD" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/structure/cable/green{icon_state = "1-4"},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 5},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"LI" = (/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/obj/effect/floor_decal/steeldecal/steel_decals4{dir = 9},/obj/effect/floor_decal/shuttles,/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"LJ" = (/obj/structure/cable/green{icon_state = "1-8"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportrooma) -"LK" = (/obj/structure/table/bench/padded,/obj/structure/sign/painting/public{pixel_y = -30},/obj/machinery/alarm/angled{dir = 4},/turf/simulated/floor/wood,/area/stellardelight/deck3/cafe) -"LO" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"LP" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/manifold/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/obj/structure/cable/green{icon_state = "4-8"},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/obj/effect/floor_decal/steeldecal/steel_decals_central5{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"LQ" = (/obj/machinery/atmospherics/unary/vent_pump/on{dir = 8},/obj/structure/closet/emergsuit_wall{dir = 4; pixel_x = 27},/obj/effect/landmark/vines,/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"LR" = (/obj/machinery/atmospherics/unary/vent_pump/high_volume{dir = 8; frequency = 1379; id_tag = "starmaint_airpump"},/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/starboardcent) -"LS" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/hatch{name = "maintenance access"; stripe_color = "#454545"},/turf/simulated/floor/tiled/steel_ridged,/area/holodeck_control) -"LT" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable/green{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/door/airlock/angled_bay/hatch{dir = 4; name = "maintenance access"; stripe_color = "#454545"},/turf/simulated/floor/tiled/steel_ridged,/area/maintenance/stellardelight/deck3/portaft) -"LV" = (/obj/structure/table/steel,/obj/machinery/chemical_dispenser/bar_soft/full,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarrooma) -"LW" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/cable/green{icon_state = "1-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"LY" = (/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"Mc" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/ladder,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarrooma) -"Mg" = (/obj/item/device/camera,/obj/item/device/camera_film,/obj/item/device/taperecorder,/obj/item/device/tape/random,/obj/item/device/tape/random,/obj/item/weapon/storage/secure/briefcase,/obj/structure/closet/walllocker_double/west,/turf/simulated/floor/carpet/blue2,/area/lawoffice) -"Mi" = (/obj/effect/floor_decal/corner_techfloor_grid{dir = 5},/obj/effect/floor_decal/corner_techfloor_grid{dir = 10},/obj/machinery/power/apc/angled{dir = 4},/obj/structure/cable/green{icon_state = "0-8"},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/cryo) -"Mk" = (/obj/structure/lattice,/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 8},/turf/simulated/open,/area/stellardelight/deck2/port) -"Ml" = (/obj/structure/table/darkglass,/obj/item/weapon/stamp/denied{pixel_x = -6; pixel_y = 6},/obj/item/weapon/stamp/internalaffairs,/turf/simulated/floor/carpet/blue2,/area/lawoffice) -"Mo" = (/obj/structure/cable{icon_state = "4-8"},/obj/machinery/atmospherics/unary/vent_pump/high_volume{dir = 4; frequency = 1380; id_tag = null},/obj/effect/map_helper/airlock/atmos/chamber_pump,/obj/effect/map_helper/airlock/sensor/chamber_sensor,/obj/machinery/airlock_sensor{frequency = 1380; id_tag = null; pixel_y = -25},/obj/machinery/embedded_controller/radio/airlock/docking_port{frequency = 1380; id_tag = "sd_port_landing"; pixel_y = 29},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"Mp" = (/obj/machinery/power/breakerbox/activated{RCon_tag = "AI/Telecomms Substation Bypass"},/turf/simulated/floor,/area/ai_cyborg_station) -"Mr" = (/obj/structure/bed/double/padded,/obj/item/weapon/bedsheet/clowndouble,/obj/structure/curtain/black{color = "#361447"},/turf/simulated/floor/carpet/gaycarpet,/area/stellardelight/deck3/clownmimeoffice) -"Ms" = (/obj/structure/table/reinforced,/obj/item/weapon/stamp/hop,/obj/item/weapon/paper_bin{pixel_x = -3; pixel_y = 7},/obj/item/weapon/pen/multi,/obj/item/device/flashlight/lamp/green{pixel_x = 3; pixel_y = 18},/obj/item/weapon/book/manual/sd_guide,/turf/simulated/floor/carpet,/area/crew_quarters/heads/hop) -"Mu" = (/obj/structure/cable{icon_state = "0-2"},/obj/machinery/power/apc/angled{dir = 4; name = "night shift APC"; nightshift_setting = 2},/obj/structure/table/steel,/obj/random/maintenance/medical,/obj/random/maintenance/medical,/obj/random/maintenance/security,/obj/random/maintenance/clean,/obj/random/maintenance,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardfore) -"Mv" = (/obj/machinery/atmospherics/unary/vent_pump/on{dir = 4},/obj/effect/landmark/vines,/turf/simulated/open,/area/stellardelight/deck2/fore) -"Mw" = (/obj/machinery/atmospherics/pipe/manifold/hidden{dir = 1},/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/starboardcent) -"Mx" = (/obj/effect/floor_decal/steeldecal/steel_decals5,/obj/structure/cable{icon_state = "4-8"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"My" = (/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"MA" = (/obj/structure/cable{icon_state = "2-4"},/turf/simulated/wall/bay/r_wall/blue,/area/maintenance/stellardelight/deck3/portaft) -"MB" = (/obj/machinery/atmospherics/pipe/simple/hidden{dir = 10},/obj/random/trash_pile,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"MC" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/effect/floor_decal/emblem/nt3,/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"ME" = (/obj/structure/sign/poster{dir = 1},/obj/random/vendordrink,/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"MF" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 6},/turf/simulated/floor,/area/stellardelight/deck2/central) -"MG" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 10},/turf/simulated/floor/carpet/purcarpet,/area/crew_quarters/heads/hor) -"MH" = (/obj/structure/table/steel,/obj/random/maintenance/clean,/obj/random/snack,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/aftstarroom) -"MI" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 5},/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"MJ" = (/obj/machinery/pointdefense_control{id_tag = "sd_pd"},/turf/simulated/floor/bluegrid,/area/ai_server_room) -"MK" = (/obj/machinery/light/small{dir = 8},/turf/simulated/floor/carpet/turcarpet,/area/ai) -"MN" = (/obj/structure/closet/secure_closet/hos2,/obj/item/clothing/accessory/permit/gun,/obj/item/clothing/accessory/permit/gun,/obj/item/clothing/accessory/permit/gun,/obj/item/clothing/accessory/permit/gun,/obj/item/clothing/accessory/permit/gun,/obj/machinery/atmospherics/unary/vent_pump/on{dir = 1},/obj/item/device/retail_scanner/security,/obj/item/device/ticket_printer,/turf/simulated/floor/tiled/dark,/area/crew_quarters/heads/hos) -"MO" = (/obj/structure/cable/blue{icon_state = "4-8"},/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"MP" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/cable/green{icon_state = "1-8"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportrooma) -"MR" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"MU" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/obj/effect/floor_decal/arrivals,/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"MV" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 10},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"MW" = (/obj/machinery/atmospherics/pipe/simple/hidden{dir = 9},/obj/structure/cable/green{icon_state = "2-8"},/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"MX" = (/obj/structure/cable{icon_state = "4-8"},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/obj/machinery/atmospherics/pipe/simple/hidden/fuel{dir = 4},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"MZ" = (/obj/machinery/alarm/angled{dir = 8},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportroomb) -"Nc" = (/obj/effect/floor_decal/corner_techfloor_grid{dir = 5},/obj/effect/floor_decal/corner_techfloor_grid{dir = 10},/obj/structure/cable/green{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/cryo) -"Nd" = (/obj/machinery/atmospherics/unary/vent_pump/on{dir = 4},/obj/effect/landmark/vines,/turf/simulated/open,/area/stellardelight/deck2/port) -"Ne" = (/obj/structure/cable{icon_state = "1-8"},/obj/structure/cable{icon_state = "1-4"},/obj/structure/disposalpipe/segment{dir = 8; icon_state = "pipe-c"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 9},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 4},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"Nf" = (/obj/machinery/light{dir = 4},/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/commandhall) -"Nh" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/turf/simulated/floor,/area/stellardelight/deck2/starboard) -"Ni" = (/obj/structure/bed/chair{dir = 4},/obj/machinery/light{dir = 8},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"Nj" = (/obj/structure/cable/blue{icon_state = "1-2"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarrooma) -"Nk" = (/obj/structure/bed/chair{dir = 4},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/obj/structure/sign/nanotrasen{pixel_x = -32},/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"Nm" = (/obj/machinery/light_switch{dir = 8; pixel_x = 24},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_server_room) -"Nq" = (/obj/structure/bed/chair{dir = 8},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"Ns" = (/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"Nx" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 5},/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/camera/network/halls{dir = 1},/obj/effect/floor_decal/steeldecal/steel_decals5,/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"Ny" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/manifold/hidden{dir = 4},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/obj/effect/floor_decal/steeldecal/steel_decals_central5{dir = 8},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"Nz" = (/obj/structure/table/rack,/obj/random/contraband,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarrooma) -"NE" = (/obj/structure/table/rack,/obj/random/contraband,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"NF" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/open,/area/crew_quarters/bar) -"NG" = (/obj/machinery/light/small{dir = 4},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportroomb) -"NI" = (/obj/structure/lattice,/obj/structure/cable/green{icon_state = "2-8"},/obj/structure/disposalpipe/segment{dir = 2; icon_state = "pipe-c"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 10},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 10},/turf/simulated/open,/area/stellardelight/deck2/port) -"NJ" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/standard/color{dir = 4; door_color = "#9c9c9c"; fill_color = "#5c5c5c"; id_tag = "readingroom2"; name = "Room 2"; stripe_color = "#89bd66"},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/readingroom) -"NK" = (/obj/structure/sign/vacuum,/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/deck3/portcent) -"NL" = (/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"NN" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/door/airlock/angled_bay/hatch{dir = 4; name = "maintenance access"; stripe_color = "#454545"},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/aft) -"NO" = (/obj/structure/table/reinforced,/obj/item/device/flashlight/lamp,/obj/item/device/radio/intercom{dir = 1; frequency = 1357; name = "station intercom (Engineering)"; pixel_y = 24},/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 4},/obj/item/clothing/glasses/welding/superior,/obj/item/clothing/glasses/meson,/turf/simulated/floor/tiled,/area/crew_quarters/heads/chief) -"NP" = (/obj/machinery/camera/network/command{dir = 9},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"NQ" = (/obj/machinery/door/firedoor/glass,/obj/machinery/access_button{command = "cycle_exterior"; frequency = 1379; master_tag = "portmaint_airlock"; name = "exterior access button"; pixel_y = 32; req_access = null; req_one_access = list(13)},/obj/machinery/door/airlock/angled_bay/external/glass{dir = 4; frequency = 1379; id_tag = "portmaint_exterior"; locked = 1; name = "Exterior Airlock"},/turf/simulated/floor/tiled/steel_ridged,/area/maintenance/stellardelight/deck3/portcent) -"NR" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/double{name = "maintenance access"; stripe_color = "#454545"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"NS" = (/obj/machinery/atmospherics/unary/engine/fancy_shuttle{dir = 1},/turf/simulated/wall/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"NT" = (/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/obj/effect/floor_decal/steeldecal/steel_decals_central5{dir = 8},/turf/simulated/floor/tiled,/area/holodeck_control) -"NU" = (/obj/machinery/alarm/angled{dir = 4},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/aftstarroom) -"NW" = (/obj/structure/bed/chair/office/light{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"NX" = (/obj/machinery/door/firedoor/glass,/obj/machinery/access_button{command = "cycle_interior"; dir = 8; frequency = 1380; master_tag = "sd_starboard_landing"; pixel_y = 32; req_one_access = list(13)},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/obj/machinery/door/airlock/angled_bay/external/glass{dir = 4; frequency = 1380; id_tag = null; locked = 1; name = "Docking Port Airlock"},/obj/effect/map_helper/airlock/door/int_door,/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/starboarddock) -"NZ" = (/obj/item/weapon/bedsheet/mimedouble,/obj/structure/bed/double/padded,/obj/structure/curtain/black,/turf/simulated/floor/carpet/bcarpet,/area/stellardelight/deck3/clownmimeoffice) -"Oa" = (/obj/machinery/door/firedoor/glass,/obj/structure/sign/poster{dir = 8},/turf/simulated/floor,/area/stellardelight/deck2/fore) -"Ob" = (/obj/effect/floor_decal/techfloor/orange{dir = 10},/obj/machinery/light{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/transitgateway) -"Oc" = (/obj/structure/sign/warning/docking_area{pixel_x = 32},/turf/simulated/floor/reinforced/airless,/area/stellardelight/deck3/exterior) -"Od" = (/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/portcent) -"Oe" = (/obj/machinery/holoplant,/obj/machinery/atmospherics/unary/vent_pump/on{dir = 4},/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"Of" = (/obj/machinery/status_display{pixel_x = -32},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Og" = (/obj/machinery/recharge_station,/obj/structure/closet/emergsuit_wall{pixel_y = 29},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"Oj" = (/obj/machinery/telecomms/bus/preset_one,/turf/simulated/floor/tiled/dark{nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"Ol" = (/turf/simulated/wall/durasteel,/area/ai) -"Oo" = (/obj/machinery/alarm/angled{dir = 8},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportrooma) -"Op" = (/obj/machinery/power/pointdefense{id_tag = "sd_pd"},/obj/effect/floor_decal/industrial/warning/full,/obj/structure/cable/green{icon_state = "0-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"Oq" = (/obj/structure/bed/chair{dir = 4},/turf/simulated/floor/glass/reinforced,/area/stellardelight/deck3/aft) -"Or" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/hologram/holopad,/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"Ot" = (/obj/structure/bed/chair/office/dark{dir = 8},/obj/effect/landmark/start/rd,/turf/simulated/floor/carpet/purcarpet,/area/crew_quarters/heads/hor) -"Ou" = (/obj/item/device/radio/beacon,/obj/effect/floor_decal/steeldecal/steel_decals5,/obj/structure/cable{icon_state = "4-8"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Ov" = (/obj/machinery/light,/obj/machinery/atmospherics/unary/vent_pump/on{dir = 1},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_server_room) -"Ow" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/door/airlock/angled_bay/secure{dir = 4; name = "Telecoms Access"; req_one_access = list(16,17,61)},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor/tiled/steel_ridged,/area/ai_server_room) -"Ox" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/structure/cable/blue{icon_state = "2-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"Oy" = (/obj/machinery/light{dir = 1},/obj/machinery/door/window{req_one_access = list(25)},/turf/simulated/floor/lino,/area/stellardelight/deck3/cafe) -"Oz" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/stellardelight/deck3/cafe) -"OA" = (/obj/structure/cable{icon_state = "1-2"},/turf/simulated/wall/bay/r_wall/blue,/area/ai_cyborg_station) -"OC" = (/obj/machinery/atmospherics/pipe/simple/hidden,/obj/machinery/door/airlock/angled_bay/hatch{frequency = null; id_tag = null; locked = 1; name = "Telecoms Server Access"; req_access = list(61); stripe_color = "#ffd863"},/obj/machinery/door/firedoor/glass,/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/access_button{command = "cycle_interior"; frequency = 1380; master_tag = "tcommsairlock"; pixel_x = 32; req_one_access = list(61)},/obj/effect/map_helper/airlock/door/int_door,/turf/simulated/floor/tiled/steel_ridged,/area/tcommsat/computer) -"OD" = (/obj/structure/table/rack/steel,/obj/machinery/door/window/brigdoor/eastleft{dir = 1; name = "Protosuit Storage"; req_access = list(58)},/obj/structure/window/reinforced{dir = 4},/obj/structure/window/reinforced{dir = 8},/obj/item/clothing/mask/breath,/obj/item/weapon/tank/oxygen,/obj/item/device/suit_cooling_unit,/obj/item/clothing/shoes/magboots,/obj/item/clothing/suit/space/void/security/prototype,/obj/item/clothing/head/helmet/space/void/security/prototype,/obj/structure/window/reinforced,/turf/simulated/floor/tiled/dark,/area/crew_quarters/heads/hos) -"OE" = (/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 4},/turf/simulated/open,/area/stellardelight/deck2/starboard) -"OF" = (/obj/effect/landmark{name = "morphspawn"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportrooma) -"OG" = (/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 4},/obj/effect/mouse_hole_spawner{dir = 8},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"OI" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 8},/obj/structure/cable/blue{icon_state = "1-4"},/turf/simulated/floor,/area/stellardelight/deck2/starboard) -"OJ" = (/obj/structure/cable/blue{icon_state = "1-4"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"OK" = (/obj/structure/closet/lawcloset,/obj/structure/sign/poster{dir = 4},/obj/machinery/newscaster{pixel_y = 28},/turf/simulated/floor/tiled/dark,/area/lawoffice) -"OM" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/structure/table/rack/shelf,/obj/random/contraband,/obj/random/maintenance,/obj/random/maintenance/medical,/obj/random/maintenance/medical,/obj/random/maintenance/engineering,/obj/random/maintenance/security,/obj/random/maintenance/security,/obj/random/snack,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"ON" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden,/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/starboardcent) -"OP" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 6},/turf/simulated/open,/area/crew_quarters/bar) -"OQ" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/open,/area/crew_quarters/bar) -"OR" = (/obj/machinery/power/apc/angled{dir = 4; name = "night shift APC"; nightshift_setting = 2},/obj/structure/cable/blue{icon_state = "0-8"},/obj/structure/table/rack,/obj/random/maintenance,/obj/random/maintenance/engineering,/obj/random/maintenance/engineering,/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/forestarroomb) -"OS" = (/obj/machinery/computer/drone_control{dir = 4},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"OU" = (/turf/simulated/wall/bay/r_wall/steel,/area/stellardelight/deck3/cryo) -"OX" = (/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"OY" = (/obj/machinery/atmospherics/unary/vent_pump/on{dir = 8},/obj/effect/landmark/vines,/turf/simulated/open,/area/stellardelight/deck2/starboard) -"Pa" = (/obj/structure/lattice,/turf/simulated/open,/area/stellardelight/deck2/starboard) -"Pc" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/manifold/hidden/supply,/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 1},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/obj/machinery/hologram/holopad,/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Pd" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable/blue{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/door/airlock/angled_bay/hatch{dir = 4; name = "maintenance access"; stripe_color = "#454545"},/turf/simulated/floor/tiled/steel_ridged,/area/maintenance/stellardelight/deck3/starboardcent) -"Pe" = (/obj/machinery/keycard_auth{pixel_y = 28},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 10},/obj/machinery/alarm/angled{dir = 8},/turf/simulated/floor/tiled/dark,/area/crew_quarters/heads/hos) -"Pj" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/hologram/holopad,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_upload) -"Pl" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/glass{name = "Starstuff Cockpit"; req_one_access = list(67)},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/fore{base_turf = /turf/simulated/floor/reinforced/airless}) -"Pm" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor,/area/stellardelight/deck2/port) -"Po" = (/obj/structure/sign/nanotrasen{pixel_y = 30},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 10},/turf/simulated/floor/tiled/dark,/area/lawoffice) -"Pp" = (/obj/effect/landmark/start/clown,/turf/simulated/floor/carpet/gaycarpet,/area/stellardelight/deck3/clownmimeoffice) -"Pq" = (/obj/structure/bed/chair{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportrooma) -"Ps" = (/obj/machinery/space_heater,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarroomb) -"Px" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 9},/obj/machinery/computer/cryopod/gateway{pixel_x = 32},/turf/simulated/floor/tiled,/area/stellardelight/deck3/transitgateway) -"PA" = (/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 1},/obj/effect/floor_decal/steeldecal/steel_decals5,/obj/machinery/camera/network/halls{dir = 1},/obj/structure/cable{icon_state = "4-8"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"PB" = (/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/turf/simulated/wall/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"PC" = (/obj/machinery/alarm/angled{dir = 4},/obj/structure/cable/blue{icon_state = "2-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor/tiled/dark,/area/lawoffice) -"PD" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"PE" = (/obj/structure/sign/department/ai{pixel_y = 32},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 1},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"PJ" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/window/northleft{dir = 8; icon_state = "right"; name = "Reception Window"},/obj/machinery/door/window/brigdoor/eastright{name = "Head of Personnel's Desk"; req_access = list(57)},/obj/structure/cable/green{icon_state = "1-8"},/obj/machinery/door/blast/shutters{dir = 8; id = "hop_office_desk"; layer = 3.1; name = "HoP's Shutters"},/obj/structure/table/reinforced,/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"PL" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/manifold/hidden/supply,/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers,/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/commandhall) -"PR" = (/obj/structure/table/glass,/obj/item/device/flashlight/lamp/green{pixel_x = -4; pixel_y = 12},/obj/item/weapon/stamp/cmo,/obj/item/weapon/book/manual/sd_guide,/turf/simulated/floor/carpet/tealcarpet,/area/crew_quarters/heads/cmo) -"PT" = (/obj/effect/floor_decal/industrial/warning{dir = 8},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"PV" = (/obj/structure/cable/green{icon_state = "2-8"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportrooma) -"PW" = (/obj/effect/landmark{name = "JoinLateCyborg"},/obj/machinery/atmospherics/unary/vent_pump/on{dir = 1},/obj/effect/landmark/start/cyborg,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"PX" = (/obj/structure/closet/emcloset,/obj/structure/sign/painting/public{pixel_x = 30},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Qe" = (/obj/structure/cable{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/manifold/hidden{dir = 4},/obj/effect/overmap/visitable/ship/landable/sd_boat,/obj/effect/shuttle_landmark/shuttle_initializer/sdboat,/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/obj/machinery/atmospherics/pipe/simple/hidden/fuel{dir = 4},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"Qf" = (/obj/structure/bed/chair/office/dark{dir = 4},/obj/effect/landmark/start/ce,/turf/simulated/floor/carpet/oracarpet,/area/crew_quarters/heads/chief) -"Qh" = (/obj/machinery/atmospherics/pipe/simple/hidden/fuel{dir = 5},/turf/simulated/wall/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"Qi" = (/obj/structure/sign/painting/public{pixel_x = -30},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/wood,/area/stellardelight/deck3/cafe) -"Qm" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_server_room) -"Qn" = (/obj/structure/window/reinforced{dir = 8; pixel_x = -4},/turf/simulated/open,/area/stellardelight/deck3/aft) -"Qo" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/light_switch{pixel_y = 25},/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"Qp" = (/turf/simulated/wall/bay/r_wall/steel,/area/crew_quarters/bar) -"Qs" = (/obj/structure/cable/cyan{icon_state = "1-2"},/obj/machinery/light{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 10},/turf/simulated/floor/bluegrid,/area/ai) -"Qu" = (/obj/structure/sink/kitchen{pixel_y = 22},/obj/machinery/light{dir = 4},/obj/machinery/alarm/angled{dir = 4},/turf/simulated/floor/tiled/monotile,/area/holodeck_control) -"Qv" = (/obj/structure/table/rack,/obj/random/contraband,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance/cargo,/obj/random/maintenance/clean,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/aftstarroom) -"Qx" = (/obj/machinery/door/firedoor/glass/hidden/steel{dir = 1},/obj/effect/floor_decal/steeldecal/steel_decals5,/obj/structure/cable{icon_state = "4-8"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"QB" = (/obj/structure/railing/grey{dir = 8},/turf/simulated/open,/area/stellardelight/deck3/commandhall) -"QC" = (/obj/machinery/camera/network/telecom,/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"QE" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 9},/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/commandhall) -"QF" = (/obj/machinery/atmospherics/unary/vent_pump/on{dir = 4},/turf/simulated/open,/area/stellardelight/deck2/port) -"QG" = (/obj/structure/cable/blue{icon_state = "1-2"},/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"QI" = (/obj/item/device/radio/intercom{dir = 8; pixel_x = -24},/turf/simulated/floor/bluegrid,/area/ai_cyborg_station) -"QJ" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/external/glass{frequency = 1380; id_tag = null; locked = 1; name = "Docking Port Airlock"},/obj/effect/map_helper/airlock/door/ext_door,/obj/machinery/access_button{command = "cycle_exterior"; frequency = 1380; master_tag = "sd_escape_center_right"; pixel_x = 32; req_one_access = list(13)},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/aft) -"QK" = (/obj/structure/bed/chair/comfy/brown{dir = 8},/obj/machinery/alarm/angled{dir = 8},/turf/simulated/floor/carpet,/area/stellardelight/deck3/readingroom) -"QL" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"QP" = (/obj/structure/cable/blue{icon_state = "1-8"},/obj/structure/disposalpipe/segment{dir = 8; icon_state = "pipe-c"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/structure/cable/blue{icon_state = "1-4"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"QS" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/manifold4w/hidden,/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/portcent) -"QT" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/standard/glass{door_color = "#323d80"; name = "Command Offices"; req_access = null; req_one_access = list(19,38); stripe_color = "#f7d35c"},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/commandhall) -"QV" = (/obj/structure/cable/blue{icon_state = "2-8"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardfore) -"QW" = (/obj/structure/cable{icon_state = "2-8"},/turf/simulated/floor/carpet/gaycarpet,/area/stellardelight/deck3/clownmimeoffice) -"QZ" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"Rc" = (/obj/machinery/porta_turret/ai_defense,/obj/structure/cable/cyan{icon_state = "1-2"},/turf/simulated/floor/bluegrid,/area/ai) -"Rd" = (/obj/machinery/atmospherics/pipe/simple/hidden/black{dir = 6},/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"Rg" = (/obj/structure/lattice,/turf/simulated/open,/area/maintenance/stellardelight/deck3/forestarroomb) -"Rh" = (/obj/structure/cable/green{icon_state = "1-8"},/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/deck3/forestarrooma) -"Ri" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/random/trash_pile,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardfore) -"Rj" = (/obj/machinery/door/firedoor/glass,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/door/airlock/angled_bay/standard/glass{name = "maintenance access"},/obj/structure/cable/blue{icon_state = "1-2"},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck2/starboard) -"Rl" = (/obj/structure/disposalpipe/sortjunction/flipped{dir = 4; name = "Command Offices"; sortType = "Command Offices"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/effect/landmark{name = "lightsout"},/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/commandhall) -"Rn" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/low_wall/bay/reinforced/blue,/turf/simulated/floor,/area/crew_quarters/heads/hop) -"Ro" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable/green{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/door/airlock/angled_bay/standard/glass/common{dir = 4; name = "Long-Range Teleporter Access"},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/transitgateway) -"Rq" = (/obj/structure/cable{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"Ru" = (/obj/machinery/holoplant,/obj/machinery/camera/network/command{dir = 4},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_upload) -"Rv" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Rw" = (/obj/machinery/door/firedoor/glass/hidden/shuttle,/obj/structure/window/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/reinforced/airless,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"Rx" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/cable/green{icon_state = "2-4"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"Rz" = (/obj/structure/lattice,/obj/structure/disposalpipe/segment{dir = 8; icon_state = "pipe-c"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 9},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 9},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/open,/area/stellardelight/deck2/starboard) -"RE" = (/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/deck3/starboardfore) -"RG" = (/obj/machinery/light/small{dir = 4},/turf/simulated/open,/area/stellardelight/deck2/starboard) -"RH" = (/obj/effect/floor_decal/techfloor/orange{dir = 1},/obj/machinery/power/apc/angled{dir = 1},/obj/structure/cable/green{icon_state = "0-2"},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/transitgateway) -"RI" = (/turf/simulated/open,/area/stellardelight/deck3/aft) -"RK" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardfore) -"RL" = (/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/deck3/foreportroomb) -"RM" = (/obj/structure/cable/green{icon_state = "1-8"},/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 8},/obj/effect/mouse_hole_spawner{dir = 4},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"RN" = (/obj/structure/sign/directions/evac{pixel_x = 32},/obj/structure/closet/firecloset,/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"RQ" = (/obj/structure/table/standard,/obj/machinery/atmospherics/unary/vent_pump/on{dir = 1},/turf/simulated/floor/bluegrid,/area/ai_cyborg_station) -"RT" = (/obj/structure/cable{icon_state = "4-8"},/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/hatch{dir = 4; door_color = "#e6ab22"; name = "Shield Generator"; req_access = null; req_one_access = list(11,24); stripe_color = "#e6ab22"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck2/central) -"RW" = (/obj/machinery/portable_atmospherics/canister/air,/obj/machinery/atmospherics/portables_connector{dir = 1},/obj/machinery/door/window/southright{dir = 1; req_one_access = list(11,67)},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"RX" = (/turf/simulated/wall/bay/steel,/area/stellardelight/deck2/central) -"RY" = (/obj/structure/bed/chair/shuttle{dir = 1},/obj/machinery/light{dir = 8},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"RZ" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/structure/sign/warning/caution{desc = "This secure area is guarded by LETHAL LASER TURRETS. Authorized personnel ONLY."; name = "\improper WARNING: LETHAL TURRETS AHEAD"; pixel_x = -32},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_server_room) -"Sb" = (/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/forestarrooma) -"Se" = (/obj/effect/floor_decal/industrial/warning/corner,/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"Sf" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 9},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Sh" = (/obj/structure/closet/crate/bin{anchored = 1},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportrooma) -"Sk" = (/obj/structure/table/standard,/obj/item/weapon/phone{pixel_x = 3; pixel_y = 11},/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 8},/obj/machinery/alarm/angled{dir = 8},/turf/simulated/floor/bluegrid,/area/ai_cyborg_station) -"Sl" = (/obj/structure/sign/warning/evac{pixel_x = -32; pixel_y = -32},/obj/effect/floor_decal/steeldecal/steel_decals5,/obj/structure/cable{icon_state = "4-8"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Sm" = (/obj/structure/cable/blue{icon_state = "1-2"},/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"Sn" = (/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/obj/effect/floor_decal/steeldecal/steel_decals_central5{dir = 8},/obj/structure/cable{icon_state = "1-8"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"Sp" = (/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportrooma) -"Sw" = (/obj/machinery/alarm/angled{dir = 8},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"Sz" = (/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"SA" = (/obj/structure/table/darkglass,/obj/machinery/computer/skills{dir = 8; pixel_y = 6},/turf/simulated/floor/carpet/blue2,/area/lawoffice) -"SB" = (/obj/machinery/requests_console/preset/ce{pixel_x = -30},/turf/simulated/floor/carpet/oracarpet,/area/crew_quarters/heads/chief) -"SC" = (/obj/structure/sign/warning/docking_area{pixel_y = 32},/turf/simulated/floor/reinforced/airless,/area/stellardelight/deck3/exterior) -"SD" = (/obj/machinery/atmospherics/portables_connector{dir = 8},/obj/machinery/portable_atmospherics/canister/air/airlock,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"SE" = (/obj/machinery/newscaster{layer = 3.3; pixel_x = 27},/turf/simulated/floor/carpet/blue2,/area/lawoffice) -"SF" = (/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 1},/obj/item/device/radio/intercom{dir = 1; pixel_y = 24},/obj/machinery/vending/nifsoft_shop,/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"SJ" = (/obj/machinery/door/firedoor/glass/hidden/shuttle,/obj/structure/window/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/reinforced/airless,/area/shuttle/sdboat/fore{base_turf = /turf/simulated/floor/reinforced/airless}) -"SK" = (/obj/structure/lattice,/turf/space,/area/space) -"SL" = (/obj/machinery/recharge_station,/turf/simulated/floor/bluegrid,/area/ai_cyborg_station) -"SN" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/obj/effect/floor_decal/steeldecal/steel_decals4{dir = 5},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"SP" = (/obj/structure/table/glass,/obj/machinery/photocopier/faxmachine{department = "CMO's Office"},/turf/simulated/floor/tiled/eris/white/cargo,/area/crew_quarters/heads/cmo) -"SQ" = (/obj/machinery/disposal/wall{dir = 8},/obj/structure/disposalpipe/trunk{dir = 8},/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/commandhall) -"SR" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportrooma) -"ST" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"SU" = (/obj/structure/table/bench/padded,/obj/structure/sign/painting/public{pixel_y = -30},/turf/simulated/floor/wood,/area/stellardelight/deck3/cafe) -"SV" = (/obj/structure/cable/blue{icon_state = "4-8"},/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/starboardcent) -"SZ" = (/obj/machinery/power/apc/angled{dir = 4},/obj/structure/cable/blue{icon_state = "0-8"},/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"Ta" = (/obj/machinery/door/firedoor/glass,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/door/airlock/angled_bay/hatch{name = "maintenance access"; stripe_color = "#454545"},/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor/tiled/steel_ridged,/area/crew_quarters/bar) -"Tc" = (/obj/structure/bed/chair{dir = 8},/obj/structure/closet/emergsuit_wall{dir = 4; pixel_x = 27},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"Td" = (/obj/structure/table/rack/shelf,/obj/random/contraband,/obj/random/contraband,/obj/random/maintenance,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarroomb) -"Te" = (/obj/effect/landmark/map_data/stellar_delight,/turf/space,/area/space) -"Tf" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/double/glass{name = "glass airlock"},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/aft) -"Ti" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarrooma) -"Tj" = (/obj/structure/table/reinforced,/obj/machinery/button/remote/blast_door{desc = "A remote control-switch for shutters."; dir = 4; id = "hop_office_desk"; layer = 3.3; name = "Desk Privacy Shutter"; pixel_x = -4; pixel_y = 4},/obj/machinery/atmospherics/unary/vent_pump/on{dir = 1},/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"Tk" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/cable/blue{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/structure/low_wall/bay/reinforced/blue,/turf/simulated/floor,/area/crew_quarters/heads/hop) -"Tl" = (/obj/structure/bed/chair/office/dark{dir = 8},/obj/item/device/radio/intercom{dir = 1; name = "Station Intercom (General)"; pixel_y = 24},/obj/effect/landmark/start/hop,/turf/simulated/floor/carpet,/area/crew_quarters/heads/hop) -"Tm" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/commandhall) -"Tn" = (/obj/structure/cable/blue{icon_state = "1-2"},/turf/simulated/floor,/area/ai_cyborg_station) -"To" = (/obj/machinery/keycard_auth{pixel_y = 28},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 6},/obj/machinery/alarm/angled{dir = 4},/turf/simulated/floor/tiled/eris/white/cargo,/area/crew_quarters/heads/cmo) -"Tp" = (/obj/structure/table/glass,/obj/machinery/light,/turf/simulated/floor/tiled/eris/white/cargo,/area/crew_quarters/heads/cmo) -"Tr" = (/obj/machinery/drone_fabricator,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"Ts" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/obj/machinery/power/apc/angled{cell_type = /obj/item/weapon/cell/super; dir = 8; name = "night shift APC"; nightshift_setting = 2},/obj/structure/cable/blue,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"Tv" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/door/airlock/angled_bay/standard/color{dir = 4; door_color = "#9fccc7"; fill_color = "#333333"; id_tag = null; name = "Internal Affairs"; req_access = list(38); stripe_color = "#ffffff"},/turf/simulated/floor/tiled/steel_ridged,/area/lawoffice) -"Tx" = (/obj/machinery/light/small,/turf/simulated/open,/area/stellardelight/deck2/central) -"Ty" = (/obj/machinery/light/small{dir = 4},/turf/simulated/floor,/area/ai_cyborg_station) -"TA" = (/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/turf/simulated/wall/bay/r_wall/steel,/area/stellardelight/deck3/aft) -"TB" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 5},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"TE" = (/obj/machinery/power/pointdefense{id_tag = "sd_pd"},/obj/effect/floor_decal/industrial/warning/full,/obj/structure/cable/green{icon_state = "0-4"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"TF" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/commandhall) -"TI" = (/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"TJ" = (/obj/structure/sign/department/telecoms{pixel_y = 32},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 1},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"TK" = (/obj/structure/cable/cyan{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/bluegrid,/area/ai) -"TL" = (/turf/simulated/floor/bluegrid,/area/ai) -"TM" = (/obj/machinery/turretid/lethal{ailock = 1; control_area = /area/tcommsat/chamber; desc = "A firewall prevents AIs from interacting with this device."; name = "Telecoms lethal turret control"; pixel_y = 29; req_access = list(61); req_one_access = list()},/obj/effect/floor_decal/industrial/warning/corner{dir = 1},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_server_room) -"TO" = (/obj/machinery/atmospherics/unary/vent_pump/on,/obj/effect/landmark/vermin,/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/commandhall) -"TP" = (/obj/structure/cable/blue{icon_state = "4-8"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardfore) -"TS" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/structure/cable/blue{icon_state = "2-8"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarroomb) -"TV" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/structure/cable/blue{icon_state = "1-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"TW" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/manifold/hidden{dir = 8},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/obj/effect/floor_decal/steeldecal/steel_decals_central5{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"TY" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/light{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor/tiled/techfloor/grid,/area/ai_server_room) -"Ub" = (/obj/machinery/vending/boozeomat{req_access = null},/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/forestarroomb) -"Uc" = (/obj/structure/frame/computer,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportrooma) -"Ud" = (/obj/structure/table/reinforced,/obj/item/weapon/stamp/ce,/obj/item/weapon/book/manual/sd_guide,/turf/simulated/floor/carpet/oracarpet,/area/crew_quarters/heads/chief) -"Ue" = (/obj/structure/table/rack,/obj/random/contraband,/obj/random/maintenance,/obj/random/drinkbottle,/obj/random/maintenance/engineering,/obj/random/maintenance/engineering,/obj/random/mre,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarroomb) -"Uf" = (/obj/structure/cable/blue{icon_state = "2-8"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"Ug" = (/obj/structure/cable/blue{icon_state = "4-8"},/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/deck3/starboardcent) -"Uj" = (/obj/structure/cable/blue,/obj/structure/cable/blue{icon_state = "0-2"},/obj/machinery/power/smes/buildable{RCon_tag = "Substation - AI/Telecomms"; output_attempt = 0},/turf/simulated/floor,/area/ai_cyborg_station) -"Uk" = (/obj/machinery/computer/card,/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"Uq" = (/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportrooma) -"Uw" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/cable/green{icon_state = "2-4"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"Uy" = (/obj/machinery/atmospherics/unary/vent_pump/on,/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 1},/obj/machinery/station_map{pixel_y = 32},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"UA" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor,/area/stellardelight/deck2/fore) -"UB" = (/obj/structure/cable/blue{icon_state = "1-4"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 5},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/light_switch{dir = 8; pixel_x = 24; pixel_y = 24},/turf/simulated/floor/tiled/dark,/area/crew_quarters/heads/hos) -"UD" = (/obj/machinery/atmospherics/pipe/simple/hidden{dir = 9},/turf/simulated/wall/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"UF" = (/obj/machinery/light/small,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarroomb) -"UG" = (/obj/structure/cable/blue{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/structure/cable/blue{icon_state = "1-4"},/turf/simulated/floor/tiled/eris/dark/gray_platform,/area/stellardelight/deck3/commandhall) -"UH" = (/obj/structure/sign/painting/library_secure{pixel_x = -30},/turf/simulated/floor/carpet,/area/crew_quarters/heads/hos) -"UI" = (/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/obj/item/device/radio/intercom{dir = 4; pixel_x = 24},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"UK" = (/obj/machinery/camera/network/telecom{dir = 4},/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"UL" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/double{name = "maintenance access"; stripe_color = "#454545"},/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"UO" = (/obj/machinery/recharge_station,/obj/item/device/radio/intercom{dir = 8; pixel_x = -24},/turf/simulated/floor/bluegrid,/area/ai_upload) -"UQ" = (/obj/machinery/door/firedoor/glass,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"UR" = (/obj/effect/floor_decal/industrial/warning{dir = 1},/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/cable/green{icon_state = "2-8"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"US" = (/obj/structure/lattice,/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/open,/area/crew_quarters/bar) -"UT" = (/obj/structure/table/steel_reinforced,/obj/item/weapon/paper_bin{pixel_x = -3; pixel_y = 7},/obj/item/device/megaphone,/obj/item/weapon/pen/multi,/obj/item/device/radio/intercom/department/security{dir = 1; pixel_y = 24},/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 4},/turf/simulated/floor/tiled/dark,/area/crew_quarters/heads/hos) -"UU" = (/obj/machinery/alarm/angled{dir = 4},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardfore) -"UV" = (/obj/machinery/atmospherics/unary/vent_pump/on{dir = 4},/obj/structure/closet/emergsuit_wall{dir = 8; pixel_x = -27},/obj/effect/landmark/vines,/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"UX" = (/obj/machinery/light/small,/turf/simulated/open,/area/crew_quarters/bar) -"Va" = (/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/deck3/portfore) -"Vb" = (/obj/effect/floor_decal/corner_techfloor_grid{dir = 5},/obj/effect/floor_decal/corner_techfloor_grid{dir = 10},/obj/machinery/light/floortube{dir = 8; pixel_x = -3},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor/tiled/techfloor,/area/stellardelight/deck3/cryo) -"Vc" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 8},/obj/structure/cable{icon_state = "4-8"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"Ve" = (/obj/structure/cable/blue{icon_state = "1-4"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 5},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/light_switch{dir = 8; pixel_x = 24; pixel_y = 24},/turf/simulated/floor/tiled,/area/crew_quarters/heads/chief) -"Vg" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardfore) -"Vh" = (/obj/machinery/door/firedoor/glass/hidden/shuttle,/obj/machinery/door/blast/shuttle/open{id = "shuttleshutter"},/obj/structure/window/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/obj/machinery/atmospherics/pipe/simple/hidden/fuel{dir = 6},/turf/simulated/floor/reinforced/airless,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"Vi" = (/obj/structure/cable/green{icon_state = "2-8"},/obj/structure/closet/crate,/obj/random/contraband,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/obj/item/device/gps,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarrooma) -"Vk" = (/obj/structure/cable{icon_state = "4-8"},/obj/effect/landmark/start/mime,/turf/simulated/floor/carpet/bcarpet,/area/stellardelight/deck3/clownmimeoffice) -"Vm" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/open,/area/crew_quarters/bar) -"Vo" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/external/glass{dir = 4; frequency = 1380; id_tag = null; locked = 1; name = "Docking Port Airlock"},/obj/effect/map_helper/airlock/door/ext_door,/obj/machinery/access_button{command = "cycle_exterior"; dir = 8; frequency = 1380; master_tag = "sd_escape_starboard"; pixel_y = 32; req_one_access = list(13)},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/starboarddock) -"Vp" = (/obj/structure/lattice,/obj/machinery/light/small,/turf/simulated/open,/area/stellardelight/deck2/starboard) -"Vq" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 5},/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/commandhall) -"Vr" = (/obj/machinery/atmospherics/unary/vent_pump/on{dir = 1},/obj/structure/table/reinforced,/obj/item/weapon/paper_bin{pixel_x = -3; pixel_y = 7},/obj/item/weapon/folder/yellow_ce,/obj/item/weapon/pen/multi,/obj/machinery/atmospherics/unary/vent_pump/on{dir = 1},/turf/simulated/floor/tiled,/area/crew_quarters/heads/chief) -"Vs" = (/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"Vt" = (/obj/item/device/radio/intercom/locked/ai_private{dir = 4; pixel_x = 32},/turf/simulated/floor/tiled/techfloor,/area/ai_cyborg_station) -"Vw" = (/obj/structure/bed/chair/shuttle{dir = 1},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"Vx" = (/obj/structure/cable/blue{icon_state = "1-4"},/obj/effect/landmark{name = "maint_pred"},/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/forestarroomb) -"Vz" = (/obj/machinery/power/pointdefense{id_tag = "sd_pd"},/obj/effect/floor_decal/industrial/warning/full,/obj/structure/cable/green{icon_state = "0-8"},/obj/structure/cable/green{icon_state = "0-4"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"VB" = (/obj/item/weapon/bedsheet/double,/obj/structure/bed/double/padded,/obj/structure/curtain/black{color = "#156363"},/obj/effect/landmark/start/cmo,/turf/simulated/floor/carpet/tealcarpet,/area/crew_quarters/heads/cmo) -"VC" = (/turf/simulated/wall/bay/r_wall/blue,/area/ai_upload) -"VD" = (/obj/structure/table/steel,/obj/random/drinkbottle,/obj/machinery/chemical_dispenser/bar_alc/full,/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportroomb) -"VE" = (/obj/structure/table/glass,/obj/item/device/radio/intercom/department/medbay{dir = 1; pixel_y = 24},/obj/item/weapon/paper_bin{pixel_x = 3; pixel_y = 7},/obj/item/weapon/pen/multi,/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 8},/obj/item/weapon/folder/white_cmo,/turf/simulated/floor/tiled/eris/white/cargo,/area/crew_quarters/heads/cmo) -"VG" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 10},/obj/item/device/radio/intercom{dir = 4; pixel_x = 24},/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"VK" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/cable/green{icon_state = "1-4"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/alarm/angled{dir = 4},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"VM" = (/obj/machinery/power/pointdefense{id_tag = "sd_pd"},/obj/effect/floor_decal/industrial/warning/full,/obj/structure/cable/green,/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"VN" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/obj/effect/floor_decal/steeldecal/steel_decals4{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"VQ" = (/obj/machinery/door/firedoor/glass,/obj/machinery/door/airlock/angled_bay/secure{name = "Nuclear Fission Device Storage"; req_access = list(16)},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled/steel_ridged,/area/ai) -"VR" = (/obj/machinery/atmospherics/pipe/simple/hidden,/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/portcent) -"VS" = (/obj/machinery/atmospherics/pipe/simple/hidden{dir = 5},/turf/simulated/wall/bay/r_wall/steel,/area/stellardelight/deck3/aft) -"VW" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_server_room) -"VZ" = (/obj/structure/table/rack,/obj/random/maintenance,/obj/random/maintenance/clean,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/aftstarroom) -"Wa" = (/turf/simulated/floor/carpet,/area/crew_quarters/heads/hop) -"Wd" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/cable/green{icon_state = "1-4"},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"Wf" = (/obj/machinery/disposal/wall,/obj/structure/disposalpipe/trunk,/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 1},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Wg" = (/obj/structure/bed/chair/shuttle{dir = 1},/obj/structure/closet/emergsuit_wall{dir = 1; pixel_y = -32},/obj/item/device/radio/intercom{dir = 4; pixel_x = 24},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"Wi" = (/obj/structure/closet/secure_closet/personal,/turf/simulated/floor/bluegrid,/area/ai) -"Wj" = (/obj/machinery/computer/ship/helm/adv,/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/fore{base_turf = /turf/simulated/floor/reinforced/airless}) -"Wl" = (/obj/structure/sign/warning/falling{pixel_x = -32},/turf/simulated/open,/area/stellardelight/deck2/port) -"Wn" = (/obj/machinery/power/smes/buildable{charge = 500000},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/obj/structure/cable/green{icon_state = "0-4"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"Wp" = (/obj/machinery/atmospherics/unary/vent_pump/on,/turf/simulated/open,/area/stellardelight/deck2/central) -"Wq" = (/obj/structure/table/darkglass,/obj/machinery/computer/skills{dir = 4; pixel_y = 6},/turf/simulated/floor/carpet/blue2,/area/lawoffice) -"Wr" = (/obj/machinery/atmospherics/pipe/manifold/hidden{dir = 4},/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardaft) -"Ws" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/table/steel,/obj/item/weapon/flame/candle,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"Wt" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/effect/floor_decal/spline/plain,/obj/structure/table/bench/marble,/turf/simulated/floor/lino,/area/stellardelight/deck3/cafe) -"Wu" = (/obj/structure/sign/warning/docking_area{pixel_x = -32},/turf/simulated/floor/airless,/area/stellardelight/deck3/exterior) -"Ww" = (/obj/structure/handrail{dir = 4},/obj/effect/map_helper/airlock/atmos/pump_out_internal,/obj/machinery/light,/obj/machinery/atmospherics/unary/vent_pump/high_volume{frequency = 1380; id_tag = "sdboat_docker_pump_out_internal"},/obj/effect/floor_decal/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/turf/simulated/floor/tiled,/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"Wx" = (/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Wy" = (/obj/machinery/camera/network/engineering{dir = 1},/obj/machinery/atmospherics/unary/vent_pump/on{dir = 1},/obj/machinery/alarm/angled{dir = 4},/obj/structure/table/steel_reinforced,/obj/item/weapon/paper/sdshield,/turf/simulated/floor,/area/stellardelight/deck2/central) -"WA" = (/obj/structure/cable{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"WB" = (/obj/machinery/light/small{dir = 4},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardfore) -"WD" = (/obj/structure/table/woodentable,/turf/simulated/floor/wood,/area/stellardelight/deck3/cafe) -"WF" = (/obj/structure/table/steel,/obj/random/contraband,/obj/random/maintenance/security,/obj/random/maintenance/security,/obj/random/maintenance/security,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarrooma) -"WG" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 8},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 4},/turf/simulated/open,/area/stellardelight/deck2/starboard) -"WH" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 6},/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/commandhall) -"WI" = (/obj/structure/bed/chair{dir = 1},/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportrooma) -"WK" = (/turf/simulated/wall/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/area/shuttle/sdboat/fore{base_turf = /turf/simulated/floor/reinforced/airless}) -"WL" = (/obj/structure/closet/crate,/obj/random/contraband,/obj/random/maintenance/clean,/obj/random/maintenance/clean,/obj/random/maintenance/clean,/obj/random/maintenance/cargo,/obj/random/maintenance/cargo,/obj/random/drinksoft,/obj/random/drinksoft,/obj/random/mre,/obj/random/mre,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportrooma) -"WM" = (/obj/effect/landmark{name = "maint_pred"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportrooma) -"WN" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 9},/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/commandhall) -"WO" = (/turf/simulated/wall/bay/r_wall/blue,/area/lawoffice) -"WQ" = (/obj/machinery/power/apc/angled{cell_type = /obj/item/weapon/cell/super; dir = 4; name = "night shift APC"; nightshift_setting = 2},/obj/structure/cable/green{icon_state = "0-8"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"WU" = (/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/obj/effect/floor_decal/steeldecal/steel_decals4{dir = 5},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"WW" = (/obj/structure/bed/chair/office/dark{dir = 8},/obj/effect/landmark/start/iaa,/turf/simulated/floor/carpet/blue2,/area/lawoffice) -"WX" = (/obj/machinery/camera/network/command{dir = 10},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"WZ" = (/obj/machinery/atmospherics/unary/vent_pump/on,/obj/machinery/light/small{dir = 1},/obj/structure/flora/pottedplant/smalltree,/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Xa" = (/obj/item/device/radio/intercom{dir = 1; name = "Station Intercom (General)"; pixel_y = 24},/obj/structure/closet/secure_closet/CMO,/obj/item/clothing/accessory/stethoscope,/obj/item/device/flashlight/pen,/obj/item/weapon/storage/belt/medical,/obj/item/clothing/glasses/hud/health,/obj/item/device/defib_kit/compact/combat/loaded,/obj/item/weapon/cmo_disk_holder,/obj/item/weapon/storage/secure/briefcase/ml3m_pack_cmo,/obj/item/weapon/storage/mrebag/pill/sleevingcure,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/item/device/retail_scanner/medical,/turf/simulated/floor/tiled/eris/white/cargo,/area/crew_quarters/heads/cmo) -"Xb" = (/turf/simulated/floor/carpet/gaycarpet,/area/stellardelight/deck3/clownmimeoffice) -"Xc" = (/obj/structure/lattice,/obj/machinery/atmospherics/unary/vent_scrubber/on,/obj/structure/cable/green{icon_state = "1-2"},/obj/effect/landmark/vermin,/obj/effect/mouse_hole_spawner{dir = 8},/turf/simulated/open,/area/crew_quarters/bar) -"Xd" = (/obj/machinery/atmospherics/pipe/manifold4w/hidden,/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/starboardcent) -"Xe" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{dir = 8},/turf/simulated/open,/area/stellardelight/deck2/fore) -"Xf" = (/obj/machinery/atmospherics/unary/vent_pump/on,/turf/simulated/open,/area/stellardelight/deck2/port) -"Xi" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/floor/wood,/area/stellardelight/deck3/cafe) -"Xl" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportroomb) -"Xm" = (/obj/structure/table/alien{name = "fancy table"},/obj/item/device/radio/intercom{dir = 1; frequency = 1351; name = "station intercom (Science)"; pixel_y = 24},/obj/random/paicard{pixel_x = 4},/obj/item/weapon/paper_bin{pixel_x = 1; pixel_y = 9},/obj/item/weapon/paper/monitorkey,/obj/item/device/megaphone,/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 8},/obj/item/weapon/folder/white_rd,/turf/simulated/floor/tiled/techfloor,/area/crew_quarters/heads/hor) -"Xo" = (/obj/structure/cable/blue{icon_state = "1-4"},/obj/machinery/power/apc/angled{dir = 8},/obj/structure/cable/blue{icon_state = "0-4"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 5},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 5},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_server_room) -"Xr" = (/obj/structure/sign/warning/secure_area{pixel_y = 32},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"Xv" = (/obj/structure/frame,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportrooma) -"XA" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 10},/obj/machinery/atmospherics/pipe/manifold/hidden/supply,/turf/simulated/open,/area/stellardelight/deck2/central) -"XB" = (/turf/simulated/wall/bay/steel,/area/maintenance/stellardelight/substation/command) -"XC" = (/obj/machinery/atmospherics/unary/vent_pump/on{dir = 4},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"XD" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 5},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/obj/structure/sign/warning/evac{pixel_x = -32},/obj/effect/landmark{name = "lightsout"},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"XE" = (/obj/machinery/door/firedoor/glass,/obj/structure/cable/green{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/door/airlock/angled_bay/standard/glass/common{dir = 4; name = "Cryogenic Storage"},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/cryo) -"XF" = (/obj/structure/lattice,/obj/structure/cable{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/turf/simulated/open,/area/stellardelight/deck2/central) -"XG" = (/obj/structure/bed/chair{dir = 4},/turf/simulated/floor/carpet/tealcarpet,/area/crew_quarters/heads/cmo) -"XH" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 10},/obj/structure/cable/green{icon_state = "2-8"},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/open,/area/crew_quarters/bar) -"XI" = (/obj/structure/cable/green{icon_state = "1-8"},/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportroomb) -"XJ" = (/obj/machinery/power/apc/angled{dir = 8},/obj/structure/cable/blue,/turf/simulated/floor/tiled/dark,/area/lawoffice) -"XK" = (/turf/simulated/wall/bay/r_wall/blue,/area/ai_server_room) -"XO" = (/obj/machinery/computer/security,/obj/machinery/status_display{pixel_y = 32},/turf/simulated/floor/tiled/dark,/area/crew_quarters/heads/hos) -"XT" = (/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"XV" = (/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportroomb) -"XX" = (/obj/machinery/holoplant,/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 4},/turf/simulated/floor/tiled/techfloor/grid,/area/tcommsat/computer) -"XY" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/frame,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/foreportrooma) -"XZ" = (/obj/machinery/door/firedoor/glass,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 10},/obj/machinery/door/airlock/angled_bay/external/glass{frequency = 1380; id_tag = null; locked = 1; name = "Docking Port Airlock"},/obj/effect/map_helper/airlock/door/int_door,/obj/machinery/access_button{command = "cycle_interior"; dir = 1; frequency = 1380; master_tag = "sd_escape_center_left"; pixel_x = -32; req_one_access = list(13)},/turf/simulated/floor/tiled/steel_ridged,/area/stellardelight/deck3/aft) -"Yb" = (/obj/machinery/atmospherics/unary/vent_pump/high_volume{dir = 4; frequency = 1379; id_tag = "portmaint_airpump"},/obj/machinery/light/small{dir = 1},/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/portcent) -"Yc" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/manifold/hidden{dir = 1},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Yd" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"Yg" = (/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/deck3/portaft) -"Yj" = (/obj/structure/girder/displaced,/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/forestarroomb) -"Yk" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 9},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 9},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"Yl" = (/obj/structure/cable/green{icon_state = "2-8"},/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"Ym" = (/obj/machinery/atmospherics/pipe/manifold/hidden{dir = 1},/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/portcent) -"Yo" = (/obj/structure/bed/chair/office/dark{dir = 4},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/aftstarroom) -"Yp" = (/obj/machinery/button/remote/blast_door{desc = "A remote control-switch for shutters."; id = "cafe"; name = "Cafe Shutters"; pixel_y = 28; req_one_access = list(25)},/turf/simulated/floor/lino,/area/stellardelight/deck3/cafe) -"Ys" = (/obj/machinery/embedded_controller/radio/airlock/airlock_controller{dir = 4; id_tag = "starmaint_airlock"; pixel_x = -24; req_access = null; req_one_access = list(13); tag_airpump = "starmaint_airpump"; tag_chamber_sensor = "starmaint_sensor"; tag_exterior_door = "starmaint_exterior"; tag_interior_door = "starmaint_interior"},/turf/simulated/floor/airless,/area/maintenance/stellardelight/deck3/starboardcent) -"Yu" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/structure/closet/crate,/obj/random/contraband,/obj/random/maintenance/research,/obj/random/maintenance/research,/obj/random/maintenance/research,/obj/random/maintenance,/obj/random/maintenance,/obj/random/maintenance,/obj/random/mre,/obj/random/snack,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"Yv" = (/obj/machinery/light_switch{dir = 4; pixel_x = -25},/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"Yw" = (/obj/structure/lattice,/obj/structure/disposalpipe/segment{dir = 4; icon_state = "pipe-c"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 6},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 6},/turf/simulated/open,/area/stellardelight/deck2/port) -"Yx" = (/obj/structure/closet/emcloset,/obj/random/maintenance/cargo,/obj/random/maintenance/cargo,/obj/random/maintenance/clean,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/starboardcent) -"Yy" = (/obj/structure/lattice,/obj/structure/cable{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/open,/area/stellardelight/deck2/starboard) -"Yz" = (/turf/simulated/wall/bay/r_wall/steel,/area/maintenance/stellardelight/deck3/portcent) -"YA" = (/obj/effect/floor_decal/steeldecal/steel_decals4{dir = 9},/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"YB" = (/obj/structure/cable/blue{icon_state = "1-2"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarroomb) -"YC" = (/obj/item/device/radio/intercom{dir = 1; name = "Station Intercom (General)"; pixel_y = 24},/obj/structure/closet/secure_closet/RD,/obj/item/device/aicard,/obj/item/clothing/glasses/omnihud/rnd,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/item/device/retail_scanner/science,/turf/simulated/floor/tiled/techfloor,/area/crew_quarters/heads/hor) -"YD" = (/obj/structure/table/steel,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"YE" = (/obj/structure/table/standard,/obj/random/soap,/obj/machinery/power/apc/angled{dir = 1},/obj/structure/cable/green{icon_state = "0-4"},/obj/machinery/light{dir = 8},/turf/simulated/floor/tiled,/area/holodeck_control) -"YH" = (/obj/item/modular_computer/console/preset/command,/obj/structure/sign/poster{dir = 8},/obj/machinery/newscaster{pixel_y = 28},/turf/simulated/floor/tiled,/area/crew_quarters/heads/chief) -"YJ" = (/obj/structure/cable/green{icon_state = "2-4"},/obj/structure/cable/green{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 6},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 6},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"YK" = (/obj/structure/window/reinforced{dir = 4; pixel_x = 4},/turf/simulated/open,/area/stellardelight/deck3/aft) -"YL" = (/obj/structure/table/reinforced,/obj/item/weapon/paper_bin{pixel_x = -3; pixel_y = 7},/obj/item/weapon/folder/blue_hop,/obj/item/weapon/pen,/obj/machinery/light,/turf/simulated/floor/tiled,/area/crew_quarters/heads/hop) -"YN" = (/turf/simulated/wall/bay/r_wall/steel,/area/stellardelight/deck3/portdock) -"YO" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 1},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"YQ" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 10},/turf/simulated/floor/carpet/tealcarpet,/area/crew_quarters/heads/cmo) -"YR" = (/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 8},/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"YS" = (/obj/structure/table/steel,/obj/random/coin/sometimes,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/aftstarroom) -"YU" = (/obj/structure/lattice,/turf/simulated/open,/area/crew_quarters/bar) -"Zd" = (/turf/simulated/wall/fancy_shuttle{fancy_shuttle_tag = "sdboat"},/area/shuttle/sdboat/aft{base_turf = /turf/simulated/floor/reinforced/airless}) -"Ze" = (/turf/simulated/floor/bluegrid{name = "Mainframe Base"; nitrogen = 100; oxygen = 0; temperature = 80},/area/tcommsat/chamber) -"Zf" = (/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 8},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"Zi" = (/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 4},/obj/effect/floor_decal/steeldecal/steel_decals4{dir = 4},/obj/effect/floor_decal/shuttles/right,/obj/structure/cable{icon_state = "1-2"},/turf/simulated/floor/tiled,/area/stellardelight/deck3/portdock) -"Zj" = (/obj/structure/bed/chair,/obj/machinery/status_display{pixel_y = 32},/obj/effect/floor_decal/steeldecal/steel_decals5{dir = 1},/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"Zk" = (/obj/machinery/light/small{dir = 8},/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portfore) -"Zl" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/open,/area/stellardelight/deck2/port) -"Zm" = (/obj/structure/cable/blue{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/light_switch{dir = 4; pixel_x = -24; pixel_y = 29},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_cyborg_station) -"Zn" = (/obj/structure/bed/chair,/turf/simulated/floor/tiled/techfloor/grid,/area/maintenance/stellardelight/deck3/foreportrooma) -"Zp" = (/obj/machinery/light/small{dir = 4},/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portcent) -"Zt" = (/obj/structure/lattice,/obj/structure/cable{icon_state = "4-8"},/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{dir = 8},/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 4},/turf/simulated/open,/area/stellardelight/deck2/central) -"Zu" = (/obj/effect/floor_decal/spline/plain{dir = 6},/obj/structure/table/bench/marble,/turf/simulated/floor/lino,/area/stellardelight/deck3/cafe) -"Zw" = (/obj/machinery/porta_turret/ai_defense,/obj/machinery/atmospherics/pipe/simple/hidden/supply{dir = 9},/turf/simulated/floor/bluegrid,/area/ai) -"ZB" = (/obj/machinery/alarm/angled{dir = 4},/turf/simulated/floor,/area/maintenance/stellardelight/deck3/portaft) -"ZC" = (/obj/machinery/atmospherics/unary/vent_pump/on{dir = 8},/turf/simulated/open,/area/stellardelight/deck2/starboard) -"ZE" = (/obj/structure/cable/green{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/atmospherics/pipe/manifold/hidden/supply{dir = 1},/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/obj/machinery/hologram/holopad,/turf/simulated/floor/tiled,/area/stellardelight/deck3/aft) -"ZF" = (/obj/structure/bed/chair{dir = 8},/turf/simulated/floor/carpet/oracarpet,/area/crew_quarters/heads/chief) -"ZH" = (/obj/machinery/atmospherics/pipe/simple/hidden/supply,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 1},/obj/structure/cable/green{icon_state = "1-2"},/obj/machinery/hologram/holopad,/turf/simulated/floor/tiled,/area/stellardelight/deck3/starboarddock) -"ZK" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/machinery/atmospherics/pipe/simple/hidden/supply,/turf/simulated/floor/tiled/monotile,/area/stellardelight/deck3/commandhall) -"ZL" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/machinery/door/blast/angled/open{dir = 4; id = "readingroom3"},/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/stellardelight/deck3/readingroom) -"ZM" = (/obj/structure/lattice,/obj/machinery/atmospherics/pipe/simple/hidden{dir = 4},/obj/structure/cable/green{icon_state = "4-8"},/turf/simulated/open,/area/stellardelight/deck2/starboard) -"ZN" = (/obj/item/device/radio/intercom{dir = 4; pixel_x = 24},/turf/simulated/floor/tiled/techfloor/grid,/area/ai) -"ZQ" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/maintenance/stellardelight/deck3/forestarrooma) -"ZS" = (/obj/machinery/atmospherics/unary/vent_scrubber/on{dir = 8},/turf/simulated/open,/area/stellardelight/deck2/port) -"ZV" = (/obj/machinery/door/firedoor/glass,/obj/structure/window/bay/reinforced,/obj/machinery/door/blast/angled/open{dir = 4; id = "readingroom1"},/obj/structure/low_wall/bay/reinforced/steel,/turf/simulated/floor,/area/stellardelight/deck3/readingroom) -"ZX" = (/obj/machinery/light{dir = 8},/obj/machinery/atmospherics/unary/vent_pump/on{dir = 4},/turf/simulated/floor/tiled/techfloor/grid,/area/ai_upload) -"ZZ" = (/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers,/obj/structure/cable/green{icon_state = "1-2"},/turf/simulated/floor,/area/stellardelight/deck2/fore) +//MAP CONVERTED BY dmm2tgm.py THIS HEADER COMMENT PREVENTS RECONVERSION, DO NOT REMOVE +"aa" = ( +/obj/effect/landmark{ + name = "morphspawn" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/aftstarroom) +"ab" = ( +/obj/structure/railing/grey{ + dir = 8 + }, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/commandhall) +"ac" = ( +/obj/effect/landmark{ + name = "morphspawn" + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/forestarroomb) +"ad" = ( +/turf/simulated/wall/bay/r_wall/blue, +/area/tcommsat/chamber) +"ae" = ( +/obj/structure/railing/grey{ + dir = 4 + }, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/commandhall) +"af" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"ag" = ( +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/aft) +"ah" = ( +/obj/structure/sign/directions/stairs_down{ + pixel_x = 32; + pixel_y = 18 + }, +/obj/structure/sign/directions/medical{ + pixel_x = 32; + pixel_y = 12 + }, +/obj/structure/sign/directions/engineering{ + pixel_x = 32; + pixel_y = 6 + }, +/obj/structure/sign/directions/cargo{ + pixel_x = 32 + }, +/obj/structure/railing/grey{ + dir = 4 + }, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/aft) +"ai" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/stellardelight/deck3/portdock) +"aj" = ( +/obj/effect/landmark/free_ai_shell, +/turf/simulated/floor/carpet/turcarpet, +/area/ai) +"ak" = ( +/obj/structure/sign/directions/stairs_down{ + pixel_x = -32; + pixel_y = 18 + }, +/obj/structure/sign/directions/medical{ + pixel_x = -32; + pixel_y = 12 + }, +/obj/structure/sign/directions/engineering{ + pixel_x = -32; + pixel_y = 6 + }, +/obj/structure/sign/directions/cargo{ + pixel_x = -32 + }, +/obj/structure/railing/grey{ + dir = 8 + }, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/aft) +"al" = ( +/obj/machinery/power/terminal{ + dir = 8 + }, +/obj/structure/cable{ + icon_state = "0-4" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/substation/command) +"am" = ( +/obj/machinery/door/airlock/angled_bay/hatch{ + dir = 4; + name = "maintenance access"; + stripe_color = "#454545" + }, +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/maintenance/stellardelight/deck3/forestarrooma) +"an" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"ao" = ( +/obj/machinery/computer/HolodeckControl{ + dir = 4 + }, +/obj/item/device/radio/intercom{ + dir = 8; + pixel_x = -24 + }, +/turf/simulated/floor/tiled, +/area/holodeck_control) +"ap" = ( +/obj/machinery/vending/altevian, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarroomb) +"aq" = ( +/obj/structure/closet/walllocker_double/emergency_engi/south, +/turf/simulated/floor, +/area/stellardelight/deck2/fore) +"ar" = ( +/obj/structure/closet/walllocker_double/command/ce{ + dir = 4; + pixel_x = 32 + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/chief) +"as" = ( +/obj/structure/closet/walllocker_double/command/cmo{ + dir = 8; + pixel_x = -32 + }, +/turf/simulated/floor/tiled/eris/white/cargo, +/area/crew_quarters/heads/cmo) +"at" = ( +/obj/structure/table/darkglass, +/turf/simulated/floor/tiled/dark, +/area/lawoffice) +"au" = ( +/obj/item/weapon/book/manual/command_guide, +/obj/item/weapon/book/manual/standard_operating_procedure, +/obj/item/weapon/book/manual/security_space_law, +/obj/structure/closet/walllocker_double/command/hos{ + dir = 4; + pixel_x = 32 + }, +/turf/simulated/floor/tiled/dark, +/area/crew_quarters/heads/hos) +"av" = ( +/obj/item/device/taperecorder{ + pixel_x = -3 + }, +/obj/item/weapon/circuitboard/aicore{ + pixel_x = -2; + pixel_y = 4 + }, +/obj/item/weapon/circuitboard/teleporter, +/obj/structure/closet/walllocker_double/command/rd{ + dir = 8; + pixel_x = -32 + }, +/turf/simulated/floor/tiled/techfloor, +/area/crew_quarters/heads/hor) +"aw" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/aftstarroom) +"ax" = ( +/obj/item/weapon/book/manual/command_guide, +/obj/item/weapon/book/manual/command_guide, +/obj/item/weapon/book/manual/standard_operating_procedure, +/obj/item/weapon/book/manual/standard_operating_procedure, +/obj/item/weapon/book/manual/security_space_law, +/obj/item/weapon/book/manual/security_space_law, +/obj/structure/closet/walllocker_double/command/iaa{ + dir = 4; + pixel_x = 32 + }, +/turf/simulated/floor/tiled/dark, +/area/lawoffice) +"ay" = ( +/obj/item/weapon/book/manual/command_guide, +/obj/item/weapon/book/manual/command_guide, +/obj/item/weapon/book/manual/standard_operating_procedure, +/obj/item/weapon/book/manual/standard_operating_procedure, +/obj/item/weapon/book/manual/security_space_law, +/obj/item/weapon/book/manual/security_space_law, +/obj/structure/closet/walllocker_double/command/iaa{ + dir = 8; + pixel_x = -32 + }, +/turf/simulated/floor/tiled/dark, +/area/lawoffice) +"az" = ( +/obj/item/device/megaphone, +/obj/item/weapon/book/manual/standard_operating_procedure, +/obj/item/weapon/book/manual/command_guide, +/obj/structure/table/reinforced, +/obj/item/weapon/folder/red, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 + }, +/obj/structure/closet/walllocker_double/command/north, +/turf/simulated/floor/carpet, +/area/crew_quarters/heads/hop) +"aA" = ( +/turf/simulated/wall/bay/r_wall/steel, +/area/stellardelight/deck3/transitgateway) +"aB" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"aC" = ( +/obj/structure/lattice, +/obj/structure/closet/walllocker_double/emergency_engi/east, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"aD" = ( +/obj/structure/table/steel, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarrooma) +"aE" = ( +/obj/structure/lattice, +/obj/structure/closet/walllocker_double/emergency_engi/south, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"aF" = ( +/obj/structure/lattice, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/structure/closet/walllocker_double/emergency_engi/south, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"aG" = ( +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"aH" = ( +/obj/machinery/account_database{ + dir = 8 + }, +/obj/structure/sign/painting/library_secure{ + pixel_x = 30 + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"aJ" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/stellardelight/deck2/starboard) +"aK" = ( +/obj/structure/cable/blue{ + icon_state = "1-4" + }, +/obj/machinery/camera/network/command{ + dir = 10 + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"aM" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 10 + }, +/turf/simulated/floor, +/area/stellardelight/deck2/central) +"aN" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 4 + }, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"aP" = ( +/obj/structure/bed/chair/shuttle{ + dir = 1 + }, +/obj/structure/closet/emergsuit_wall{ + dir = 1; + pixel_y = -32 + }, +/obj/machinery/alarm{ + dir = 4; + pixel_x = -28 + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"aQ" = ( +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"aS" = ( +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarrooma) +"aX" = ( +/obj/structure/sign/deck3{ + pixel_x = 32 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"ba" = ( +/obj/machinery/atmospherics/unary/vent_pump/on, +/obj/effect/landmark/vines, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"bb" = ( +/obj/effect/floor_decal/techfloor/orange{ + dir = 8 + }, +/obj/machinery/atmospherics/unary/vent_pump/on, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/transitgateway) +"bd" = ( +/obj/structure/closet, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"be" = ( +/obj/machinery/door/firedoor/glass/hidden/shuttle, +/obj/machinery/door/blast/shuttle/open{ + dir = 4; + id = "shuttleshutter" + }, +/obj/structure/window/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/reinforced/airless, +/area/shuttle/sdboat/fore{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"bg" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/door/airlock/angled_bay/standard/color{ + dir = 4; + door_color = "#323d80"; + fill_color = "#313866"; + id_tag = "hopdoor"; + name = "Head of Personnel"; + req_access = list(57); + stripe_color = "#a3d1d1" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/crew_quarters/heads/hop) +"bh" = ( +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/hatch{ + dir = 4; + door_color = "#e6ab22"; + name = "Command Substation"; + req_one_access = list(10); + stripe_color = "#e6ab22" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/maintenance/stellardelight/deck3/starboardfore) +"bj" = ( +/obj/structure/flora/pottedplant/stoutbush, +/turf/simulated/floor/tiled/dark, +/area/lawoffice) +"bl" = ( +/obj/structure/lattice, +/obj/structure/cable/green{ + icon_state = "32-2" + }, +/obj/machinery/door/firedoor/glass, +/turf/simulated/open, +/area/maintenance/stellardelight/deck3/portcent) +"bm" = ( +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/structure/cable{ + icon_state = "1-4" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/substation/command) +"bn" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 1 + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"bp" = ( +/obj/effect/floor_decal/industrial/warning{ + dir = 4 + }, +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"br" = ( +/obj/structure/lattice, +/obj/structure/cable{ + icon_state = "32-2" + }, +/obj/structure/disposalpipe/down, +/obj/machinery/door/firedoor/glass, +/turf/simulated/open, +/area/maintenance/stellardelight/deck3/starboardcent) +"bs" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 9 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"bx" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/carpet/purcarpet, +/area/crew_quarters/heads/hor) +"by" = ( +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/deck3/starboardaft) +"bB" = ( +/obj/structure/cable{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"bC" = ( +/obj/structure/closet/crate, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance/medical, +/obj/random/maintenance/medical, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"bE" = ( +/turf/simulated/floor/glass/reinforced, +/area/stellardelight/deck3/commandhall) +"bI" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 1 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 1 + }, +/obj/structure/cable/blue{ + icon_state = "2-4" + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"bJ" = ( +/obj/structure/table/steel, +/obj/item/weapon/flame/candle, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/forestarrooma) +"bK" = ( +/obj/machinery/camera/network/command, +/turf/simulated/floor/bluegrid, +/area/ai) +"bL" = ( +/obj/machinery/media/jukebox/hacked, +/obj/machinery/status_display{ + pixel_y = 32 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"bM" = ( +/obj/effect/floor_decal/emblem/nt1, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_upload) +"bO" = ( +/obj/structure/table/darkglass, +/obj/item/weapon/clipboard, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 1 + }, +/turf/simulated/floor/tiled/dark, +/area/lawoffice) +"bP" = ( +/obj/machinery/atmospherics/pipe/manifold/hidden, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"bQ" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 1 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"bS" = ( +/obj/structure/cable{ + icon_state = "2-4" + }, +/obj/structure/disposalpipe/segment{ + dir = 4; + icon_state = "pipe-c" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 6 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 6 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"bT" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor, +/area/stellardelight/deck2/central) +"bU" = ( +/turf/simulated/wall/bay{ + desc = "It has a blue stripe! A huge chunk of metal used to seperate rooms."; + stripe_color = "#2e2aa1" + }, +/area/stellardelight/deck3/commandhall) +"bV" = ( +/obj/machinery/alarm/angled, +/turf/simulated/open, +/area/crew_quarters/bar) +"bW" = ( +/obj/structure/table/standard, +/obj/item/toy/plushie/ipc/toaster, +/obj/machinery/atmospherics/unary/vent_pump/on, +/turf/simulated/floor/bluegrid, +/area/ai_cyborg_station) +"bY" = ( +/obj/structure/table/woodentable, +/obj/machinery/door/blast/shutters{ + dir = 4; + id = "cafe"; + layer = 3.1; + name = "Cafe Shutters" + }, +/turf/simulated/floor/lino, +/area/stellardelight/deck3/cafe) +"bZ" = ( +/obj/machinery/ntnet_relay, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"ca" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 1 + }, +/obj/effect/landmark/vines, +/turf/simulated/open, +/area/crew_quarters/bar) +"cb" = ( +/turf/simulated/wall/bay/r_wall/blue, +/area/crew_quarters/heads/chief) +"cc" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 6 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"ch" = ( +/obj/machinery/vending/wardrobe/mimedrobe, +/turf/simulated/floor/carpet/bcarpet, +/area/stellardelight/deck3/clownmimeoffice) +"ci" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/door/airlock/angled_bay/secure{ + dir = 4; + name = "Robotic Storage"; + req_access = list(16) + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/ai_cyborg_station) +"ck" = ( +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 2; + icon_state = "pipe-c" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 10 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 10 + }, +/obj/structure/sign/painting/public{ + pixel_y = 30 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"cm" = ( +/obj/machinery/exonet_node{ + anchored = 1 + }, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"cn" = ( +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"cp" = ( +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/obj/machinery/light/small, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"cq" = ( +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"cs" = ( +/obj/structure/bed/chair{ + dir = 8 + }, +/turf/simulated/floor/glass/reinforced, +/area/stellardelight/deck3/aft) +"ct" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/door/airlock/angled_bay/secure{ + dir = 4; + name = "AI Storage"; + req_access = list(16) + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/ai_cyborg_station) +"cu" = ( +/obj/structure/sign/directions/evac{ + pixel_x = -32 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/obj/structure/flora/pottedplant/smalltree, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"cw" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_upload) +"cx" = ( +/obj/machinery/computer/timeclock/premade/north, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"cy" = ( +/obj/machinery/recharge_station, +/obj/structure/closet/emergsuit_wall{ + pixel_y = 29 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"cz" = ( +/obj/structure/cable{ + icon_state = "1-8" + }, +/turf/simulated/wall/bay/r_wall/blue, +/area/ai_cyborg_station) +"cA" = ( +/obj/structure/bed/chair{ + dir = 8 + }, +/obj/machinery/light, +/turf/simulated/floor/glass/reinforced, +/area/stellardelight/deck3/aft) +"cH" = ( +/obj/machinery/power/apc/angled{ + dir = 8; + name = "night shift APC"; + nightshift_setting = 2 + }, +/obj/structure/cable/green{ + icon_state = "0-4" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportroomb) +"cI" = ( +/obj/effect/floor_decal/techfloor{ + dir = 8 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/cryo) +"cK" = ( +/obj/structure/cable/green{ + icon_state = "2-4" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"cL" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/structure/cable/blue{ + icon_state = "2-4" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardfore) +"cO" = ( +/obj/machinery/holoplant, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 + }, +/obj/machinery/status_display{ + pixel_x = 32 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"cP" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"cS" = ( +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 8 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"cW" = ( +/obj/machinery/atmospherics/unary/vent_pump{ + external_pressure_bound = 140; + external_pressure_bound_default = 140; + icon_state = "map_vent_out"; + pressure_checks = 0; + pressure_checks_default = 0; + use_power = 1 + }, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"cY" = ( +/obj/machinery/telecomms/broadcaster/preset_right/sd, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"cZ" = ( +/obj/machinery/light/small{ + dir = 8 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportrooma) +"db" = ( +/obj/structure/lattice, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 4 + }, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"df" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"dh" = ( +/obj/effect/floor_decal/industrial/warning/corner{ + dir = 8 + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"dj" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 1 + }, +/obj/effect/floor_decal/steeldecal/steel_decals_central5{ + dir = 1; + pixel_y = 1 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"dk" = ( +/obj/machinery/atmospherics/unary/vent_pump/high_volume{ + dir = 4; + frequency = 1379; + id_tag = "starmaint_airpump" + }, +/obj/machinery/camera/network/civilian, +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/starboardcent) +"dn" = ( +/obj/item/device/radio/intercom{ + dir = 8; + pixel_x = -24 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_server_room) +"do" = ( +/obj/machinery/papershredder, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"dr" = ( +/obj/machinery/light{ + dir = 4 + }, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"du" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/hatch{ + dir = 4; + name = "maintenance access"; + stripe_color = "#454545" + }, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/maintenance/stellardelight/deck3/forestarrooma) +"dw" = ( +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"dx" = ( +/turf/simulated/wall/bay/steel, +/area/maintenance/stellardelight/deck3/forestarroomb) +"dy" = ( +/obj/effect/floor_decal/industrial/warning, +/obj/structure/cable/blue{ + icon_state = "2-8" + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold4w/hidden/supply, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"dB" = ( +/obj/effect/floor_decal/industrial/warning/corner{ + dir = 4 + }, +/obj/structure/cable/green{ + icon_state = "1-4" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"dD" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 6 + }, +/turf/simulated/floor/carpet, +/area/crew_quarters/heads/hos) +"dE" = ( +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"dF" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/effect/floor_decal/emblem/nt1, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"dH" = ( +/obj/structure/table/steel_reinforced, +/obj/machinery/recharger{ + pixel_y = 4 + }, +/obj/machinery/light, +/turf/simulated/floor/tiled/dark, +/area/crew_quarters/heads/hos) +"dL" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/table/steel, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportroomb) +"dM" = ( +/obj/structure/closet/firecloset, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"dN" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/door/airlock/angled_bay/hatch{ + name = "maintenance access"; + stripe_color = "#454545" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/crew_quarters/bar) +"dQ" = ( +/obj/machinery/door/firedoor/glass/hidden/shuttle, +/obj/machinery/door/blast/shuttle/open{ + id = "shuttleshutter" + }, +/obj/structure/window/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/reinforced/airless, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"dS" = ( +/obj/machinery/camera/network/command{ + dir = 4 + }, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 4 + }, +/turf/simulated/floor/carpet/turcarpet, +/area/ai) +"dT" = ( +/obj/machinery/light/small{ + dir = 8 + }, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"dU" = ( +/turf/simulated/wall/bay/blue, +/area/lawoffice) +"dV" = ( +/obj/effect/floor_decal/industrial/warning/corner{ + dir = 8 + }, +/obj/machinery/holoplant, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 8 + }, +/obj/machinery/light_switch{ + dir = 8; + pixel_x = 24 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"dY" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/carpet, +/area/crew_quarters/heads/hos) +"dZ" = ( +/obj/machinery/light_switch{ + dir = 8; + pixel_x = 24; + pixel_y = 24 + }, +/turf/simulated/floor/tiled/dark, +/area/lawoffice) +"ea" = ( +/obj/structure/table/bench/padded, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/cafe) +"eb" = ( +/obj/machinery/atmospherics/unary/vent_pump/high_volume{ + dir = 4; + frequency = 1379; + id_tag = "starmaint_airpump" + }, +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/starboardcent) +"ed" = ( +/obj/structure/closet, +/obj/random/firstaid, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"eg" = ( +/obj/machinery/porta_turret/ai_defense, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/turf/simulated/floor/bluegrid, +/area/ai) +"eh" = ( +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 8 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"ei" = ( +/obj/machinery/light{ + dir = 4 + }, +/turf/simulated/floor/tiled/steel_grid, +/area/stellardelight/deck3/aft) +"ej" = ( +/obj/effect/floor_decal/techfloor/orange{ + dir = 1 + }, +/obj/structure/closet/emergsuit_wall{ + pixel_y = 29 + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/transitgateway) +"ek" = ( +/obj/machinery/camera/network/halls{ + dir = 8 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 + }, +/obj/structure/cable{ + icon_state = "1-8" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"el" = ( +/obj/machinery/pda_multicaster/prebuilt, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"em" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarrooma) +"en" = ( +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"eo" = ( +/obj/machinery/power/apc/angled{ + dir = 4 + }, +/obj/structure/cable/blue{ + icon_state = "0-2" + }, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"ep" = ( +/obj/structure/cable{ + icon_state = "2-4" + }, +/turf/simulated/floor, +/area/ai_cyborg_station) +"et" = ( +/obj/effect/floor_decal/industrial/warning{ + dir = 8 + }, +/obj/machinery/light/small, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/portdock) +"eu" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/bluegrid, +/area/ai) +"ev" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/door/airlock/angled_bay/standard/color{ + dir = 4; + door_color = "#323d80"; + fill_color = "#313866"; + id_tag = "rddoor"; + name = "Research Director"; + req_access = list(30); + stripe_color = "#5a19a8" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/crew_quarters/heads/hor) +"ew" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"ex" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/light{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"ey" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportroomb) +"ez" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/double{ + name = "maintenance access"; + stripe_color = "#454545" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardfore) +"eC" = ( +/obj/machinery/telecomms/receiver/preset_right/sd, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"eD" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 5 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 5 + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"eE" = ( +/obj/machinery/alarm/angled{ + dir = 4 + }, +/obj/structure/table/rack, +/obj/random/maintenance, +/obj/random/drinkbottle, +/obj/random/snack, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarroomb) +"eF" = ( +/obj/structure/table/rack, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance/clean, +/obj/random/maintenance/clean, +/obj/random/maintenance/engineering, +/obj/random/maintenance/medical, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"eI" = ( +/obj/structure/cable/green{ + icon_state = "1-4" + }, +/turf/simulated/wall/bay/r_wall/steel, +/area/crew_quarters/bar) +"eJ" = ( +/turf/simulated/wall/fancy_shuttle/nondense{ + fancy_shuttle_tag = "sdboat" + }, +/area/shuttle/sdboat/fore{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"eK" = ( +/obj/machinery/atmospherics/unary/vent_pump{ + external_pressure_bound = 0; + external_pressure_bound_default = 0; + icon_state = "map_vent_in"; + initialize_directions = 1; + internal_pressure_bound = 4000; + internal_pressure_bound_default = 4000; + pressure_checks = 2; + pressure_checks_default = 2; + pump_direction = 0; + use_power = 1 + }, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"eL" = ( +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 4 + }, +/obj/machinery/camera/network/command{ + dir = 4 + }, +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"eN" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"eP" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/standard/color/common{ + dir = 4; + name = "Holodeck" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/holodeck_control) +"eQ" = ( +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 1 + }, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"eR" = ( +/obj/structure/table/steel, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/forestarrooma) +"eS" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"eU" = ( +/obj/structure/table/woodentable, +/obj/machinery/door/blast/shutters{ + dir = 2; + id = "cafe"; + layer = 3.1; + name = "Cafe Shutters" + }, +/turf/simulated/floor/lino, +/area/stellardelight/deck3/cafe) +"eV" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 8 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/open, +/area/crew_quarters/bar) +"eX" = ( +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"eY" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"fa" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/carpet/oracarpet, +/area/crew_quarters/heads/chief) +"fb" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_server_room) +"fd" = ( +/obj/item/weapon/reagent_containers/food/drinks/cup{ + pixel_x = 8; + pixel_y = 8 + }, +/obj/item/weapon/reagent_containers/food/drinks/cup{ + pixel_x = -4; + pixel_y = 8 + }, +/obj/item/weapon/reagent_containers/food/drinks/cup{ + pixel_x = 8; + pixel_y = -4 + }, +/obj/item/weapon/reagent_containers/food/drinks/cup{ + pixel_x = -4; + pixel_y = -4 + }, +/obj/item/weapon/reagent_containers/food/drinks/cup{ + pixel_x = 8 + }, +/obj/item/weapon/reagent_containers/food/drinks/cup{ + pixel_x = -4 + }, +/obj/item/weapon/reagent_containers/food/drinks/cup{ + pixel_x = 8; + pixel_y = 12 + }, +/obj/item/weapon/reagent_containers/food/drinks/cup{ + pixel_x = -4; + pixel_y = 12 + }, +/obj/structure/table/woodentable, +/obj/item/weapon/hand_labeler, +/obj/machinery/alarm/angled, +/obj/machinery/status_display{ + pixel_x = -32 + }, +/turf/simulated/floor/lino, +/area/stellardelight/deck3/cafe) +"ff" = ( +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/hatch{ + dir = 4; + name = "maintenance access"; + stripe_color = "#454545" + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/maintenance/stellardelight/deck3/starboardaft) +"fg" = ( +/obj/structure/handrail{ + dir = 1 + }, +/obj/machinery/alarm{ + dir = 1; + pixel_y = -28 + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"fh" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportroomb) +"fj" = ( +/obj/structure/table/woodentable, +/obj/item/toy/figure/clown, +/obj/item/weapon/pen/crayon/marker/rainbow, +/obj/item/weapon/pen/crayon/rainbow, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 4 + }, +/turf/simulated/floor/carpet/gaycarpet, +/area/stellardelight/deck3/clownmimeoffice) +"fk" = ( +/obj/machinery/telecomms/server/presets/common, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"fs" = ( +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/turf/simulated/wall/bay/r_wall/steel, +/area/crew_quarters/bar) +"fv" = ( +/obj/machinery/holoplant, +/obj/machinery/power/apc/angled{ + dir = 4 + }, +/obj/structure/cable/blue{ + icon_state = "0-8" + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_upload) +"fz" = ( +/obj/effect/floor_decal/techfloor/orange, +/obj/effect/landmark{ + name = "JoinLateGateway" + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/transitgateway) +"fD" = ( +/obj/structure/table/rack, +/obj/random/maintenance, +/obj/random/maintenance/engineering, +/obj/random/maintenance/engineering, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarroomb) +"fE" = ( +/obj/structure/lattice, +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 1 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"fG" = ( +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 9 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 9 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden{ + dir = 1 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"fM" = ( +/obj/machinery/power/terminal{ + dir = 8 + }, +/obj/structure/cable, +/turf/simulated/floor, +/area/ai_cyborg_station) +"fO" = ( +/obj/structure/cable/blue{ + icon_state = "2-4" + }, +/obj/machinery/light{ + dir = 1 + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"fP" = ( +/obj/machinery/space_heater, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"fS" = ( +/turf/simulated/wall/bay/steel, +/area/crew_quarters/heads/hop) +"fT" = ( +/obj/machinery/light_switch{ + dir = 4; + pixel_x = -24; + pixel_y = 24 + }, +/turf/simulated/floor/tiled/dark, +/area/lawoffice) +"fW" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"gb" = ( +/obj/structure/table/steel_reinforced, +/obj/item/weapon/folder/red_hos, +/turf/simulated/floor/carpet, +/area/crew_quarters/heads/hos) +"gc" = ( +/obj/machinery/atmospherics/unary/vent_pump/high_volume{ + dir = 4; + frequency = 1379; + id_tag = "portmaint_airpump" + }, +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/portcent) +"gg" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 + }, +/obj/effect/mouse_hole_spawner{ + dir = 4 + }, +/turf/simulated/open, +/area/crew_quarters/bar) +"gh" = ( +/obj/machinery/telecomms/server/presets/command, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"gi" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/fuel, +/turf/simulated/wall/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"gj" = ( +/obj/structure/table/rack/shelf, +/obj/item/weapon/disk/nifsoft/compliance, +/obj/random/contraband, +/obj/random/contraband, +/obj/random/contraband, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/snack, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportroomb) +"gk" = ( +/obj/structure/table/woodentable, +/obj/random/paicard, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/cafe) +"gl" = ( +/obj/structure/bed/chair/shuttle{ + dir = 1 + }, +/obj/structure/closet/emergsuit_wall{ + pixel_y = 32 + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"gm" = ( +/obj/structure/lattice, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"gq" = ( +/obj/effect/floor_decal/spline/plain{ + dir = 4 + }, +/obj/structure/closet/hydrant{ + pixel_y = 28 + }, +/turf/simulated/floor/lino, +/area/stellardelight/deck3/cafe) +"gs" = ( +/obj/machinery/requests_console/preset/rd{ + pixel_x = 30 + }, +/turf/simulated/floor/carpet/purcarpet, +/area/crew_quarters/heads/hor) +"gw" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/cable/green{ + icon_state = "1-4" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"gy" = ( +/obj/structure/closet/secure_closet/engineering_chief, +/obj/item/device/radio/intercom{ + dir = 1; + name = "Station Intercom (General)"; + pixel_y = 24 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/item/device/retail_scanner/engineering, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/chief) +"gA" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/structure/cable/green{ + icon_state = "1-4" + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"gB" = ( +/obj/machinery/power/pointdefense{ + id_tag = "sd_pd" + }, +/obj/effect/floor_decal/industrial/warning/full, +/obj/structure/cable/green{ + icon_state = "0-4" + }, +/obj/structure/cable/green{ + icon_state = "0-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"gE" = ( +/obj/structure/table/darkglass, +/obj/item/weapon/stamp/denied{ + pixel_x = 6; + pixel_y = 6 + }, +/obj/item/weapon/stamp/internalaffairs, +/turf/simulated/floor/carpet/blue2, +/area/lawoffice) +"gG" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"gH" = ( +/turf/simulated/floor, +/area/ai_cyborg_station) +"gJ" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/obj/structure/cable/green{ + icon_state = "2-4" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"gL" = ( +/obj/item/weapon/bedsheet/hosdouble, +/obj/structure/bed/double/padded, +/obj/structure/curtain/black{ + color = "#631915" + }, +/obj/effect/landmark/start/hos, +/turf/simulated/floor/carpet, +/area/crew_quarters/heads/hos) +"gM" = ( +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/turf/simulated/wall/bay/r_wall/steel, +/area/stellardelight/deck3/aft) +"gN" = ( +/obj/structure/cable/blue{ + icon_state = "2-8" + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 1 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 1 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"gO" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"gQ" = ( +/obj/machinery/power/smes/buildable{ + charge = 5e+006; + input_attempt = 1; + input_level = 200000; + output_level = 200000 + }, +/obj/structure/window/reinforced{ + dir = 1 + }, +/obj/structure/window/reinforced{ + dir = 4 + }, +/obj/structure/cable/cyan{ + icon_state = "0-4" + }, +/obj/machinery/light{ + dir = 8 + }, +/turf/simulated/floor/bluegrid, +/area/ai) +"gR" = ( +/obj/effect/floor_decal/techfloor/orange{ + dir = 6 + }, +/obj/machinery/light{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/transitgateway) +"gS" = ( +/obj/structure/cable/cyan{ + icon_state = "2-8" + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"gU" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/black{ + dir = 5 + }, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"gV" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/double/glass{ + name = "glass airlock" + }, +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/aft) +"gW" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/black{ + dir = 10 + }, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"hb" = ( +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/cafe) +"hc" = ( +/obj/machinery/requests_console/preset/hos{ + pixel_x = -30 + }, +/turf/simulated/floor/carpet, +/area/crew_quarters/heads/hos) +"hd" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"he" = ( +/obj/machinery/button/remote/airlock{ + id = "readingroom1"; + name = "Room 1 Lock"; + pixel_y = 24; + specialfunctions = 4 + }, +/obj/machinery/button/remote/blast_door{ + id = "readingroom1"; + name = "Window Lockdown"; + pixel_x = -10; + pixel_y = 24 + }, +/turf/simulated/floor/carpet, +/area/stellardelight/deck3/readingroom) +"hf" = ( +/obj/structure/sign/warning/docking_area{ + pixel_x = -32 + }, +/turf/simulated/floor/reinforced/airless, +/area/stellardelight/deck3/exterior) +"hg" = ( +/obj/effect/fancy_shuttle/sd_shuttle{ + dir = 1; + fancy_shuttle_tag = "sdboat" + }, +/obj/effect/fancy_shuttle_floor_preview/sd_shuttle{ + dir = 1 + }, +/turf/simulated/wall/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"hj" = ( +/obj/machinery/portable_atmospherics/hydroponics, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportroomb) +"hk" = ( +/obj/effect/floor_decal/industrial/warning, +/obj/structure/sign/warning/docking_area{ + pixel_y = 32 + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"hp" = ( +/obj/structure/table/glass, +/obj/machinery/computer/med_data/laptop{ + dir = 4; + pixel_y = 6 + }, +/turf/simulated/floor/carpet/tealcarpet, +/area/crew_quarters/heads/cmo) +"hr" = ( +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/machinery/light/small{ + dir = 1 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/substation/command) +"ht" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_upload) +"hu" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/carpet/blue2, +/area/lawoffice) +"hw" = ( +/obj/machinery/telecomms/processor/preset_one, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"hy" = ( +/obj/machinery/atmospherics/pipe/simple/hidden, +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/starboardcent) +"hz" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/forestarroomb) +"hB" = ( +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"hC" = ( +/obj/machinery/light/small{ + dir = 4 + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"hD" = ( +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/deck3/foreportrooma) +"hE" = ( +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/door/firedoor/glass, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"hF" = ( +/obj/machinery/holoplant, +/obj/machinery/light_switch{ + dir = 8; + pixel_x = 24 + }, +/turf/simulated/floor/bluegrid, +/area/ai_cyborg_station) +"hG" = ( +/obj/structure/sign/poster{ + dir = 4 + }, +/turf/simulated/floor, +/area/stellardelight/deck2/port) +"hK" = ( +/obj/machinery/light{ + dir = 4 + }, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_upload) +"hN" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/stellardelight/deck3/portdock) +"hO" = ( +/obj/machinery/power/breakerbox/activated{ + RCon_tag = "Command Substation Bypass" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/substation/command) +"hP" = ( +/obj/structure/lattice, +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/structure/cable{ + icon_state = "2-4" + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"hQ" = ( +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/deck3/aftstarroom) +"hR" = ( +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"hT" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/deck3/starboardfore) +"hU" = ( +/obj/structure/sign/painting/library_secure{ + pixel_x = 30 + }, +/turf/simulated/floor/carpet/purcarpet, +/area/crew_quarters/heads/hor) +"hX" = ( +/turf/simulated/floor/carpet/oracarpet, +/area/crew_quarters/heads/chief) +"hY" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor, +/area/stellardelight/deck2/port) +"hZ" = ( +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/obj/structure/sign/vacuum{ + pixel_x = 32; + plane = -34 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"ib" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/black{ + dir = 9 + }, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"if" = ( +/obj/structure/cable{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"ii" = ( +/turf/simulated/floor, +/area/maintenance/stellardelight/substation/command) +"ij" = ( +/obj/structure/bed/chair/office/dark{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 6 + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"il" = ( +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportrooma) +"im" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 9 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"in" = ( +/turf/simulated/wall/bay/r_wall/blue, +/area/crew_quarters/heads/hop) +"ip" = ( +/obj/structure/cable{ + icon_state = "4-8" + }, +/turf/simulated/floor/carpet/gaycarpet, +/area/stellardelight/deck3/clownmimeoffice) +"ir" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/forestarroomb) +"is" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/secure{ + name = "AI/Telecoms"; + req_access = list(16) + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled/steel_ridged, +/area/ai_upload) +"iv" = ( +/obj/machinery/alarm/angled{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 9 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"iw" = ( +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/fuel{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"iy" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/commandhall) +"iz" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/bed/chair/sofa/corp/right{ + dir = 4 + }, +/obj/effect/landmark{ + name = "morphspawn" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"iC" = ( +/obj/structure/cryofeed{ + dir = 4 + }, +/obj/effect/floor_decal/corner_techfloor_grid{ + dir = 5 + }, +/obj/effect/floor_decal/corner_techfloor_grid{ + dir = 10 + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/cryo) +"iE" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/hatch{ + door_color = "#e6ab22"; + name = "Shield Generator"; + req_access = null; + req_one_access = list(11,24); + stripe_color = "#e6ab22" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/commandhall) +"iI" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/structure/closet/emergsuit_wall{ + dir = 4; + pixel_x = 27 + }, +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"iJ" = ( +/obj/machinery/cryopod/robot, +/obj/machinery/light{ + dir = 8 + }, +/turf/simulated/floor/bluegrid, +/area/ai_cyborg_station) +"iK" = ( +/obj/machinery/power/terminal{ + dir = 1 + }, +/obj/structure/cable/blue{ + icon_state = "0-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 6 + }, +/obj/item/device/radio/intercom{ + dir = 8; + pixel_x = -24 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"iL" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"iN" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/open, +/area/crew_quarters/bar) +"iP" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"iQ" = ( +/obj/machinery/light/small{ + dir = 8 + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"iR" = ( +/obj/structure/cable/cyan{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"iS" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"iV" = ( +/obj/structure/railing/grey{ + dir = 4 + }, +/turf/simulated/open, +/area/stellardelight/deck3/commandhall) +"iW" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"iY" = ( +/obj/machinery/power/pointdefense{ + id_tag = "sd_pd" + }, +/obj/effect/floor_decal/industrial/warning/full, +/obj/structure/cable/blue, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"iZ" = ( +/obj/effect/floor_decal/industrial/warning{ + dir = 4 + }, +/obj/machinery/light/small, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/starboarddock) +"ja" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 6 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/open, +/area/crew_quarters/bar) +"jc" = ( +/obj/machinery/computer/ship/sensors/adv, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/fore{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"jd" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/transitgateway) +"jg" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/stellardelight/deck3/starboarddock) +"jh" = ( +/obj/structure/closet/secure_closet/hop2, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 8 + }, +/obj/machinery/alarm/angled{ + dir = 8; + pixel_x = 30 + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"jm" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/table/woodentable, +/obj/machinery/door/blast/shutters{ + dir = 2; + id = "cafe"; + layer = 3.1; + name = "Cafe Shutters" + }, +/turf/simulated/floor/lino, +/area/stellardelight/deck3/cafe) +"jn" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/door/airlock/angled_bay/standard/color{ + dir = 4; + door_color = "#323d80"; + fill_color = "#858585"; + id_tag = "cedoor"; + name = "Chief Engineer"; + req_access = list(56); + stripe_color = "#e6ab22" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/crew_quarters/heads/chief) +"jo" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/effect/mouse_hole_spawner{ + dir = 8 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"jp" = ( +/obj/structure/closet, +/obj/random/contraband, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance/cargo, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/aftstarroom) +"jy" = ( +/obj/structure/window/bay/reinforced, +/obj/structure/low_wall/bay/reinforced/steel, +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/blast/angled/open{ + dir = 4; + id = "clownmimeoffice" + }, +/turf/simulated/floor, +/area/stellardelight/deck3/clownmimeoffice) +"jC" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/open, +/area/crew_quarters/bar) +"jD" = ( +/obj/structure/bed/double/padded, +/obj/item/weapon/bedsheet/hopdouble, +/obj/structure/curtain/black, +/obj/effect/landmark/start/hop, +/obj/machinery/requests_console{ + announcementConsole = 1; + department = "Bridge"; + departmentType = 5; + name = "Bridge RC"; + pixel_y = 28 + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"jE" = ( +/obj/machinery/light{ + dir = 1 + }, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"jK" = ( +/obj/machinery/alarm/angled{ + dir = 4 + }, +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"jL" = ( +/obj/structure/lattice, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"jM" = ( +/obj/item/modular_computer/console/preset/command, +/obj/structure/sign/poster{ + dir = 4 + }, +/obj/machinery/newscaster{ + pixel_y = 28 + }, +/turf/simulated/floor/tiled/techfloor, +/area/crew_quarters/heads/hor) +"jO" = ( +/obj/machinery/station_map{ + dir = 4; + pixel_x = -32 + }, +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"jP" = ( +/obj/machinery/alarm/angled, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"jT" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"jV" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/light{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"jY" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/open, +/area/stellardelight/deck2/central) +"ka" = ( +/obj/structure/table/darkglass, +/obj/item/weapon/storage/briefcase{ + pixel_x = -2; + pixel_y = -5 + }, +/turf/simulated/floor/tiled/dark, +/area/lawoffice) +"kb" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/black{ + dir = 4 + }, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"kc" = ( +/obj/machinery/telecomms/server/presets/medical, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"ki" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"kj" = ( +/obj/structure/lattice, +/obj/structure/cable{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 4 + }, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"kk" = ( +/obj/effect/floor_decal/industrial/warning/corner{ + dir = 4 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"kl" = ( +/obj/machinery/keycard_auth{ + pixel_y = 28 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 10 + }, +/obj/machinery/alarm/angled{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/chief) +"ko" = ( +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"kp" = ( +/obj/structure/cable{ + icon_state = "2-8" + }, +/obj/machinery/alarm/angled, +/turf/simulated/floor, +/area/maintenance/stellardelight/substation/command) +"kr" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"ks" = ( +/obj/machinery/telecomms/server/presets/security, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"kt" = ( +/obj/machinery/light{ + dir = 8 + }, +/turf/simulated/floor/tiled/steel_grid, +/area/stellardelight/deck3/aft) +"ku" = ( +/obj/structure/barricade/cutout/mime, +/turf/simulated/floor/carpet/bcarpet, +/area/stellardelight/deck3/clownmimeoffice) +"kw" = ( +/obj/machinery/light{ + dir = 8 + }, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"kz" = ( +/obj/machinery/airlock_sensor/airlock_exterior/shuttle{ + dir = 6; + pixel_x = 7; + pixel_y = 26 + }, +/obj/effect/map_helper/airlock/sensor/ext_sensor, +/obj/effect/map_helper/airlock/door/ext_door, +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/glass_external, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/fuel{ + dir = 10 + }, +/obj/structure/cable{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"kB" = ( +/obj/machinery/porta_turret/ai_defense, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 5 + }, +/turf/simulated/floor/bluegrid, +/area/ai) +"kF" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 10 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"kN" = ( +/obj/structure/sign/painting/library_secure{ + pixel_x = 30 + }, +/obj/structure/closet/secure_closet/hop, +/obj/item/clothing/glasses/omnihud, +/obj/item/weapon/paper/dockingcodes/sd, +/obj/item/device/retail_scanner/command, +/obj/item/weapon/storage/box/PDAs, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"kO" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor, +/area/stellardelight/deck2/fore) +"kP" = ( +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/deck3/portfore) +"kQ" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/deck3/foreportrooma) +"kT" = ( +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 1 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 10 + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"kU" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/open, +/area/crew_quarters/bar) +"kV" = ( +/obj/structure/bed/chair/office/dark{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportroomb) +"kW" = ( +/obj/machinery/camera/network/halls{ + dir = 4 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"kX" = ( +/obj/structure/cable/blue{ + icon_state = "2-4" + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"kY" = ( +/obj/effect/floor_decal/techfloor{ + dir = 10 + }, +/obj/effect/landmark{ + name = "JoinLateCryo" + }, +/obj/machinery/camera/network/civilian{ + dir = 1 + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/cryo) +"kZ" = ( +/obj/structure/handrail{ + dir = 1 + }, +/obj/machinery/airlock_sensor{ + dir = 8; + pixel_x = 29; + pixel_y = 2 + }, +/obj/effect/map_helper/airlock/sensor/int_sensor, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/obj/structure/closet/emergsuit_wall{ + dir = 1; + pixel_y = -32 + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"la" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 9 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/effect/floor_decal/shuttles, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"lc" = ( +/obj/structure/fuel_port{ + dir = 8; + pixel_x = -32 + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/obj/machinery/atmospherics/binary/pump/fuel{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"le" = ( +/obj/structure/railing/grey{ + dir = 8 + }, +/obj/structure/railing/grey, +/turf/simulated/open, +/area/maintenance/stellardelight/deck3/starboardaft) +"lh" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/hatch{ + dir = 4; + name = "maintenance access"; + stripe_color = "#454545" + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/maintenance/stellardelight/deck3/foreportroomb) +"li" = ( +/obj/machinery/telecomms/hub/preset/sd, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"lj" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 6 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 6 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"lk" = ( +/obj/structure/filingcabinet/medical, +/obj/machinery/status_display{ + pixel_y = 32 + }, +/turf/simulated/floor/tiled/eris/white/cargo, +/area/crew_quarters/heads/cmo) +"lm" = ( +/obj/machinery/light{ + dir = 8 + }, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 4 + }, +/obj/structure/closet/emcloset, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"lo" = ( +/obj/machinery/telecomms/server/presets/engineering, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"lq" = ( +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/aftstarroom) +"lt" = ( +/obj/structure/bed/chair, +/obj/machinery/atmospherics/unary/vent_pump/on, +/obj/structure/sign/poster{ + dir = 1 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"lu" = ( +/obj/machinery/camera/network/command, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"lv" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/light/small{ + dir = 1 + }, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 1 + }, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 6 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"lw" = ( +/obj/machinery/telecomms/server/presets/science, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"lx" = ( +/obj/machinery/telecomms/processor/preset_two, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"lA" = ( +/obj/structure/table/rack, +/obj/random/contraband, +/obj/random/maintenance, +/obj/random/maintenance/engineering, +/obj/random/maintenance/engineering, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/forestarroomb) +"lB" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/glass, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"lC" = ( +/obj/machinery/power/apc/angled{ + dir = 4 + }, +/obj/structure/cable/green{ + icon_state = "0-8" + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"lD" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/effect/landmark/start/bartender, +/turf/simulated/floor/lino, +/area/stellardelight/deck3/cafe) +"lE" = ( +/obj/machinery/telecomms/bus/preset_two/sd, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"lF" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/universal, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"lH" = ( +/obj/machinery/telecomms/server/presets/service/sd, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"lJ" = ( +/obj/structure/cable/green{ + icon_state = "2-4" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"lL" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/light{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"lP" = ( +/obj/structure/table/woodentable, +/obj/item/device/radio/intercom{ + dir = 4; + name = "Station Intercom (General)"; + pixel_x = 24 + }, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 + }, +/turf/simulated/floor/carpet/turcarpet, +/area/ai) +"lQ" = ( +/obj/machinery/light, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"lT" = ( +/obj/effect/floor_decal/techfloor/orange{ + dir = 4 + }, +/obj/machinery/atmospherics/unary/vent_scrubber/on, +/obj/machinery/alarm/angled{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/transitgateway) +"lU" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/standard/color{ + dir = 4; + door_color = "#9c9c9c"; + fill_color = "#5c5c5c"; + id_tag = "readingroom1"; + name = "Room 1"; + stripe_color = "#89bd66" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/readingroom) +"lV" = ( +/obj/machinery/light/small{ + dir = 8 + }, +/turf/simulated/floor/carpet/bcarpet, +/area/stellardelight/deck3/clownmimeoffice) +"lY" = ( +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 1 + }, +/turf/simulated/open, +/area/stellardelight/deck2/central) +"ma" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/external/glass{ + dir = 4; + frequency = 1379; + id_tag = "portmaint_exterior"; + locked = 1; + name = "Exterior Airlock" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/maintenance/stellardelight/deck3/portcent) +"mb" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 9 + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"md" = ( +/obj/machinery/button/remote/airlock{ + id = "readingroom3"; + name = "Room 3 Lock"; + pixel_y = 24; + specialfunctions = 4 + }, +/obj/machinery/button/remote/blast_door{ + id = "readingroom3"; + name = "Window Lockdown"; + pixel_x = -10; + pixel_y = 24 + }, +/turf/simulated/floor/carpet, +/area/stellardelight/deck3/readingroom) +"me" = ( +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/deck3/starboardcent) +"mf" = ( +/obj/effect/shuttle_landmark/premade/sd/deck3/portairlock, +/turf/space, +/area/space) +"mg" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/open, +/area/stellardelight/deck2/central) +"mh" = ( +/obj/structure/table/steel_reinforced, +/obj/item/device/radio/intercom{ + dir = 4; + pixel_x = 1; + pixel_y = 1 + }, +/obj/structure/closet/emergsuit_wall{ + dir = 1; + pixel_y = -32 + }, +/obj/machinery/alarm{ + pixel_y = 28 + }, +/obj/machinery/light{ + dir = 4 + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/fore{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"mi" = ( +/obj/machinery/shipsensors/fancy_shuttle, +/turf/simulated/wall/fancy_shuttle/nondense{ + fancy_shuttle_tag = "sdboat" + }, +/area/shuttle/sdboat/fore{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"mj" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"mm" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers, +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/turf/simulated/floor, +/area/stellardelight/deck2/fore) +"mn" = ( +/obj/effect/floor_decal/techfloor{ + dir = 4 + }, +/obj/effect/landmark{ + name = "JoinLateCryo" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/cryo) +"mo" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/door/firedoor/glass, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/starboarddock) +"mp" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 1 + }, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"mq" = ( +/obj/structure/bed/chair{ + dir = 4 + }, +/obj/machinery/alarm/angled{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"mr" = ( +/obj/structure/table/bench/padded, +/obj/effect/landmark/start/visitor, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/cafe) +"ms" = ( +/obj/structure/reagent_dispensers/watertank, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"mv" = ( +/obj/effect/map_helper/airlock/atmos/pump_out_external, +/obj/machinery/atmospherics/unary/vent_pump/high_volume{ + dir = 1; + frequency = 1380; + id_tag = "sdboat_docker_pump_out_external" + }, +/turf/simulated/wall/fancy_shuttle/low{ + fancy_shuttle_tag = "sdboat" + }, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"mA" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 6 + }, +/turf/simulated/floor/bluegrid, +/area/ai) +"mC" = ( +/obj/machinery/telecomms/server/presets/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/black, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"mD" = ( +/obj/structure/table/steel_reinforced, +/obj/machinery/photocopier/faxmachine{ + department = "Head of Security" + }, +/turf/simulated/floor/tiled/dark, +/area/crew_quarters/heads/hos) +"mF" = ( +/turf/simulated/floor/carpet/bcarpet, +/area/stellardelight/deck3/clownmimeoffice) +"mI" = ( +/obj/structure/cable/blue{ + icon_state = "1-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 9 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/light_switch{ + dir = 4; + pixel_x = -24; + pixel_y = 24 + }, +/turf/simulated/floor/tiled/eris/white/cargo, +/area/crew_quarters/heads/cmo) +"mK" = ( +/obj/structure/cable{ + icon_state = "1-2" + }, +/obj/machinery/light/small{ + dir = 8 + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 8 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"mM" = ( +/obj/structure/cable/green{ + icon_state = "1-4" + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"mO" = ( +/obj/structure/table/alien{ + name = "fancy table" + }, +/obj/machinery/computer/skills{ + dir = 4; + pixel_y = 6 + }, +/turf/simulated/floor/carpet/purcarpet, +/area/crew_quarters/heads/hor) +"mQ" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"mR" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarrooma) +"mS" = ( +/obj/structure/lattice, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"mT" = ( +/obj/machinery/space_heater, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"mX" = ( +/obj/structure/bed/chair{ + dir = 4 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"na" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/turf/simulated/floor, +/area/stellardelight/deck2/fore) +"nd" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/light, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"ne" = ( +/obj/machinery/light/small{ + dir = 1 + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"nf" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/external/glass{ + dir = 4; + frequency = 1379; + id_tag = "starmaint_exterior"; + locked = 1; + name = "Exterior Airlock" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/maintenance/stellardelight/deck3/starboardcent) +"nh" = ( +/obj/effect/floor_decal/industrial/warning{ + dir = 8 + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"nj" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/door/airlock/angled_bay/hatch{ + dir = 4; + name = "maintenance access"; + stripe_color = "#454545" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/cafe) +"nk" = ( +/obj/machinery/light, +/obj/structure/table/bench/padded, +/obj/effect/landmark/start/visitor, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/cafe) +"nm" = ( +/obj/machinery/telecomms/server/presets/unused, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"np" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/camera/network/command{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"nr" = ( +/obj/effect/floor_decal/techfloor/orange{ + dir = 5 + }, +/obj/structure/closet/emergsuit_wall{ + pixel_y = 29 + }, +/obj/structure/closet/emergsuit_wall{ + dir = 4; + pixel_x = 27 + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/transitgateway) +"ns" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 6 + }, +/turf/simulated/floor/carpet/oracarpet, +/area/crew_quarters/heads/chief) +"nt" = ( +/obj/machinery/status_display{ + pixel_x = 32 + }, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/commandhall) +"nu" = ( +/obj/structure/cable{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 4 + }, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/alarm/angled{ + dir = 8 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"nv" = ( +/obj/item/weapon/reagent_containers/glass/bucket/wood, +/obj/structure/closet/crate, +/obj/item/weapon/material/minihoe, +/obj/item/seeds/reishimycelium, +/obj/item/seeds/random, +/obj/item/seeds/random, +/obj/item/seeds/random, +/obj/item/seeds/random, +/obj/item/seeds/random, +/obj/item/seeds/ambrosiavulgarisseed, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportroomb) +"nw" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/double{ + dir = 8; + name = "maintenance access"; + stripe_color = "#454545" + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"nx" = ( +/turf/simulated/open, +/area/stellardelight/deck2/central) +"nz" = ( +/obj/machinery/camera/network/civilian{ + dir = 1 + }, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/cafe) +"nB" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/external/glass{ + dir = 4; + frequency = 1380; + id_tag = null; + locked = 1; + name = "Docking Port Airlock" + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/obj/effect/map_helper/airlock/door/int_door, +/obj/machinery/access_button{ + command = "cycle_interior"; + dir = 4; + frequency = 1380; + master_tag = "sd_escape_starboard"; + pixel_y = 32; + req_one_access = list(13) + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/starboarddock) +"nC" = ( +/obj/machinery/telecomms/bus/preset_four, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"nD" = ( +/obj/machinery/power/apc/angled{ + dir = 4; + name = "night shift APC"; + nightshift_setting = 2 + }, +/obj/structure/cable{ + icon_state = "0-8" + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/table/rack, +/obj/random/contraband, +/obj/random/maintenance/clean, +/obj/random/maintenance, +/obj/random/maintenance/engineering, +/obj/random/maintenance/engineering, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"nF" = ( +/obj/structure/table/woodentable, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 1 + }, +/obj/item/device/radio/intercom{ + dir = 8; + pixel_x = -24 + }, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/cafe) +"nH" = ( +/obj/structure/table/steel_reinforced, +/obj/item/device/flashlight/lamp/green{ + pixel_x = -4; + pixel_y = 12 + }, +/obj/item/weapon/stamp/hos, +/obj/item/weapon/book/manual/sd_guide, +/turf/simulated/floor/carpet, +/area/crew_quarters/heads/hos) +"nL" = ( +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/obj/machinery/item_bank{ + dir = 4; + pixel_x = -26 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"nM" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/item/device/radio/intercom{ + dir = 8; + pixel_x = -24 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"nN" = ( +/obj/machinery/cryopod/robot, +/turf/simulated/floor/bluegrid, +/area/ai_cyborg_station) +"nO" = ( +/obj/structure/closet/crate, +/obj/random/contraband, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportrooma) +"nP" = ( +/turf/simulated/wall/bay/purple, +/area/crew_quarters/heads/hor) +"nS" = ( +/obj/machinery/hologram/holopad, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_server_room) +"nT" = ( +/obj/machinery/smartfridge/drinks, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/aftstarroom) +"nV" = ( +/obj/structure/table/rack, +/obj/random/contraband, +/obj/random/maintenance, +/obj/random/maintenance, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"nW" = ( +/turf/simulated/wall/bay/steel, +/area/stellardelight/deck3/cafe) +"nX" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportroomb) +"nZ" = ( +/obj/machinery/door/firedoor/glass/hidden/steel{ + dir = 2 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"ob" = ( +/obj/structure/lattice, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 1 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"od" = ( +/obj/machinery/atmospherics/unary/vent_pump/high_volume{ + dir = 8; + frequency = 1379; + id_tag = "starmaint_airpump" + }, +/obj/machinery/light/small{ + dir = 1 + }, +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/starboardcent) +"og" = ( +/obj/structure/bed/chair{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportrooma) +"ok" = ( +/obj/structure/lattice, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"ol" = ( +/obj/structure/table/alien{ + name = "fancy table" + }, +/obj/item/weapon/stamp/rd, +/obj/item/weapon/book/manual/sd_guide, +/turf/simulated/floor/carpet/purcarpet, +/area/crew_quarters/heads/hor) +"op" = ( +/obj/structure/cable/green{ + icon_state = "1-4" + }, +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"oq" = ( +/obj/effect/landmark/arrivals, +/turf/simulated/floor/glass/reinforced, +/area/stellardelight/deck3/aft) +"os" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 6 + }, +/obj/machinery/door/airlock/angled_bay/external/glass{ + frequency = 1380; + id_tag = null; + locked = 1; + name = "Docking Port Airlock" + }, +/obj/effect/map_helper/airlock/door/int_door, +/obj/machinery/access_button{ + command = "cycle_interior"; + dir = 1; + frequency = 1380; + master_tag = "sd_escape_center_right"; + pixel_x = 32; + req_one_access = list(13) + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/aft) +"ou" = ( +/obj/machinery/atmospherics/unary/vent_pump/high_volume{ + dir = 1; + frequency = 1380; + id_tag = null + }, +/obj/machinery/embedded_controller/radio/airlock/docking_port_multi{ + dir = 8; + frequency = 1380; + id_tag = "sd_escape_center_right"; + master_tag = "escape_dock"; + pixel_x = 24; + req_one_access = list(13); + tag_airpump = null; + tag_chamber_sensor = null; + tag_exterior_door = null; + tag_interior_door = null + }, +/obj/machinery/airlock_sensor{ + dir = 4; + frequency = 1380; + id_tag = null; + pixel_x = -25 + }, +/obj/effect/map_helper/airlock/atmos/chamber_pump, +/obj/effect/map_helper/airlock/sensor/chamber_sensor, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"ov" = ( +/obj/structure/closet/crate/bin{ + anchored = 1 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarroomb) +"ow" = ( +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"oy" = ( +/obj/machinery/door/firedoor/glass/hidden/steel, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"oA" = ( +/obj/machinery/telecomms/processor/preset_four, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"oC" = ( +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"oD" = ( +/obj/item/modular_computer/console/preset/command, +/obj/structure/sign/poster{ + dir = 4 + }, +/obj/machinery/newscaster{ + pixel_y = 28 + }, +/turf/simulated/floor/tiled/eris/white/cargo, +/area/crew_quarters/heads/cmo) +"oE" = ( +/obj/machinery/hologram/holopad, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/readingroom) +"oI" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/zpipe/down/scrubbers{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/zpipe/down/supply{ + dir = 4 + }, +/obj/machinery/door/firedoor/glass, +/turf/simulated/open, +/area/maintenance/stellardelight/deck3/portcent) +"oM" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/light/small{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"oN" = ( +/obj/machinery/teleport/hub{ + dir = 2 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"oO" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/portdock) +"oP" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/open, +/area/crew_quarters/bar) +"oR" = ( +/obj/machinery/newscaster/security_unit{ + pixel_x = -32; + pixel_y = 32 + }, +/obj/item/device/radio/intercom/locked/ai_private{ + dir = 4; + pixel_x = 32 + }, +/obj/item/device/radio/intercom{ + broadcasting = 1; + dir = 8; + name = "Common Channel"; + pixel_x = -21 + }, +/obj/item/device/radio/intercom{ + dir = 1; + name = "Station Intercom (General)"; + pixel_y = 21 + }, +/obj/machinery/requests_console/preset/ai{ + pixel_x = 32; + pixel_y = 32 + }, +/obj/effect/landmark/start/ai, +/turf/simulated/floor/bluegrid, +/area/ai) +"oS" = ( +/obj/structure/cryofeed, +/obj/effect/floor_decal/corner_techfloor_grid{ + dir = 5 + }, +/obj/effect/floor_decal/corner_techfloor_grid{ + dir = 10 + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/cryo) +"oT" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 4 + }, +/obj/item/device/radio/intercom{ + dir = 4; + pixel_x = 24 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"oU" = ( +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 8 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"oV" = ( +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 4 + }, +/obj/machinery/camera/network/halls{ + dir = 4 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"oW" = ( +/turf/simulated/open, +/area/stellardelight/deck2/port) +"oX" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"oY" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/door/airlock/angled_bay/hatch{ + name = "Telecoms Control Room"; + req_access = list(61) + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/tiled/steel_ridged, +/area/tcommsat/computer) +"oZ" = ( +/turf/simulated/wall/bay/steel, +/area/stellardelight/deck3/readingroom) +"pb" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 5 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"pc" = ( +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"pd" = ( +/obj/machinery/power/apc/angled{ + dir = 8 + }, +/obj/structure/cable/blue{ + icon_state = "0-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/tiled/eris/white/cargo, +/area/crew_quarters/heads/cmo) +"pf" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"pk" = ( +/obj/structure/table/steel, +/obj/random/drinkbottle, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportrooma) +"pl" = ( +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/obj/item/device/radio/intercom{ + dir = 4; + pixel_x = 24 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"pm" = ( +/obj/structure/table/darkglass, +/obj/item/device/radio/intercom{ + dir = 1; + name = "Station Intercom (General)"; + pixel_y = 24 + }, +/obj/item/device/flashlight/lamp/green{ + pixel_x = -5; + pixel_y = -5 + }, +/obj/item/weapon/paper_bin, +/obj/item/weapon/pen/blade/red{ + pixel_x = -2; + pixel_y = -2 + }, +/obj/item/weapon/pen, +/obj/item/weapon/pen/blue{ + pixel_x = 2; + pixel_y = 3 + }, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 + }, +/turf/simulated/floor/tiled/dark, +/area/lawoffice) +"po" = ( +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 4 + }, +/obj/structure/flora/pottedplant/decorative, +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"pp" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 1 + }, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/cafe) +"pq" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarrooma) +"pt" = ( +/obj/structure/cable{ + icon_state = "1-8" + }, +/obj/structure/cable{ + icon_state = "1-4" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 9 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 9 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"px" = ( +/obj/machinery/telecomms/processor/preset_three, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"pz" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/hatch{ + name = "maintenance access"; + stripe_color = "#454545" + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/maintenance/stellardelight/deck3/aftstarroom) +"pA" = ( +/obj/structure/bed/double/padded, +/obj/item/weapon/bedsheet/cosmosdouble{ + icon_state = "dobulesheetcosmos" + }, +/obj/machinery/camera/network/command, +/turf/simulated/floor/carpet/turcarpet, +/area/ai) +"pB" = ( +/obj/structure/bed/chair, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 1 + }, +/obj/item/device/radio/intercom{ + dir = 1; + pixel_y = 24 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"pC" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 9 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/obj/structure/sign/warning/evac{ + pixel_x = 32 + }, +/obj/effect/landmark{ + name = "lightsout" + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"pE" = ( +/obj/machinery/light/small{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/forestarrooma) +"pG" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 4 + }, +/obj/effect/floor_decal/shuttles/right, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"pK" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"pL" = ( +/obj/structure/table/steel, +/obj/random/snack, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarrooma) +"pN" = ( +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportroomb) +"pO" = ( +/obj/machinery/power/apc/angled{ + dir = 4 + }, +/obj/structure/cable/blue{ + icon_state = "0-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/tiled/dark, +/area/crew_quarters/heads/hos) +"pS" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/alarm/angled{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"pT" = ( +/obj/effect/floor_decal/industrial/warning{ + dir = 4 + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"pV" = ( +/obj/machinery/keycard_auth{ + pixel_y = 28 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 6 + }, +/obj/machinery/alarm/angled{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor, +/area/crew_quarters/heads/hor) +"pW" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"pX" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable{ + icon_state = "1-2" + }, +/obj/machinery/door/airlock/angled_bay/hatch{ + door_color = "#323d80"; + name = "maintenance access"; + req_one_access = list(16); + stripe_color = "#323d80" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/ai_cyborg_station) +"pY" = ( +/obj/machinery/telecomms/bus/preset_three, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"qb" = ( +/obj/machinery/power/pointdefense{ + id_tag = "sd_pd" + }, +/obj/effect/floor_decal/industrial/warning/full, +/obj/structure/cable/blue{ + icon_state = "0-2" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"qc" = ( +/obj/structure/table/bench/padded, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/cafe) +"qd" = ( +/obj/effect/landmark{ + name = "JoinLateCyborg" + }, +/obj/effect/landmark/start/cyborg, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"qe" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/external/glass{ + dir = 4; + frequency = 1380; + id_tag = null; + locked = 1; + name = "Docking Port Airlock" + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/obj/effect/map_helper/airlock/door/int_door, +/obj/machinery/access_button{ + command = "cycle_interior"; + dir = 8; + frequency = 1380; + master_tag = "sd_escape_port"; + pixel_y = 32; + req_one_access = list(13) + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/portdock) +"qf" = ( +/obj/structure/cable{ + icon_state = "1-4" + }, +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/structure/cable{ + icon_state = "1-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 8; + icon_state = "pipe-c" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"qg" = ( +/obj/structure/table/glass, +/obj/machinery/light/small{ + dir = 4 + }, +/obj/random/contraband, +/obj/random/snack, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/readingroom) +"qi" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"qn" = ( +/obj/machinery/porta_turret/stationary, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"qp" = ( +/turf/simulated/open, +/area/crew_quarters/bar) +"qq" = ( +/turf/simulated/wall/bay/r_wall/blue, +/area/tcommsat/computer) +"qs" = ( +/obj/structure/table/rack, +/obj/random/maintenance/clean, +/obj/random/maintenance/clean, +/obj/random/maintenance/clean, +/obj/random/maintenance/clean, +/obj/random/maintenance/security, +/obj/random/maintenance/security, +/obj/random/maintenance/security, +/obj/random/drinkbottle, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarrooma) +"qv" = ( +/obj/structure/cable/cyan{ + icon_state = "4-8" + }, +/obj/machinery/door/airlock/angled_bay/hatch{ + dir = 4; + door_color = "#323d80"; + id_tag = "AICore"; + id_tint = null; + locked = 1; + name = "AI Core"; + req_one_access = list(16); + stripe_color = "#323d80" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/ai) +"qx" = ( +/obj/structure/table/glass, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/readingroom) +"qy" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"qz" = ( +/turf/simulated/floor/reinforced{ + name = "Holodeck Projector Floor" + }, +/area/holodeck/alphadeck) +"qA" = ( +/obj/machinery/turretid/stun{ + check_synth = 1; + control_area = /area/ai; + name = "AI Chamber turret control"; + pixel_x = -30; + pixel_y = -24 + }, +/obj/machinery/flasher{ + id = "AI"; + pixel_x = -24; + pixel_y = 25 + }, +/obj/machinery/hologram/holopad, +/obj/structure/cable/cyan{ + icon_state = "2-8" + }, +/turf/simulated/floor/bluegrid, +/area/ai) +"qC" = ( +/obj/structure/table/glass, +/turf/simulated/floor/carpet, +/area/stellardelight/deck3/readingroom) +"qE" = ( +/obj/effect/floor_decal/industrial/warning{ + dir = 4 + }, +/obj/machinery/light/small{ + dir = 1 + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/starboarddock) +"qF" = ( +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"qK" = ( +/obj/effect/landmark{ + name = "lightsout" + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"qL" = ( +/obj/structure/sign/warning/docking_area{ + pixel_x = 32 + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"qM" = ( +/obj/structure/table/steel, +/obj/random/firstaid, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportrooma) +"qN" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"qO" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/door/airlock/angled_bay/hatch{ + door_color = "#323d80"; + name = "maintenance access"; + req_one_access = list(16); + stripe_color = "#323d80" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/ai_cyborg_station) +"qP" = ( +/obj/structure/lattice, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"qQ" = ( +/obj/machinery/porta_turret/stationary, +/obj/structure/cable/blue{ + icon_state = "2-4" + }, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"qS" = ( +/obj/machinery/light/small, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"qU" = ( +/obj/machinery/light{ + dir = 4 + }, +/obj/structure/cable/blue{ + icon_state = "1-8" + }, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"qW" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/hatch{ + dir = 4; + name = "maintenance access"; + stripe_color = "#454545" + }, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/maintenance/stellardelight/deck3/forestarroomb) +"qX" = ( +/obj/random/vendorfood, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"qY" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 5 + }, +/obj/structure/reagent_dispensers/fueltank, +/obj/machinery/alarm/angled{ + dir = 4 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"qZ" = ( +/obj/structure/filingcabinet/chestdrawer, +/obj/machinery/power/apc/angled{ + dir = 4 + }, +/obj/structure/cable/blue{ + icon_state = "0-8" + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"rb" = ( +/obj/effect/floor_decal/emblem/nt3, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_upload) +"rc" = ( +/turf/simulated/wall/bay/r_wall/blue, +/area/stellardelight/deck3/commandhall) +"rg" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/cafe) +"rh" = ( +/obj/machinery/cryopod{ + dir = 4 + }, +/obj/effect/floor_decal/corner_techfloor_grid{ + dir = 10 + }, +/obj/effect/floor_decal/corner_techfloor_grid{ + dir = 5 + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/cryo) +"ri" = ( +/obj/structure/handrail, +/obj/effect/map_helper/airlock/atmos/chamber_pump, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/obj/machinery/atmospherics/unary/vent_pump/high_volume{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"rj" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportroomb) +"rl" = ( +/obj/structure/sign/painting/library_secure{ + pixel_x = -30 + }, +/turf/simulated/floor/carpet/blue2, +/area/lawoffice) +"rm" = ( +/obj/effect/floor_decal/techfloor{ + dir = 5 + }, +/obj/effect/landmark{ + name = "JoinLateCryo" + }, +/obj/machinery/atmospherics/unary/vent_pump/on, +/obj/machinery/computer/cryopod{ + pixel_x = 32; + pixel_y = 32 + }, +/obj/item/device/radio/intercom{ + dir = 1; + pixel_y = 24 + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/cryo) +"rn" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/transitgateway) +"rp" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/door/firedoor/glass, +/obj/machinery/atmospherics/pipe/simple/hidden, +/obj/machinery/access_button{ + command = "cycle_interior"; + frequency = 1379; + master_tag = "portmaint_airlock"; + name = "interior access button"; + pixel_x = 32; + req_access = null; + req_one_access = list(13) + }, +/obj/machinery/door/airlock/angled_bay/external/glass{ + frequency = 1379; + id_tag = "portmaint_interior"; + locked = 1; + name = "Exterior Airlock" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/maintenance/stellardelight/deck3/portcent) +"rq" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/aftstarroom) +"rr" = ( +/obj/machinery/atmospherics/unary/vent_pump/high_volume{ + dir = 4; + frequency = 1380; + id_tag = null + }, +/obj/machinery/embedded_controller/radio/airlock/docking_port_multi{ + frequency = 1380; + id_tag = "sd_escape_starboard"; + master_tag = "escape_dock"; + pixel_y = 30; + req_one_access = list(13); + tag_airpump = null; + tag_chamber_sensor = null; + tag_exterior_door = null; + tag_interior_door = null + }, +/obj/machinery/airlock_sensor{ + frequency = 1380; + id_tag = null; + pixel_y = -25 + }, +/obj/effect/map_helper/airlock/atmos/chamber_pump, +/obj/effect/map_helper/airlock/sensor/chamber_sensor, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"rs" = ( +/obj/machinery/atmospherics/pipe/manifold/hidden/black{ + dir = 1 + }, +/obj/machinery/hologram/holopad, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"rx" = ( +/turf/simulated/wall/bay/white, +/area/crew_quarters/heads/cmo) +"rA" = ( +/obj/structure/table/reinforced, +/obj/machinery/computer/skills, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"rB" = ( +/obj/machinery/door/airlock/angled_bay/hatch{ + dir = 4; + door_color = "#323d80"; + id_tag = "AICore"; + id_tint = null; + locked = 1; + name = "AI Core"; + req_one_access = list(16); + stripe_color = "#323d80" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/ai) +"rH" = ( +/obj/structure/lattice, +/obj/structure/cable/blue{ + icon_state = "32-8" + }, +/obj/structure/disposalpipe/down{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/zpipe/down/supply, +/obj/machinery/atmospherics/pipe/zpipe/down/scrubbers, +/obj/machinery/door/firedoor/glass, +/turf/simulated/open, +/area/maintenance/stellardelight/deck3/starboardcent) +"rL" = ( +/turf/simulated/floor/lino, +/area/stellardelight/deck3/cafe) +"rN" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 10 + }, +/turf/simulated/floor/bluegrid, +/area/ai) +"rS" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"rW" = ( +/obj/effect/mouse_hole_spawner{ + dir = 4 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"rX" = ( +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/obj/machinery/light{ + dir = 1 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"rZ" = ( +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"sa" = ( +/obj/effect/map_helper/airlock/door/int_door, +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/glass_external, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/fuel{ + dir = 4 + }, +/obj/structure/cable{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"sb" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/door/airlock/angled_bay/secure{ + name = "AI Storage"; + req_access = list(16) + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled/steel_ridged, +/area/ai_cyborg_station) +"sc" = ( +/turf/simulated/wall/bay/r_wall/blue, +/area/ai) +"sd" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"sf" = ( +/obj/machinery/light{ + dir = 8 + }, +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"si" = ( +/obj/structure/table/woodentable, +/obj/machinery/chemical_dispenser/bar_coffee/full{ + pixel_y = 8 + }, +/obj/structure/sign/painting/library_secure{ + pixel_y = 30 + }, +/turf/simulated/floor/lino, +/area/stellardelight/deck3/cafe) +"sj" = ( +/obj/machinery/power/apc/angled{ + dir = 4; + name = "night shift APC"; + nightshift_setting = 2 + }, +/obj/structure/closet, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/structure/cable/blue{ + icon_state = "0-2" + }, +/obj/random/snack, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarrooma) +"sl" = ( +/obj/machinery/atmospherics/unary/vent_pump{ + dir = 8; + external_pressure_bound = 140; + external_pressure_bound_default = 140; + icon_state = "map_vent_out"; + pressure_checks = 0; + pressure_checks_default = 0; + use_power = 1 + }, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"sn" = ( +/obj/structure/lattice, +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"sr" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 6 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"ss" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/external/glass{ + dir = 4; + frequency = 1380; + id_tag = null; + locked = 1; + name = "Docking Port Airlock" + }, +/obj/effect/map_helper/airlock/door/int_door, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/obj/machinery/access_button{ + command = "cycle_interior"; + dir = 4; + frequency = 1380; + master_tag = "sd_port_landing"; + pixel_y = 32; + req_one_access = list(13) + }, +/obj/structure/cable{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/portdock) +"st" = ( +/obj/structure/bed/chair/sofa/corp/right{ + dir = 8 + }, +/obj/machinery/light/small{ + dir = 4 + }, +/mob/living/simple_mob/animal/passive/fox/syndicate/aipet, +/turf/simulated/floor/carpet/turcarpet, +/area/ai) +"su" = ( +/obj/machinery/power/apc/angled{ + dir = 8 + }, +/obj/structure/cable/blue{ + icon_state = "0-4" + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"sx" = ( +/obj/machinery/door/firedoor/glass, +/turf/simulated/floor, +/area/stellardelight/deck2/central) +"sz" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/hatch{ + dir = 4; + door_color = "#e6ab22"; + name = "Shield Generator"; + req_access = null; + req_one_access = list(11,24); + stripe_color = "#e6ab22" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck2/central) +"sA" = ( +/obj/structure/bed/chair{ + dir = 4 + }, +/turf/simulated/floor/carpet/purcarpet, +/area/crew_quarters/heads/hor) +"sC" = ( +/obj/machinery/computer/mecha{ + dir = 1 + }, +/turf/simulated/floor/tiled/techfloor, +/area/crew_quarters/heads/hor) +"sE" = ( +/obj/effect/shuttle_landmark/premade/sd/deck3/starboardlanding, +/turf/space, +/area/space) +"sI" = ( +/obj/structure/table/standard, +/obj/random/paicard, +/obj/machinery/atmospherics/unary/vent_scrubber/on, +/turf/simulated/floor/bluegrid, +/area/ai_cyborg_station) +"sJ" = ( +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"sK" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/black{ + dir = 4 + }, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"sM" = ( +/turf/simulated/floor/reinforced/airless, +/area/stellardelight/deck3/exterior) +"sN" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/structure/cable/green{ + icon_state = "1-4" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"sO" = ( +/turf/simulated/floor, +/area/stellardelight/deck2/fore) +"sP" = ( +/obj/structure/cable/green{ + icon_state = "1-4" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"sQ" = ( +/obj/structure/table/standard, +/obj/item/weapon/aiModule/reset, +/obj/machinery/alarm{ + dir = 4; + pixel_x = -28 + }, +/obj/structure/sign/warning/secure_area{ + pixel_y = 32 + }, +/turf/simulated/floor/bluegrid, +/area/ai_cyborg_station) +"sR" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarroomb) +"sU" = ( +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"sX" = ( +/obj/structure/closet/crate, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance/security, +/obj/random/maintenance/security, +/obj/random/drinkbottle, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"sZ" = ( +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/wall/bay/r_wall/blue, +/area/maintenance/stellardelight/deck3/portaft) +"tb" = ( +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/obj/effect/floor_decal/steeldecal/steel_decals_central5{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"tc" = ( +/obj/structure/cable/blue{ + icon_state = "1-4" + }, +/obj/effect/mouse_hole_spawner{ + dir = 8 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardfore) +"tg" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/junction{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"th" = ( +/turf/simulated/wall/bay/r_wall/blue, +/area/ai_cyborg_station) +"tk" = ( +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"tn" = ( +/obj/machinery/light_switch{ + dir = 8; + pixel_x = 24 + }, +/turf/simulated/floor/carpet/turcarpet, +/area/ai) +"tp" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 10 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 10 + }, +/obj/random/trash_pile, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"tq" = ( +/obj/machinery/camera/network/command{ + dir = 9 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"tu" = ( +/obj/machinery/light/small{ + dir = 4 + }, +/obj/structure/closet/crate, +/obj/random/contraband, +/obj/random/maintenance, +/obj/random/maintenance/clean, +/obj/random/maintenance/clean, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/aftstarroom) +"ty" = ( +/obj/machinery/computer/teleporter, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"tz" = ( +/obj/machinery/recharge_station, +/turf/simulated/floor/bluegrid, +/area/ai_upload) +"tC" = ( +/obj/structure/sign/vacuum, +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/deck3/starboardcent) +"tF" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/frame, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/forestarrooma) +"tG" = ( +/obj/machinery/light, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5, +/obj/structure/cable{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"tH" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 9 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/transitgateway) +"tJ" = ( +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 + }, +/obj/machinery/light{ + dir = 1 + }, +/obj/structure/flora/pottedplant/decorative, +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"tK" = ( +/obj/effect/floor_decal/industrial/warning{ + dir = 4 + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"tL" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/black{ + dir = 4 + }, +/obj/structure/cable/blue{ + icon_state = "1-8" + }, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"tO" = ( +/obj/structure/table/steel_reinforced, +/obj/item/device/taperecorder{ + pixel_x = 10 + }, +/obj/item/weapon/reagent_containers/food/drinks/flask/barflask{ + pixel_x = -9; + pixel_y = -2 + }, +/obj/item/device/radio/off, +/turf/simulated/floor/tiled/dark, +/area/crew_quarters/heads/hos) +"tQ" = ( +/obj/structure/table/standard, +/obj/item/weapon/aiModule/freeform, +/obj/machinery/light{ + dir = 1 + }, +/turf/simulated/floor/bluegrid, +/area/ai_cyborg_station) +"tR" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/external/glass{ + dir = 4; + frequency = 1380; + id_tag = null; + locked = 1; + name = "Docking Port Airlock" + }, +/obj/effect/map_helper/airlock/door/ext_door, +/obj/machinery/access_button{ + command = "cycle_exterior"; + dir = 4; + frequency = 1380; + master_tag = "sd_escape_port"; + pixel_y = 32; + req_one_access = list(13) + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/portdock) +"tT" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"tV" = ( +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 1 + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"tW" = ( +/obj/machinery/atmospherics/portables_connector{ + dir = 4 + }, +/obj/machinery/portable_atmospherics/canister/air/airlock{ + start_pressure = 4559.63 + }, +/turf/simulated/floor, +/area/tcommsat/computer) +"tX" = ( +/obj/structure/bed/chair/sofa/corp/left{ + dir = 8 + }, +/turf/simulated/floor/bluegrid, +/area/ai) +"tZ" = ( +/turf/simulated/floor/carpet/purcarpet, +/area/crew_quarters/heads/hor) +"ub" = ( +/obj/item/modular_computer/console/preset/command, +/obj/structure/sign/poster{ + dir = 8 + }, +/obj/machinery/newscaster/security_unit{ + pixel_y = 28 + }, +/turf/simulated/floor/tiled/dark, +/area/crew_quarters/heads/hos) +"uc" = ( +/obj/machinery/teleport/station{ + dir = 2 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"uf" = ( +/obj/structure/lattice, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"ui" = ( +/obj/machinery/portable_atmospherics/canister/phoron, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/obj/machinery/atmospherics/portables_connector/fuel{ + dir = 1 + }, +/obj/machinery/door/window/southleft{ + dir = 1; + req_one_access = list(11,67) + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"uj" = ( +/turf/simulated/wall/bay/r_wall/blue, +/area/crew_quarters/heads/hor) +"uk" = ( +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/obj/item/device/radio/intercom{ + dir = 8; + pixel_x = -24 + }, +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"ul" = ( +/obj/structure/cable/blue{ + icon_state = "2-8" + }, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/structure/cable/blue{ + icon_state = "1-8" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardfore) +"un" = ( +/obj/structure/cable/green{ + icon_state = "2-4" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"uq" = ( +/turf/simulated/wall/bay/r_wall/steel, +/area/stellardelight/deck3/starboarddock) +"ur" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/deck3/starboardaft) +"us" = ( +/obj/machinery/light{ + dir = 4 + }, +/turf/simulated/floor/bluegrid, +/area/ai) +"ut" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 4 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"uv" = ( +/obj/machinery/atmospherics/pipe/manifold/hidden/black, +/obj/structure/cable/blue{ + icon_state = "2-4" + }, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"uw" = ( +/obj/machinery/atmospherics/pipe/manifold/hidden{ + dir = 1 + }, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"uz" = ( +/obj/effect/floor_decal/techfloor{ + dir = 4 + }, +/obj/effect/landmark{ + name = "JoinLateCryo" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/cryo) +"uB" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/machinery/atmospherics/pipe/simple/hidden/black, +/obj/structure/low_wall/bay/reinforced/blue, +/turf/simulated/floor, +/area/tcommsat/computer) +"uD" = ( +/obj/structure/closet/firecloset, +/obj/random/maintenance, +/obj/random/maintenance/cargo, +/obj/random/maintenance/clean, +/obj/random/drinkbottle, +/obj/random/drinkbottle, +/obj/random/drinkbottle, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/aftstarroom) +"uE" = ( +/obj/structure/table/rack, +/obj/random/contraband, +/obj/random/maintenance, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarroomb) +"uH" = ( +/obj/structure/cable/blue{ + icon_state = "2-8" + }, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"uI" = ( +/obj/structure/cable/blue{ + icon_state = "1-4" + }, +/turf/simulated/floor/bluegrid, +/area/ai) +"uJ" = ( +/obj/structure/closet/firecloset, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"uM" = ( +/obj/machinery/alarm/angled, +/obj/structure/table/woodentable, +/obj/item/device/flashlight/lamp/clown{ + pixel_x = -4; + pixel_y = 6 + }, +/obj/item/weapon/bikehorn{ + pixel_x = -2; + pixel_y = 2 + }, +/obj/item/weapon/stamp/clown{ + pixel_x = 6; + pixel_y = 9 + }, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/clownmimeoffice) +"uQ" = ( +/obj/machinery/alarm/angled{ + dir = 8 + }, +/obj/machinery/computer/shuttle_control/explore/sdboat{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_server_room) +"uT" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/structure/cable/blue{ + icon_state = "2-8" + }, +/turf/simulated/floor/tiled/techfloor, +/area/ai_cyborg_station) +"uU" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/standard/color{ + dir = 4; + door_color = "#9c9c9c"; + fill_color = "#5c5c5c"; + id_tag = "readingroom3"; + name = "Room 3"; + stripe_color = "#89bd66" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/readingroom) +"uV" = ( +/obj/machinery/computer/robotics{ + dir = 1 + }, +/turf/simulated/floor/tiled/techfloor, +/area/crew_quarters/heads/hor) +"uW" = ( +/obj/effect/floor_decal/corner_techfloor_grid{ + dir = 5 + }, +/obj/effect/floor_decal/corner_techfloor_grid{ + dir = 10 + }, +/obj/machinery/light/floortube{ + dir = 4; + pixel_x = 2 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/cryo) +"uX" = ( +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor, +/area/stellardelight/deck2/starboard) +"uY" = ( +/obj/structure/cable{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/manifold/hidden{ + dir = 8 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"uZ" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/camera/network/command{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_server_room) +"va" = ( +/obj/effect/floor_decal/industrial/warning{ + dir = 8 + }, +/obj/structure/cable/green{ + icon_state = "2-4" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"vb" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 10 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 9 + }, +/turf/simulated/floor/tiled/techfloor, +/area/ai_cyborg_station) +"vf" = ( +/obj/structure/table/reinforced, +/obj/machinery/photocopier/faxmachine{ + department = "Chief Engineer's Office" + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/chief) +"vh" = ( +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 1 + }, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/cafe) +"vi" = ( +/turf/simulated/floor/carpet/tealcarpet, +/area/crew_quarters/heads/cmo) +"vo" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 5 + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"vq" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/deck3/portaft) +"vr" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/fuel{ + dir = 9 + }, +/turf/simulated/wall/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"vt" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/structure/cable{ + icon_state = "2-4" + }, +/turf/simulated/floor, +/area/stellardelight/deck2/central) +"vv" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/effect/floor_decal/emblem/nt2, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/obj/effect/landmark{ + name = "lightsout" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"vw" = ( +/obj/structure/sign/department/shield, +/turf/simulated/wall/bay/r_wall/blue, +/area/stellardelight/deck3/commandhall) +"vy" = ( +/obj/machinery/atmospherics/portables_connector{ + dir = 1 + }, +/obj/machinery/portable_atmospherics/canister/air/airlock, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"vA" = ( +/obj/machinery/power/apc/angled{ + dir = 1; + name = "night shift APC"; + nightshift_setting = 2 + }, +/obj/structure/cable/green{ + icon_state = "0-4" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"vE" = ( +/obj/effect/shuttle_landmark{ + base_area = /area/stellardelight/deck3/exterior; + base_turf = /turf/simulated/floor/reinforced/airless; + docking_controller = "sd_starboard_landing"; + landmark_tag = "starboard_shuttlepad"; + name = "Starboard Shuttlepad" + }, +/turf/simulated/floor/reinforced/airless, +/area/stellardelight/deck3/exterior) +"vF" = ( +/obj/structure/lattice, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"vG" = ( +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 8 + }, +/obj/structure/cable{ + icon_state = "1-8" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"vI" = ( +/obj/structure/bed/chair{ + dir = 8 + }, +/obj/machinery/light{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"vJ" = ( +/obj/structure/bed/chair{ + dir = 8 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"vN" = ( +/obj/machinery/computer/telecomms/monitor{ + dir = 8; + network = "tcommsat" + }, +/obj/machinery/light{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"vO" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/door/airlock/angled_bay/hatch{ + door_color = "#323d80"; + name = "maintenance access"; + req_one_access = list(19,38); + stripe_color = "#323d80" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/commandhall) +"vP" = ( +/obj/structure/bed/chair{ + dir = 8 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/obj/structure/sign/nanotrasen{ + pixel_x = 32 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"vQ" = ( +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"vS" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"vT" = ( +/obj/machinery/holoplant, +/obj/machinery/status_display{ + pixel_x = -32 + }, +/turf/simulated/floor/bluegrid, +/area/ai_cyborg_station) +"vX" = ( +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/effect/map_helper/airlock/atmos/chamber_pump, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/obj/machinery/atmospherics/unary/vent_pump/high_volume{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/fuel{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"wa" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/stellardelight/deck2/port) +"wc" = ( +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 8 + }, +/obj/effect/landmark/vermin, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"wd" = ( +/obj/structure/table/standard, +/obj/item/weapon/aiModule/oxygen, +/obj/item/weapon/aiModule/oneHuman, +/obj/item/weapon/aiModule/purge, +/obj/item/weapon/aiModule/antimov, +/obj/item/weapon/aiModule/teleporterOffline, +/obj/machinery/alarm/angled{ + dir = 8 + }, +/turf/simulated/floor/bluegrid, +/area/ai_cyborg_station) +"we" = ( +/obj/machinery/power/pointdefense{ + id_tag = "sd_pd" + }, +/obj/effect/floor_decal/industrial/warning/full, +/obj/structure/cable/blue{ + icon_state = "0-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"wg" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"wm" = ( +/obj/machinery/atmospherics/unary/vent_pump/high_volume{ + dir = 8; + frequency = 1380; + id_tag = null + }, +/obj/machinery/embedded_controller/radio/airlock/docking_port{ + frequency = 1380; + id_tag = "sd_starboard_landing"; + pixel_y = 29 + }, +/obj/effect/map_helper/airlock/atmos/chamber_pump, +/obj/effect/map_helper/airlock/sensor/chamber_sensor, +/obj/machinery/airlock_sensor{ + frequency = 1380; + id_tag = null; + pixel_y = -25 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"wo" = ( +/obj/structure/table/standard, +/obj/item/weapon/aiModule/asimov, +/obj/item/weapon/aiModule/freeformcore, +/obj/item/weapon/aiModule/corp, +/obj/item/weapon/aiModule/paladin, +/obj/item/weapon/aiModule/robocop, +/obj/structure/cable/blue, +/obj/machinery/power/apc/angled{ + dir = 8 + }, +/turf/simulated/floor/bluegrid, +/area/ai_cyborg_station) +"wq" = ( +/obj/structure/bed/chair{ + dir = 8 + }, +/turf/simulated/floor/carpet, +/area/crew_quarters/heads/hos) +"wr" = ( +/obj/machinery/computer/ship/engines/adv, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/fore{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"wt" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/machinery/door/blast/angled/open{ + dir = 4; + id = "readingroom2" + }, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/stellardelight/deck3/readingroom) +"wv" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"ww" = ( +/obj/machinery/atmospherics/portables_connector{ + dir = 8 + }, +/obj/machinery/portable_atmospherics/canister/air/airlock, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"wy" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 4 + }, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"wA" = ( +/obj/machinery/alarm/angled{ + dir = 4 + }, +/turf/simulated/floor/bluegrid, +/area/ai_upload) +"wG" = ( +/obj/machinery/alarm/angled{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"wK" = ( +/obj/effect/floor_decal/techfloor/orange{ + dir = 1 + }, +/obj/item/device/radio/intercom{ + dir = 1; + pixel_y = 24 + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/transitgateway) +"wM" = ( +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/starboardcent) +"wN" = ( +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"wP" = ( +/obj/machinery/atmospherics/unary/vent_scrubber/on, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 1 + }, +/obj/machinery/station_map{ + pixel_y = 32 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"wQ" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"wR" = ( +/obj/structure/lattice, +/obj/structure/cable{ + icon_state = "2-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 10 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 10 + }, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"wS" = ( +/obj/machinery/holoplant, +/turf/simulated/floor/bluegrid, +/area/ai) +"wV" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/structure/closet/emergsuit_wall{ + dir = 8; + pixel_x = -27 + }, +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"wW" = ( +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/camera/network/civilian{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/transitgateway) +"wY" = ( +/obj/machinery/light, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"wZ" = ( +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 6 + }, +/turf/simulated/wall/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"xb" = ( +/obj/machinery/light/small{ + dir = 4 + }, +/obj/structure/closet/crate, +/obj/random/contraband, +/obj/random/contraband, +/obj/random/maintenance/clean, +/obj/random/maintenance/clean, +/obj/random/maintenance/clean, +/obj/random/maintenance/engineering, +/obj/random/maintenance/engineering, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportrooma) +"xd" = ( +/obj/structure/lattice, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"xe" = ( +/obj/machinery/light{ + dir = 4 + }, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_server_room) +"xf" = ( +/obj/structure/handrail{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"xg" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/structure/low_wall/bay/reinforced/blue, +/turf/simulated/floor, +/area/crew_quarters/heads/hop) +"xh" = ( +/obj/machinery/light{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/bluegrid, +/area/ai) +"xi" = ( +/obj/structure/cable/green{ + icon_state = "1-4" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 5 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 5 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"xj" = ( +/obj/structure/table/standard, +/obj/item/weapon/aiModule/consuming_eradicator, +/obj/item/weapon/aiModule/guard_dog, +/obj/item/weapon/aiModule/pleasurebot, +/obj/item/weapon/aiModule/protective_shell, +/obj/item/weapon/aiModule/scientific_pursuer, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 1 + }, +/turf/simulated/floor/bluegrid, +/area/ai_cyborg_station) +"xm" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"xo" = ( +/obj/structure/cable{ + icon_state = "4-8" + }, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/clownmimeoffice) +"xp" = ( +/turf/simulated/floor/wood, +/area/stellardelight/deck3/clownmimeoffice) +"xu" = ( +/obj/machinery/door/airlock/angled_bay/external/glass{ + dir = 4; + frequency = 1379; + id_tag = "starmaint_exterior"; + locked = 1; + name = "Exterior Airlock" + }, +/obj/machinery/door/firedoor/glass, +/obj/machinery/access_button{ + command = "cycle_exterior"; + frequency = 1379; + master_tag = "starmaint_airlock"; + name = "exterior access button"; + pixel_y = 32; + req_access = null; + req_one_access = list(13) + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/maintenance/stellardelight/deck3/starboardcent) +"xv" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/readingroom) +"xw" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"xy" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 6 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 6 + }, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/commandhall) +"xz" = ( +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/obj/machinery/atmospherics/unary/freezer{ + dir = 1; + icon_state = "freezer_1"; + set_temperature = 73; + use_power = 1 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"xA" = ( +/obj/structure/sign/warning/evac{ + pixel_x = 32; + pixel_y = -32 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5, +/obj/structure/cable{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"xB" = ( +/obj/machinery/atmospherics/binary/passive_gate/on{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"xC" = ( +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/obj/effect/landmark/vermin, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"xE" = ( +/obj/structure/closet, +/obj/random/firstaid, +/obj/random/maintenance, +/obj/random/maintenance/cargo, +/obj/random/maintenance/cargo, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/aftstarroom) +"xH" = ( +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"xI" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportroomb) +"xL" = ( +/turf/simulated/wall/fancy_shuttle/low{ + fancy_shuttle_tag = "sdboat" + }, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"xM" = ( +/obj/structure/bed/chair/office/dark{ + dir = 4 + }, +/obj/effect/landmark/start/iaa, +/turf/simulated/floor/carpet/blue2, +/area/lawoffice) +"xN" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/forestarrooma) +"xO" = ( +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 8 + }, +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"xP" = ( +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportroomb) +"xR" = ( +/obj/machinery/atmospherics/unary/vent_pump/on, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"xS" = ( +/obj/structure/bed/chair/office/dark{ + dir = 4 + }, +/obj/effect/landmark/start/hos, +/turf/simulated/floor/carpet, +/area/crew_quarters/heads/hos) +"xT" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"xU" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"xW" = ( +/obj/machinery/door/firedoor/glass, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/aft) +"xY" = ( +/turf/simulated/floor/carpet/blue2, +/area/lawoffice) +"xZ" = ( +/turf/simulated/floor/wood, +/area/stellardelight/deck3/cafe) +"ya" = ( +/obj/machinery/button/remote/blast_door{ + id = "shuttleshutter"; + name = "Shutter Control"; + pixel_x = 17; + pixel_y = 27 + }, +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/fore{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"yb" = ( +/obj/structure/sign/deck3{ + pixel_x = 32 + }, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 1 + }, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/commandhall) +"yc" = ( +/obj/machinery/atmospherics/pipe/manifold/hidden, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"yd" = ( +/obj/structure/cable/green{ + icon_state = "1-4" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"ye" = ( +/obj/structure/dogbed, +/mob/living/simple_mob/animal/passive/dog/corgi/Lisa, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"yf" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/double{ + dir = 8; + name = "maintenance access"; + stripe_color = "#454545" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"yi" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/structure/cable/blue, +/obj/machinery/power/sensor{ + name = "Powernet Sensor - Command Subgrid"; + name_tag = "Command Subgrid" + }, +/obj/machinery/power/apc/angled{ + dir = 8 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/substation/command) +"yj" = ( +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 9 + }, +/turf/simulated/wall/bay/r_wall/steel, +/area/stellardelight/deck3/aft) +"ym" = ( +/obj/structure/table/rack, +/obj/random/maintenance, +/obj/random/maintenance/clean, +/obj/random/maintenance/engineering, +/obj/random/maintenance/security, +/obj/random/contraband, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardfore) +"yo" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"yp" = ( +/obj/structure/cable/blue{ + icon_state = "1-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 9 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 9 + }, +/obj/machinery/computer/cryopod/robot{ + pixel_x = 32 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"yq" = ( +/obj/machinery/light/small{ + dir = 4 + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/readingroom) +"ys" = ( +/obj/machinery/atm{ + pixel_y = 30 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"yt" = ( +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"yw" = ( +/obj/effect/floor_decal/techfloor/orange{ + dir = 9 + }, +/obj/structure/closet/emergsuit_wall{ + pixel_y = 29 + }, +/obj/structure/closet/emergsuit_wall{ + dir = 8; + pixel_x = -27 + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/transitgateway) +"yy" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarroomb) +"yB" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/carpet/tealcarpet, +/area/crew_quarters/heads/cmo) +"yC" = ( +/obj/machinery/power/apc/angled{ + dir = 4 + }, +/obj/structure/cable/blue, +/turf/simulated/floor/tiled/dark, +/area/lawoffice) +"yE" = ( +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"yF" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/double/glass{ + name = "glass airlock" + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/portdock) +"yH" = ( +/obj/structure/cable{ + icon_state = "4-8" + }, +/turf/simulated/wall/bay/r_wall/blue, +/area/ai_cyborg_station) +"yI" = ( +/obj/item/weapon/folder{ + pixel_x = -4 + }, +/obj/item/weapon/folder/blue{ + pixel_x = 5 + }, +/obj/item/weapon/folder/red{ + pixel_y = 3 + }, +/obj/item/weapon/folder/yellow, +/obj/structure/table/darkglass, +/obj/machinery/light, +/turf/simulated/floor/tiled/dark, +/area/lawoffice) +"yJ" = ( +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 10 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 10 + }, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/commandhall) +"yM" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/standard/color{ + door_color = "#323d80"; + fill_color = "#313866"; + name = "Head of Personnel"; + req_access = list(57); + stripe_color = "#a3d1d1" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/crew_quarters/heads/hop) +"yP" = ( +/obj/structure/sign/warning/falling{ + pixel_x = 32 + }, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"yR" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"yS" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/access_button{ + command = "cycle_exterior"; + dir = 4; + frequency = 1380; + master_tag = "sd_starboard_landing"; + pixel_y = 32; + req_one_access = list(13) + }, +/obj/machinery/door/airlock/angled_bay/external/glass{ + dir = 4; + frequency = 1380; + id_tag = null; + locked = 1; + name = "Docking Port Airlock" + }, +/obj/effect/map_helper/airlock/door/ext_door, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/starboarddock) +"yV" = ( +/obj/machinery/light{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"yW" = ( +/obj/effect/floor_decal/industrial/warning{ + dir = 4 + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"yY" = ( +/obj/structure/table/steel, +/obj/random/maintenance/clean, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportroomb) +"yZ" = ( +/obj/machinery/door/airlock/angled_bay/hatch{ + name = "maintenance access"; + stripe_color = "#454545" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/readingroom) +"za" = ( +/obj/machinery/cryopod/robot/door/gateway, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/transitgateway) +"zb" = ( +/obj/machinery/atmospherics/pipe/manifold4w/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/manifold4w/hidden/supply, +/obj/structure/cable/blue{ + icon_state = "1-4" + }, +/obj/structure/cable/blue{ + icon_state = "1-8" + }, +/obj/structure/cable/blue{ + icon_state = "2-4" + }, +/obj/structure/cable/blue{ + icon_state = "2-8" + }, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"zf" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardfore) +"zg" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_upload) +"zi" = ( +/obj/effect/floor_decal/emblem/nt2, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_upload) +"zk" = ( +/obj/effect/landmark{ + name = "droppod_landing" + }, +/turf/space, +/area/space) +"zm" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/structure/table/reinforced, +/obj/machinery/photocopier/faxmachine{ + department = "Head of Personnel's Office" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 + }, +/obj/machinery/alarm/angled, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"zn" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/low_wall/bay/reinforced/blue, +/turf/simulated/floor, +/area/tcommsat/computer) +"zo" = ( +/obj/structure/bed/chair{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/carpet/blue2, +/area/lawoffice) +"zp" = ( +/obj/machinery/light/small{ + dir = 8 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportroomb) +"zr" = ( +/obj/machinery/cryopod, +/obj/effect/floor_decal/corner_techfloor_grid{ + dir = 5 + }, +/obj/effect/floor_decal/corner_techfloor_grid{ + dir = 10 + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/cryo) +"zt" = ( +/obj/structure/table/steel, +/obj/random/contraband, +/obj/random/maintenance/clean, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportroomb) +"zv" = ( +/obj/item/weapon/bedsheet/rddouble, +/obj/structure/bed/double/padded, +/obj/structure/curtain/black{ + color = "#361447" + }, +/obj/effect/landmark/start/rd, +/turf/simulated/floor/carpet/purcarpet, +/area/crew_quarters/heads/hor) +"zw" = ( +/obj/machinery/embedded_controller/radio/airlock/airlock_controller{ + dir = 8; + id_tag = "portmaint_airlock"; + pixel_x = 24; + req_access = null; + req_one_access = list(13); + tag_airpump = "portmaint_airpump"; + tag_chamber_sensor = "portmaint_sensor"; + tag_exterior_door = "portmaint_exterior"; + tag_interior_door = "portmaint_interior" + }, +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/portcent) +"zy" = ( +/obj/machinery/camera/network/halls{ + dir = 8 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"zz" = ( +/turf/simulated/wall/bay/steel, +/area/stellardelight/deck3/commandhall) +"zA" = ( +/obj/structure/cable{ + icon_state = "1-2" + }, +/obj/structure/table/steel, +/obj/random/maintenance/engineering, +/obj/random/maintenance/security, +/obj/random/maintenance/clean, +/obj/random/maintenance, +/obj/random/contraband, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardfore) +"zB" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/effect/landmark{ + name = "lightsout" + }, +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"zC" = ( +/obj/item/toy/figure/mime, +/obj/item/weapon/pen/crayon/marker/mime, +/obj/item/weapon/pen/crayon/mime, +/obj/structure/table/woodentable, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 4 + }, +/turf/simulated/floor/carpet/bcarpet, +/area/stellardelight/deck3/clownmimeoffice) +"zD" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/effect/floor_decal/industrial/warning{ + dir = 1 + }, +/obj/structure/sign/warning/secure_area{ + pixel_x = -32 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_server_room) +"zE" = ( +/obj/structure/table/bench/padded, +/obj/effect/landmark/start/commandsecretary, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/cafe) +"zF" = ( +/obj/structure/cable{ + icon_state = "0-4" + }, +/obj/machinery/power/apc/angled{ + dir = 8 + }, +/turf/simulated/floor/carpet/bcarpet, +/area/stellardelight/deck3/clownmimeoffice) +"zH" = ( +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor, +/area/stellardelight/deck2/port) +"zI" = ( +/obj/structure/cable/green{ + icon_state = "1-4" + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment{ + dir = 1; + icon_state = "pipe-c" + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 6 + }, +/obj/effect/floor_decal/arrivals, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"zJ" = ( +/obj/effect/floor_decal/techfloor{ + dir = 9 + }, +/obj/effect/landmark{ + name = "JoinLateCryo" + }, +/obj/machinery/alarm/angled{ + pixel_x = -32; + pixel_y = 19 + }, +/obj/structure/closet/emergsuit_wall{ + pixel_y = 29 + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/cryo) +"zL" = ( +/obj/structure/cable{ + icon_state = "1-4" + }, +/obj/structure/disposalpipe/segment{ + dir = 1; + icon_state = "pipe-c" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 5 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 5 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"zM" = ( +/obj/effect/landmark{ + name = "JoinLateCyborg" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/effect/landmark/start/cyborg, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"zN" = ( +/turf/simulated/wall/bay/r_wall/blue, +/area/crew_quarters/heads/hos) +"zQ" = ( +/obj/structure/table/steel, +/obj/item/device/flashlight/lamp, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportrooma) +"zS" = ( +/obj/structure/handrail{ + dir = 1 + }, +/obj/machinery/power/apc{ + pixel_y = -28; + req_access = null; + req_one_access = list(11,67) + }, +/obj/structure/cable/green, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"zV" = ( +/obj/structure/cable/green{ + icon_state = "1-4" + }, +/obj/structure/closet/crate, +/obj/random/contraband, +/obj/random/maintenance, +/obj/random/snack, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/aftstarroom) +"zW" = ( +/obj/structure/lattice, +/obj/structure/sign/warning/falling{ + pixel_y = 32 + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"zX" = ( +/turf/simulated/wall/bay/r_wall/steel, +/area/stellardelight/deck3/readingroom) +"zY" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/universal{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"Ae" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"Af" = ( +/obj/structure/closet/crate/bin{ + anchored = 1 + }, +/obj/machinery/atmospherics/unary/vent_scrubber/on, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/readingroom) +"Ai" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/effect/landmark{ + name = "maint_pred" + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/forestarrooma) +"Aj" = ( +/obj/item/device/camera, +/obj/item/device/camera_film, +/obj/item/device/taperecorder, +/obj/item/device/tape/random, +/obj/item/device/tape/random, +/obj/item/weapon/storage/secure/briefcase, +/obj/structure/closet/walllocker_double/east, +/turf/simulated/floor/carpet/blue2, +/area/lawoffice) +"Al" = ( +/obj/machinery/power/apc/angled{ + dir = 4; + name = "night shift APC"; + nightshift_setting = 2 + }, +/obj/structure/cable/green{ + icon_state = "0-8" + }, +/obj/structure/table/rack, +/obj/random/maintenance, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/aftstarroom) +"Am" = ( +/obj/machinery/power/apc/angled{ + dir = 4; + req_access = list(19,43,67) + }, +/obj/structure/cable/green{ + icon_state = "0-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/unary/vent_pump/on, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/readingroom) +"An" = ( +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 10 + }, +/turf/simulated/floor/carpet, +/area/crew_quarters/heads/hop) +"Ap" = ( +/obj/structure/cable{ + icon_state = "1-4" + }, +/obj/structure/disposalpipe/segment{ + dir = 4; + icon_state = "pipe-c" + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 8 + }, +/obj/structure/cable{ + icon_state = "4-8" + }, +/turf/simulated/floor, +/area/stellardelight/deck2/starboard) +"Aq" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 10 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"As" = ( +/obj/structure/cable{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 5 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"At" = ( +/obj/structure/table/glass, +/obj/item/device/flashlight/lamp/green, +/turf/simulated/floor/carpet, +/area/stellardelight/deck3/readingroom) +"Av" = ( +/obj/effect/floor_decal/techfloor{ + dir = 6 + }, +/obj/effect/landmark{ + name = "JoinLateCryo" + }, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 1 + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/cryo) +"Aw" = ( +/obj/machinery/camera/network/command{ + dir = 9 + }, +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"Ax" = ( +/obj/machinery/holoplant, +/turf/simulated/floor/bluegrid, +/area/ai_cyborg_station) +"Ay" = ( +/obj/structure/table/steel, +/obj/random/maintenance/engineering, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarrooma) +"Az" = ( +/obj/item/weapon/camera_assembly, +/obj/item/weapon/camera_assembly, +/obj/item/weapon/camera_assembly, +/obj/item/weapon/camera_assembly, +/obj/item/weapon/camera_assembly, +/obj/item/weapon/camera_assembly, +/obj/structure/closet/crate{ + name = "Camera Assembly Crate" + }, +/obj/machinery/light{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"AD" = ( +/obj/structure/handrail, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 10 + }, +/obj/machinery/embedded_controller/radio/airlock/docking_port{ + frequency = 1380; + id_tag = "sdboat_docker"; + pixel_x = 5; + pixel_y = 25 + }, +/obj/machinery/airlock_sensor{ + dir = 8; + frequency = 1380; + id_tag = null; + pixel_x = 25; + pixel_y = 2 + }, +/obj/effect/map_helper/airlock/sensor/chamber_sensor, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"AE" = ( +/obj/structure/table/glass, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 1 + }, +/turf/simulated/floor/tiled/eris/white/cargo, +/area/crew_quarters/heads/cmo) +"AH" = ( +/obj/structure/cable{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 4 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"AK" = ( +/obj/random/trash_pile, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"AP" = ( +/obj/machinery/power/apc/angled{ + dir = 4 + }, +/obj/structure/cable/blue{ + icon_state = "0-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/chief) +"AQ" = ( +/obj/structure/closet/crate, +/obj/random/contraband, +/obj/random/contraband, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarrooma) +"AS" = ( +/obj/machinery/computer/telecomms/server{ + dir = 8; + network = "tcommsat" + }, +/obj/machinery/alarm/angled{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"AT" = ( +/obj/structure/cable{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/double{ + name = "maintenance access"; + stripe_color = "#454545" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"AU" = ( +/obj/machinery/light/small, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 1 + }, +/obj/structure/bed/chair{ + dir = 8 + }, +/turf/simulated/floor, +/area/stellardelight/deck2/central) +"AX" = ( +/obj/structure/table/reinforced, +/obj/machinery/recharger{ + pixel_y = 6 + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"AY" = ( +/obj/machinery/door/firedoor/glass/hidden/steel{ + dir = 8 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"AZ" = ( +/obj/machinery/porta_turret, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_upload) +"Bb" = ( +/obj/structure/bed/chair/bay/comfy/blue{ + dir = 1 + }, +/obj/structure/panic_button/small{ + pixel_x = -29; + pixel_y = 30 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/fore{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"Bd" = ( +/obj/machinery/alarm/angled{ + dir = 8 + }, +/obj/structure/bookcase, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/readingroom) +"Be" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/obj/effect/floor_decal/steeldecal/steel_decals_central5{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Bg" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/machinery/door/airlock/angled_bay/hatch{ + dir = 4; + name = "maintenance access"; + stripe_color = "#454545" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/maintenance/stellardelight/deck3/starboardaft) +"Bj" = ( +/obj/machinery/message_server, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_server_room) +"Bk" = ( +/obj/machinery/computer/aiupload{ + dir = 4 + }, +/obj/machinery/light{ + dir = 8 + }, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_upload) +"Bl" = ( +/obj/machinery/atmospherics/unary/vent_pump/high_volume{ + dir = 8; + id_tag = null + }, +/obj/machinery/embedded_controller/radio/airlock/airlock_controller{ + frequency = 1380; + id_tag = "tcommsairlock"; + pixel_y = 24; + req_one_access = list(61) + }, +/obj/effect/map_helper/airlock/atmos/chamber_pump, +/obj/effect/map_helper/airlock/sensor/chamber_sensor, +/obj/machinery/airlock_sensor{ + dir = 8; + pixel_x = 25 + }, +/turf/simulated/floor, +/area/tcommsat/computer) +"Bm" = ( +/obj/structure/closet/emcloset, +/obj/random/drinkbottle, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"Bn" = ( +/obj/effect/landmark{ + name = "maint_pred" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/aftstarroom) +"Bp" = ( +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/substation/command) +"Bq" = ( +/obj/machinery/status_display{ + pixel_y = 32 + }, +/turf/simulated/floor/tiled/dark, +/area/lawoffice) +"Br" = ( +/obj/structure/table/alien{ + name = "fancy table" + }, +/obj/machinery/photocopier/faxmachine{ + department = "Research Director's Office" + }, +/turf/simulated/floor/tiled/techfloor, +/area/crew_quarters/heads/hor) +"Bs" = ( +/obj/machinery/computer/borgupload{ + dir = 8 + }, +/obj/machinery/light{ + dir = 4 + }, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_upload) +"Bt" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/cafe) +"Bz" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/door/airlock/angled_bay/standard/color{ + dir = 4; + door_color = "#323d80"; + fill_color = "#313866"; + id_tag = "cmodoor"; + name = "Chief Medical Officer"; + req_access = list(40); + stripe_color = "#ffffff" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/crew_quarters/heads/cmo) +"BA" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/external/glass{ + dir = 4; + frequency = 1380; + id_tag = null; + locked = 1; + name = "Docking Port Airlock" + }, +/obj/effect/map_helper/airlock/door/ext_door, +/obj/machinery/access_button{ + command = "cycle_exterior"; + dir = 8; + frequency = 1380; + master_tag = "sd_port_landing"; + pixel_y = 32; + req_one_access = list(13) + }, +/obj/structure/cable{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/portdock) +"BB" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/stellardelight/deck3/aft) +"BC" = ( +/obj/structure/disposalpipe/segment{ + dir = 4; + icon_state = "pipe-c" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 6 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 1 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 6 + }, +/obj/structure/cable/green{ + icon_state = "2-4" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"BF" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/hatch{ + door_color = "#e6ab22"; + name = "Command Substation"; + req_one_access = list(10); + stripe_color = "#e6ab22" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/maintenance/stellardelight/substation/command) +"BG" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/table/rack, +/obj/random/maintenance/clean, +/obj/random/maintenance, +/obj/random/maintenance/engineering, +/obj/random/maintenance/research, +/obj/random/maintenance/research, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"BH" = ( +/turf/simulated/floor/carpet, +/area/crew_quarters/heads/hos) +"BJ" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/double/glass{ + name = "glass airlock" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/starboarddock) +"BK" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"BL" = ( +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 1 + }, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"BM" = ( +/obj/structure/sign/painting/library_secure{ + pixel_x = -30 + }, +/turf/simulated/floor/carpet/oracarpet, +/area/crew_quarters/heads/chief) +"BQ" = ( +/obj/structure/cable/blue{ + icon_state = "1-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 9 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/light_switch{ + dir = 4; + pixel_x = -24; + pixel_y = 24 + }, +/turf/simulated/floor/tiled/techfloor, +/area/crew_quarters/heads/hor) +"BR" = ( +/obj/machinery/atmospherics/unary/vent_pump/high_volume{ + dir = 1; + frequency = 1380; + id_tag = null + }, +/obj/machinery/embedded_controller/radio/airlock/docking_port_multi{ + dir = 4; + frequency = 1380; + id_tag = "sd_escape_center_left"; + master_tag = "escape_dock"; + pixel_x = -24; + req_one_access = list(13); + tag_airpump = null; + tag_chamber_sensor = null; + tag_exterior_door = null; + tag_interior_door = null + }, +/obj/machinery/airlock_sensor{ + dir = 8; + frequency = 1380; + id_tag = null; + pixel_x = 25 + }, +/obj/effect/map_helper/airlock/atmos/chamber_pump, +/obj/effect/map_helper/airlock/sensor/chamber_sensor, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"BV" = ( +/obj/structure/bed/chair{ + dir = 8 + }, +/obj/machinery/alarm/angled{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"BW" = ( +/obj/machinery/power/terminal{ + dir = 1 + }, +/obj/structure/cable{ + icon_state = "0-4" + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/fuel{ + dir = 1 + }, +/obj/effect/landmark/stardog, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"BY" = ( +/obj/machinery/newscaster{ + layer = 3.3; + pixel_x = -27 + }, +/turf/simulated/floor/carpet/blue2, +/area/lawoffice) +"BZ" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/door/firedoor/glass, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"Cb" = ( +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 4 + }, +/obj/effect/landmark/vermin, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"Cc" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/hatch{ + dir = 4; + name = "maintenance access"; + stripe_color = "#454545" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/aft) +"Cd" = ( +/obj/structure/table/woodentable, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 1 + }, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/cafe) +"Ce" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/carpet/turcarpet, +/area/ai) +"Cf" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/machinery/door/airlock/angled_bay/hatch{ + dir = 4; + name = "maintenance access"; + stripe_color = "#454545" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/maintenance/stellardelight/deck3/portcent) +"Cn" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 5 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 5 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"Co" = ( +/obj/machinery/button/remote/airlock{ + id = "readingroom2"; + name = "Room 2 Lock"; + pixel_y = 24; + specialfunctions = 4 + }, +/obj/machinery/button/remote/blast_door{ + id = "readingroom2"; + name = "Window Lockdown"; + pixel_x = -10; + pixel_y = 24 + }, +/turf/simulated/floor/carpet, +/area/stellardelight/deck3/readingroom) +"Cp" = ( +/obj/machinery/door/firedoor/glass, +/turf/simulated/floor, +/area/stellardelight/deck2/fore) +"Cu" = ( +/obj/machinery/power/apc/angled{ + dir = 1 + }, +/obj/structure/cable/green{ + icon_state = "0-8" + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 1 + }, +/obj/random/vendorfood, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Cw" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 10 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 10 + }, +/obj/structure/cable/blue{ + icon_state = "2-8" + }, +/obj/structure/cable/blue{ + icon_state = "2-4" + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"Cx" = ( +/obj/effect/shuttle_landmark{ + base_area = /area/stellardelight/deck3/exterior; + base_turf = /turf/simulated/floor/reinforced/airless; + docking_controller = "escape_dock"; + landmark_tag = "escape_station"; + name = "Ship Arrivals" + }, +/turf/simulated/floor/reinforced/airless, +/area/stellardelight/deck3/exterior) +"Cy" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 8; + icon_state = "pipe-c" + }, +/obj/machinery/atmospherics/pipe/manifold4w/hidden/supply, +/obj/machinery/atmospherics/pipe/manifold4w/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/manifold/hidden{ + dir = 4 + }, +/obj/effect/floor_decal/arrivals/right, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Cz" = ( +/obj/structure/lattice, +/obj/structure/disposalpipe/segment{ + dir = 8; + icon_state = "pipe-c" + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"CA" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/machinery/door/blast/angled/open{ + dir = 2; + id = "barlockdown" + }, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/crew_quarters/bar) +"CC" = ( +/turf/simulated/wall/bay/r_wall/steel, +/area/stellardelight/deck3/clownmimeoffice) +"CD" = ( +/obj/machinery/atmospherics/unary/vent_pump/high_volume{ + dir = 8; + frequency = 1380; + id_tag = null + }, +/obj/machinery/embedded_controller/radio/airlock/docking_port_multi{ + frequency = 1380; + id_tag = "sd_escape_port"; + master_tag = "escape_dock"; + pixel_y = 30; + req_one_access = list(13); + tag_airpump = null; + tag_chamber_sensor = null; + tag_exterior_door = null; + tag_interior_door = null + }, +/obj/machinery/airlock_sensor{ + frequency = 1380; + id_tag = null; + pixel_y = -25 + }, +/obj/effect/map_helper/airlock/atmos/chamber_pump, +/obj/effect/map_helper/airlock/sensor/chamber_sensor, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"CG" = ( +/obj/machinery/blackbox_recorder, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_server_room) +"CH" = ( +/obj/machinery/light/small{ + dir = 8 + }, +/obj/structure/cable{ + icon_state = "4-8" + }, +/turf/simulated/floor, +/area/stellardelight/deck2/starboard) +"CJ" = ( +/obj/structure/lattice, +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"CK" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"CO" = ( +/obj/effect/overmap/visitable/ship/stellar_delight, +/turf/space, +/area/space) +"CP" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/obj/effect/floor_decal/arrivals/right, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"CR" = ( +/obj/structure/bed/chair{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 6 + }, +/obj/machinery/newscaster{ + pixel_y = 28 + }, +/turf/simulated/floor/carpet, +/area/crew_quarters/heads/hop) +"CS" = ( +/obj/structure/lattice, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"CT" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 1 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"CU" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor, +/area/stellardelight/deck2/fore) +"CV" = ( +/obj/structure/bed/chair, +/obj/structure/sign/painting/public{ + pixel_y = 30 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"CY" = ( +/obj/effect/floor_decal/techfloor{ + dir = 8 + }, +/obj/effect/landmark{ + name = "JoinLateCryo" + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/cryo) +"Dd" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/open, +/area/crew_quarters/bar) +"De" = ( +/obj/structure/cable{ + icon_state = "2-4" + }, +/turf/simulated/wall/bay/r_wall/blue, +/area/ai_cyborg_station) +"Df" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/stellardelight/deck2/fore) +"Dh" = ( +/obj/machinery/computer/message_monitor{ + dir = 1 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_server_room) +"Di" = ( +/obj/effect/floor_decal/industrial/warning{ + dir = 1 + }, +/obj/structure/cable/green{ + icon_state = "2-4" + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"Dk" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/structure/reagent_dispensers/watertank, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"Dn" = ( +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"Dp" = ( +/obj/random/trash_pile, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"Ds" = ( +/obj/machinery/hologram/holopad, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"Du" = ( +/obj/machinery/vending/wardrobe/clowndrobe, +/turf/simulated/floor/carpet/gaycarpet, +/area/stellardelight/deck3/clownmimeoffice) +"Dw" = ( +/obj/machinery/hologram/holopad, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 1 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 1 + }, +/turf/simulated/floor/carpet/geo, +/area/ai) +"Dy" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/black, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"DC" = ( +/turf/simulated/wall/bay/steel, +/area/maintenance/stellardelight/deck3/foreportroomb) +"DD" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/door/airlock/angled_bay/standard/glass{ + name = "maintenance access" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck2/port) +"DE" = ( +/obj/structure/cable{ + icon_state = "4-8" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"DH" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 5 + }, +/obj/structure/cable/green{ + icon_state = "1-4" + }, +/turf/simulated/open, +/area/crew_quarters/bar) +"DI" = ( +/obj/machinery/power/apc/angled{ + dir = 8 + }, +/obj/structure/cable/blue{ + icon_state = "0-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/tiled/techfloor, +/area/crew_quarters/heads/hor) +"DL" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 1 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_server_room) +"DM" = ( +/obj/structure/table/steel, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportrooma) +"DN" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 9 + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"DO" = ( +/obj/structure/closet/hydrant{ + pixel_y = 28 + }, +/obj/structure/dogbed{ + name = "catslug bed" + }, +/mob/living/simple_mob/vore/alienanimals/catslug/tulidaan, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/readingroom) +"DP" = ( +/obj/effect/floor_decal/industrial/warning/corner, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"DQ" = ( +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardfore) +"DT" = ( +/obj/structure/railing/grey, +/obj/structure/railing/grey{ + dir = 4 + }, +/turf/simulated/open, +/area/maintenance/stellardelight/deck3/portaft) +"DV" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/wall/bay/blue, +/area/lawoffice) +"DW" = ( +/obj/structure/cable{ + icon_state = "1-2" + }, +/obj/machinery/button/remote/blast_door{ + dir = 8; + id = "clownmimeoffice"; + name = "Window Lockdown"; + pixel_x = 23; + pixel_y = 7 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 10 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 10 + }, +/turf/simulated/floor/carpet/gaycarpet, +/area/stellardelight/deck3/clownmimeoffice) +"DY" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportrooma) +"DZ" = ( +/obj/structure/cable{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"Ec" = ( +/turf/simulated/wall/bay/steel, +/area/stellardelight/deck3/clownmimeoffice) +"Ed" = ( +/turf/simulated/wall/bay/r_wall/steel, +/area/stellardelight/deck3/aft) +"Ee" = ( +/obj/machinery/atmospherics/pipe/manifold/hidden/black{ + dir = 1 + }, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"Ef" = ( +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/forestarroomb) +"Eg" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 9 + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/camera/network/halls{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"Eh" = ( +/obj/effect/floor_decal/techfloor{ + dir = 4 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 10 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 9 + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/cryo) +"Ei" = ( +/obj/structure/cable/green{ + icon_state = "1-4" + }, +/obj/random/trash_pile, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"El" = ( +/obj/effect/landmark{ + name = "carpspawn" + }, +/turf/space, +/area/space) +"En" = ( +/obj/effect/floor_decal/industrial/warning/corner{ + dir = 1 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"Es" = ( +/obj/effect/shuttle_landmark/premade/sd/deck3/portlanding, +/turf/space, +/area/space) +"Et" = ( +/obj/structure/closet/secure_closet/hos, +/obj/item/device/radio/intercom{ + dir = 1; + name = "Station Intercom (General)"; + pixel_y = 24 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor/tiled/dark, +/area/crew_quarters/heads/hos) +"Eu" = ( +/turf/simulated/wall/bay/r_wall/blue, +/area/stellardelight/deck2/port) +"Ev" = ( +/obj/structure/cable/blue{ + icon_state = "1-4" + }, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment{ + dir = 4; + icon_state = "pipe-c" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"Ex" = ( +/obj/structure/bed/chair/bay/comfy/blue{ + dir = 1 + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/fore{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"EE" = ( +/obj/structure/table/rack{ + dir = 8; + layer = 2.9 + }, +/obj/item/weapon/rig/ce/equipped, +/obj/item/clothing/mask/breath, +/obj/item/clothing/shoes/magboots/adv, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/chief) +"EF" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"EH" = ( +/obj/structure/table/steel, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportroomb) +"EI" = ( +/obj/machinery/atmospherics/unary/vent_pump/high_volume{ + dir = 8; + frequency = 1379; + id_tag = "portmaint_airpump" + }, +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/portcent) +"EJ" = ( +/turf/simulated/wall/bay/r_wall/blue, +/area/crew_quarters/heads/cmo) +"EL" = ( +/obj/machinery/door/airlock/angled_bay/hatch{ + frequency = null; + id_tag = null; + locked = 1; + name = "Telecoms Server Access"; + req_access = list(61); + stripe_color = "#ffd863" + }, +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/access_button{ + command = "cycle_exterior"; + dir = 1; + frequency = 1380; + master_tag = "tcommsairlock"; + pixel_x = -32; + req_one_access = list(61) + }, +/obj/effect/map_helper/airlock/door/ext_door, +/turf/simulated/floor/tiled/steel_ridged, +/area/tcommsat/computer) +"EN" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/obj/effect/floor_decal/steeldecal/steel_decals_central5{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"EO" = ( +/obj/structure/sign/nanotrasen{ + pixel_y = 30 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 6 + }, +/turf/simulated/floor/tiled/dark, +/area/lawoffice) +"ER" = ( +/turf/simulated/floor/tiled/steel_grid, +/area/stellardelight/deck3/aft) +"ET" = ( +/obj/structure/cable{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"EU" = ( +/obj/structure/cable/blue{ + icon_state = "2-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"EV" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"EW" = ( +/obj/structure/cable/blue{ + icon_state = "1-4" + }, +/obj/structure/cable/blue{ + icon_state = "1-8" + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers, +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"EX" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/fuel{ + dir = 10 + }, +/turf/simulated/wall/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"EY" = ( +/obj/structure/table/reinforced, +/obj/machinery/computer/skills{ + dir = 8; + pixel_y = 6 + }, +/turf/simulated/floor/carpet/oracarpet, +/area/crew_quarters/heads/chief) +"EZ" = ( +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/deck3/forestarroomb) +"Fb" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/open, +/area/crew_quarters/bar) +"Fe" = ( +/obj/machinery/hologram/holopad, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_upload) +"Ff" = ( +/obj/structure/bed/chair, +/obj/machinery/atmospherics/unary/vent_scrubber/on, +/obj/machinery/alarm/angled, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 1 + }, +/obj/effect/landmark/vermin, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Fg" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/door/airlock/angled_bay/standard/color{ + dir = 4; + door_color = "#323d80"; + fill_color = "#854a44"; + id_tag = "hosdoor"; + name = "Head of Security"; + req_access = list(58); + stripe_color = "#d27428" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/crew_quarters/heads/hos) +"Fh" = ( +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_server_room) +"Fj" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/turf/simulated/floor, +/area/stellardelight/deck2/fore) +"Fm" = ( +/obj/machinery/atmospherics/unary/vent_pump/high_volume{ + dir = 8; + frequency = 1379; + id_tag = "portmaint_airpump" + }, +/obj/machinery/camera/network/civilian, +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/portcent) +"Fr" = ( +/obj/structure/disposalpipe/segment{ + dir = 4; + icon_state = "pipe-c" + }, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/commandhall) +"Ft" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4; + icon_state = "pipe-c" + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 8 + }, +/turf/simulated/floor, +/area/stellardelight/deck2/port) +"Fv" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"Fy" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/portcent) +"FC" = ( +/obj/machinery/alarm/angled{ + dir = 8 + }, +/obj/structure/cable/blue{ + icon_state = "2-4" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor/tiled/dark, +/area/lawoffice) +"FD" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarroomb) +"FE" = ( +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarroomb) +"FG" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 5 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"FH" = ( +/obj/machinery/power/pointdefense{ + id_tag = "sd_pd" + }, +/obj/effect/floor_decal/industrial/warning/full, +/obj/structure/cable/green{ + icon_state = "0-2" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"FI" = ( +/obj/effect/floor_decal/industrial/warning/corner{ + dir = 1 + }, +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"FL" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"FM" = ( +/obj/structure/bed/chair/comfy/brown{ + dir = 1 + }, +/turf/simulated/floor/tiled/eris/white/cargo, +/area/crew_quarters/heads/cmo) +"FO" = ( +/obj/structure/bed/psych{ + name = "couch" + }, +/turf/simulated/floor/tiled/eris/white/cargo, +/area/crew_quarters/heads/cmo) +"FR" = ( +/obj/effect/floor_decal/techfloor/orange, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/transitgateway) +"FS" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/universal{ + dir = 8 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"FU" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"FW" = ( +/obj/machinery/power/apc/angled{ + dir = 8; + name = "night shift APC"; + nightshift_setting = 2 + }, +/obj/structure/cable/green{ + icon_state = "0-2" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportrooma) +"FY" = ( +/obj/structure/closet, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportrooma) +"Ga" = ( +/obj/structure/cable/cyan{ + icon_state = "1-4" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/bluegrid, +/area/ai) +"Gc" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 10 + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"Ge" = ( +/obj/structure/table/standard, +/obj/item/weapon/aiModule/nanotrasen, +/obj/machinery/camera/network/command, +/obj/machinery/atmospherics/unary/vent_scrubber/on, +/turf/simulated/floor/bluegrid, +/area/ai_cyborg_station) +"Gf" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/unary/vent_scrubber/on, +/obj/machinery/alarm/angled, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Gg" = ( +/obj/structure/sink{ + dir = 8; + pixel_x = -12; + pixel_y = -3 + }, +/turf/simulated/floor/lino, +/area/stellardelight/deck3/cafe) +"Gh" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/structure/cable/blue{ + icon_state = "2-4" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_upload) +"Gi" = ( +/obj/structure/table/rack, +/obj/item/weapon/rig/hazmat/equipped, +/obj/machinery/light, +/turf/simulated/floor/tiled/techfloor, +/area/crew_quarters/heads/hor) +"Gj" = ( +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/commandhall) +"Gk" = ( +/turf/simulated/wall/bay/r_wall/blue, +/area/maintenance/stellardelight/deck3/portaft) +"Gl" = ( +/obj/structure/bed/chair/office/dark{ + dir = 8 + }, +/obj/effect/landmark/start/cmo, +/turf/simulated/floor/carpet/tealcarpet, +/area/crew_quarters/heads/cmo) +"Gm" = ( +/obj/structure/cable/blue{ + icon_state = "0-2" + }, +/obj/structure/cable/blue, +/obj/machinery/power/smes/buildable{ + RCon_tag = "Substation - Command"; + output_attempt = 0 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/substation/command) +"Go" = ( +/obj/structure/cable/green{ + icon_state = "2-4" + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"Gq" = ( +/obj/structure/cable{ + icon_state = "2-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 2; + icon_state = "pipe-c" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 10 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 10 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 10 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"Gv" = ( +/obj/structure/sign/deck3{ + pixel_x = -32 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"GB" = ( +/obj/item/weapon/reagent_containers/food/drinks/shaker, +/obj/item/weapon/reagent_containers/glass/rag, +/obj/structure/table/rack, +/obj/random/donkpocketbox, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/forestarroomb) +"GD" = ( +/obj/structure/cable/blue{ + icon_state = "1-4" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 5 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"GE" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/door/firedoor/glass, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/aft) +"GF" = ( +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden, +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/portcent) +"GH" = ( +/obj/item/device/radio/intercom{ + dir = 8; + pixel_x = -24 + }, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/readingroom) +"GJ" = ( +/obj/structure/cable/blue{ + icon_state = "1-4" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarrooma) +"GP" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/bluegrid, +/area/ai) +"GQ" = ( +/turf/simulated/wall/bay/red, +/area/crew_quarters/heads/hos) +"GR" = ( +/obj/machinery/requests_console/preset/cmo{ + pixel_x = 30 + }, +/turf/simulated/floor/carpet/tealcarpet, +/area/crew_quarters/heads/cmo) +"GS" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/door/firedoor/glass, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"GT" = ( +/obj/effect/floor_decal/industrial/warning{ + dir = 8 + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/cable/green{ + icon_state = "1-4" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"GU" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_server_room) +"GW" = ( +/obj/structure/table/reinforced, +/obj/item/weapon/book/manual/supermatter_engine, +/obj/item/device/radio{ + pixel_x = -4 + }, +/obj/item/device/megaphone, +/obj/machinery/light, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/chief) +"Ha" = ( +/obj/structure/bed/double/padded, +/obj/item/weapon/bedsheet/cedouble, +/obj/structure/curtain/black{ + color = "#945112" + }, +/obj/effect/landmark/start/ce, +/turf/simulated/floor/carpet/oracarpet, +/area/crew_quarters/heads/chief) +"Hc" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/structure/cable/blue, +/obj/machinery/power/sensor{ + name = "Powernet Sensor - AI/Telecomms Subgrid"; + name_tag = "AI/Telecomms Subgrid" + }, +/obj/machinery/power/apc/angled{ + dir = 8 + }, +/turf/simulated/floor, +/area/ai_cyborg_station) +"Hd" = ( +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 4 + }, +/obj/structure/closet/firecloset, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"He" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor, +/area/stellardelight/deck2/central) +"Hf" = ( +/obj/machinery/atmospherics/unary/vent_pump/on, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"Hg" = ( +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/obj/structure/sign/vacuum{ + pixel_x = -32; + plane = -34 + }, +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"Hh" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/airlock_sensor{ + dir = 4; + id_tag = "starmaint_sensor"; + pixel_x = -24; + req_access = list(13) + }, +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/starboardcent) +"Hi" = ( +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 8 + }, +/obj/item/device/radio/intercom{ + dir = 4; + pixel_x = 24 + }, +/obj/structure/closet/emergsuit_wall{ + pixel_y = 29 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Hk" = ( +/obj/machinery/alarm/angled{ + dir = 8 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"Hm" = ( +/obj/structure/closet/emcloset, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"Ho" = ( +/obj/structure/table/steel, +/obj/random/contraband, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance/clean, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/aftstarroom) +"Hq" = ( +/obj/structure/sign/warning/falling{ + pixel_y = 32 + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"Hs" = ( +/turf/simulated/wall/bay/orange, +/area/crew_quarters/heads/chief) +"Ht" = ( +/obj/machinery/atmospherics/unary/vent_pump{ + dir = 4; + external_pressure_bound = 0; + external_pressure_bound_default = 0; + icon_state = "map_vent_in"; + initialize_directions = 1; + internal_pressure_bound = 4000; + internal_pressure_bound_default = 4000; + pressure_checks = 2; + pressure_checks_default = 2; + pump_direction = 0; + use_power = 1 + }, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"Hu" = ( +/obj/effect/floor_decal/industrial/warning{ + dir = 8 + }, +/obj/machinery/light/small{ + dir = 1 + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/portdock) +"Hv" = ( +/obj/structure/sign/painting/library_secure{ + pixel_x = 30 + }, +/turf/simulated/floor/carpet/blue2, +/area/lawoffice) +"Hw" = ( +/obj/structure/sign/painting/public{ + pixel_y = 30 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Hx" = ( +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"HA" = ( +/obj/structure/cable/cyan, +/obj/machinery/button/remote/blast_door{ + desc = "A remote control-switch for the AI core maintenance door."; + dir = 4; + id = "AICore"; + name = "AI Maintenance Hatch"; + pixel_x = -25; + pixel_y = -5; + req_access = list(16) + }, +/obj/machinery/light, +/obj/machinery/holoplant, +/obj/machinery/power/apc/angled{ + dir = 4 + }, +/turf/simulated/floor/bluegrid, +/area/ai) +"HB" = ( +/obj/effect/floor_decal/spline/plain{ + dir = 4 + }, +/obj/structure/table/bench/marble, +/turf/simulated/floor/lino, +/area/stellardelight/deck3/cafe) +"HF" = ( +/obj/structure/cable/green{ + icon_state = "2-4" + }, +/obj/structure/table/rack, +/obj/random/maintenance/clean, +/obj/random/maintenance, +/obj/random/maintenance, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"HH" = ( +/obj/structure/closet/emcloset, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"HL" = ( +/obj/structure/cable{ + icon_state = "2-8" + }, +/obj/structure/cable{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"HN" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/light{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"HO" = ( +/obj/structure/cable/green{ + icon_state = "1-4" + }, +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/deck3/foreportrooma) +"HP" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/stellardelight/deck3/starboarddock) +"HQ" = ( +/obj/machinery/door/airlock/angled_bay/standard/color{ + door_color = "#9c9c9c"; + fill_color = "#5c5c5c"; + id_tag = null; + name = "Reading Rooms"; + stripe_color = "#89bd66" + }, +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/readingroom) +"HR" = ( +/obj/structure/table/steel, +/obj/random/contraband, +/obj/machinery/chemical_dispenser/bar_coffee/full{ + pixel_y = 8 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportrooma) +"HS" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 9 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 9 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"HT" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"HV" = ( +/obj/structure/cable/green{ + icon_state = "1-4" + }, +/obj/effect/landmark{ + name = "morphspawn" + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/forestarrooma) +"HW" = ( +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 4 + }, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"HX" = ( +/obj/machinery/light{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"HY" = ( +/obj/structure/table/rack, +/obj/random/contraband, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/snack, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"HZ" = ( +/obj/structure/lattice, +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 5 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 1 + }, +/turf/simulated/open, +/area/stellardelight/deck2/central) +"Ia" = ( +/turf/simulated/wall/fancy_shuttle/nondense{ + fancy_shuttle_tag = "sdboat" + }, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"Ib" = ( +/obj/machinery/alarm/angled{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/forestarrooma) +"Ie" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 1 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"Ig" = ( +/obj/structure/lattice, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"Ii" = ( +/turf/simulated/wall/bay/r_wall/steel, +/area/holodeck_control) +"Ij" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/effect/landmark{ + name = "maint_pred" + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportroomb) +"Il" = ( +/obj/machinery/photocopier, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"Im" = ( +/obj/effect/landmark/tram, +/turf/simulated/floor/glass/reinforced, +/area/stellardelight/deck3/aft) +"In" = ( +/obj/structure/cable{ + icon_state = "1-8" + }, +/obj/random/trash_pile, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"Io" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"Ir" = ( +/obj/structure/bed/chair/shuttle{ + dir = 1 + }, +/obj/machinery/light{ + dir = 4 + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"It" = ( +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 5 + }, +/obj/structure/cable{ + icon_state = "2-4" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Iu" = ( +/obj/machinery/holoplant, +/turf/simulated/floor/bluegrid, +/area/ai_server_room) +"Iz" = ( +/obj/effect/floor_decal/industrial/warning, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"IC" = ( +/obj/machinery/computer/station_alert/all, +/obj/machinery/status_display{ + pixel_y = 32 + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/chief) +"ID" = ( +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 8 + }, +/obj/effect/landmark/vines, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"IG" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/structure/cable/blue{ + icon_state = "1-8" + }, +/obj/structure/cable/blue{ + icon_state = "1-4" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"IH" = ( +/obj/structure/lattice, +/obj/structure/cable/green{ + icon_state = "1-4" + }, +/obj/structure/disposalpipe/segment{ + dir = 1; + icon_state = "pipe-c" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 5 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 5 + }, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"II" = ( +/obj/structure/sign/nanotrasen{ + pixel_y = 30 + }, +/obj/machinery/camera/network/command, +/obj/structure/flora/pottedplant/stoutbush, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/commandhall) +"IK" = ( +/obj/effect/floor_decal/industrial/warning{ + dir = 1 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"IN" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"IO" = ( +/obj/structure/lattice, +/obj/structure/cable/green{ + icon_state = "1-4" + }, +/obj/structure/disposalpipe/segment{ + dir = 1; + icon_state = "pipe-c" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 5 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 5 + }, +/obj/machinery/light/small, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"IP" = ( +/obj/structure/table/steel, +/obj/random/contraband, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"IQ" = ( +/obj/machinery/porta_turret/ai_defense, +/turf/simulated/floor/bluegrid, +/area/ai) +"IR" = ( +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"IS" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable{ + icon_state = "1-2" + }, +/obj/machinery/door/airlock/angled_bay/hatch{ + name = "Clown and Mime Office"; + req_one_access = list(138,136); + stripe_color = "#454545" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor, +/area/stellardelight/deck3/clownmimeoffice) +"IU" = ( +/obj/machinery/hologram/holopad, +/obj/structure/sign/warning/secure_area{ + pixel_y = 32 + }, +/turf/simulated/floor/bluegrid, +/area/ai) +"IV" = ( +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 4 + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"IW" = ( +/obj/machinery/status_display{ + pixel_x = 32 + }, +/obj/structure/closet/emcloset, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"IY" = ( +/obj/machinery/airlock_sensor{ + dir = 8; + id_tag = "portmaint_sensor"; + pixel_x = 24; + req_access = list(13) + }, +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/portcent) +"IZ" = ( +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Ja" = ( +/obj/machinery/door/airlock/angled_bay/external/glass{ + frequency = 1379; + id_tag = "starmaint_interior"; + locked = 1; + name = "Exterior Airlock" + }, +/obj/machinery/door/firedoor/glass, +/obj/machinery/access_button{ + command = "cycle_interior"; + frequency = 1379; + master_tag = "starmaint_airlock"; + name = "interior access button"; + pixel_x = 32; + req_access = null; + req_one_access = list(13) + }, +/obj/machinery/atmospherics/pipe/simple/hidden, +/turf/simulated/floor/tiled/steel_ridged, +/area/maintenance/stellardelight/deck3/starboardcent) +"Jc" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/effect/landmark{ + name = "morphspawn" + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportroomb) +"Jd" = ( +/obj/structure/closet/lawcloset, +/obj/structure/sign/poster{ + dir = 8 + }, +/obj/machinery/newscaster{ + pixel_y = 28 + }, +/turf/simulated/floor/tiled/dark, +/area/lawoffice) +"Jg" = ( +/obj/machinery/light{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 6 + }, +/turf/simulated/floor/bluegrid, +/area/ai) +"Jh" = ( +/turf/space, +/area/space) +"Ji" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/cable/green{ + icon_state = "0-2" + }, +/obj/machinery/power/apc/angled{ + dir = 8; + name = "night shift APC"; + nightshift_setting = 2 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"Jj" = ( +/obj/structure/sign/painting/library_secure{ + pixel_x = 30 + }, +/turf/simulated/floor/carpet/tealcarpet, +/area/crew_quarters/heads/cmo) +"Jk" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/transitgateway) +"Jm" = ( +/obj/structure/barricade/cutout/clown, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/clownmimeoffice) +"Jn" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/hatch{ + dir = 4; + name = "maintenance access"; + stripe_color = "#454545" + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/maintenance/stellardelight/deck3/foreportrooma) +"Jo" = ( +/obj/machinery/light{ + dir = 4 + }, +/obj/structure/bed/chair{ + dir = 8 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"Js" = ( +/obj/structure/table/darkglass, +/obj/item/device/radio/intercom{ + dir = 1; + name = "Station Intercom (General)"; + pixel_y = 24 + }, +/obj/item/device/flashlight/lamp/green{ + pixel_x = 5; + pixel_y = -5 + }, +/obj/item/weapon/paper_bin, +/obj/item/weapon/pen/blade/red{ + pixel_x = -2; + pixel_y = -2 + }, +/obj/item/weapon/pen, +/obj/item/weapon/pen/blue{ + pixel_x = 2; + pixel_y = 3 + }, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 4 + }, +/turf/simulated/floor/tiled/dark, +/area/lawoffice) +"Ju" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor, +/area/stellardelight/deck2/port) +"Jv" = ( +/obj/machinery/computer/aifixer, +/obj/machinery/status_display{ + pixel_y = 32 + }, +/turf/simulated/floor/tiled/techfloor, +/area/crew_quarters/heads/hor) +"Jx" = ( +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/deck3/forestarrooma) +"Jz" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/door/airlock/angled_bay/secure{ + name = "AI Core"; + req_access = list(16) + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/tiled/steel_ridged, +/area/ai) +"JA" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/external/glass{ + frequency = 1380; + id_tag = null; + locked = 1; + name = "Docking Port Airlock" + }, +/obj/effect/map_helper/airlock/door/ext_door, +/obj/machinery/access_button{ + command = "cycle_exterior"; + frequency = 1380; + master_tag = "sd_escape_center_left"; + pixel_x = -32; + req_one_access = list(13) + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/aft) +"JE" = ( +/obj/machinery/power/apc/angled{ + dir = 1 + }, +/obj/structure/cable/green{ + icon_state = "0-2" + }, +/obj/structure/table/woodentable, +/obj/item/weapon/reagent_containers/food/drinks/glass2/square{ + pixel_x = 8; + pixel_y = 8 + }, +/obj/item/weapon/reagent_containers/food/drinks/glass2/square{ + pixel_x = 8; + pixel_y = 8 + }, +/obj/item/weapon/reagent_containers/food/drinks/glass2/square{ + pixel_x = 8; + pixel_y = 8 + }, +/obj/item/weapon/reagent_containers/glass/rag, +/turf/simulated/floor/lino, +/area/stellardelight/deck3/cafe) +"JJ" = ( +/obj/machinery/computer/aifixer, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"JK" = ( +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/ai_cyborg_station) +"JO" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"JP" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/door/airlock/angled_bay/secure{ + name = "AI Upload"; + req_access = list(16) + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled/steel_ridged, +/area/ai_upload) +"JQ" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/turretid/stun{ + control_area = /area/ai_upload; + name = "AI Upload turret control"; + pixel_x = -32; + pixel_y = 30 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_upload) +"JR" = ( +/obj/machinery/light{ + dir = 8 + }, +/obj/structure/bed/chair{ + dir = 4 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/obj/structure/cable{ + icon_state = "2-4" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"JS" = ( +/obj/machinery/embedded_controller/radio/docking_port_multi{ + child_names_txt = "Port;Center Left;Center Right;Starboard"; + child_tags_txt = "sd_escape_port;sd_escape_center_left;sd_escape_center_right;sd_escape_starboard"; + dir = 1; + frequency = 1380; + id_tag = "escape_dock"; + pixel_y = -18; + req_one_access = list(13) + }, +/obj/effect/landmark/arrivals, +/turf/simulated/floor/glass/reinforced, +/area/stellardelight/deck3/aft) +"JU" = ( +/obj/structure/table/reinforced, +/obj/item/weapon/rcd, +/obj/item/weapon/rcd_ammo, +/obj/item/weapon/rcd_ammo, +/obj/item/weapon/rcd_ammo, +/obj/item/weapon/rcd_ammo, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/chief) +"JW" = ( +/obj/random/trash_pile, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"JY" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/bed/chair{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportroomb) +"JZ" = ( +/obj/effect/floor_decal/spline/plain, +/obj/structure/table/bench/marble, +/obj/machinery/light{ + dir = 8 + }, +/turf/simulated/floor/lino, +/area/stellardelight/deck3/cafe) +"Kb" = ( +/obj/structure/bed/chair{ + dir = 4 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"Ke" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/fuel{ + dir = 6 + }, +/turf/simulated/wall/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"Kf" = ( +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 1 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5, +/obj/machinery/camera/network/halls{ + dir = 1 + }, +/obj/structure/cable{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Kg" = ( +/obj/structure/cable/green{ + icon_state = "2-4" + }, +/obj/structure/bed/chair/sofa/corp/left{ + dir = 4 + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/move_trader_landmark{ + dir = 4; + trader_type = /obj/trader/general + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"Ki" = ( +/obj/machinery/computer/ship/navigation/telescreen{ + pixel_x = 32 + }, +/obj/machinery/power/shield_generator/charged, +/obj/structure/cable, +/turf/simulated/floor, +/area/stellardelight/deck2/central) +"Kj" = ( +/obj/machinery/computer/shuttle_control/explore/sdboat{ + dir = 4 + }, +/obj/machinery/light{ + dir = 8 + }, +/obj/machinery/power/apc{ + pixel_y = -28; + req_access = null; + req_one_access = list(11,67) + }, +/obj/structure/cable/green{ + icon_state = "0-4" + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/fore{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"Kk" = ( +/obj/structure/table/steel, +/obj/random/maintenance/clean, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/aftstarroom) +"Ko" = ( +/obj/effect/landmark/tram, +/obj/machinery/camera/network/halls{ + dir = 1 + }, +/turf/simulated/floor/glass/reinforced, +/area/stellardelight/deck3/aft) +"Kq" = ( +/obj/structure/table/rack, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance/engineering, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardfore) +"Kr" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/deck3/forestarrooma) +"Ks" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor, +/area/stellardelight/deck2/starboard) +"Kt" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/universal, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"Kv" = ( +/obj/structure/bed/chair{ + dir = 4 + }, +/obj/structure/closet/emergsuit_wall{ + dir = 8; + pixel_x = -27 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"Kw" = ( +/obj/machinery/light{ + dir = 4 + }, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 + }, +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"Kx" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"Ky" = ( +/obj/structure/bed/chair{ + dir = 4 + }, +/obj/machinery/light, +/turf/simulated/floor/glass/reinforced, +/area/stellardelight/deck3/aft) +"Kz" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/structure/closet/emcloset, +/obj/random/contraband, +/obj/random/maintenance/research, +/obj/random/maintenance/research, +/obj/random/maintenance/research, +/obj/random/maintenance/research, +/obj/random/maintenance/research, +/obj/random/maintenance/research, +/obj/random/maintenance/cargo, +/obj/random/mre, +/obj/random/mre, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"KD" = ( +/obj/machinery/atmospherics/pipe/manifold/hidden{ + dir = 1 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"KF" = ( +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 8 + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"KG" = ( +/obj/structure/table/alien{ + name = "fancy table" + }, +/obj/item/weapon/cartridge/signal/science, +/obj/item/weapon/cartridge/signal/science, +/obj/item/clothing/glasses/welding/superior, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 1 + }, +/turf/simulated/floor/tiled/techfloor, +/area/crew_quarters/heads/hor) +"KH" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/camera/network/command{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"KI" = ( +/turf/simulated/floor/wood, +/area/stellardelight/deck3/readingroom) +"KJ" = ( +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"KL" = ( +/obj/machinery/power/apc/angled{ + dir = 8 + }, +/obj/structure/cable/green{ + icon_state = "0-4" + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"KM" = ( +/obj/machinery/alarm/angled{ + dir = 4 + }, +/turf/simulated/floor/carpet/turcarpet, +/area/ai) +"KQ" = ( +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/obj/structure/reagent_dispensers/fueltank, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"KS" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/structure/cable/blue{ + icon_state = "1-4" + }, +/obj/machinery/atmospherics/pipe/manifold4w/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/manifold4w/hidden/supply, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_upload) +"KT" = ( +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 4 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"KU" = ( +/obj/machinery/camera/network/command, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"KV" = ( +/obj/structure/table/steel, +/obj/random/contraband, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarrooma) +"KW" = ( +/obj/machinery/door/firedoor/glass, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"KY" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 5 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"Lb" = ( +/obj/structure/cable{ + icon_state = "1-8" + }, +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/ai_cyborg_station) +"Ld" = ( +/obj/machinery/atmospherics/portables_connector{ + dir = 4 + }, +/obj/machinery/portable_atmospherics/canister/air/airlock, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"Le" = ( +/obj/machinery/atmospherics/unary/vent_scrubber/on, +/obj/structure/flora/pottedplant/minitree, +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Lf" = ( +/obj/structure/sign/warning/falling{ + pixel_x = -32 + }, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"Lh" = ( +/obj/machinery/hologram/holopad, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/structure/cable/blue{ + icon_state = "1-4" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/camera/network/telecom{ + dir = 1 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"Li" = ( +/obj/move_trader_landmark{ + dir = 8; + trader_type = /obj/trader/general + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"Lm" = ( +/obj/random/paicard, +/obj/structure/table/glass, +/obj/machinery/camera/network/civilian{ + dir = 8 + }, +/obj/random/coin/sometimes, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/readingroom) +"Ln" = ( +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardfore) +"Lo" = ( +/obj/effect/mouse_hole_spawner{ + dir = 4 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"Lr" = ( +/obj/effect/shuttle_landmark/premade/sd/deck3/starboardairlock, +/turf/space, +/area/space) +"Lv" = ( +/obj/structure/bed/chair{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/carpet/blue2, +/area/lawoffice) +"Lw" = ( +/obj/effect/floor_decal/spline/plain, +/obj/structure/table/bench/marble, +/turf/simulated/floor/lino, +/area/stellardelight/deck3/cafe) +"Lx" = ( +/obj/effect/landmark{ + name = "JoinLateCyborg" + }, +/obj/machinery/camera/network/command{ + dir = 10 + }, +/obj/effect/landmark/start/cyborg, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"Ly" = ( +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 5 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"Lz" = ( +/obj/machinery/newscaster{ + pixel_x = 30 + }, +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"LC" = ( +/obj/machinery/holoplant, +/obj/structure/sign/warning/secure_area{ + pixel_y = 32 + }, +/obj/machinery/camera/network/command{ + dir = 9 + }, +/turf/simulated/floor/bluegrid, +/area/ai_upload) +"LD" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/structure/cable/green{ + icon_state = "1-4" + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 5 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"LI" = ( +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 9 + }, +/obj/effect/floor_decal/shuttles, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"LJ" = ( +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportrooma) +"LK" = ( +/obj/structure/table/bench/padded, +/obj/structure/sign/painting/public{ + pixel_y = -30 + }, +/obj/machinery/alarm/angled{ + dir = 4 + }, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/cafe) +"LO" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"LP" = ( +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/obj/effect/floor_decal/steeldecal/steel_decals_central5{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"LQ" = ( +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 8 + }, +/obj/structure/closet/emergsuit_wall{ + dir = 4; + pixel_x = 27 + }, +/obj/effect/landmark/vines, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"LR" = ( +/obj/machinery/atmospherics/unary/vent_pump/high_volume{ + dir = 8; + frequency = 1379; + id_tag = "starmaint_airpump" + }, +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/starboardcent) +"LS" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/hatch{ + name = "maintenance access"; + stripe_color = "#454545" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/holodeck_control) +"LT" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/door/airlock/angled_bay/hatch{ + dir = 4; + name = "maintenance access"; + stripe_color = "#454545" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/maintenance/stellardelight/deck3/portaft) +"LV" = ( +/obj/structure/table/steel, +/obj/machinery/chemical_dispenser/bar_soft/full, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarrooma) +"LW" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"LY" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"Mc" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/ladder, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarrooma) +"Mg" = ( +/obj/item/device/camera, +/obj/item/device/camera_film, +/obj/item/device/taperecorder, +/obj/item/device/tape/random, +/obj/item/device/tape/random, +/obj/item/weapon/storage/secure/briefcase, +/obj/structure/closet/walllocker_double/west, +/turf/simulated/floor/carpet/blue2, +/area/lawoffice) +"Mi" = ( +/obj/effect/floor_decal/corner_techfloor_grid{ + dir = 5 + }, +/obj/effect/floor_decal/corner_techfloor_grid{ + dir = 10 + }, +/obj/machinery/power/apc/angled{ + dir = 4 + }, +/obj/structure/cable/green{ + icon_state = "0-8" + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/cryo) +"Mk" = ( +/obj/structure/lattice, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"Ml" = ( +/obj/structure/table/darkglass, +/obj/item/weapon/stamp/denied{ + pixel_x = -6; + pixel_y = 6 + }, +/obj/item/weapon/stamp/internalaffairs, +/turf/simulated/floor/carpet/blue2, +/area/lawoffice) +"Mo" = ( +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/unary/vent_pump/high_volume{ + dir = 4; + frequency = 1380; + id_tag = null + }, +/obj/effect/map_helper/airlock/atmos/chamber_pump, +/obj/effect/map_helper/airlock/sensor/chamber_sensor, +/obj/machinery/airlock_sensor{ + frequency = 1380; + id_tag = null; + pixel_y = -25 + }, +/obj/machinery/embedded_controller/radio/airlock/docking_port{ + frequency = 1380; + id_tag = "sd_port_landing"; + pixel_y = 29 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"Mp" = ( +/obj/machinery/power/breakerbox/activated{ + RCon_tag = "AI/Telecomms Substation Bypass" + }, +/turf/simulated/floor, +/area/ai_cyborg_station) +"Mr" = ( +/obj/structure/bed/double/padded, +/obj/item/weapon/bedsheet/clowndouble, +/obj/structure/curtain/black{ + color = "#361447" + }, +/turf/simulated/floor/carpet/gaycarpet, +/area/stellardelight/deck3/clownmimeoffice) +"Ms" = ( +/obj/structure/table/reinforced, +/obj/item/weapon/stamp/hop, +/obj/item/weapon/paper_bin{ + pixel_x = -3; + pixel_y = 7 + }, +/obj/item/weapon/pen/multi, +/obj/item/device/flashlight/lamp/green{ + pixel_x = 3; + pixel_y = 18 + }, +/obj/item/weapon/book/manual/sd_guide, +/turf/simulated/floor/carpet, +/area/crew_quarters/heads/hop) +"Mu" = ( +/obj/structure/cable{ + icon_state = "0-2" + }, +/obj/machinery/power/apc/angled{ + dir = 4; + name = "night shift APC"; + nightshift_setting = 2 + }, +/obj/structure/table/steel, +/obj/random/maintenance/medical, +/obj/random/maintenance/medical, +/obj/random/maintenance/security, +/obj/random/maintenance/clean, +/obj/random/maintenance, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardfore) +"Mv" = ( +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 4 + }, +/obj/effect/landmark/vines, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"Mw" = ( +/obj/machinery/atmospherics/pipe/manifold/hidden{ + dir = 1 + }, +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/starboardcent) +"Mx" = ( +/obj/effect/floor_decal/steeldecal/steel_decals5, +/obj/structure/cable{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"My" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"MA" = ( +/obj/structure/cable{ + icon_state = "2-4" + }, +/turf/simulated/wall/bay/r_wall/blue, +/area/maintenance/stellardelight/deck3/portaft) +"MB" = ( +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 10 + }, +/obj/random/trash_pile, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"MC" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/effect/floor_decal/emblem/nt3, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"ME" = ( +/obj/structure/sign/poster{ + dir = 1 + }, +/obj/random/vendordrink, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"MF" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 6 + }, +/turf/simulated/floor, +/area/stellardelight/deck2/central) +"MG" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 10 + }, +/turf/simulated/floor/carpet/purcarpet, +/area/crew_quarters/heads/hor) +"MH" = ( +/obj/structure/table/steel, +/obj/random/maintenance/clean, +/obj/random/snack, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/aftstarroom) +"MI" = ( +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 5 + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"MJ" = ( +/obj/machinery/pointdefense_control{ + id_tag = "sd_pd" + }, +/turf/simulated/floor/bluegrid, +/area/ai_server_room) +"MK" = ( +/obj/machinery/light/small{ + dir = 8 + }, +/turf/simulated/floor/carpet/turcarpet, +/area/ai) +"MN" = ( +/obj/structure/closet/secure_closet/hos2, +/obj/item/clothing/accessory/permit/gun, +/obj/item/clothing/accessory/permit/gun, +/obj/item/clothing/accessory/permit/gun, +/obj/item/clothing/accessory/permit/gun, +/obj/item/clothing/accessory/permit/gun, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 1 + }, +/obj/item/device/retail_scanner/security, +/obj/item/device/ticket_printer, +/turf/simulated/floor/tiled/dark, +/area/crew_quarters/heads/hos) +"MO" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"MP" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportrooma) +"MR" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"MU" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/obj/effect/floor_decal/arrivals, +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"MV" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 10 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"MW" = ( +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 9 + }, +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"MX" = ( +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/fuel{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"MZ" = ( +/obj/machinery/alarm/angled{ + dir = 8 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportroomb) +"Nc" = ( +/obj/effect/floor_decal/corner_techfloor_grid{ + dir = 5 + }, +/obj/effect/floor_decal/corner_techfloor_grid{ + dir = 10 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/cryo) +"Nd" = ( +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 4 + }, +/obj/effect/landmark/vines, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"Ne" = ( +/obj/structure/cable{ + icon_state = "1-8" + }, +/obj/structure/cable{ + icon_state = "1-4" + }, +/obj/structure/disposalpipe/segment{ + dir = 8; + icon_state = "pipe-c" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 9 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"Nf" = ( +/obj/machinery/light{ + dir = 4 + }, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/commandhall) +"Nh" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/turf/simulated/floor, +/area/stellardelight/deck2/starboard) +"Ni" = ( +/obj/structure/bed/chair{ + dir = 4 + }, +/obj/machinery/light{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"Nj" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarrooma) +"Nk" = ( +/obj/structure/bed/chair{ + dir = 4 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/obj/structure/sign/nanotrasen{ + pixel_x = -32 + }, +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"Nm" = ( +/obj/machinery/light_switch{ + dir = 8; + pixel_x = 24 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_server_room) +"Nq" = ( +/obj/structure/bed/chair{ + dir = 8 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"Ns" = ( +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"Nx" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 5 + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/camera/network/halls{ + dir = 1 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"Ny" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/manifold/hidden{ + dir = 4 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/obj/effect/floor_decal/steeldecal/steel_decals_central5{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"Nz" = ( +/obj/structure/table/rack, +/obj/random/contraband, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarrooma) +"NE" = ( +/obj/structure/table/rack, +/obj/random/contraband, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"NF" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/open, +/area/crew_quarters/bar) +"NG" = ( +/obj/machinery/light/small{ + dir = 4 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportroomb) +"NI" = ( +/obj/structure/lattice, +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 2; + icon_state = "pipe-c" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 10 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 10 + }, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"NJ" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/standard/color{ + dir = 4; + door_color = "#9c9c9c"; + fill_color = "#5c5c5c"; + id_tag = "readingroom2"; + name = "Room 2"; + stripe_color = "#89bd66" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/readingroom) +"NK" = ( +/obj/structure/sign/vacuum, +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/deck3/portcent) +"NL" = ( +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"NN" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/door/airlock/angled_bay/hatch{ + dir = 4; + name = "maintenance access"; + stripe_color = "#454545" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/aft) +"NO" = ( +/obj/structure/table/reinforced, +/obj/item/device/flashlight/lamp, +/obj/item/device/radio/intercom{ + dir = 1; + frequency = 1357; + name = "station intercom (Engineering)"; + pixel_y = 24 + }, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 4 + }, +/obj/item/clothing/glasses/welding/superior, +/obj/item/clothing/glasses/meson, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/chief) +"NP" = ( +/obj/machinery/camera/network/command{ + dir = 9 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"NQ" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/access_button{ + command = "cycle_exterior"; + frequency = 1379; + master_tag = "portmaint_airlock"; + name = "exterior access button"; + pixel_y = 32; + req_access = null; + req_one_access = list(13) + }, +/obj/machinery/door/airlock/angled_bay/external/glass{ + dir = 4; + frequency = 1379; + id_tag = "portmaint_exterior"; + locked = 1; + name = "Exterior Airlock" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/maintenance/stellardelight/deck3/portcent) +"NR" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/double{ + name = "maintenance access"; + stripe_color = "#454545" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"NS" = ( +/obj/machinery/atmospherics/unary/engine/fancy_shuttle{ + dir = 1 + }, +/turf/simulated/wall/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"NT" = ( +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/obj/effect/floor_decal/steeldecal/steel_decals_central5{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/holodeck_control) +"NU" = ( +/obj/machinery/alarm/angled{ + dir = 4 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/aftstarroom) +"NW" = ( +/obj/structure/bed/chair/office/light{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"NX" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/access_button{ + command = "cycle_interior"; + dir = 8; + frequency = 1380; + master_tag = "sd_starboard_landing"; + pixel_y = 32; + req_one_access = list(13) + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/obj/machinery/door/airlock/angled_bay/external/glass{ + dir = 4; + frequency = 1380; + id_tag = null; + locked = 1; + name = "Docking Port Airlock" + }, +/obj/effect/map_helper/airlock/door/int_door, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/starboarddock) +"NZ" = ( +/obj/item/weapon/bedsheet/mimedouble, +/obj/structure/bed/double/padded, +/obj/structure/curtain/black, +/turf/simulated/floor/carpet/bcarpet, +/area/stellardelight/deck3/clownmimeoffice) +"Oa" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/sign/poster{ + dir = 8 + }, +/turf/simulated/floor, +/area/stellardelight/deck2/fore) +"Ob" = ( +/obj/effect/floor_decal/techfloor/orange{ + dir = 10 + }, +/obj/machinery/light{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/transitgateway) +"Oc" = ( +/obj/structure/sign/warning/docking_area{ + pixel_x = 32 + }, +/turf/simulated/floor/reinforced/airless, +/area/stellardelight/deck3/exterior) +"Od" = ( +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/portcent) +"Oe" = ( +/obj/machinery/holoplant, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"Of" = ( +/obj/machinery/status_display{ + pixel_x = -32 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Og" = ( +/obj/machinery/recharge_station, +/obj/structure/closet/emergsuit_wall{ + pixel_y = 29 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"Oj" = ( +/obj/machinery/telecomms/bus/preset_one, +/turf/simulated/floor/tiled/dark{ + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"Ol" = ( +/turf/simulated/wall/durasteel, +/area/ai) +"On" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/effect/landmark/stardog, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardfore) +"Oo" = ( +/obj/machinery/alarm/angled{ + dir = 8 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportrooma) +"Op" = ( +/obj/machinery/power/pointdefense{ + id_tag = "sd_pd" + }, +/obj/effect/floor_decal/industrial/warning/full, +/obj/structure/cable/green{ + icon_state = "0-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"Oq" = ( +/obj/structure/bed/chair{ + dir = 4 + }, +/turf/simulated/floor/glass/reinforced, +/area/stellardelight/deck3/aft) +"Or" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/hologram/holopad, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"Ot" = ( +/obj/structure/bed/chair/office/dark{ + dir = 8 + }, +/obj/effect/landmark/start/rd, +/turf/simulated/floor/carpet/purcarpet, +/area/crew_quarters/heads/hor) +"Ou" = ( +/obj/item/device/radio/beacon, +/obj/effect/floor_decal/steeldecal/steel_decals5, +/obj/structure/cable{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Ov" = ( +/obj/machinery/light, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 1 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_server_room) +"Ow" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/door/airlock/angled_bay/secure{ + dir = 4; + name = "Telecoms Access"; + req_one_access = list(16,17,61) + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/ai_server_room) +"Ox" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/structure/cable/blue{ + icon_state = "2-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"Oy" = ( +/obj/machinery/light{ + dir = 1 + }, +/obj/machinery/door/window{ + req_one_access = list(25) + }, +/turf/simulated/floor/lino, +/area/stellardelight/deck3/cafe) +"Oz" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/stellardelight/deck3/cafe) +"OA" = ( +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/wall/bay/r_wall/blue, +/area/ai_cyborg_station) +"OC" = ( +/obj/machinery/atmospherics/pipe/simple/hidden, +/obj/machinery/door/airlock/angled_bay/hatch{ + frequency = null; + id_tag = null; + locked = 1; + name = "Telecoms Server Access"; + req_access = list(61); + stripe_color = "#ffd863" + }, +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/access_button{ + command = "cycle_interior"; + frequency = 1380; + master_tag = "tcommsairlock"; + pixel_x = 32; + req_one_access = list(61) + }, +/obj/effect/map_helper/airlock/door/int_door, +/turf/simulated/floor/tiled/steel_ridged, +/area/tcommsat/computer) +"OD" = ( +/obj/structure/table/rack/steel, +/obj/machinery/door/window/brigdoor/eastleft{ + dir = 1; + name = "Protosuit Storage"; + req_access = list(58) + }, +/obj/structure/window/reinforced{ + dir = 4 + }, +/obj/structure/window/reinforced{ + dir = 8 + }, +/obj/item/clothing/mask/breath, +/obj/item/weapon/tank/oxygen, +/obj/item/device/suit_cooling_unit, +/obj/item/clothing/shoes/magboots, +/obj/item/clothing/suit/space/void/security/prototype, +/obj/item/clothing/head/helmet/space/void/security/prototype, +/obj/structure/window/reinforced, +/turf/simulated/floor/tiled/dark, +/area/crew_quarters/heads/hos) +"OE" = ( +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 4 + }, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"OF" = ( +/obj/effect/landmark{ + name = "morphspawn" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportrooma) +"OG" = ( +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 4 + }, +/obj/effect/mouse_hole_spawner{ + dir = 8 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"OI" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 8 + }, +/obj/structure/cable/blue{ + icon_state = "1-4" + }, +/turf/simulated/floor, +/area/stellardelight/deck2/starboard) +"OJ" = ( +/obj/structure/cable/blue{ + icon_state = "1-4" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"OK" = ( +/obj/structure/closet/lawcloset, +/obj/structure/sign/poster{ + dir = 4 + }, +/obj/machinery/newscaster{ + pixel_y = 28 + }, +/turf/simulated/floor/tiled/dark, +/area/lawoffice) +"OM" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/structure/table/rack/shelf, +/obj/random/contraband, +/obj/random/maintenance, +/obj/random/maintenance/medical, +/obj/random/maintenance/medical, +/obj/random/maintenance/engineering, +/obj/random/maintenance/security, +/obj/random/maintenance/security, +/obj/random/snack, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"ON" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden, +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/starboardcent) +"OP" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 6 + }, +/turf/simulated/open, +/area/crew_quarters/bar) +"OQ" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/open, +/area/crew_quarters/bar) +"OR" = ( +/obj/machinery/power/apc/angled{ + dir = 4; + name = "night shift APC"; + nightshift_setting = 2 + }, +/obj/structure/cable/blue{ + icon_state = "0-8" + }, +/obj/structure/table/rack, +/obj/random/maintenance, +/obj/random/maintenance/engineering, +/obj/random/maintenance/engineering, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/forestarroomb) +"OS" = ( +/obj/machinery/computer/drone_control{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"OU" = ( +/turf/simulated/wall/bay/r_wall/steel, +/area/stellardelight/deck3/cryo) +"OX" = ( +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"OY" = ( +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 8 + }, +/obj/effect/landmark/vines, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"Pa" = ( +/obj/structure/lattice, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"Pc" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 1 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/obj/machinery/hologram/holopad, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Pd" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/door/airlock/angled_bay/hatch{ + dir = 4; + name = "maintenance access"; + stripe_color = "#454545" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/maintenance/stellardelight/deck3/starboardcent) +"Pe" = ( +/obj/machinery/keycard_auth{ + pixel_y = 28 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 10 + }, +/obj/machinery/alarm/angled{ + dir = 8 + }, +/turf/simulated/floor/tiled/dark, +/area/crew_quarters/heads/hos) +"Pj" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/hologram/holopad, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_upload) +"Pl" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/glass{ + name = "Starstuff Cockpit"; + req_one_access = list(67) + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/fore{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"Pm" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor, +/area/stellardelight/deck2/port) +"Po" = ( +/obj/structure/sign/nanotrasen{ + pixel_y = 30 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 10 + }, +/turf/simulated/floor/tiled/dark, +/area/lawoffice) +"Pp" = ( +/obj/effect/landmark/start/clown, +/turf/simulated/floor/carpet/gaycarpet, +/area/stellardelight/deck3/clownmimeoffice) +"Pq" = ( +/obj/structure/bed/chair{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportrooma) +"Ps" = ( +/obj/machinery/space_heater, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarroomb) +"Px" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 9 + }, +/obj/machinery/computer/cryopod/gateway{ + pixel_x = 32 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/transitgateway) +"PA" = ( +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 1 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5, +/obj/machinery/camera/network/halls{ + dir = 1 + }, +/obj/structure/cable{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"PB" = ( +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/turf/simulated/wall/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"PC" = ( +/obj/machinery/alarm/angled{ + dir = 4 + }, +/obj/structure/cable/blue{ + icon_state = "2-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor/tiled/dark, +/area/lawoffice) +"PD" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"PE" = ( +/obj/structure/sign/department/ai{ + pixel_y = 32 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"PJ" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/window/northleft{ + dir = 8; + icon_state = "right"; + name = "Reception Window" + }, +/obj/machinery/door/window/brigdoor/eastright{ + name = "Head of Personnel's Desk"; + req_access = list(57) + }, +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/obj/machinery/door/blast/shutters{ + dir = 8; + id = "hop_office_desk"; + layer = 3.1; + name = "HoP's Shutters" + }, +/obj/structure/table/reinforced, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"PL" = ( +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/commandhall) +"PR" = ( +/obj/structure/table/glass, +/obj/item/device/flashlight/lamp/green{ + pixel_x = -4; + pixel_y = 12 + }, +/obj/item/weapon/stamp/cmo, +/obj/item/weapon/book/manual/sd_guide, +/turf/simulated/floor/carpet/tealcarpet, +/area/crew_quarters/heads/cmo) +"PT" = ( +/obj/effect/floor_decal/industrial/warning{ + dir = 8 + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"PV" = ( +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportrooma) +"PW" = ( +/obj/effect/landmark{ + name = "JoinLateCyborg" + }, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 1 + }, +/obj/effect/landmark/start/cyborg, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"PX" = ( +/obj/structure/closet/emcloset, +/obj/structure/sign/painting/public{ + pixel_x = 30 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Qe" = ( +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/manifold/hidden{ + dir = 4 + }, +/obj/effect/overmap/visitable/ship/landable/sd_boat, +/obj/effect/shuttle_landmark/shuttle_initializer/sdboat, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/fuel{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"Qf" = ( +/obj/structure/bed/chair/office/dark{ + dir = 4 + }, +/obj/effect/landmark/start/ce, +/turf/simulated/floor/carpet/oracarpet, +/area/crew_quarters/heads/chief) +"Qh" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/fuel{ + dir = 5 + }, +/turf/simulated/wall/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"Qi" = ( +/obj/structure/sign/painting/public{ + pixel_x = -30 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/cafe) +"Qm" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_server_room) +"Qn" = ( +/obj/structure/window/reinforced{ + dir = 8; + pixel_x = -4 + }, +/turf/simulated/open, +/area/stellardelight/deck3/aft) +"Qo" = ( +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/light_switch{ + pixel_y = 25 + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"Qp" = ( +/turf/simulated/wall/bay/r_wall/steel, +/area/crew_quarters/bar) +"Qs" = ( +/obj/structure/cable/cyan{ + icon_state = "1-2" + }, +/obj/machinery/light{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 10 + }, +/turf/simulated/floor/bluegrid, +/area/ai) +"Qu" = ( +/obj/structure/sink/kitchen{ + pixel_y = 22 + }, +/obj/machinery/light{ + dir = 4 + }, +/obj/machinery/alarm/angled{ + dir = 4 + }, +/turf/simulated/floor/tiled/monotile, +/area/holodeck_control) +"Qv" = ( +/obj/structure/table/rack, +/obj/random/contraband, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance/cargo, +/obj/random/maintenance/clean, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/aftstarroom) +"Qx" = ( +/obj/machinery/door/firedoor/glass/hidden/steel{ + dir = 1 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5, +/obj/structure/cable{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"QB" = ( +/obj/structure/railing/grey{ + dir = 8 + }, +/turf/simulated/open, +/area/stellardelight/deck3/commandhall) +"QC" = ( +/obj/machinery/camera/network/telecom, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"QE" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 9 + }, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/commandhall) +"QF" = ( +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 4 + }, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"QG" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"QI" = ( +/obj/item/device/radio/intercom{ + dir = 8; + pixel_x = -24 + }, +/turf/simulated/floor/bluegrid, +/area/ai_cyborg_station) +"QJ" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/external/glass{ + frequency = 1380; + id_tag = null; + locked = 1; + name = "Docking Port Airlock" + }, +/obj/effect/map_helper/airlock/door/ext_door, +/obj/machinery/access_button{ + command = "cycle_exterior"; + frequency = 1380; + master_tag = "sd_escape_center_right"; + pixel_x = 32; + req_one_access = list(13) + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/aft) +"QK" = ( +/obj/structure/bed/chair/comfy/brown{ + dir = 8 + }, +/obj/machinery/alarm/angled{ + dir = 8 + }, +/turf/simulated/floor/carpet, +/area/stellardelight/deck3/readingroom) +"QL" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"QP" = ( +/obj/structure/cable/blue{ + icon_state = "1-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 8; + icon_state = "pipe-c" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/structure/cable/blue{ + icon_state = "1-4" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"QS" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/manifold4w/hidden, +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/portcent) +"QT" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/standard/glass{ + door_color = "#323d80"; + name = "Command Offices"; + req_access = null; + req_one_access = list(19,38); + stripe_color = "#f7d35c" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/commandhall) +"QV" = ( +/obj/structure/cable/blue{ + icon_state = "2-8" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardfore) +"QW" = ( +/obj/structure/cable{ + icon_state = "2-8" + }, +/turf/simulated/floor/carpet/gaycarpet, +/area/stellardelight/deck3/clownmimeoffice) +"QZ" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"Rc" = ( +/obj/machinery/porta_turret/ai_defense, +/obj/structure/cable/cyan{ + icon_state = "1-2" + }, +/turf/simulated/floor/bluegrid, +/area/ai) +"Rd" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/black{ + dir = 6 + }, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"Rg" = ( +/obj/structure/lattice, +/turf/simulated/open, +/area/maintenance/stellardelight/deck3/forestarroomb) +"Rh" = ( +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/deck3/forestarrooma) +"Ri" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/random/trash_pile, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardfore) +"Rj" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/door/airlock/angled_bay/standard/glass{ + name = "maintenance access" + }, +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck2/starboard) +"Rl" = ( +/obj/structure/disposalpipe/sortjunction/flipped{ + dir = 4; + name = "Command Offices"; + sortType = "Command Offices" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/effect/landmark{ + name = "lightsout" + }, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/commandhall) +"Rn" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/low_wall/bay/reinforced/blue, +/turf/simulated/floor, +/area/crew_quarters/heads/hop) +"Ro" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/door/airlock/angled_bay/standard/glass/common{ + dir = 4; + name = "Long-Range Teleporter Access" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/transitgateway) +"Rq" = ( +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"Ru" = ( +/obj/machinery/holoplant, +/obj/machinery/camera/network/command{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_upload) +"Rv" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Rw" = ( +/obj/machinery/door/firedoor/glass/hidden/shuttle, +/obj/structure/window/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/reinforced/airless, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"Rx" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/cable/green{ + icon_state = "2-4" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"Rz" = ( +/obj/structure/lattice, +/obj/structure/disposalpipe/segment{ + dir = 8; + icon_state = "pipe-c" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 9 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 9 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"RE" = ( +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/deck3/starboardfore) +"RG" = ( +/obj/machinery/light/small{ + dir = 4 + }, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"RH" = ( +/obj/effect/floor_decal/techfloor/orange{ + dir = 1 + }, +/obj/machinery/power/apc/angled{ + dir = 1 + }, +/obj/structure/cable/green{ + icon_state = "0-2" + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/transitgateway) +"RI" = ( +/turf/simulated/open, +/area/stellardelight/deck3/aft) +"RK" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardfore) +"RL" = ( +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/deck3/foreportroomb) +"RM" = ( +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 + }, +/obj/effect/mouse_hole_spawner{ + dir = 4 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"RN" = ( +/obj/structure/sign/directions/evac{ + pixel_x = 32 + }, +/obj/structure/closet/firecloset, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"RQ" = ( +/obj/structure/table/standard, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 1 + }, +/turf/simulated/floor/bluegrid, +/area/ai_cyborg_station) +"RT" = ( +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/hatch{ + dir = 4; + door_color = "#e6ab22"; + name = "Shield Generator"; + req_access = null; + req_one_access = list(11,24); + stripe_color = "#e6ab22" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck2/central) +"RW" = ( +/obj/machinery/portable_atmospherics/canister/air, +/obj/machinery/atmospherics/portables_connector{ + dir = 1 + }, +/obj/machinery/door/window/southright{ + dir = 1; + req_one_access = list(11,67) + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"RX" = ( +/turf/simulated/wall/bay/steel, +/area/stellardelight/deck2/central) +"RY" = ( +/obj/structure/bed/chair/shuttle{ + dir = 1 + }, +/obj/machinery/light{ + dir = 8 + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"RZ" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/structure/sign/warning/caution{ + desc = "This secure area is guarded by LETHAL LASER TURRETS. Authorized personnel ONLY."; + name = "\improper WARNING: LETHAL TURRETS AHEAD"; + pixel_x = -32 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_server_room) +"Sb" = ( +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/forestarrooma) +"Se" = ( +/obj/effect/floor_decal/industrial/warning/corner, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"Sf" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 9 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Sh" = ( +/obj/structure/closet/crate/bin{ + anchored = 1 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportrooma) +"Sk" = ( +/obj/structure/table/standard, +/obj/item/weapon/phone{ + pixel_x = 3; + pixel_y = 11 + }, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 + }, +/obj/machinery/alarm/angled{ + dir = 8 + }, +/turf/simulated/floor/bluegrid, +/area/ai_cyborg_station) +"Sl" = ( +/obj/structure/sign/warning/evac{ + pixel_x = -32; + pixel_y = -32 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5, +/obj/structure/cable{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Sm" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"Sn" = ( +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/obj/effect/floor_decal/steeldecal/steel_decals_central5{ + dir = 8 + }, +/obj/structure/cable{ + icon_state = "1-8" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"Sp" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportrooma) +"Sw" = ( +/obj/machinery/alarm/angled{ + dir = 8 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"Sz" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"SA" = ( +/obj/structure/table/darkglass, +/obj/machinery/computer/skills{ + dir = 8; + pixel_y = 6 + }, +/turf/simulated/floor/carpet/blue2, +/area/lawoffice) +"SB" = ( +/obj/machinery/requests_console/preset/ce{ + pixel_x = -30 + }, +/turf/simulated/floor/carpet/oracarpet, +/area/crew_quarters/heads/chief) +"SC" = ( +/obj/structure/sign/warning/docking_area{ + pixel_y = 32 + }, +/turf/simulated/floor/reinforced/airless, +/area/stellardelight/deck3/exterior) +"SD" = ( +/obj/machinery/atmospherics/portables_connector{ + dir = 8 + }, +/obj/machinery/portable_atmospherics/canister/air/airlock, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"SE" = ( +/obj/machinery/newscaster{ + layer = 3.3; + pixel_x = 27 + }, +/turf/simulated/floor/carpet/blue2, +/area/lawoffice) +"SF" = ( +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 1 + }, +/obj/item/device/radio/intercom{ + dir = 1; + pixel_y = 24 + }, +/obj/machinery/vending/nifsoft_shop, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"SJ" = ( +/obj/machinery/door/firedoor/glass/hidden/shuttle, +/obj/structure/window/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/reinforced/airless, +/area/shuttle/sdboat/fore{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"SK" = ( +/obj/structure/lattice, +/turf/space, +/area/space) +"SL" = ( +/obj/machinery/recharge_station, +/turf/simulated/floor/bluegrid, +/area/ai_cyborg_station) +"SN" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 5 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"SP" = ( +/obj/structure/table/glass, +/obj/machinery/photocopier/faxmachine{ + department = "CMO's Office" + }, +/turf/simulated/floor/tiled/eris/white/cargo, +/area/crew_quarters/heads/cmo) +"SQ" = ( +/obj/machinery/disposal/wall{ + dir = 8 + }, +/obj/structure/disposalpipe/trunk{ + dir = 8 + }, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/commandhall) +"SR" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportrooma) +"ST" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"SU" = ( +/obj/structure/table/bench/padded, +/obj/structure/sign/painting/public{ + pixel_y = -30 + }, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/cafe) +"SV" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/starboardcent) +"SZ" = ( +/obj/machinery/power/apc/angled{ + dir = 4 + }, +/obj/structure/cable/blue{ + icon_state = "0-8" + }, +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"Ta" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/door/airlock/angled_bay/hatch{ + name = "maintenance access"; + stripe_color = "#454545" + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/crew_quarters/bar) +"Tc" = ( +/obj/structure/bed/chair{ + dir = 8 + }, +/obj/structure/closet/emergsuit_wall{ + dir = 4; + pixel_x = 27 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"Td" = ( +/obj/structure/table/rack/shelf, +/obj/random/contraband, +/obj/random/contraband, +/obj/random/maintenance, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarroomb) +"Te" = ( +/obj/effect/landmark/map_data/stellar_delight, +/turf/space, +/area/space) +"Tf" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/double/glass{ + name = "glass airlock" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/aft) +"Ti" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarrooma) +"Tj" = ( +/obj/structure/table/reinforced, +/obj/machinery/button/remote/blast_door{ + desc = "A remote control-switch for shutters."; + dir = 4; + id = "hop_office_desk"; + layer = 3.3; + name = "Desk Privacy Shutter"; + pixel_x = -4; + pixel_y = 4 + }, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"Tk" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/structure/low_wall/bay/reinforced/blue, +/turf/simulated/floor, +/area/crew_quarters/heads/hop) +"Tl" = ( +/obj/structure/bed/chair/office/dark{ + dir = 8 + }, +/obj/item/device/radio/intercom{ + dir = 1; + name = "Station Intercom (General)"; + pixel_y = 24 + }, +/obj/effect/landmark/start/hop, +/turf/simulated/floor/carpet, +/area/crew_quarters/heads/hop) +"Tm" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/commandhall) +"Tn" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/ai_cyborg_station) +"To" = ( +/obj/machinery/keycard_auth{ + pixel_y = 28 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 6 + }, +/obj/machinery/alarm/angled{ + dir = 4 + }, +/turf/simulated/floor/tiled/eris/white/cargo, +/area/crew_quarters/heads/cmo) +"Tp" = ( +/obj/structure/table/glass, +/obj/machinery/light, +/turf/simulated/floor/tiled/eris/white/cargo, +/area/crew_quarters/heads/cmo) +"Tr" = ( +/obj/machinery/drone_fabricator, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"Ts" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/power/apc/angled{ + cell_type = /obj/item/weapon/cell/super; + dir = 8; + name = "night shift APC"; + nightshift_setting = 2 + }, +/obj/structure/cable/blue, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"Tv" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/door/airlock/angled_bay/standard/color{ + dir = 4; + door_color = "#9fccc7"; + fill_color = "#333333"; + id_tag = null; + name = "Internal Affairs"; + req_access = list(38); + stripe_color = "#ffffff" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/lawoffice) +"Tx" = ( +/obj/machinery/light/small, +/turf/simulated/open, +/area/stellardelight/deck2/central) +"Ty" = ( +/obj/machinery/light/small{ + dir = 4 + }, +/turf/simulated/floor, +/area/ai_cyborg_station) +"TA" = ( +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/turf/simulated/wall/bay/r_wall/steel, +/area/stellardelight/deck3/aft) +"TB" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 5 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"TE" = ( +/obj/machinery/power/pointdefense{ + id_tag = "sd_pd" + }, +/obj/effect/floor_decal/industrial/warning/full, +/obj/structure/cable/green{ + icon_state = "0-4" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"TF" = ( +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/commandhall) +"TI" = ( +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"TJ" = ( +/obj/structure/sign/department/telecoms{ + pixel_y = 32 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"TK" = ( +/obj/structure/cable/cyan{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/bluegrid, +/area/ai) +"TL" = ( +/turf/simulated/floor/bluegrid, +/area/ai) +"TM" = ( +/obj/machinery/turretid/lethal{ + ailock = 1; + control_area = /area/tcommsat/chamber; + desc = "A firewall prevents AIs from interacting with this device."; + name = "Telecoms lethal turret control"; + pixel_y = 29; + req_access = list(61); + req_one_access = list() + }, +/obj/effect/floor_decal/industrial/warning/corner{ + dir = 1 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_server_room) +"TO" = ( +/obj/machinery/atmospherics/unary/vent_pump/on, +/obj/effect/landmark/vermin, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/commandhall) +"TP" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardfore) +"TS" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/structure/cable/blue{ + icon_state = "2-8" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarroomb) +"TV" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/structure/cable/blue{ + icon_state = "1-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"TW" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/manifold/hidden{ + dir = 8 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/obj/effect/floor_decal/steeldecal/steel_decals_central5{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"TY" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/light{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_server_room) +"Ub" = ( +/obj/machinery/vending/boozeomat{ + req_access = null + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/forestarroomb) +"Uc" = ( +/obj/structure/frame/computer, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportrooma) +"Ud" = ( +/obj/structure/table/reinforced, +/obj/item/weapon/stamp/ce, +/obj/item/weapon/book/manual/sd_guide, +/turf/simulated/floor/carpet/oracarpet, +/area/crew_quarters/heads/chief) +"Ue" = ( +/obj/structure/table/rack, +/obj/random/contraband, +/obj/random/maintenance, +/obj/random/drinkbottle, +/obj/random/maintenance/engineering, +/obj/random/maintenance/engineering, +/obj/random/mre, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarroomb) +"Uf" = ( +/obj/structure/cable/blue{ + icon_state = "2-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"Ug" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/deck3/starboardcent) +"Uj" = ( +/obj/structure/cable/blue, +/obj/structure/cable/blue{ + icon_state = "0-2" + }, +/obj/machinery/power/smes/buildable{ + RCon_tag = "Substation - AI/Telecomms"; + output_attempt = 0 + }, +/turf/simulated/floor, +/area/ai_cyborg_station) +"Uk" = ( +/obj/machinery/computer/card, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"Uq" = ( +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportrooma) +"Uw" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/cable/green{ + icon_state = "2-4" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"Uy" = ( +/obj/machinery/atmospherics/unary/vent_pump/on, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 1 + }, +/obj/machinery/station_map{ + pixel_y = 32 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"UA" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor, +/area/stellardelight/deck2/fore) +"UB" = ( +/obj/structure/cable/blue{ + icon_state = "1-4" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 5 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/light_switch{ + dir = 8; + pixel_x = 24; + pixel_y = 24 + }, +/turf/simulated/floor/tiled/dark, +/area/crew_quarters/heads/hos) +"UD" = ( +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 9 + }, +/turf/simulated/wall/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"UF" = ( +/obj/machinery/light/small, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarroomb) +"UG" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/structure/cable/blue{ + icon_state = "1-4" + }, +/turf/simulated/floor/tiled/eris/dark/gray_platform, +/area/stellardelight/deck3/commandhall) +"UH" = ( +/obj/structure/sign/painting/library_secure{ + pixel_x = -30 + }, +/turf/simulated/floor/carpet, +/area/crew_quarters/heads/hos) +"UI" = ( +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/obj/item/device/radio/intercom{ + dir = 4; + pixel_x = 24 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"UK" = ( +/obj/machinery/camera/network/telecom{ + dir = 4 + }, +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"UL" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/double{ + name = "maintenance access"; + stripe_color = "#454545" + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"UO" = ( +/obj/machinery/recharge_station, +/obj/item/device/radio/intercom{ + dir = 8; + pixel_x = -24 + }, +/turf/simulated/floor/bluegrid, +/area/ai_upload) +"UQ" = ( +/obj/machinery/door/firedoor/glass, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"UR" = ( +/obj/effect/floor_decal/industrial/warning{ + dir = 1 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"US" = ( +/obj/structure/lattice, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/open, +/area/crew_quarters/bar) +"UT" = ( +/obj/structure/table/steel_reinforced, +/obj/item/weapon/paper_bin{ + pixel_x = -3; + pixel_y = 7 + }, +/obj/item/device/megaphone, +/obj/item/weapon/pen/multi, +/obj/item/device/radio/intercom/department/security{ + dir = 1; + pixel_y = 24 + }, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 4 + }, +/turf/simulated/floor/tiled/dark, +/area/crew_quarters/heads/hos) +"UU" = ( +/obj/machinery/alarm/angled{ + dir = 4 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardfore) +"UV" = ( +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 4 + }, +/obj/structure/closet/emergsuit_wall{ + dir = 8; + pixel_x = -27 + }, +/obj/effect/landmark/vines, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"UX" = ( +/obj/machinery/light/small, +/turf/simulated/open, +/area/crew_quarters/bar) +"Va" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/deck3/portfore) +"Vb" = ( +/obj/effect/floor_decal/corner_techfloor_grid{ + dir = 5 + }, +/obj/effect/floor_decal/corner_techfloor_grid{ + dir = 10 + }, +/obj/machinery/light/floortube{ + dir = 8; + pixel_x = -3 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled/techfloor, +/area/stellardelight/deck3/cryo) +"Vc" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 8 + }, +/obj/structure/cable{ + icon_state = "4-8" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"Ve" = ( +/obj/structure/cable/blue{ + icon_state = "1-4" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 5 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/light_switch{ + dir = 8; + pixel_x = 24; + pixel_y = 24 + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/chief) +"Vg" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardfore) +"Vh" = ( +/obj/machinery/door/firedoor/glass/hidden/shuttle, +/obj/machinery/door/blast/shuttle/open{ + id = "shuttleshutter" + }, +/obj/structure/window/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/fuel{ + dir = 6 + }, +/turf/simulated/floor/reinforced/airless, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"Vi" = ( +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/obj/structure/closet/crate, +/obj/random/contraband, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/item/device/gps, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarrooma) +"Vk" = ( +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/effect/landmark/start/mime, +/turf/simulated/floor/carpet/bcarpet, +/area/stellardelight/deck3/clownmimeoffice) +"Vm" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/open, +/area/crew_quarters/bar) +"Vo" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/external/glass{ + dir = 4; + frequency = 1380; + id_tag = null; + locked = 1; + name = "Docking Port Airlock" + }, +/obj/effect/map_helper/airlock/door/ext_door, +/obj/machinery/access_button{ + command = "cycle_exterior"; + dir = 8; + frequency = 1380; + master_tag = "sd_escape_starboard"; + pixel_y = 32; + req_one_access = list(13) + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/starboarddock) +"Vp" = ( +/obj/structure/lattice, +/obj/machinery/light/small, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"Vq" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 5 + }, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/commandhall) +"Vr" = ( +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 1 + }, +/obj/structure/table/reinforced, +/obj/item/weapon/paper_bin{ + pixel_x = -3; + pixel_y = 7 + }, +/obj/item/weapon/folder/yellow_ce, +/obj/item/weapon/pen/multi, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/chief) +"Vs" = ( +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"Vt" = ( +/obj/item/device/radio/intercom/locked/ai_private{ + dir = 4; + pixel_x = 32 + }, +/turf/simulated/floor/tiled/techfloor, +/area/ai_cyborg_station) +"Vw" = ( +/obj/structure/bed/chair/shuttle{ + dir = 1 + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"Vx" = ( +/obj/structure/cable/blue{ + icon_state = "1-4" + }, +/obj/effect/landmark{ + name = "maint_pred" + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/forestarroomb) +"Vz" = ( +/obj/machinery/power/pointdefense{ + id_tag = "sd_pd" + }, +/obj/effect/floor_decal/industrial/warning/full, +/obj/structure/cable/green{ + icon_state = "0-8" + }, +/obj/structure/cable/green{ + icon_state = "0-4" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"VB" = ( +/obj/item/weapon/bedsheet/double, +/obj/structure/bed/double/padded, +/obj/structure/curtain/black{ + color = "#156363" + }, +/obj/effect/landmark/start/cmo, +/turf/simulated/floor/carpet/tealcarpet, +/area/crew_quarters/heads/cmo) +"VC" = ( +/turf/simulated/wall/bay/r_wall/blue, +/area/ai_upload) +"VD" = ( +/obj/structure/table/steel, +/obj/random/drinkbottle, +/obj/machinery/chemical_dispenser/bar_alc/full, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportroomb) +"VE" = ( +/obj/structure/table/glass, +/obj/item/device/radio/intercom/department/medbay{ + dir = 1; + pixel_y = 24 + }, +/obj/item/weapon/paper_bin{ + pixel_x = 3; + pixel_y = 7 + }, +/obj/item/weapon/pen/multi, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 + }, +/obj/item/weapon/folder/white_cmo, +/turf/simulated/floor/tiled/eris/white/cargo, +/area/crew_quarters/heads/cmo) +"VG" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 10 + }, +/obj/item/device/radio/intercom{ + dir = 4; + pixel_x = 24 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"VK" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/cable/green{ + icon_state = "1-4" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/alarm/angled{ + dir = 4 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"VM" = ( +/obj/machinery/power/pointdefense{ + id_tag = "sd_pd" + }, +/obj/effect/floor_decal/industrial/warning/full, +/obj/structure/cable/green, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"VN" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"VQ" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/angled_bay/secure{ + name = "Nuclear Fission Device Storage"; + req_access = list(16) + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled/steel_ridged, +/area/ai) +"VR" = ( +/obj/machinery/atmospherics/pipe/simple/hidden, +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/portcent) +"VS" = ( +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 5 + }, +/turf/simulated/wall/bay/r_wall/steel, +/area/stellardelight/deck3/aft) +"VW" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_server_room) +"VZ" = ( +/obj/structure/table/rack, +/obj/random/maintenance, +/obj/random/maintenance/clean, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/aftstarroom) +"Wa" = ( +/turf/simulated/floor/carpet, +/area/crew_quarters/heads/hop) +"Wd" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/cable/green{ + icon_state = "1-4" + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"Wf" = ( +/obj/machinery/disposal/wall, +/obj/structure/disposalpipe/trunk, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Wg" = ( +/obj/structure/bed/chair/shuttle{ + dir = 1 + }, +/obj/structure/closet/emergsuit_wall{ + dir = 1; + pixel_y = -32 + }, +/obj/item/device/radio/intercom{ + dir = 4; + pixel_x = 24 + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"Wi" = ( +/obj/structure/closet/secure_closet/personal, +/turf/simulated/floor/bluegrid, +/area/ai) +"Wj" = ( +/obj/machinery/computer/ship/helm/adv, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/fore{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"Wl" = ( +/obj/structure/sign/warning/falling{ + pixel_x = -32 + }, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"Wn" = ( +/obj/machinery/power/smes/buildable{ + charge = 500000 + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/obj/structure/cable/green{ + icon_state = "0-4" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"Wp" = ( +/obj/machinery/atmospherics/unary/vent_pump/on, +/turf/simulated/open, +/area/stellardelight/deck2/central) +"Wq" = ( +/obj/structure/table/darkglass, +/obj/machinery/computer/skills{ + dir = 4; + pixel_y = 6 + }, +/turf/simulated/floor/carpet/blue2, +/area/lawoffice) +"Wr" = ( +/obj/machinery/atmospherics/pipe/manifold/hidden{ + dir = 4 + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"Ws" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/table/steel, +/obj/item/weapon/flame/candle, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"Wt" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/effect/floor_decal/spline/plain, +/obj/structure/table/bench/marble, +/turf/simulated/floor/lino, +/area/stellardelight/deck3/cafe) +"Wu" = ( +/obj/structure/sign/warning/docking_area{ + pixel_x = -32 + }, +/turf/simulated/floor/airless, +/area/stellardelight/deck3/exterior) +"Ww" = ( +/obj/structure/handrail{ + dir = 4 + }, +/obj/effect/map_helper/airlock/atmos/pump_out_internal, +/obj/machinery/light, +/obj/machinery/atmospherics/unary/vent_pump/high_volume{ + frequency = 1380; + id_tag = "sdboat_docker_pump_out_internal" + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/turf/simulated/floor/tiled, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"Wx" = ( +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Wy" = ( +/obj/machinery/camera/network/engineering{ + dir = 1 + }, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 1 + }, +/obj/machinery/alarm/angled{ + dir = 4 + }, +/obj/structure/table/steel_reinforced, +/obj/item/weapon/paper/sdshield, +/turf/simulated/floor, +/area/stellardelight/deck2/central) +"WA" = ( +/obj/structure/cable{ + icon_state = "1-2" + }, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"WB" = ( +/obj/machinery/light/small{ + dir = 4 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardfore) +"WD" = ( +/obj/structure/table/woodentable, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/cafe) +"WF" = ( +/obj/structure/table/steel, +/obj/random/contraband, +/obj/random/maintenance/security, +/obj/random/maintenance/security, +/obj/random/maintenance/security, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarrooma) +"WG" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 4 + }, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"WH" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 6 + }, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/commandhall) +"WI" = ( +/obj/structure/bed/chair{ + dir = 1 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportrooma) +"WK" = ( +/turf/simulated/wall/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/area/shuttle/sdboat/fore{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"WL" = ( +/obj/structure/closet/crate, +/obj/random/contraband, +/obj/random/maintenance/clean, +/obj/random/maintenance/clean, +/obj/random/maintenance/clean, +/obj/random/maintenance/cargo, +/obj/random/maintenance/cargo, +/obj/random/drinksoft, +/obj/random/drinksoft, +/obj/random/mre, +/obj/random/mre, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportrooma) +"WM" = ( +/obj/effect/landmark{ + name = "maint_pred" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportrooma) +"WN" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 9 + }, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/commandhall) +"WO" = ( +/turf/simulated/wall/bay/r_wall/blue, +/area/lawoffice) +"WQ" = ( +/obj/machinery/power/apc/angled{ + cell_type = /obj/item/weapon/cell/super; + dir = 4; + name = "night shift APC"; + nightshift_setting = 2 + }, +/obj/structure/cable/green{ + icon_state = "0-8" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"WU" = ( +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 5 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"WW" = ( +/obj/structure/bed/chair/office/dark{ + dir = 8 + }, +/obj/effect/landmark/start/iaa, +/turf/simulated/floor/carpet/blue2, +/area/lawoffice) +"WX" = ( +/obj/machinery/camera/network/command{ + dir = 10 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"WZ" = ( +/obj/machinery/atmospherics/unary/vent_pump/on, +/obj/machinery/light/small{ + dir = 1 + }, +/obj/structure/flora/pottedplant/smalltree, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Xa" = ( +/obj/item/device/radio/intercom{ + dir = 1; + name = "Station Intercom (General)"; + pixel_y = 24 + }, +/obj/structure/closet/secure_closet/CMO, +/obj/item/clothing/accessory/stethoscope, +/obj/item/device/flashlight/pen, +/obj/item/weapon/storage/belt/medical, +/obj/item/clothing/glasses/hud/health, +/obj/item/device/defib_kit/compact/combat/loaded, +/obj/item/weapon/cmo_disk_holder, +/obj/item/weapon/storage/secure/briefcase/ml3m_pack_cmo, +/obj/item/weapon/storage/mrebag/pill/sleevingcure, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/item/device/retail_scanner/medical, +/turf/simulated/floor/tiled/eris/white/cargo, +/area/crew_quarters/heads/cmo) +"Xb" = ( +/turf/simulated/floor/carpet/gaycarpet, +/area/stellardelight/deck3/clownmimeoffice) +"Xc" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/unary/vent_scrubber/on, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/effect/landmark/vermin, +/obj/effect/mouse_hole_spawner{ + dir = 8 + }, +/turf/simulated/open, +/area/crew_quarters/bar) +"Xd" = ( +/obj/machinery/atmospherics/pipe/manifold4w/hidden, +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/starboardcent) +"Xe" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/open, +/area/stellardelight/deck2/fore) +"Xf" = ( +/obj/machinery/atmospherics/unary/vent_pump/on, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"Xi" = ( +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/floor/wood, +/area/stellardelight/deck3/cafe) +"Xl" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportroomb) +"Xm" = ( +/obj/structure/table/alien{ + name = "fancy table" + }, +/obj/item/device/radio/intercom{ + dir = 1; + frequency = 1351; + name = "station intercom (Science)"; + pixel_y = 24 + }, +/obj/random/paicard{ + pixel_x = 4 + }, +/obj/item/weapon/paper_bin{ + pixel_x = 1; + pixel_y = 9 + }, +/obj/item/weapon/paper/monitorkey, +/obj/item/device/megaphone, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 + }, +/obj/item/weapon/folder/white_rd, +/turf/simulated/floor/tiled/techfloor, +/area/crew_quarters/heads/hor) +"Xo" = ( +/obj/structure/cable/blue{ + icon_state = "1-4" + }, +/obj/machinery/power/apc/angled{ + dir = 8 + }, +/obj/structure/cable/blue{ + icon_state = "0-4" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 5 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 5 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_server_room) +"Xr" = ( +/obj/structure/sign/warning/secure_area{ + pixel_y = 32 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"Xv" = ( +/obj/structure/frame, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportrooma) +"XA" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 10 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply, +/turf/simulated/open, +/area/stellardelight/deck2/central) +"XB" = ( +/turf/simulated/wall/bay/steel, +/area/maintenance/stellardelight/substation/command) +"XC" = ( +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 4 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"XD" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 5 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/obj/structure/sign/warning/evac{ + pixel_x = -32 + }, +/obj/effect/landmark{ + name = "lightsout" + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"XE" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/door/airlock/angled_bay/standard/glass/common{ + dir = 4; + name = "Cryogenic Storage" + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/cryo) +"XF" = ( +/obj/structure/lattice, +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/turf/simulated/open, +/area/stellardelight/deck2/central) +"XG" = ( +/obj/structure/bed/chair{ + dir = 4 + }, +/turf/simulated/floor/carpet/tealcarpet, +/area/crew_quarters/heads/cmo) +"XH" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 10 + }, +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/open, +/area/crew_quarters/bar) +"XI" = ( +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportroomb) +"XJ" = ( +/obj/machinery/power/apc/angled{ + dir = 8 + }, +/obj/structure/cable/blue, +/turf/simulated/floor/tiled/dark, +/area/lawoffice) +"XK" = ( +/turf/simulated/wall/bay/r_wall/blue, +/area/ai_server_room) +"XO" = ( +/obj/machinery/computer/security, +/obj/machinery/status_display{ + pixel_y = 32 + }, +/turf/simulated/floor/tiled/dark, +/area/crew_quarters/heads/hos) +"XT" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"XV" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportroomb) +"XX" = ( +/obj/machinery/holoplant, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/tcommsat/computer) +"XY" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/frame, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/foreportrooma) +"XZ" = ( +/obj/machinery/door/firedoor/glass, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 10 + }, +/obj/machinery/door/airlock/angled_bay/external/glass{ + frequency = 1380; + id_tag = null; + locked = 1; + name = "Docking Port Airlock" + }, +/obj/effect/map_helper/airlock/door/int_door, +/obj/machinery/access_button{ + command = "cycle_interior"; + dir = 1; + frequency = 1380; + master_tag = "sd_escape_center_left"; + pixel_x = -32; + req_one_access = list(13) + }, +/turf/simulated/floor/tiled/steel_ridged, +/area/stellardelight/deck3/aft) +"Yb" = ( +/obj/machinery/atmospherics/unary/vent_pump/high_volume{ + dir = 4; + frequency = 1379; + id_tag = "portmaint_airpump" + }, +/obj/machinery/light/small{ + dir = 1 + }, +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/portcent) +"Yc" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Yd" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"Yg" = ( +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/deck3/portaft) +"Yj" = ( +/obj/structure/girder/displaced, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/forestarroomb) +"Yk" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 9 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 9 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"Yl" = ( +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"Ym" = ( +/obj/machinery/atmospherics/pipe/manifold/hidden{ + dir = 1 + }, +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/portcent) +"Yo" = ( +/obj/structure/bed/chair/office/dark{ + dir = 4 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/aftstarroom) +"Yp" = ( +/obj/machinery/button/remote/blast_door{ + desc = "A remote control-switch for shutters."; + id = "cafe"; + name = "Cafe Shutters"; + pixel_y = 28; + req_one_access = list(25) + }, +/turf/simulated/floor/lino, +/area/stellardelight/deck3/cafe) +"Ys" = ( +/obj/machinery/embedded_controller/radio/airlock/airlock_controller{ + dir = 4; + id_tag = "starmaint_airlock"; + pixel_x = -24; + req_access = null; + req_one_access = list(13); + tag_airpump = "starmaint_airpump"; + tag_chamber_sensor = "starmaint_sensor"; + tag_exterior_door = "starmaint_exterior"; + tag_interior_door = "starmaint_interior" + }, +/turf/simulated/floor/airless, +/area/maintenance/stellardelight/deck3/starboardcent) +"Yu" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/closet/crate, +/obj/random/contraband, +/obj/random/maintenance/research, +/obj/random/maintenance/research, +/obj/random/maintenance/research, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/maintenance, +/obj/random/mre, +/obj/random/snack, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"Yv" = ( +/obj/machinery/light_switch{ + dir = 4; + pixel_x = -25 + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"Yw" = ( +/obj/structure/lattice, +/obj/structure/disposalpipe/segment{ + dir = 4; + icon_state = "pipe-c" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 6 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 6 + }, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"Yx" = ( +/obj/structure/closet/emcloset, +/obj/random/maintenance/cargo, +/obj/random/maintenance/cargo, +/obj/random/maintenance/clean, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardcent) +"Yy" = ( +/obj/structure/lattice, +/obj/structure/cable{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"Yz" = ( +/turf/simulated/wall/bay/r_wall/steel, +/area/maintenance/stellardelight/deck3/portcent) +"YA" = ( +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 9 + }, +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"YB" = ( +/obj/structure/cable/blue{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarroomb) +"YC" = ( +/obj/item/device/radio/intercom{ + dir = 1; + name = "Station Intercom (General)"; + pixel_y = 24 + }, +/obj/structure/closet/secure_closet/RD, +/obj/item/device/aicard, +/obj/item/clothing/glasses/omnihud/rnd, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/item/device/retail_scanner/science, +/turf/simulated/floor/tiled/techfloor, +/area/crew_quarters/heads/hor) +"YD" = ( +/obj/structure/table/steel, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"YE" = ( +/obj/structure/table/standard, +/obj/random/soap, +/obj/machinery/power/apc/angled{ + dir = 1 + }, +/obj/structure/cable/green{ + icon_state = "0-4" + }, +/obj/machinery/light{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/holodeck_control) +"YH" = ( +/obj/item/modular_computer/console/preset/command, +/obj/structure/sign/poster{ + dir = 8 + }, +/obj/machinery/newscaster{ + pixel_y = 28 + }, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/chief) +"YJ" = ( +/obj/structure/cable/green{ + icon_state = "2-4" + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 6 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 6 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"YK" = ( +/obj/structure/window/reinforced{ + dir = 4; + pixel_x = 4 + }, +/turf/simulated/open, +/area/stellardelight/deck3/aft) +"YL" = ( +/obj/structure/table/reinforced, +/obj/item/weapon/paper_bin{ + pixel_x = -3; + pixel_y = 7 + }, +/obj/item/weapon/folder/blue_hop, +/obj/item/weapon/pen, +/obj/machinery/light, +/turf/simulated/floor/tiled, +/area/crew_quarters/heads/hop) +"YN" = ( +/turf/simulated/wall/bay/r_wall/steel, +/area/stellardelight/deck3/portdock) +"YO" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 1 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"YQ" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 10 + }, +/turf/simulated/floor/carpet/tealcarpet, +/area/crew_quarters/heads/cmo) +"YR" = ( +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 8 + }, +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"YS" = ( +/obj/structure/table/steel, +/obj/random/coin/sometimes, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/aftstarroom) +"YU" = ( +/obj/structure/lattice, +/turf/simulated/open, +/area/crew_quarters/bar) +"Zd" = ( +/turf/simulated/wall/fancy_shuttle{ + fancy_shuttle_tag = "sdboat" + }, +/area/shuttle/sdboat/aft{ + base_turf = /turf/simulated/floor/reinforced/airless + }) +"Ze" = ( +/turf/simulated/floor/bluegrid{ + name = "Mainframe Base"; + nitrogen = 100; + oxygen = 0; + temperature = 80 + }, +/area/tcommsat/chamber) +"Zf" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 8 + }, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"Zi" = ( +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 4 + }, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 4 + }, +/obj/effect/floor_decal/shuttles/right, +/obj/structure/cable{ + icon_state = "1-2" + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/portdock) +"Zj" = ( +/obj/structure/bed/chair, +/obj/machinery/status_display{ + pixel_y = 32 + }, +/obj/effect/floor_decal/steeldecal/steel_decals5{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"Zk" = ( +/obj/machinery/light/small{ + dir = 8 + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/effect/landmark/stardog, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portfore) +"Zl" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"Zm" = ( +/obj/structure/cable/blue{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/light_switch{ + dir = 4; + pixel_x = -24; + pixel_y = 29 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_cyborg_station) +"Zn" = ( +/obj/structure/bed/chair, +/turf/simulated/floor/tiled/techfloor/grid, +/area/maintenance/stellardelight/deck3/foreportrooma) +"Zp" = ( +/obj/machinery/light/small{ + dir = 4 + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portcent) +"Zt" = ( +/obj/structure/lattice, +/obj/structure/cable{ + icon_state = "4-8" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/turf/simulated/open, +/area/stellardelight/deck2/central) +"Zu" = ( +/obj/effect/floor_decal/spline/plain{ + dir = 6 + }, +/obj/structure/table/bench/marble, +/turf/simulated/floor/lino, +/area/stellardelight/deck3/cafe) +"Zw" = ( +/obj/machinery/porta_turret/ai_defense, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 9 + }, +/turf/simulated/floor/bluegrid, +/area/ai) +"ZB" = ( +/obj/machinery/alarm/angled{ + dir = 4 + }, +/obj/effect/landmark/stardog, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/portaft) +"ZC" = ( +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 8 + }, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"ZD" = ( +/obj/effect/landmark/stardog, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/starboardaft) +"ZE" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 1 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/obj/machinery/hologram/holopad, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/aft) +"ZF" = ( +/obj/structure/bed/chair{ + dir = 8 + }, +/turf/simulated/floor/carpet/oracarpet, +/area/crew_quarters/heads/chief) +"ZH" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 1 + }, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/hologram/holopad, +/turf/simulated/floor/tiled, +/area/stellardelight/deck3/starboarddock) +"ZK" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/turf/simulated/floor/tiled/monotile, +/area/stellardelight/deck3/commandhall) +"ZL" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/machinery/door/blast/angled/open{ + dir = 4; + id = "readingroom3" + }, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/stellardelight/deck3/readingroom) +"ZM" = ( +/obj/structure/lattice, +/obj/machinery/atmospherics/pipe/simple/hidden{ + dir = 4 + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/open, +/area/stellardelight/deck2/starboard) +"ZN" = ( +/obj/item/device/radio/intercom{ + dir = 4; + pixel_x = 24 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai) +"ZQ" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/maintenance/stellardelight/deck3/forestarrooma) +"ZS" = ( +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 + }, +/turf/simulated/open, +/area/stellardelight/deck2/port) +"ZV" = ( +/obj/machinery/door/firedoor/glass, +/obj/structure/window/bay/reinforced, +/obj/machinery/door/blast/angled/open{ + dir = 4; + id = "readingroom1" + }, +/obj/structure/low_wall/bay/reinforced/steel, +/turf/simulated/floor, +/area/stellardelight/deck3/readingroom) +"ZX" = ( +/obj/machinery/light{ + dir = 8 + }, +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 4 + }, +/turf/simulated/floor/tiled/techfloor/grid, +/area/ai_upload) +"ZZ" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/turf/simulated/floor, +/area/stellardelight/deck2/fore) (1,1,1) = {" -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhElJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhElJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhElJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLJhJhJhNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLJhNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLJhJhNLNLNLSKSKSKunAekoFHNLSKNLFHunAekoSKSKSKNLNLNLJhJhNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLunGoAekoNLJhJhJhNLafSKydewNLJhNLRxeXSKafNLJhJhJhNLunAevQkoNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLVMafJhydAeAeAegJAeHxJhNLydAeAeAeeXNLJhmMAeAeAeAeAeeXJhafVMNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafSKNLJhJhJhafTEeXJhJhNLJhJhJhNLJhJhydOpNLJhJhJhNLSKafNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLuneXJhJhJhJhSKafNLJhJhJhSKJhJhJhSKJhJhJhNLNLSKJhJhJhJhydkoNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLunUwAeAeeXJhJhJhJhSKSKafJhJhJhJhSKJhJhJhSKJhJhJhJhNLSKSKJhJhJhJhydAeAeEVkoNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLVMafNLNLSKJhJhJhSKSKSKeIfsCACACAQpCACACAQpCACACAQpQpSKSKSKJhJhJhSKNLNLafVMNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLuneXJhJhSKJhJhSKSKSKQpQpXcqpqpqpYUqpqpqpYUqpqpqpqpQpQpSKSKSKJhJhSKJhJhydkoNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLafJhJhhDhDhDSRSRSRhDQpqpDdqpqpqpYUqpqpqpYUqpqpqpqpbVJxJxZQZQZQJxJxJxJhJhafNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhSKafJhhDhDUcXvWLShqMHRQpqpDHkUkUkUXHUSUSUSjaiNiNiNiNeVammRmRmRViqspLJxJxJhafSKJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhafhDhDFWilUqZnZnUqqMQpqpYUqpqpqpDdqpqpqpoPqpqpqpqpqpJxaSaSaSpqaSKVLVJxJxafJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhkQhDcZDYilogDMzQPqxbQpqpYUqpqpqpDdqpqpqpoPqpqpqpqpqpJxpESbSbAiSbSbSbsjJxKrJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhkPmQkQnOilXYWMogpkDMPqOoQpqpYUqpqpqpDdqpqpqpoPqpqpqpqpqpJxIbeRbJHVtFtFxNTiMcRhVgREJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhElJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhkPkPsXHOPVilXYOFUqWIWIUqXvQpqpOPNFNFNFOQVmVmVmFbjCjCjCjCggJxSbSbSbSbSbSbSbNjaSJxymREREJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhFHJhmQDpcKJnMPSpLJililFYilXvXvQpqpcaqpqpqpDdqpUXqpoPqpqpqpqpqpJxWFAyaDaDNzAQaSGJemduQVKqVgJhqbJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLgwAeVaKQXThDhDhDhDhDhDhDhDhDhDQpQpQpQpQpQpTaQpQpQpdNQpQpQpQpQpJxJxJxJxJxJxJxJxJxJxJxcLTPhTqyOxNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhElJhJhJhJhJhJhJhJhNLNLafSKkPXTXTRLztVDgjpNpNDCnezWHfqFCpqFqFbaqFZZHqneHfUAqFHfqFqFCpqFHfzWnedxapFETdfDUeEZzfDQRESKxmNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLafJhmQKgpfxIdLJYfhXVXVlhvFljIegGCUgGgGIegGmmbnbIgOFjmjmpmjmjnamjmpCwgmqWsRsRTSsRsRyyulDQVgJhxmNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafJhmQizNsXlxPxPnXpNpNDCqFqitVqFCpqFqFtVqFsOtVoXqFaqqFtVqFqFCpqFtVsdqFdxFEFEYBFEFEFDzfDQVgJhxmNLNLNLNLJhzkJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafJhkPWsNsRLpNpNrjpNpNDCqFqiqFcbcbcbcbcbcbcbrcvOrcEJEJEJEJEJEJEJqFsdqFdxEfEfhzEfEfEZzfDQREJhxmNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafJhkPYuNsRLpNxPJcxPpNDCqFqiqFcbYHICNOgyklHspoHWtJrxToXaVElkoDEJqFsdqFdxUbGBhzEfYjEZzfDQREJhxmNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafJhkPZkrWRLzphjIjhjNGDCqFqiqFcbSBQfUdZFAPHsaQxwaQrxpdXGPRGlGREJqFsdqFdxYjYjVxirOREZRiWBREJhxmNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLTEUwWdAeVaYlNsRLcHeyXIxPpNDCqFqiqFcbHahXEYnsVejnBKzbxUBzmIYQhpviVBEJqFsdqFdxYjYjacEflAEZtcTPhTqyTVuHweNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhunAeAeeXNLSKkPXTeFRLpNpNpNpNpNDCCbXesJcbBMhXhXfaarHsaQtTaQrxasyBviviJjEJIVwyIDdxEfEfEfEfEfEZDQDQRESKNLOJqyqyEUJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhafNLNLNLNLJhmQXTIPXlnvxPxPpNpNDCqFqiqFcbEEJUGWVrvfHsaQtTaQrxSPAETpFMFOEJqFsdqFdxFEFEFEFEFEEZDQDQREJhNLNLNLNLxmJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhafNLNLNLJhJhmQXTYDXlyYkVxPpNpNDCqFqiqFcbcbcbcbcbcbcbsftTAwEJEJEJEJEJEJEJqFsdqFdxPsFEFERgFEFDDQDQVgJhJhNLNLNLxmJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhafNLNLNLJhJhkPXTbCRLztEHyYpNMZDCqFqiqFzNubXOUTEtPeGQjOtTLznPpVYCXmJvjMujqFsdqFdxeEuEUFFEovFDDQDQVgJhJhNLNLNLxmJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhafNLNLJhJhJhkPXTmszXzXzXzXyZzXoZqFqiqFzNhcxSnHwqpOGQaQzBaQnPDIsAolOtgsujqFsdqFdxdxdxdxdxdxEZDQDQREJhJhJhNLNLxmJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhafNLNLJhJhJhmQXTNsZLAtmduUKIDOoZCpkOCpzNgLBHgbdDUBFgBKzbBKevBQMGmOtZzvujOaDfCpEcchkuuMMrDuCCUUDQREJhJhJhNLNLxmJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhafNLJhJhJhJhmQXTNsZLqCQKzXKIqgoZqFqiqFzNUHBHBHdYauGQaQtTaQnPavbxtZtZhUujqFsdqFEclVmFxpPpXbjyDQMuREJhJhJhJhNLxmJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhafNLJhJhJhJhkPJiHkzXzXzXzXGHLmoZqFqiqFzNODtOdHMNmDGQjKUGSZnPBrKGGiuVsCujqFsdqFEczFVkxoipQWjyDQzAREJhJhJhJhNLxmJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhafJhJhJhJhJhmQXTNswtAtCoNJKIAfoZqFqiqFzNzNzNzNzNzNzNeLwQKwujujujujujujujqFsdqFEcNZzCJmfjDWCCDQLnREJhJhJhJhJhxmJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhVMJhJhJhJhJhmQXTNswtqCQKzXoEBdoZMvXesJWOJdBqJsEOFCDVwVEWiIDVPCPopmBqOKWOIVwyKFEcEcEcEcEcISCCDQLnREJhJhJhJhJhiYJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhkPXTNszXzXzXzXKIAmoZqFqiqFWOMgxMMlLvyCdUbEbEbEdUXJzogEWWAjWOqFsdqFXBhOhrkpREbBVgDQLnVgJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhElJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhmQXTNsZVAthelUKIyqoZqFqiqFWOBYxYSAhudZTvbEbEbETvfThuWqxYSEWOqFsdqFXBGmalbmbhHLVgDQLnVgJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhmQXTNsZVqCQKzXqxxvoZqFqiqFWOrlxYxYhuaxdUbEbEbEdUayhuxYxYHvWOqFsdqFXByiiiiiREbBREDQLnREJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhkPULKWzXzXzXzXzXHQzXiQqiqFWObjkayIbOatdUaQaQaQdUatbOyIkabjWOqFsdhCBpBFBpBpmebBREezRKREJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhElJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhYzMyOXHmuJbloItpZpYzwaDDwaWOWOWOWOWOWOWOQTbUQTWOWOWOWOWOWOWOaJRjaJmeEvOMrHbrbBxHxHhBmeJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhYzEiSzSzSzopSzehYkYzoWrSoWnWfdsiJEYpOygqGjIIntinAXCRazTljDinowFLowmeIobSoCqfptDEDEInmeJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhmfJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhYzYzYzYzyRYzYzgARMYzQFjTZSOzGgrLlDrLbYHBxyiyiybgcPAnMsWakNinOEaNwcmeutDZmemeaBmemememeJhJhJhJhJhElJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhLrJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhElJhJhJhJhNLNLYzYbYmFmyRsNWQYzoWrSoWOzeUeUjmeUeUHBTmGjNfinYveDkTwYjhinowFLowmeTsWAaBdkMwodmeNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNQOdVRzwYzMROXYzdTrSoWnWJZLwWtLwLwZuTmFrSQinininyMinininowFLyPmeIoWAmeYshywMxuNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhTEAemaFyGFIYYzVKSzCfhYFtPmnjppBthbXiXivhPLRlTFyJxgQoMIfOzmTkNhOIKsPdQPnuUgHhONSVnfqyweJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLYzgcQSEIyRZfcSYzWlIgoWnWQixZxZxZxZrgGjGjGjZKRnyeiPyoIlRnoweYRGmexHWAaBebXdLRmeNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhFHJhJhJhJhJhJhJhJhYgYgYzNKrpYzYzMRHmYzoWIgoWOzqcmrxZxZzEeaabaeTOZKRnUkrAyodoRnoweYowmeOGAHmetCJamemebybyJhJhJhJhJhJhJhJhFHJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhafJhJhJhJhJhJhJhJhYgvAYJYOLDYdGSfGSDYzQFMkZSOznFgkxZxZWDCdQBiVVqQEPJijDNyoaHinOEWGZCmemTzLhERqLytkGqLibyJhJhJhJhJhJhJhJhafJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhafNLJhJhJhJhJhJhJhYgdExTFGFScpnwbPSDYzoWIgoWnWLKzEnzxZnkSUQBiVWHWNRnTjYLaKqZinoweYowmeYxxHyfKJKJqSETKJbyJhJhJhJhJhJhJhNLafJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhafNLJhJhJhJhJhJhJhYgDTxTYgYgYgYzYzYzYzoWIgoWnWnWOzOzOznWnWQBiVybfSininininininoweYowmemememebybybyETlebyJhJhJhJhJhJhJhNLafJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhydAekoJhJhJhJhJhJhkidMxTYgoWCSoWoWoWXfoWIgoWsxnxnxWpnxnxzzrcvwiEzznxnxWpnxnxsxoweYowxRowowowPaowbyuYwwCKJhJhJhJhJhJhunAeeXJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLafJhJhJhJhJhJhkibdxTYgCSYwxdxdxdobxdCzZlHemgmgXAjYjYszaMMFvtRTXFXFHZZtZtbTCJhPCJfECJCJCJwRaCbyuYwwCKJhJhJhJhJhJhafNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLTEewNLJhJhJhJhJhYgNExTYgoWufoWoWoWBLoWaEoWsxnxnxlYnxTxRXWyAUKiRXTxnxlYnxnxsxowsnoweQowowowYyowbyAsMBbyJhJhJhJhJhNLRxOpNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLafNLJhJhJhJhJhYgnVxTYgoWufoWadadadadadadadadadadscscscscscscscscscscscscscthpXGkGkGkGkowYyowbyifKtbyJhJhJhJhJhNLafNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLafNLNLJhJhJhJhYgZBoMYgoWufoWadqnjEZeZeQCZeZejEqnscwSbKVsbLVsTLwSscwSpAwSscepLbGkdEdEGkowYyowbymKivbyJhJhJhJhNLNLafNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLafNLNLJhJhJhJhYgdExTYgNdMkZSadbZcmcWcYeleCeKfkghscgQgSVsVsVsVsusscKMajtnscMpJKGkdEdEGkOEkjZCbyifKJbyJhJhJhJhNLNLafNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLafNLNLNLJhJhJhYgNRBZYgoWufoWadZeZegUgWZeRdibZeZesciKiRVsIQVsrZVGscdSDwlPscUjfMGkdEdEGkowYyowbyATUQbyJhJhJhNLNLNLafNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafNLNLNLNLJhSKYgdExTYgoWufoWadUKkcksDyliDylolweoscKHRcTLTLTLIQNPscMKCestscHcTyGkdEdEGkowYyowbyifKJbySKJhNLNLNLNLafNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLRxAeAeAeAeAeAevqhdINYgoWufoWadkwZeqngUrsibqQMOqUscKYQsOlOlOlJgbsscWiCetXscTngHGkdEdEGkLfYyowbyifHFurAeAeAeAeAeAeewNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhElJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafNLNLNLNLSKJhYgdExiLTJuzHhGadlxlEZelHmCnmSmnCoAscQGTKOloROlGPVsscscVQscscqOthGkdEdEMACHApuXBgNenDbyJhSKNLNLNLNLafNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLTEewNLNLNLNLNLNLYgdEdEYgoWqPoWadOjhwZeqnDyqnSmpxpYscegGaqvqArBGPIQscvTanKUXrHTAxGkdEdEsZowmSowbyiSBGbyNLNLNLNLNLNLRxOpNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafNLNLNLNLNLNLYgdEdEYgoWqPoWadHtsKEesKuvkbtLsKslscQGeuOlHAOlGPwGscQIanbWsIlLthGkGkGksZowmSowbyjoLYbyNLNLNLNLNLNLafNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafNLNLNLNLNLNLYgdELoYgoWqPoWqquBznuBznELznznznznscQGxhOlOlOlGPVsscyVanJOwvHTthsQGetQOAowmSowbyKzLYbyNLNLNLNLNLNLafNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafNLNLNLNLJhJhYgdEdEYgoWqPoWqqOekFuBtWuwBlzncccOscnpkBrNIUmAZwtqscoNkXvSCTIGctuTvbVtOAowmSowbyDkLYbyJhJhNLNLNLNLafNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhzkJhJhNLNLNLNLafNLNLNLNLSKJhYgfPSwYgQFjLZSqqHXFvuBznOCznzniLvNscnMrZMVIQsrTIZNscuceSJJRQAxthwoxjwdOAOEdbOYbyqYGcbyJhSKNLNLNLNLafNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafNLNLNLNLSKSKYgHYdEYgoWqPoWqqsuUfxzxBycyEzYAqASscuIndCngNHSlQTLsctyQLNWSkthDeyHyHyHczowmSyPbyAKlFbySKSKNLNLNLNLafNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafNLNLNLNLJhSKkieddEYgWlqPEuqqXXGDpWpWLhpWDPdydVscwSscscJzscscwSscAzeSWXhFthLejPWZEdowowmSowbyLdWrCKSKJhNLNLNLNLafNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLafNLNLNLJhJhJhkiBmdEYgCSIHNIqqqqqqqqqqqqqqqqoYqqscscscAZPjAZscscscthsbthththTBBCLPCcokokRzZMffKDMWCKJhJhJhNLNLNLafNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLafNLSKSKJhJhJhYgJWdEIiIiIiIOaFNNlvckGfCuMEXKzDTMBjXKBkbMzirbBsthSLluoTthqXSFIZenzyEdowowVpowbyvyLYbyJhJhJhSKSKNLafNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLTEewJhSKSKIiIiIiIiIiLSIiQuIiIiIiIioVkrSfpcUIXKRZVWxeXKXKRuGhfvXKthTrwNHNthnLpcIZenPXaAaAaAaAaAaAaApzhQhQhQhQSKSKJhRxOpNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLafJhSKNLIiqzqzqzqzqzqzqzqzqzqzIiOfRvpcpcaXXKuZnSFhMJXKVCJPVCthOSwNDsKxthGvpcIZenIWaAywwKRHejnraAawlqlquDhQNLSKJhafNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLSKafJhNLNLIiqzqzqzqzqzqzqzqzqzqzIicuRvpcEReiXKTYFhFhuQXKwAJQLCthTrwNqKpSthktERIZenRNaAbbzarnzalTaAawlqlqQvhQNLNLJhafSKNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhSKafNLNLNLIiqzqzqzqzqzqzqzqzqzqzIiHdeNWxagahXKXofbDLQmOwcwKSzgciZmbQFUypthakagYRcqsUaAObfzFRfzgRaAzVrqrqAlhQNLNLNLafSKJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhElJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhSKafNLNLNLIiqzqzqzqzqzqzqzqzqzqzIiHHRvWxQnRIXKdnFhGUNmXKZXFehKthiJzMqdnNthRIYKYRlJENRotHjdwWJkPxaAjplqlqVZhQNLNLNLafSKJhJhzkJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLafNLNLNLIiqzqzqzqzqzqzqzqzqzqzIilmiWWUQnRIXKCGDhOvIuXKUOhttzthnNPWLxnNthRIYKxOpbdrOUOUOUOUOUOUOUOUlqaatuhQNLNLNLafNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLafNLNLNLIiqzqzqzqzqzqzqzqzqzqzIiIiTfxWEdEdXKXKXKXKXKXKVCisVCththththththEdEdgVGEEdOUiCrhzJrmzroSOUNUBnlqhQNLNLNLafNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLafNLNLNLIiqzqzqzqzqzqzqzqzqzqzIiYEimytjPwPWfcxnZZjltCVTJdjPEpBFfZjnZysHwUyjPYAVNHiOUiCrhCYuzzroSOUlqlqnThQNLNLNLafNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafNLNLNLIiqzqzqzqzqzqzqzqzqzqzePNTzICPpKZEtgpKAYYcwgpKdFvvMCpKEFYcoypKpKPcpKMUCyBeXENcuWcIEhVbMiOUlqlqxEhQNLNLNLafNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhElJhJhJhJhJhJhJhJhNLNLNLNLafNLNLNLIiqzqzqzqzqzqzqzqzqzqzIiaoqNItMxKfMxMxQxtGSlMxMxOuMxMxxAtGQxMxMxPAMxvGSNaGOUiCrhCYmnzroSOUlqYoYShQNLNLNLafNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafNLNLNLIiqzqzqzqzqzqzqzqzqzqzIiIiyFoOYNEdEdEdEdgMOqImoqoqoqImcsgMEdEdEdEduqBJmouqOUiCrhkYAvzroSOUKkMHHohQNLNLNLafNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLTEAeAeewNLNLNLIiIiIiIiIiIiIiIiIiIiIiIiOglaZiYNhfsMSCsMBBOqImoqoqoqImcsBBsMSCsMOcuqLIpGcyOUOUOUOUOUOUOUOUhQhQhQhQNLNLNLRxAeAeOpNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafSeIzIzIzhkIzIzIzIzhkIzIzdhNLYNJRVcekYNsMsMsMsMBBKyImoqJSoqKocABBsMsMsMsMuqkWQZJouqNLSeIzIzhkIzIzIzIzhkIzIzIzdhafNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafpTsMsMsMeJWKbebebeWKmisMPTNLaimXSTNqaisMsMsMsMVSTATAXZEdosTATAyjsMsMsMsMjgKbfWvJjgNLpTsMsMsMsMsMsMsMsMsMsMsMPTafNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafpTsMsMsMWKWKwrWjjcWKWKsMPTNLaimXSTNqaisMsMsMsMsMsMEdBREdouEdsMsMsMsMsMsMjgKbfWvJjgNLpTsMsMsMsMsMsMsMsMsMsMsMPTafNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafpTsMsMsMWKKjBbyaExmhWKsMPTNLYNNkSTBVYNsMsMsMsMsMsMEdJAEdQJEdsMsMsMsMsMsMuqmqfWvPuqNLpTsMsMsMsMsMsMsMsMsMsMsMPTafNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafpTsMsMsMWKWKSJPlSJWKWKsMPTNLaiXCjVYNYNYNsMsMsMsMsMsMsMCxsMsMsMsMsMsMsMuququqexoUjgNLpTsMsMsMsMsMsMsMsMsMsMsMPTafNLNLNLNLJhJhJhJhJhJhJhJhElJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhEsJhNLNLNLNLafpTsMsMsMdQglVwLOVwgldQsMPTNLaiHgTWqeCDtRsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMVorrnBNyhZjgNLpTsMsMsMsMsMsMsMsMsMsMsMPTafNLNLNLNLJhsEJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafpTsMsMsMZdRYVwLOVwIrZdsMPTNLaiKTpCYNYNYNsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMuququqXDxCjgNLpTsMsMsMsMsMsMsMsMsMsMsMPTafNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLTEAeAeewpTsMsMIaZdaPVwLOVwWgZdIaPTNLYNukPDvIYNsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMuqNidfpluqNLpTsMsMsMsMsMsMsMsMsMsMsMPTRxAeAeOpNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafpTsMsMZdZdZdRwlBZdZdZdZdetqLYNKLdwNqaisMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMjgKbsPlCuqWuiZsMsMsMsMsMsMsMsMsMsMsMPTafNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafpTsMsMZdWnrXcnhRRwriADZdYNaiYNIROrNqaisMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMjgKbZHDnuqjguqsMsMsMsMsMsMsMsMsMsMsMPTafNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLafpTsMsMVhBWMXiwMXsavXQekzBAMossSnmbNqaisMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMjgKbvotbNXwmySsMvEsMsMsMsMsMsMsMsMsMPTafNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLunWdbpsMsMgilcfgzSkZZdWwxfgiYNaiYNUVEgTcYNsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMuqKvNxLQuqjguqsMsMsMsMsMsMsMsMsMsMsMvaLWkoNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLafNLyWsMsMgiuiZdZdwZPBUDRWgiHuqLYNYNhNYNYNhfsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMOcuquqHPuquqWuqEsMsMsMsMsMsMsMsMsMsMsMnhNLafNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhElJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhSKNLafNLyWsMsMQhEXZdxLmvxLZdKevrPTNLNLNLyWsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMnhNLNLNLpTsMsMsMsMsMsMsMsMsMsMsMnhNLafNLSKJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLSKJhafNLyWsMsMhgNSZdsMsMsMZdNSZdPTNLNLNLyWsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMnhNLNLNLpTsMsMsMsMsMsMsMsMsMsMsMnhNLafJhSKNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLJhafNLyWsMsMsMsMsMsMsMsMsMsMsMPTNLNLNLyWsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMnhNLNLNLpTsMsMsMsMsMsMsMsMsMsMsMnhNLafJhNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLafJhdBIKIKIKIKIKIKIKIKIKDiIKEnAeAeAetKsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMGTAeAeAekkIKURIKIKIKIKIKIKIKIKIKFIJhafNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLTEAeeXJhJhJhSKSKJhJhJhJhJhJhafSKJhJhNLTEtKsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMGTOpNLJhJhSKafJhJhJhJhJhJhSKSKJhJhJhydAeOpNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLNLJhJhNLNLNLNLNLNLNLNLNLafNLNLJhNLNLyWsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMnhNLNLJhNLNLafNLNLNLNLNLNLNLNLNLJhJhNLNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLJhJhJhNLNLNLNLNLNLTEAeAeeXNLNLJhJhJhyWsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMnhJhJhJhNLNLydAeAeAeOpNLNLNLNLNLJhJhJhNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLNLJhJhJhJhNLNLNLNLNLNLNLNLNLNLJhJhJhJhyWsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMnhJhJhJhJhNLNLNLNLNLNLNLNLNLNLJhJhJhJhNLNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhyWsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMnhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhyWsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMnhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhyWsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMsMnhJhJhJhJhJhJhJhJhJhJhJhJhJhzkJhJhJhJhJhJhNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhNLJhJhJhJhJhJhJhJhJhJhJhJhElJhJhJhJhJhJhJhdBIKIKIKIKIKIKIKIKVzIKIKIKgBIKIKIKIKIKIKIKIKFIJhJhJhJhJhJhJhJhJhElJhJhJhJhJhJhJhJhJhJhNLJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhzkJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhElJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhElJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -JhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -COJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh -TeJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJhJh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +CO +Te +"} +(2,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(3,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(4,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(5,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(6,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(7,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(8,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(9,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(10,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(11,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(12,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(13,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(14,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(15,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(16,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(17,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(18,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(19,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +El +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(20,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(21,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(22,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +mf +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(23,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +El +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(24,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(25,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(26,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(27,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(28,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(29,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +El +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(30,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +El +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +El +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(31,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(32,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(33,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(34,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(35,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +zk +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(36,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +El +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Es +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(37,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(38,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +Jh +Jh +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +Jh +Jh +zk +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(39,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +TE +NL +NL +NL +NL +NL +NL +NL +TE +NL +NL +NL +NL +NL +SK +SK +NL +NL +TE +NL +NL +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(40,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +FH +af +af +af +yd +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +Jh +Jh +Jh +NL +NL +NL +NL +NL +Ae +NL +NL +NL +NL +NL +NL +NL +Ae +NL +NL +NL +NL +NL +NL +Jh +Jh +NL +Ae +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(41,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +Ae +NL +TE +NL +NL +NL +NL +NL +NL +NL +TE +NL +NL +NL +NL +NL +NL +NL +NL +TE +NL +SK +SK +SK +NL +NL +NL +NL +NL +NL +Ae +NL +NL +NL +NL +NL +NL +NL +Ae +NL +NL +NL +un +af +af +af +af +af +eX +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(42,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +ko +af +ew +af +af +af +af +af +Rx +af +ew +af +af +af +af +af +af +af +af +ew +af +af +af +af +af +af +af +af +af +af +ew +af +af +af +af +af +af +af +ew +af +af +af +Wd +NL +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(43,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +NL +un +af +af +af +af +af +af +af +af +VM +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +NL +NL +Ae +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +Jh +Jh +Jh +NL +NL +NL +NL +NL +NL +NL +NL +NL +Se +pT +pT +pT +pT +pT +pT +pT +pT +pT +pT +bp +yW +yW +yW +yW +dB +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(44,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +NL +NL +Ae +NL +NL +NL +NL +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +El +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +Ae +NL +NL +NL +NL +NL +NL +NL +NL +NL +SK +SK +SK +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +Iz +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(45,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +NL +NL +TE +Ae +NL +NL +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +Ae +NL +NL +NL +NL +NL +NL +NL +NL +NL +SK +SK +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +Iz +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +SK +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(46,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +NL +NL +NL +Uw +eX +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +Ae +NL +NL +NL +NL +NL +NL +NL +NL +Jh +Jh +Ii +Ii +Ii +Ii +Ii +Ii +Ii +Ii +Ii +Ii +Ii +Ii +Iz +sM +sM +sM +sM +sM +sM +Ia +Zd +Zd +Vh +gi +gi +Qh +hg +sM +IK +SK +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(47,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +FH +gw +af +af +af +af +af +af +Wd +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Ae +SK +NL +NL +NL +Jh +SK +SK +Jh +Jh +Jh +Ii +qz +qz +qz +qz +qz +qz +qz +qz +qz +qz +Ii +hk +eJ +WK +WK +WK +dQ +Zd +Zd +Zd +Wn +BW +lc +ui +EX +NS +sM +IK +Jh +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(48,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Ae +SK +Jh +Jh +Jh +Jh +Jh +Ae +SK +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +SK +Ae +Jh +NL +NL +NL +Jh +Jh +SK +SK +Jh +Jh +Ii +qz +qz +qz +qz +qz +qz +qz +qz +qz +qz +Ii +Iz +WK +WK +Kj +WK +gl +RY +aP +Zd +rX +MX +fg +Zd +Zd +Zd +sM +IK +Jh +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(49,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +kP +mQ +Va +kP +mQ +mQ +kP +kP +kP +Va +kP +mQ +mQ +kP +kP +mQ +mQ +kP +mQ +mQ +kP +mQ +mQ +kP +Yz +Yz +Yz +NL +NL +TE +NL +Yg +Yg +Yg +Yg +ki +ki +Yg +Yg +Yg +Yg +Yg +Yg +vq +Yg +Yg +Yg +Yg +Yg +Yg +Yg +ki +ki +Yg +Ii +qz +qz +qz +qz +qz +qz +qz +qz +qz +qz +Ii +Iz +be +wr +Bb +SJ +Vw +Vw +Vw +Rw +cn +iw +zS +Zd +xL +sM +sM +IK +Jh +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(50,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +kP +kP +Dp +KQ +XT +Kg +iz +Ws +Yu +Zk +Yl +XT +XT +XT +XT +XT +XT +XT +Ji +XT +XT +XT +XT +XT +UL +My +Ei +Yz +NL +NL +Ae +NL +Yg +vA +dE +DT +dM +bd +NE +nV +ZB +dE +NR +dE +hd +dE +dE +dE +dE +dE +fP +HY +ed +Bm +JW +Ii +qz +qz +qz +qz +qz +qz +qz +qz +qz +qz +Ii +Iz +be +Wj +ya +Pl +LO +LO +LO +lB +hR +MX +kZ +wZ +mv +sM +sM +IK +Jh +NL +TE +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(51,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +SK +Jh +Jh +mQ +sX +cK +XT +XT +pf +Ns +Ns +Ns +rW +Ns +eF +IP +YD +bC +ms +Ns +Ns +Hk +Ns +Ns +Ns +Ns +Ns +KW +OX +Sz +Yz +Yz +NQ +ma +Yz +Yz +YJ +xT +xT +xT +xT +xT +xT +oM +xT +BZ +xT +IN +xi +dE +dE +Lo +dE +Sw +dE +dE +dE +dE +LS +qz +qz +qz +qz +qz +qz +qz +qz +qz +qz +Ii +Iz +be +jc +Ex +SJ +Vw +Vw +Vw +Zd +Rw +sa +Zd +PB +xL +sM +sM +IK +Jh +NL +Ae +NL +Jh +Jh +Jh +El +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(52,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +un +VM +un +af +af +af +kQ +kQ +HO +Jn +hD +RL +xI +Xl +RL +RL +RL +RL +RL +Xl +Xl +RL +zX +ZL +ZL +zX +wt +wt +zX +ZV +ZV +zX +Hm +Sz +Yz +Yb +Od +Fy +gc +NK +YO +FG +Yg +Yg +Yg +Yg +Yg +Yg +Yg +Yg +Yg +Yg +LT +Yg +Yg +Yg +Yg +Yg +Yg +Yg +Yg +Ii +Ii +qz +qz +qz +qz +qz +qz +qz +qz +qz +qz +Ii +hk +WK +WK +mh +WK +gl +Ir +Wg +Zd +ri +vX +Ww +UD +Zd +Zd +sM +IK +Jh +NL +Ae +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(53,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +Uw +af +eX +Jh +Jh +hD +hD +nO +PV +MP +hD +zt +dL +xP +pN +pN +zp +cH +pN +nv +yY +zt +zX +At +qC +zX +At +qC +zX +At +qC +zX +uJ +Sz +yR +Ym +VR +GF +QS +rp +LD +FS +Yg +oW +CS +oW +oW +oW +Nd +oW +oW +oW +Ju +oW +oW +oW +oW +QF +oW +Wl +CS +Ii +Qu +qz +qz +qz +qz +qz +qz +qz +qz +qz +qz +Ii +Iz +mi +WK +WK +WK +dQ +Zd +Zd +Zd +AD +Qe +xf +RW +Ke +NS +sM +Di +af +af +eX +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(54,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +Ae +NL +Jh +Jh +hD +hD +cZ +il +il +Sp +hD +VD +JY +xP +pN +xP +hj +ey +pN +xP +kV +EH +zX +md +QK +zX +Co +QK +zX +he +QK +zX +bl +op +Yz +Fm +zw +IY +EI +Yz +Yd +cp +Yg +CS +Yw +uf +uf +uf +Mk +uf +uf +uf +zH +qP +qP +qP +qP +jL +qP +qP +IH +Ii +Ii +qz +qz +qz +qz +qz +qz +qz +qz +qz +qz +Ii +Iz +sM +sM +sM +sM +sM +sM +Ia +Zd +Zd +kz +gi +gi +vr +Zd +sM +IK +SK +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +El +Jh +Jh +Jh +Jh +Jh +Jh +"} +(55,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +Ae +NL +Jh +hD +hD +FW +DY +XY +XY +LJ +hD +gj +fh +nX +rj +Jc +Ij +XI +pN +xP +xP +yY +zX +uU +zX +zX +NJ +zX +zX +lU +zX +zX +oI +Sz +Yz +yR +Yz +Yz +yR +Yz +GS +nw +Yz +oW +xd +oW +oW +oW +ZS +oW +oW +oW +hG +oW +oW +oW +oW +ZS +oW +Eu +NI +IO +Ii +qz +qz +qz +qz +qz +qz +qz +qz +qz +qz +Ii +dh +PT +PT +PT +PT +PT +PT +PT +et +YN +BA +YN +Hu +PT +PT +PT +En +Jh +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(56,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +un +VM +NL +un +eX +SK +SK +hD +Uc +il +il +WM +OF +il +hD +pN +XV +pN +pN +xP +hj +xP +pN +pN +pN +pN +yZ +KI +KI +GH +KI +oE +KI +KI +qx +zX +tp +eh +gA +sN +MR +VK +Zf +MR +fG +bP +Yz +oW +xd +oW +ad +ad +ad +ad +ad +ad +ad +ad +ad +qq +qq +qq +qq +qq +qq +aF +Ii +qz +qz +qz +qz +qz +qz +qz +qz +qz +qz +Ii +NL +NL +NL +NL +NL +NL +NL +NL +qL +ai +Mo +ai +qL +NL +NL +NL +Ae +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(57,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +El +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Go +af +af +eX +Jh +Jh +Jh +hD +Xv +Uq +og +og +Uq +il +hD +pN +XV +pN +pN +pN +NG +pN +pN +pN +pN +MZ +zX +DO +qg +Lm +Af +Bd +Am +yq +xv +HQ +Zp +Yk +RM +WQ +OX +Sz +cS +Hm +SD +SD +Yz +oW +xd +oW +ad +qn +bZ +Ze +UK +kw +lx +Oj +Ht +uB +Oe +HX +su +XX +qq +NN +Ii +Ii +Ii +Ii +Ii +Ii +Ii +Ii +eP +Ii +Ii +Ii +YN +ai +ai +YN +ai +ai +ai +YN +YN +YN +ss +YN +YN +NL +NL +NL +Ae +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(58,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Ae +Jh +SK +Jh +Jh +Jh +Jh +SR +WL +Zn +DM +pk +WI +FY +hD +DC +lh +DC +DC +DC +DC +DC +DC +DC +DC +DC +oZ +oZ +oZ +oZ +oZ +oZ +oZ +oZ +oZ +zX +Yz +Yz +Yz +Yz +Yz +Cf +Yz +Yz +Yz +Yz +Yz +Xf +ob +BL +ad +jE +cm +Ze +kc +Ze +lE +hw +sK +zn +kF +Fv +Uf +GD +qq +lv +oV +Of +cu +Hd +HH +lm +Ii +YE +NT +ao +Ii +Og +JR +mX +mX +Nk +XC +Hg +KT +uk +KL +IR +Sn +UV +YN +NL +NL +NL +Ae +TE +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(59,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +ko +yd +NL +Jh +Jh +Jh +SK +SR +Sh +Zn +zQ +DM +WI +il +hD +ne +vF +qF +qF +qF +qF +qF +Cb +qF +qF +qF +qF +Cp +qF +qF +qF +Mv +qF +qF +qF +iQ +wa +oW +QF +oW +dT +hY +Wl +oW +QF +oW +oW +oW +xd +oW +ad +Ze +cW +gU +ks +qn +Ze +Ze +Ee +uB +uB +uB +xz +pW +qq +ck +kr +Rv +Rv +eN +Rv +iW +Tf +im +zI +qN +yF +la +Vc +ST +ST +ST +jV +TW +pC +PD +dw +Or +mb +Eg +hN +yW +yW +yW +tK +tK +yW +yW +yW +yW +yW +yW +dB +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(60,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +Ae +Jh +Jh +Jh +SK +SK +SR +qM +Uq +Pq +Pq +Uq +Xv +hD +zW +lj +qi +qi +qi +qi +qi +Xe +qi +qi +qi +qi +kO +qi +qi +qi +Xe +qi +qi +qi +qi +DD +rS +jT +rS +rS +Ft +Ig +Ig +Mk +Ig +Ig +Ig +Cz +aE +ad +Ze +cY +gW +Dy +gU +lH +qn +sK +zn +tW +zn +xB +pW +qq +Gf +Sf +pc +pc +Wx +Wx +WU +xW +yt +CP +It +oO +Zi +ek +Nq +Nq +BV +YN +qe +YN +vI +Nq +Nq +Nq +Tc +YN +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(61,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +Jh +Ae +Jh +Jh +SK +SK +SK +hD +HR +qM +xb +Oo +Xv +Xv +hD +Hf +Ie +tV +qF +qF +qF +qF +sJ +qF +qF +qF +qF +Cp +qF +qF +qF +sJ +qF +qF +qF +qF +wa +oW +ZS +oW +oW +Pm +oW +oW +ZS +oW +oW +oW +Zl +oW +ad +QC +el +Ze +li +rs +mC +Dy +uv +EL +uw +OC +yc +Lh +qq +Cu +pc +pc +ER +ag +Qn +Qn +Ed +jP +pK +Mx +YN +YN +YN +ai +ai +YN +YN +CD +YN +YN +ai +ai +ai +YN +YN +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(62,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +SK +Jh +Ae +Jh +SK +SK +SK +Qp +Qp +Qp +Qp +Qp +Qp +Qp +Qp +Qp +qF +gG +qF +cb +cb +cb +cb +cb +cb +cb +zN +zN +zN +zN +zN +zN +WO +WO +WO +WO +WO +WO +nW +Oz +Oz +nW +nj +nW +Oz +Oz +nW +nW +sx +He +sx +ad +Ze +eC +Rd +Dy +ib +nm +qn +kb +zn +Bl +zn +yE +pW +qq +ME +UI +aX +ei +ah +RI +RI +Ed +wP +ZE +Kf +Ed +hf +sM +sM +sM +sM +YN +tR +YN +sM +sM +sM +sM +sM +hf +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(63,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +SK +Jh +gJ +af +af +af +eI +Qp +qp +qp +qp +qp +qp +qp +qp +Qp +Cp +CU +Cp +cb +YH +SB +Ha +BM +EE +cb +ub +hc +gL +UH +OD +zN +Jd +Mg +BY +rl +bj +WO +fd +Gg +eU +JZ +pp +Qi +qc +nF +LK +nW +nx +mg +nx +ad +Ze +eK +ib +lo +qQ +Sm +Sm +tL +zn +zn +zn +zY +DP +qq +XK +XK +XK +XK +XK +XK +XK +XK +Wf +tg +Mx +Ed +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(64,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +SK +NL +Ae +TE +NL +Jh +fs +Xc +Dd +DH +YU +YU +YU +OP +ca +Qp +qF +gG +qF +cb +IC +Qf +hX +hX +JU +cb +XO +xS +BH +BH +tO +zN +Bq +xM +xY +xY +ka +WO +si +rL +eU +Lw +Bt +xZ +mr +gk +zE +Oz +nx +mg +nx +ad +jE +fk +Ze +lw +MO +nC +px +sK +zn +cc +iL +Aq +dy +oY +zD +RZ +uZ +TY +Xo +dn +CG +XK +cx +pK +Mx +Ed +SC +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(65,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +un +af +Hx +eX +Jh +Jh +CA +qp +qp +kU +qp +qp +qp +NF +qp +Qp +qF +gG +qF +cb +NO +Ud +EY +hX +GW +cb +UT +nH +gb +BH +dH +zN +Js +Ml +SA +xY +yI +WO +JE +lD +jm +Wt +hb +xZ +xZ +xZ +nz +Oz +Wp +XA +lY +ad +qn +gh +Ze +eo +qU +oA +pY +sl +zn +cO +vN +AS +dV +qq +TM +VW +nS +Fh +fb +Fh +Dh +XK +nZ +AY +Qx +Ed +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(66,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +Ae +SK +Jh +Jh +Jh +Jh +CA +qp +qp +kU +qp +qp +qp +NF +qp +Qp +ba +Ie +tV +cb +gy +ZF +ns +fa +Vr +cb +Et +wq +dD +dY +MN +zN +EO +Lv +hu +hu +bO +WO +Yp +rL +eU +Lw +Xi +xZ +xZ +xZ +xZ +Oz +nx +jY +nx +sc +sc +sc +sc +sc +sc +sc +sc +sc +sc +sc +sc +sc +sc +sc +Bj +xe +Fh +Fh +DL +GU +Ov +XK +Zj +Yc +tG +gM +BB +BB +VS +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(67,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +ko +yd +NL +Jh +Jh +Jh +CA +qp +qp +kU +qp +qp +qp +NF +qp +Qp +qF +gG +qF +cb +kl +AP +Ve +ar +vf +cb +Pe +pO +UB +au +mD +zN +FC +yC +dZ +ax +at +WO +Oy +bY +eU +Lw +Xi +xZ +zE +WD +nk +nW +nx +jY +Tx +sc +wS +gQ +iK +KH +KY +QG +eg +QG +QG +np +nM +uI +wS +sc +XK +XK +MJ +uQ +Qm +Nm +Iu +XK +lt +wg +Sl +Oq +Oq +Ky +TA +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(68,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +FH +ew +yd +NL +SK +SK +Qp +YU +YU +XH +Dd +Dd +Dd +OQ +Dd +Ta +ZZ +mm +sO +cb +Hs +Hs +jn +Hs +Hs +cb +GQ +GQ +Fg +GQ +GQ +zN +DV +dU +Tv +dU +dU +WO +gq +HB +HB +Zu +vh +rg +ea +Cd +SU +nW +zz +sz +RX +sc +bK +gS +iR +Rc +Qs +TK +Ga +eu +xh +kB +rZ +nd +sc +sc +Bk +XK +XK +XK +Ow +XK +XK +XK +CV +pK +Mx +Im +Im +Im +TA +Ed +Ed +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +Vz +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(69,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +Ae +Jh +Jh +Jh +CA +qp +qp +US +qp +qp +qp +Vm +qp +Qp +Hq +bn +tV +rc +po +aQ +BK +aQ +aQ +sf +jO +aQ +BK +aQ +jK +eL +wV +bE +bE +bE +aQ +QT +Gj +xy +Tm +Tm +PL +Gj +ab +QB +QB +QB +rc +aM +Wy +sc +Vs +Vs +Vs +TL +Ol +Ol +qv +Ol +Ol +rN +MV +Cn +sc +AZ +bM +Ru +VC +wA +cw +ZX +UO +VC +TJ +dF +Mx +oq +oq +oq +XZ +BR +JA +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(70,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +SK +Jh +Ae +Jh +Jh +Jh +CA +qp +qp +US +qp +qp +qp +Vm +UX +Qp +ne +bI +oX +vO +HW +xw +zb +tT +tT +tT +tT +zB +zb +tT +UG +wQ +EW +bE +bE +bE +aQ +bU +II +iy +Gj +Fr +Rl +Gj +ae +iV +iV +iV +vw +MF +AU +sc +bL +Vs +IQ +TL +Ol +oR +qA +HA +Ol +IU +IQ +gN +Jz +Pj +zi +Gh +JP +JQ +KS +Fe +ht +is +dj +vv +Ou +oq +oq +JS +Ed +Ed +Ed +Cx +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(71,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +Ae +Jh +Jh +Jh +CA +qp +qp +US +qp +qp +qp +Vm +qp +Qp +Hf +gO +qF +rc +tJ +aQ +xU +aQ +aQ +Aw +Lz +aQ +BK +aQ +SZ +Kw +iI +bE +bE +bE +aQ +QT +nt +iy +Nf +SQ +TF +Gj +TO +Vq +WH +yb +iE +vt +Ki +sc +Vs +Vs +Vs +TL +Ol +Ol +rB +Ol +Ol +mA +sr +HS +sc +AZ +rb +fv +VC +LC +zg +hK +tz +VC +PE +MC +Mx +oq +oq +oq +os +ou +QJ +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(72,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +FH +Rx +eX +NL +SK +SK +Qp +YU +YU +ja +oP +oP +oP +Fb +oP +dN +UA +Fj +aq +EJ +rx +rx +Bz +rx +rx +EJ +nP +nP +ev +nP +nP +uj +DV +dU +Tv +dU +dU +WO +in +bg +in +in +yJ +ZK +ZK +QE +WN +fS +zz +RT +RX +sc +TL +Vs +rZ +IQ +Jg +GP +GP +GP +GP +Zw +TI +lQ +sc +sc +Bs +XK +th +th +ci +th +th +th +pB +pK +Mx +Im +Im +Ko +TA +Ed +Ed +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +gB +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(73,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +un +eX +NL +Jh +Jh +Jh +CA +qp +qp +iN +qp +qp +qp +jC +qp +Qp +qF +mj +qF +EJ +To +pd +mI +as +SP +EJ +pV +DI +BQ +av +Br +uj +PC +XJ +fT +ay +at +WO +AX +cP +Yv +in +xg +Rn +Rn +PJ +Rn +in +nx +XF +Tx +sc +wS +us +VG +NP +bs +Vs +IQ +wG +Vs +tq +ZN +TL +wS +sc +th +th +OS +Tr +Zm +iJ +nN +th +Ff +EF +xA +cs +cs +cA +TA +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(74,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +Ae +SK +Jh +Jh +Jh +Jh +CA +qp +qp +iN +qp +qp +qp +jC +qp +Qp +Hf +mp +tV +EJ +Xa +XG +YQ +yB +AE +EJ +YC +sA +MG +bx +KG +uj +Po +zo +hu +hu +bO +WO +CR +An +eD +in +Qo +ye +Uk +ij +Tj +in +nx +XF +nx +sc +sc +sc +sc +sc +sc +sc +sc +sc +sc +sc +sc +sc +sc +sc +SL +Tr +wN +wN +bQ +zM +PW +th +Zj +Yc +tG +gM +BB +BB +yj +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(75,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +ko +af +mM +yd +Jh +Jh +CA +qp +qp +iN +qp +qp +qp +jC +qp +Qp +qF +mj +qF +EJ +VE +PR +hp +vi +Tp +EJ +Xm +ol +mO +tZ +Gi +uj +pm +gE +Wq +xY +yI +WO +az +Ms +kT +yM +MI +iP +rA +DN +YL +in +Wp +HZ +lY +sc +wS +KM +dS +MK +Wi +sc +vT +QI +yV +oN +uc +ty +Az +th +lu +wN +Ds +qK +FU +qd +Lx +th +nZ +oy +Qx +Ed +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(76,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +SK +NL +Ae +Op +NL +Jh +Qp +qp +qp +iN +qp +qp +qp +jC +qp +Qp +qF +mj +qF +EJ +lk +Gl +vi +vi +FM +EJ +Jv +Ot +tZ +tZ +uV +uj +Bq +WW +xY +xY +ka +WO +Tl +Wa +wY +in +fO +yo +yo +yo +aK +in +nx +Zt +nx +sc +pA +aj +Dw +Ce +Ce +VQ +an +an +an +kX +eS +QL +eS +sb +oT +HN +Kx +pS +yp +nN +nN +th +ys +pK +Mx +Ed +SC +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(77,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +SK +Jh +Ae +NL +NL +NL +Qp +Qp +bV +eV +qp +qp +qp +gg +qp +Qp +Cp +na +Cp +EJ +oD +GR +VB +Jj +FO +EJ +jM +gs +zv +hU +sC +uj +OK +Aj +SE +Hv +bj +WO +jD +kN +jh +in +zm +Il +do +aH +qZ +in +nx +Zt +nx +sc +wS +tn +lP +st +tX +sc +KU +bW +JO +vS +JJ +NW +WX +th +th +th +th +th +th +th +th +th +Hw +pK +Mx +Ed +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(78,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +SK +Jh +Ae +Jh +SK +SK +SK +Qp +Jx +am +Jx +Jx +Jx +Jx +Jx +Jx +qF +mj +qF +EJ +EJ +EJ +EJ +EJ +EJ +EJ +uj +uj +uj +uj +uj +uj +WO +WO +WO +WO +WO +WO +in +in +in +in +Tk +Rn +Rn +in +in +in +sx +bT +sx +sc +sc +sc +sc +sc +sc +sc +Xr +sI +wv +CT +RQ +Sk +hF +th +qX +nL +Gv +kt +ak +RI +RI +Ed +Uy +Pc +PA +Ed +Oc +sM +sM +sM +sM +uq +Vo +uq +sM +sM +sM +sM +sM +Oc +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(79,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +Jh +Ae +Jh +Jh +SK +SK +SK +Jx +mR +aS +pE +Ib +Sb +WF +Jx +Hf +mp +tV +qF +qF +qF +qF +IV +qF +qF +qF +qF +Oa +qF +qF +qF +IV +qF +qF +qF +qF +aJ +ow +OE +ow +ow +Nh +ow +ow +OE +ow +ow +ow +CJ +ow +th +ep +Mp +Uj +Hc +Tn +qO +HT +lL +HT +IG +Ax +th +th +th +SF +pc +pc +ER +ag +YK +YK +Ed +jP +pK +Mx +uq +uq +uq +jg +jg +uq +uq +rr +uq +uq +jg +jg +jg +uq +uq +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(80,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +Ae +Jh +Jh +Jh +SK +SK +ZQ +mR +aS +Sb +eR +Sb +Ay +Jx +zW +Cw +sd +sd +sd +sd +sd +wy +sd +sd +sd +sd +Df +sd +sd +sd +wy +sd +sd +sd +sd +Rj +FL +aN +FL +FL +OI +eY +eY +WG +eY +eY +eY +hP +sn +pX +Lb +JK +fM +Ty +gH +th +Ax +th +th +ct +th +De +Le +TB +IZ +IZ +IZ +IZ +YR +YR +xO +gV +YA +MU +vG +BJ +LI +kW +Kb +Kb +mq +uq +nB +uq +Ni +Kb +Kb +Kb +Kv +uq +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(81,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +un +eX +NL +Jh +Jh +Jh +SK +ZQ +mR +aS +Sb +bJ +Sb +aD +Jx +ne +gm +qF +qF +qF +qF +qF +ID +qF +qF +qF +qF +Cp +qF +qF +qF +KF +qF +qF +qF +hC +aJ +ow +wc +ow +yP +Ks +RG +ow +ZC +ow +ow +ow +CJ +ow +Gk +Gk +Gk +Gk +Gk +Gk +Gk +Gk +Gk +sQ +uT +wo +yH +jP +BC +en +en +en +en +cq +lJ +pb +GE +VN +Cy +SN +mo +pG +QZ +fW +fW +fW +ex +Ny +XD +df +sP +ZH +vo +Nx +HP +nh +nh +nh +GT +GT +nh +nh +nh +nh +nh +nh +FI +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(82,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Ae +Jh +SK +Jh +Jh +Jh +Jh +ZQ +Vi +pq +Ai +HV +Sb +aD +Jx +dx +qW +dx +dx +dx +dx +dx +dx +dx +dx +dx +dx +Ec +Ec +Ec +Ec +Ec +XB +XB +XB +Bp +me +me +me +me +me +Pd +me +me +me +me +me +xR +fE +eQ +Gk +dE +dE +dE +dE +dE +dE +dE +Gk +Ge +vb +xj +yH +WZ +LP +zy +PX +IW +RN +sU +EN +dr +Ed +Hi +Be +aG +uq +cy +Jo +vJ +vJ +vP +oU +hZ +xC +pl +lC +Dn +tb +LQ +uq +NL +NL +NL +Ae +Op +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(83,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +vQ +af +af +yd +Jh +Jh +Jh +Jx +qs +aS +Sb +tF +Sb +Nz +Jx +ap +sR +FE +Ef +Ub +Yj +Yj +Ef +FE +Ps +eE +dx +ch +lV +zF +NZ +Ec +hO +Gm +yi +BF +Ev +Io +ut +Ts +Io +QP +xH +OG +mT +Yx +me +ow +CJ +ow +Gk +dE +dE +dE +dE +dE +dE +dE +Gk +tQ +Vt +wd +yH +Ed +Cc +Ed +aA +aA +aA +aA +Ro +OU +OU +OU +XE +OU +OU +OU +uq +jg +jg +uq +jg +jg +jg +uq +uq +uq +NX +uq +uq +NL +NL +NL +Ae +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(84,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +ko +VM +NL +ko +yd +SK +SK +Jx +pL +KV +Sb +tF +Sb +AQ +Jx +FE +sR +FE +Ef +GB +Yj +Yj +Ef +FE +FE +uE +dx +ku +mF +Vk +zC +Ec +hr +al +ii +Bp +OM +bS +DZ +WA +WA +nu +WA +AH +zL +xH +me +ow +CJ +ow +Gk +Gk +Gk +Gk +Gk +Gk +MA +sZ +sZ +OA +OA +OA +cz +ow +ok +ow +aA +yw +bb +Ob +tH +OU +iC +iC +Nc +iC +iC +OU +NL +NL +NL +NL +NL +NL +NL +NL +Wu +jg +wm +jg +Wu +NL +NL +NL +Ae +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(85,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +Ae +NL +Jh +Jx +Jx +LV +Sb +xN +Sb +aS +Jx +Td +TS +YB +hz +hz +Vx +ac +Ef +FE +FE +UF +dx +uM +xp +xo +Jm +Ec +kp +bm +ii +Bp +rH +oC +me +aB +me +Ug +aB +me +hE +yf +me +ow +CJ +ow +ow +ow +OE +ow +ow +Lf +CH +ow +ow +ow +ow +OE +ow +ow +ok +ow +aA +wK +za +fz +jd +OU +rh +rh +uW +rh +rh +OU +Se +pT +pT +pT +pT +pT +pT +pT +iZ +uq +yS +uq +qE +pT +pT +pT +kk +Jh +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(86,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +Ae +NL +Jh +Jh +Jx +Jx +sj +Ti +Nj +GJ +Jx +fD +sR +FE +Ef +Ef +ir +Ef +Ef +FE +Rg +FE +dx +Mr +Pp +ip +fj +Ec +RE +bh +RE +me +br +qf +me +dk +Ys +Hh +eb +tC +Rq +KJ +by +Pa +wR +Yy +Yy +Yy +kj +Yy +Yy +Yy +Ap +mS +mS +mS +mS +db +mS +mS +Rz +Vp +aA +RH +rn +FR +wW +OU +zJ +CY +cI +CY +kY +OU +Iz +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +SK +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(87,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +EV +af +yd +Jh +Jh +Jx +Jx +Mc +aS +em +Jx +Ue +sR +FE +Ef +Yj +OR +lA +Ef +FE +FE +ov +dx +Du +Xb +QW +DW +IS +bB +HL +bB +bB +bB +pt +aB +Mw +hy +ON +Xd +Ja +Ly +KJ +by +ow +aC +ow +ow +ow +ZC +ow +ow +ow +uX +ow +ow +ow +ow +OY +yP +ow +ZM +ow +aA +ej +za +fz +Jk +OU +rm +uz +Eh +mn +Av +OU +Iz +sM +sM +sM +sM +sM +sM +sM +sM +sM +vE +sM +sM +sM +sM +sM +UR +af +af +yd +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(88,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +ko +VM +ko +af +af +af +Kr +Rh +Jx +du +Jx +EZ +yy +FD +EZ +EZ +EZ +EZ +EZ +EZ +FD +FD +EZ +CC +jy +jy +CC +CC +Vg +Vg +RE +RE +xH +DE +me +od +wM +SV +LR +me +tk +qS +by +by +by +by +by +by +by +by +by +by +Bg +by +by +by +by +by +by +by +ff +by +aA +nr +lT +gR +Px +OU +zr +zr +Vb +zr +zr +OU +hk +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +NL +Ae +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(89,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +SK +Jh +Jh +Vg +ym +QV +cL +zf +ul +zf +zf +zf +Ri +tc +DQ +DQ +DQ +DQ +DQ +UU +DQ +DQ +DQ +DQ +DQ +DQ +DQ +ez +xH +DE +me +me +xu +nf +me +me +Gq +ET +ET +uY +uY +As +if +mK +if +AT +if +if +Ne +iS +jo +Kz +Dk +qY +AK +Ld +KD +vy +aA +aA +aA +aA +aA +OU +oS +oS +Mi +oS +oS +OU +Iz +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +NL +Ae +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(90,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +RE +RE +Kq +On +DQ +DQ +DQ +DQ +DQ +WB +TP +DQ +DQ +DQ +DQ +DQ +DQ +Mu +zA +Ln +Ln +Ln +Ln +Ln +RK +hB +In +me +NL +NL +qy +NL +by +Li +KJ +le +ww +ww +MB +Kt +iv +ZD +UQ +KJ +HF +nD +BG +LY +LY +LY +Gc +lF +Wr +MW +LY +pz +aw +aw +zV +jp +OU +OU +OU +OU +OU +OU +OU +Iz +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +NL +Ae +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(91,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +RE +Vg +hT +RE +Vg +Vg +RE +RE +RE +hT +RE +RE +Vg +Vg +RE +RE +RE +RE +RE +RE +Vg +Vg +RE +RE +me +me +me +NL +NL +we +NL +by +by +by +by +CK +CK +by +by +by +by +by +by +ur +by +by +by +by +by +by +by +CK +CK +by +hQ +lq +lq +rq +lq +lq +NU +lq +lq +lq +Kk +hQ +Iz +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +NL +Op +NL +Jh +Jh +Jh +El +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(92,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +qy +SK +Jh +Jh +Jh +Jh +Jh +qy +SK +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +SK +Ae +Jh +NL +NL +NL +Jh +Jh +SK +SK +Jh +Jh +hQ +lq +lq +rq +lq +aa +Bn +lq +lq +Yo +MH +hQ +Iz +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(93,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +qb +Ox +xm +xm +xm +xm +xm +xm +TV +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Ae +SK +NL +NL +NL +Jh +SK +SK +Jh +Jh +Jh +hQ +uD +Qv +Al +VZ +tu +lq +nT +xE +YS +Ho +hQ +hk +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(94,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +NL +NL +NL +uH +OJ +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +Ae +NL +NL +NL +NL +NL +NL +NL +NL +Jh +Jh +hQ +hQ +hQ +hQ +hQ +hQ +hQ +hQ +hQ +hQ +hQ +hQ +Iz +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +SK +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(95,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +NL +NL +we +qy +NL +NL +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +Ae +NL +NL +NL +NL +NL +NL +NL +NL +NL +SK +SK +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +Iz +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +SK +NL +NL +NL +Jh +Jh +zk +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(96,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +NL +NL +qy +NL +NL +NL +NL +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +Ae +NL +NL +NL +NL +NL +NL +NL +NL +NL +SK +SK +SK +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +Iz +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +sM +IK +Jh +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(97,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +NL +EU +xm +xm +xm +xm +xm +xm +xm +xm +iY +Jh +Jh +Jh +Jh +Jh +Jh +El +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +NL +NL +Ae +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +Jh +Jh +Jh +NL +NL +NL +NL +NL +NL +NL +NL +NL +dh +PT +PT +PT +PT +PT +PT +PT +PT +PT +PT +va +nh +nh +nh +nh +FI +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(98,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +un +af +Rx +af +af +af +af +af +ew +af +Rx +af +af +af +af +af +af +af +af +Rx +af +af +af +af +af +af +af +af +af +af +Rx +af +af +af +af +af +af +af +Rx +af +af +af +LW +NL +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(99,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +zk +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +Ae +NL +Op +NL +NL +NL +NL +NL +NL +NL +Op +NL +NL +NL +NL +NL +NL +NL +NL +Op +NL +SK +SK +SK +NL +NL +NL +NL +NL +NL +Ae +NL +NL +NL +NL +NL +NL +NL +Ae +NL +NL +NL +ko +af +af +af +af +af +yd +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(100,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +FH +af +af +af +eX +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +Jh +Jh +Jh +NL +NL +NL +NL +NL +Ae +NL +NL +NL +NL +NL +NL +NL +Ae +NL +NL +NL +NL +NL +NL +Jh +Jh +NL +Ae +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(101,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +Op +NL +NL +NL +NL +NL +NL +NL +Op +NL +NL +NL +NL +NL +SK +SK +NL +NL +Op +NL +NL +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(102,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +zk +Jh +Jh +Jh +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +Jh +Jh +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +NL +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(103,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(104,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +sE +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(105,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(106,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +El +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(107,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(108,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(109,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(110,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(111,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +El +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +El +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(112,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +El +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +El +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(113,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(114,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(115,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(116,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +El +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(117,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(118,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(119,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(120,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Lr +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(121,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(122,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(123,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(124,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(125,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(126,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(127,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(128,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(129,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(130,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(131,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(132,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(133,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(134,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(135,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(136,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(137,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(138,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(139,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +"} +(140,1,1) = {" +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh +Jh "} diff --git a/maps/stellar_delight/stellar_delight_defines.dm b/maps/stellar_delight/stellar_delight_defines.dm index 496a06ef8a..80689d9933 100644 --- a/maps/stellar_delight/stellar_delight_defines.dm +++ b/maps/stellar_delight/stellar_delight_defines.dm @@ -27,7 +27,8 @@ "logo2" = 50, "gateway" = 5, "youcanttaketheskyfromme" = 200, - "intothedark" = 200 + "intothedark" = 200, + "above3b" = 200 )) if(choice) lobby_screens = list(choice) @@ -159,7 +160,6 @@ list(list("Honleth Highlands A", "Honleth Highlands B")), list("Arynthi Lake Underground A","Arynthi Lake A"), list("Arynthi Lake Underground B","Arynthi Lake B"), - list("Eggnog Town Underground","Eggnog Town"), list("Wild West") ) @@ -171,7 +171,10 @@ list("Teppi Ranch"), list("Innland"), list("Abandoned Island"), - list("Dark Adventure") + list("Dark Adventure"), + list("Eggnog Town Underground","Eggnog Town"), + list("Star Dog"), + list("Hotsprings") ) ai_shell_restricted = TRUE diff --git a/maps/stellar_delight/stellar_delight_shuttle_defs.dm b/maps/stellar_delight/stellar_delight_shuttle_defs.dm index 57cbe5d469..c5e42b9f7d 100644 --- a/maps/stellar_delight/stellar_delight_shuttle_defs.dm +++ b/maps/stellar_delight/stellar_delight_shuttle_defs.dm @@ -256,6 +256,7 @@ initial_restricted_waypoints = list("Central Command Shuttlepad" = list("cc_shuttlepad")) extra_z_levels = list(Z_LEVEL_SPACE_ROCKS) + var/mob_announce_cooldown = 0 /////SD Starts at V3b to pick up crew refuel and repair (And to make sure it doesn't spawn on hazards) /obj/effect/overmap/visitable/sector/virgo3b/Initialize() @@ -273,6 +274,11 @@ announce_atc(AM,going = TRUE) /obj/effect/overmap/visitable/sector/virgo3b/proc/announce_atc(var/atom/movable/AM, var/going = FALSE) + if(istype(AM, /obj/effect/overmap/visitable/ship/simplemob)) + if(world.time < mob_announce_cooldown) + return + else + mob_announce_cooldown = world.time + 5 MINUTES var/message = "Sensor contact for vessel '[AM.name]' has [going ? "left" : "entered"] ATC control area." //For landables, we need to see if their shuttle is cloaked if(istype(AM, /obj/effect/overmap/visitable/ship/landable)) diff --git a/maps/submaps/admin_use_vr/event_autonomous_drone.dm b/maps/submaps/admin_use_vr/event_autonomous_drone.dm new file mode 100644 index 0000000000..4539fdd8a0 --- /dev/null +++ b/maps/submaps/admin_use_vr/event_autonomous_drone.dm @@ -0,0 +1,85 @@ +// Compile in the map for CI testing if we're testing compileability of all the maps +#if MAP_TEST +#include "event_autonomous_drone.dmm" +#endif + +/datum/map_template/om_ships/event_autonomous_drone + name = "OM Ship - Cargo Drone" + desc = "A small cargo hauler" + mappath = 'event_autonomous_drone.dmm' + annihilate = TRUE + +/datum/shuttle/autodock/overmap/event_autonomous_drone + name = "Autonomous Cargo Drone" + warmup_time = 0 + current_location = "omship_event_autonomous_drone" + docking_controller_tag = "event_autonomousdrone_docker" + shuttle_area = list(/area/submap/event_autonomous_drone/engineering, /area/submap/event_autonomous_drone/cargo, + /area/submap/event_autonomous_drone/command) + fuel_consumption = 1 //efficient but slow + defer_initialisation = TRUE + move_direction = WEST + +/obj/effect/shuttle_landmark/shuttle_initializer/event_autonomous_drone + name = "Autonomous Cargo Drone" + base_area = /area/space + base_turf = /turf/space + landmark_tag = "omship_event_autonomous_drone" + shuttle_type = /datum/shuttle/autodock/overmap/event_autonomous_drone + +/obj/effect/shuttle_landmark/shuttle_initializer/event_autonomous_drone/Initialize() + var/obj/effect/overmap/visitable/O = get_overmap_sector(get_z(src)) //make this into general system some other time + LAZYINITLIST(O.initial_restricted_waypoints) + O.initial_restricted_waypoints["Autonomous Cargo Drone"] = list(landmark_tag) + . = ..() + +/obj/effect/overmap/visitable/ship/landable/event_autonomous_drone + name = "TBD" + scanner_desc = "TBD" + vessel_mass = 20000 //Slow and bulky cargo boat + vessel_size = SHIP_SIZE_SMALL + shuttle = "Autonomous Cargo Drone" + +/obj/effect/overmap/visitable/ship/landable/event_autonomous_drone/Initialize() + . = ..() + var/datum/lore/organization/O = loremaster.organizations[/datum/lore/organization/tsc/nanotrasen] + var/newname = "NTV [pick(O.ship_names)]" + name = newname + scanner_desc = {"\[i\]Registration\[/i\]: [newname] +\[i\]Class\[/i\]: Autonomous Cargo Drone +\[i\]Transponder\[/i\]: Transmitting (CIV), Weak Signal +\[b\]Notice\[/b\]: Reported missing."} + rename_areas(newname) + +/obj/effect/overmap/visitable/ship/landable/event_autonomous_drone/proc/rename_areas(newname) + if(!SSshuttles.subsystem_initialized) + spawn(300) + rename_areas(newname) + return + var/datum/shuttle/S = SSshuttles.shuttles[shuttle] + for(var/area/A in S.shuttle_area) + A.name = "[newname] [initial(A.name)]" + if(A.apc) + A.apc.name = "[A.name] APC" + A.air_vent_names = list() + A.air_scrub_names = list() + A.air_vent_info = list() + A.air_scrub_info = list() + for(var/obj/machinery/alarm/AA in A) + AA.name = "[A.name] Air Alarm" + +/obj/machinery/computer/shuttle_control/explore/event_autonomous_drone + shuttle_tag = "Autonomous Cargo Drone" + req_one_access = list() + +/area/submap/event_autonomous_drone + secret_name = FALSE + +/area/submap/event_autonomous_drone/engineering + name = "Engine Bay" + +/area/submap/event_autonomous_drone/cargo + name = "Cargo Bay" + +/area/submap/event_autonomous_drone/command + name = "Command Deck" diff --git a/maps/submaps/admin_use_vr/event_autonomous_drone.dmm b/maps/submaps/admin_use_vr/event_autonomous_drone.dmm new file mode 100644 index 0000000000..79a7a83b61 --- /dev/null +++ b/maps/submaps/admin_use_vr/event_autonomous_drone.dmm @@ -0,0 +1,717 @@ +//MAP CONVERTED BY dmm2tgm.py THIS HEADER COMMENT PREVENTS RECONVERSION, DO NOT REMOVE +"au" = ( +/turf/simulated/shuttle/wall/dark, +/area/submap/event_autonomous_drone/engineering) +"ba" = ( +/turf/simulated/shuttle/floor, +/area/submap/event_autonomous_drone/cargo) +"cG" = ( +/obj/machinery/button/remote/blast_door{ + dir = 4; + id = "autonomloadinghatch"; + name = "Open Loading Bay"; + pixel_x = 1; + pixel_y = 2 + }, +/turf/simulated/shuttle/wall/dark/hard_corner, +/area/submap/event_autonomous_drone/cargo) +"cL" = ( +/obj/machinery/atmospherics/pipe/manifold/visible/fuel, +/obj/machinery/power/port_gen/pacman/mrs, +/obj/structure/cable{ + dir = 4 + }, +/turf/simulated/shuttle/floor/yellow, +/area/submap/event_autonomous_drone/engineering) +"cU" = ( +/obj/machinery/atmospherics/portables_connector/fuel{ + dir = 4 + }, +/obj/machinery/portable_atmospherics/canister/phoron, +/turf/simulated/shuttle/floor/yellow, +/area/submap/event_autonomous_drone/engineering) +"dq" = ( +/obj/machinery/light/small{ + dir = 1 + }, +/turf/simulated/shuttle/floor, +/area/submap/event_autonomous_drone/cargo) +"eW" = ( +/obj/structure/cable/green{ + dir = 1; + icon_state = "4-8" + }, +/obj/machinery/light_switch{ + pixel_y = -26 + }, +/turf/simulated/shuttle/floor/yellow, +/area/submap/event_autonomous_drone/engineering) +"gz" = ( +/obj/structure/cable/green{ + icon_state = "2-8" + }, +/obj/machinery/atmospherics/pipe/simple/visible/fuel{ + dir = 6 + }, +/obj/structure/cable{ + dir = 4; + icon_state = "2-4" + }, +/turf/simulated/shuttle/floor/yellow, +/area/submap/event_autonomous_drone/engineering) +"gI" = ( +/obj/machinery/atmospherics/pipe/simple/visible/fuel{ + dir = 10 + }, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"gO" = ( +/obj/machinery/atmospherics/pipe/simple/visible{ + dir = 9 + }, +/obj/structure/cable/green{ + icon_state = "2-4" + }, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"jA" = ( +/obj/machinery/door/airlock/glass_external, +/obj/effect/map_helper/airlock/door/int_door, +/obj/machinery/atmospherics/pipe/simple/visible{ + dir = 4 + }, +/obj/machinery/door/firedoor, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"lB" = ( +/obj/structure/cable/green{ + icon_state = "4-8" + }, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"mU" = ( +/obj/machinery/atmospherics/portables_connector{ + dir = 4 + }, +/obj/machinery/door/window/southright{ + req_one_access = list() + }, +/obj/machinery/portable_atmospherics/canister/air, +/obj/machinery/door/window/southright{ + dir = 4; + req_one_access = list() + }, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"nW" = ( +/turf/template_noop, +/area/space) +"ph" = ( +/obj/machinery/light/small{ + dir = 1 + }, +/obj/machinery/atmospherics/pipe/simple/visible/fuel{ + dir = 8 + }, +/obj/structure/cable{ + icon_state = "4-8" + }, +/turf/simulated/shuttle/floor/yellow, +/area/submap/event_autonomous_drone/engineering) +"pM" = ( +/obj/machinery/atmospherics/pipe/simple/visible/fuel, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/door/firedoor, +/obj/machinery/door/airlock/maintenance_hatch, +/turf/simulated/shuttle/floor/yellow, +/area/submap/event_autonomous_drone/engineering) +"pO" = ( +/obj/machinery/power/terminal, +/obj/machinery/atmospherics/binary/pump/fuel/on{ + dir = 4 + }, +/obj/structure/cable{ + dir = 8 + }, +/obj/structure/fuel_port{ + pixel_y = 28 + }, +/turf/simulated/shuttle/floor/yellow, +/area/submap/event_autonomous_drone/engineering) +"pT" = ( +/obj/machinery/alarm{ + dir = 1; + pixel_y = -28 + }, +/turf/simulated/shuttle/floor, +/area/submap/event_autonomous_drone/cargo) +"qt" = ( +/obj/machinery/atmospherics/pipe/manifold/visible{ + dir = 1 + }, +/obj/machinery/airlock_sensor{ + frequency = 1380; + id_tag = null; + pixel_y = 27 + }, +/obj/effect/map_helper/airlock/sensor/chamber_sensor, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"rs" = ( +/obj/machinery/computer/shuttle_control/explore/event_autonomous_drone{ + dir = 8 + }, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"rE" = ( +/obj/machinery/atmospherics/pipe/manifold/visible/fuel{ + dir = 1 + }, +/turf/simulated/shuttle/floor/yellow, +/area/submap/event_autonomous_drone/engineering) +"su" = ( +/turf/simulated/shuttle/wall/dark, +/area/submap/event_autonomous_drone/cargo) +"sP" = ( +/obj/machinery/atmospherics/pipe/simple/visible, +/obj/machinery/light_switch{ + dir = 8; + pixel_x = -29 + }, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"tC" = ( +/obj/machinery/door/airlock/glass_external, +/obj/effect/map_helper/airlock/door/ext_door, +/obj/effect/map_helper/airlock/sensor/ext_sensor, +/obj/machinery/airlock_sensor/airlock_exterior/shuttle{ + dir = 6; + pixel_x = 7; + pixel_y = 26 + }, +/obj/machinery/door/firedoor, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"tF" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/visible/fuel, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"tM" = ( +/obj/machinery/atmospherics/pipe/simple/visible/fuel{ + dir = 5 + }, +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"xS" = ( +/obj/machinery/light/small, +/turf/simulated/shuttle/floor, +/area/submap/event_autonomous_drone/cargo) +"zf" = ( +/obj/machinery/light/small{ + dir = 4 + }, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"zm" = ( +/obj/machinery/light_switch{ + pixel_y = -26 + }, +/turf/simulated/shuttle/floor, +/area/submap/event_autonomous_drone/cargo) +"zw" = ( +/obj/machinery/atmospherics/unary/engine{ + dir = 8 + }, +/turf/simulated/shuttle/plating/airless/carry, +/area/submap/event_autonomous_drone/engineering) +"Af" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/visible/fuel, +/obj/machinery/door/firedoor, +/obj/machinery/door/airlock/hatch, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"Az" = ( +/obj/machinery/atmospherics/pipe/simple/visible/fuel{ + dir = 6 + }, +/turf/simulated/shuttle/wall/dark/hard_corner, +/area/submap/event_autonomous_drone/engineering) +"BF" = ( +/obj/machinery/embedded_controller/radio/airlock/docking_port{ + frequency = 1380; + id_tag = "event_autonomousdrone_docker"; + pixel_x = 5; + pixel_y = 25 + }, +/obj/machinery/atmospherics/pipe/simple/visible{ + dir = 6 + }, +/obj/effect/overmap/visitable/ship/landable/event_autonomous_drone, +/obj/effect/shuttle_landmark/shuttle_initializer/event_autonomous_drone, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"BT" = ( +/obj/machinery/computer/ship/engines{ + dir = 8 + }, +/obj/machinery/atmospherics/pipe/simple/visible/fuel{ + dir = 8 + }, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"Cb" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/obj/machinery/atmospherics/pipe/simple/visible/fuel, +/turf/simulated/shuttle/floor, +/area/submap/event_autonomous_drone/cargo) +"CX" = ( +/turf/simulated/shuttle/wall/dark/hard_corner, +/area/submap/event_autonomous_drone/command) +"Dx" = ( +/obj/machinery/door/firedoor, +/obj/machinery/door/blast/shuttle{ + id = "autonomloadinghatch" + }, +/turf/simulated/shuttle/floor, +/area/submap/event_autonomous_drone/cargo) +"Dz" = ( +/obj/machinery/computer/ship/helm{ + dir = 1 + }, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"Hs" = ( +/obj/machinery/atmospherics/pipe/simple/visible{ + dir = 10 + }, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"Je" = ( +/obj/machinery/atmospherics/unary/vent_pump/high_volume{ + dir = 1; + id_tag = "event_autonomousdrone_docker" + }, +/obj/effect/map_helper/airlock/atmos/chamber_pump, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"LT" = ( +/obj/machinery/atmospherics/pipe/simple/visible/fuel{ + dir = 9 + }, +/obj/machinery/power/apc/alarms_hidden{ + pixel_y = -26 + }, +/obj/structure/cable/green{ + icon_state = "0-4" + }, +/turf/simulated/shuttle/floor/yellow, +/area/submap/event_autonomous_drone/engineering) +"NF" = ( +/obj/machinery/atmospherics/pipe/simple/visible/fuel{ + dir = 5 + }, +/turf/simulated/shuttle/wall/dark, +/area/submap/event_autonomous_drone/command) +"OV" = ( +/obj/machinery/atmospherics/pipe/manifold/visible/fuel, +/turf/simulated/shuttle/wall/dark, +/area/submap/event_autonomous_drone/engineering) +"QJ" = ( +/obj/effect/map_helper/airlock/sensor/int_sensor, +/obj/machinery/atmospherics/pipe/simple/visible, +/obj/machinery/airlock_sensor{ + dir = 4; + pixel_x = -23; + pixel_y = 2 + }, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"QR" = ( +/obj/machinery/power/smes/buildable{ + charge = 500000 + }, +/obj/structure/cable/green{ + icon_state = "0-4" + }, +/obj/structure/cable/green{ + icon_state = "0-8" + }, +/turf/simulated/shuttle/floor/yellow, +/area/submap/event_autonomous_drone/engineering) +"QU" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/manifold/visible/fuel{ + dir = 8 + }, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"Rk" = ( +/turf/simulated/shuttle/wall/dark/hard_corner, +/area/submap/event_autonomous_drone/cargo) +"RG" = ( +/obj/structure/cable/green{ + icon_state = "0-4" + }, +/obj/machinery/power/apc/alarms_hidden{ + pixel_y = -26 + }, +/turf/simulated/shuttle/floor, +/area/submap/event_autonomous_drone/cargo) +"Sc" = ( +/obj/machinery/atmospherics/unary/vent_pump/high_volume{ + dir = 1; + id_tag = "event_autonomousdrone_docker" + }, +/obj/effect/map_helper/airlock/atmos/chamber_pump, +/obj/machinery/light/small, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"Sk" = ( +/obj/machinery/power/apc/alarms_hidden{ + pixel_y = -26 + }, +/obj/structure/cable/green{ + icon_state = "0-4" + }, +/obj/machinery/light/small{ + dir = 8 + }, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"Sl" = ( +/obj/machinery/atmospherics/pipe/simple/visible/fuel{ + dir = 8 + }, +/turf/simulated/shuttle/wall/dark, +/area/submap/event_autonomous_drone/command) +"SO" = ( +/obj/machinery/firealarm/angled{ + dir = 4; + pixel_x = 17 + }, +/obj/machinery/atmospherics/pipe/simple/visible/fuel, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"Ta" = ( +/obj/machinery/atmospherics/pipe/simple/visible/fuel{ + dir = 10 + }, +/obj/machinery/power/port_gen/pacman/mrs, +/obj/structure/cable{ + dir = 4 + }, +/turf/simulated/shuttle/floor/yellow, +/area/submap/event_autonomous_drone/engineering) +"Uh" = ( +/obj/machinery/atmospherics/pipe/simple/visible/fuel{ + dir = 8 + }, +/turf/simulated/shuttle/wall/dark/hard_corner, +/area/submap/event_autonomous_drone/command) +"VM" = ( +/obj/machinery/shipsensors{ + dir = 8; + pixel_x = 1 + }, +/obj/effect/floor_decal/techfloor/orange{ + dir = 8 + }, +/obj/effect/floor_decal/techfloor/orange{ + dir = 4 + }, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/engineering) +"VQ" = ( +/obj/machinery/firealarm/angled{ + pixel_y = 18 + }, +/turf/simulated/shuttle/floor, +/area/submap/event_autonomous_drone/cargo) +"VU" = ( +/obj/machinery/button/remote/blast_door{ + id = "autonomloadinghatch"; + name = "Open Loading Bay"; + pixel_x = 1; + pixel_y = 27 + }, +/turf/simulated/shuttle/floor, +/area/submap/event_autonomous_drone/cargo) +"Ws" = ( +/turf/simulated/shuttle/wall/dark, +/area/submap/event_autonomous_drone/command) +"Xr" = ( +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/visible/fuel, +/turf/simulated/shuttle/floor, +/area/submap/event_autonomous_drone/cargo) +"Xx" = ( +/obj/structure/cable/green{ + icon_state = "1-8" + }, +/obj/machinery/computer/ship/sensors{ + dir = 1 + }, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"XA" = ( +/obj/machinery/atmospherics/pipe/simple/visible/fuel, +/turf/simulated/shuttle/wall/dark, +/area/submap/event_autonomous_drone/engineering) +"XB" = ( +/obj/machinery/firealarm/angled{ + pixel_y = 18 + }, +/obj/machinery/atmospherics/pipe/simple/visible/fuel{ + dir = 8 + }, +/obj/structure/cable{ + dir = 8; + icon_state = "2-4" + }, +/obj/structure/cable{ + icon_state = "4-8" + }, +/turf/simulated/shuttle/floor/yellow, +/area/submap/event_autonomous_drone/engineering) +"Yg" = ( +/obj/machinery/atmospherics/pipe/simple/visible{ + dir = 4 + }, +/turf/simulated/shuttle/plating, +/area/submap/event_autonomous_drone/command) +"ZD" = ( +/obj/machinery/door/blast/shuttle{ + id = "autonomloadinghatch" + }, +/obj/machinery/door/firedoor, +/turf/simulated/shuttle/floor, +/area/submap/event_autonomous_drone/cargo) + +(1,1,1) = {" +au +au +au +au +nW +nW +nW +CX +tC +Ws +Ws +VM +nW +nW +"} +(2,1,1) = {" +au +cU +cU +au +su +su +su +Ws +BF +Sc +Ws +Ws +Ws +Ws +"} +(3,1,1) = {" +au +rE +LT +au +dq +ba +ba +Ws +qt +Je +Ws +mU +Sk +Ws +"} +(4,1,1) = {" +au +pO +QR +au +VQ +ba +pT +CX +jA +Ws +CX +Yg +lB +Ws +"} +(5,1,1) = {" +au +ph +eW +au +ba +ba +RG +Ws +Hs +QJ +sP +gO +Xx +Ws +"} +(6,1,1) = {" +au +XB +gz +pM +Xr +Xr +Cb +Af +tF +tF +QU +tM +Dz +Ws +"} +(7,1,1) = {" +au +Ta +cL +au +ba +ba +zm +Ws +rs +zf +BT +gI +SO +NF +"} +(8,1,1) = {" +Az +XA +OV +au +ba +ba +ba +Ws +Ws +Ws +Sl +Ws +Ws +Uh +"} +(9,1,1) = {" +zw +nW +zw +au +ba +ba +ba +su +nW +nW +zw +nW +nW +zw +"} +(10,1,1) = {" +nW +nW +nW +su +VU +ba +xS +su +nW +nW +nW +nW +nW +nW +"} +(11,1,1) = {" +nW +nW +nW +Rk +ZD +Dx +Dx +cG +nW +nW +nW +nW +nW +nW +"} +(12,1,1) = {" +nW +nW +nW +nW +nW +nW +nW +nW +nW +nW +nW +nW +nW +nW +"} +(13,1,1) = {" +nW +nW +nW +nW +nW +nW +nW +nW +nW +nW +nW +nW +nW +nW +"} diff --git a/maps/tether/tether-01-surface1.dmm b/maps/tether/tether-01-surface1.dmm index 95613fb8c3..3193de39e4 100644 --- a/maps/tether/tether-01-surface1.dmm +++ b/maps/tether/tether-01-surface1.dmm @@ -30996,6 +30996,7 @@ dir = 4; pixel_x = -22 }, +/obj/effect/landmark/stardog, /turf/simulated/floor/plating, /area/maintenance/lower/xenoflora) "bcA" = ( @@ -32059,6 +32060,10 @@ /obj/item/clothing/mask/gas, /turf/simulated/floor/tiled/steel_dirty, /area/maintenance/lowmedbaymaint) +"cvv" = ( +/obj/effect/landmark/stardog, +/turf/simulated/floor/plating, +/area/vacant/vacant_site/east) "cwS" = ( /obj/effect/floor_decal/borderfloor{ dir = 1 @@ -32853,6 +32858,10 @@ }, /turf/simulated/floor/tiled, /area/crew_quarters/locker/laundry_arrival) +"eRJ" = ( +/obj/effect/landmark/stardog, +/turf/simulated/floor/plating, +/area/maintenance/lower/atmos) "eUS" = ( /obj/effect/floor_decal/borderfloor{ dir = 8 @@ -38546,6 +38555,10 @@ /obj/effect/floor_decal/industrial/warning, /turf/simulated/floor/tiled/dark, /area/tether/surfacebase/security/weaponsrange) +"tTx" = ( +/obj/effect/landmark/stardog, +/turf/simulated/floor/plating, +/area/maintenance/lower/solars) "tTC" = ( /obj/effect/floor_decal/borderfloor{ dir = 8 @@ -38749,6 +38762,7 @@ /obj/machinery/atmospherics/pipe/simple/hidden/supply{ dir = 10 }, +/obj/effect/landmark/stardog, /turf/simulated/floor/plating, /area/maintenance/lowmedbaymaint) "uxF" = ( @@ -45759,7 +45773,7 @@ anx anx acJ ahl -rJv +tTx aws abN aeR @@ -50483,7 +50497,7 @@ aTp aIh aIh aIh -aTZ +eRJ aTZ aVI aTZ @@ -53440,7 +53454,7 @@ aCJ aFs aCJ aCJ -aCJ +cvv agM oGO aJe diff --git a/maps/tether/tether-02-surface2.dmm b/maps/tether/tether-02-surface2.dmm index d2fb9d4635..73771899d8 100644 --- a/maps/tether/tether-02-surface2.dmm +++ b/maps/tether/tether-02-surface2.dmm @@ -20074,6 +20074,7 @@ /obj/effect/decal/cleanable/cobweb{ icon_state = "cobweb2" }, +/obj/effect/landmark/stardog, /turf/simulated/floor/plating, /area/maintenance/lower/atmos) "aIN" = ( @@ -28842,6 +28843,7 @@ /obj/structure/railing{ dir = 8 }, +/obj/effect/landmark/stardog, /turf/simulated/floor/plating, /area/maintenance/lower/south) "bak" = ( @@ -33401,6 +33403,10 @@ /obj/effect/mouse_hole_spawner, /turf/simulated/floor/tiled/techmaint, /area/tether/surfacebase/surface_two_hall) +"ien" = ( +/obj/effect/landmark/stardog, +/turf/simulated/floor, +/area/maintenance/lower/north) "ilH" = ( /obj/structure/table/standard, /obj/item/weapon/aiModule/reset, @@ -34805,6 +34811,11 @@ }, /turf/simulated/floor/tiled/techfloor/grid, /area/ai) +"tYW" = ( +/obj/effect/floor_decal/rust, +/obj/effect/landmark/stardog, +/turf/simulated/floor/plating, +/area/maintenance/lower/rnd) "tZD" = ( /obj/machinery/atmospherics/unary/vent_scrubber/on{ dir = 8 @@ -42906,7 +42917,7 @@ axR axR axR awY -aql +tYW aql aIP aJn @@ -44588,7 +44599,7 @@ ann ann ann ann -auA +ien auy ajE aAA diff --git a/maps/tether/tether-03-surface3.dmm b/maps/tether/tether-03-surface3.dmm index 4c0ac58041..085f8a7eac 100644 --- a/maps/tether/tether-03-surface3.dmm +++ b/maps/tether/tether-03-surface3.dmm @@ -23087,6 +23087,7 @@ /obj/machinery/atmospherics/pipe/simple/hidden/cyan{ dir = 6 }, +/obj/effect/landmark/stardog, /turf/simulated/floor/plating, /area/tether/surfacebase/topairlock) "aLX" = ( @@ -39026,6 +39027,19 @@ /obj/machinery/vending/sovietsoda, /turf/simulated/floor/tiled, /area/tether/surfacebase/cafeteria) +"eYm" = ( +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "tourbus"; + name = "tourbus" + }, +/obj/structure/cable/green{ + dir = 1; + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden/yellow, +/obj/effect/landmark/stardog, +/turf/simulated/floor/tiled, +/area/shuttle/tourbus/general) "fag" = ( /obj/effect/floor_decal/fancy_shuttle{ fancy_shuttle_tag = "tourbus"; @@ -56554,7 +56568,7 @@ xOa aXa aXa kcC -sJY +eYm sJY fEX gCZ diff --git a/maps/tether/tether-05-station1.dmm b/maps/tether/tether-05-station1.dmm index 0b23ae9668..8676966edb 100644 --- a/maps/tether/tether-05-station1.dmm +++ b/maps/tether/tether-05-station1.dmm @@ -37,11 +37,10 @@ /obj/structure/window/reinforced{ dir = 1 }, -/obj/structure/dogbed, /obj/effect/floor_decal/spline/fancy/wood{ dir = 1 }, -/mob/living/simple_mob/animal/sif/fluffy, +/obj/structure/curtain/open/privacy, /turf/simulated/floor/grass, /area/quartermaster/qm) "aag" = ( @@ -2390,12 +2389,11 @@ /obj/effect/floor_decal/steeldecal/steel_decals7{ dir = 6 }, -/obj/machinery/camera/network/tether{ +/obj/machinery/disposal/wall{ dir = 4 }, -/obj/item/device/radio/intercom{ - dir = 8; - pixel_x = -24 +/obj/structure/disposalpipe/trunk{ + dir = 4 }, /turf/simulated/floor/tiled, /area/quartermaster/foyer) @@ -2478,6 +2476,9 @@ dir = 10 }, /obj/structure/closet/emcloset, +/obj/machinery/light{ + dir = 8 + }, /turf/simulated/floor/tiled, /area/quartermaster/foyer) "aed" = ( @@ -2614,33 +2615,23 @@ /turf/simulated/floor/tiled, /area/engineering/workshop) "aeo" = ( -/obj/structure/plasticflaps, -/obj/structure/window/reinforced{ - dir = 1 - }, -/obj/machinery/conveyor{ - dir = 8; - id = "crate-belt" - }, -/obj/machinery/door/window/brigdoor/westleft{ - id = "mailing-door"; - name = "Mail Room"; - req_access = list(50) - }, -/obj/machinery/door/firedoor/glass, -/turf/simulated/floor/plating, -/area/quartermaster/delivery) -"aep" = ( -/obj/structure/disposalpipe/segment, -/obj/structure/table/steel_reinforced, -/obj/machinery/door/window/northright{ +/obj/structure/disposalpipe/segment{ dir = 2; - name = "Mailing Room"; - req_access = list(50) + icon_state = "pipe-c" }, -/obj/machinery/door/firedoor/glass, /turf/simulated/floor/tiled, /area/quartermaster/foyer) +"aep" = ( +/obj/structure/disposalpipe/segment, +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/glass_mining{ + id_tag = "cargodoor"; + name = "Cargo Office"; + req_access = list(31); + req_one_access = list() + }, +/turf/simulated/floor/tiled/steel_grid, +/area/quartermaster/office) "aeq" = ( /obj/structure/table/steel_reinforced, /obj/machinery/door/window/northright{ @@ -2721,11 +2712,6 @@ /turf/simulated/floor/tiled, /area/engineering/engine_monitoring) "aeu" = ( -/obj/machinery/door/airlock/glass_mining{ - name = "Delivery Office"; - req_access = list(50); - req_one_access = list() - }, /obj/structure/disposalpipe/segment{ dir = 4 }, @@ -2736,30 +2722,40 @@ dir = 4 }, /obj/structure/cable/green{ - d1 = 4; - d2 = 8; icon_state = "4-8" }, -/obj/machinery/door/firedoor/glass, /turf/simulated/floor/tiled, /area/quartermaster/office) "aev" = ( +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, /obj/structure/cable/green{ d1 = 1; d2 = 2; icon_state = "1-2" }, -/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, -/obj/machinery/door/airlock/mining{ - name = "Quartermaster"; - req_access = list(41); - req_one_access = list() +/obj/structure/noticeboard{ + dir = 8; + pixel_x = 32 }, -/obj/structure/disposalpipe/segment, -/obj/machinery/atmospherics/pipe/simple/hidden/supply, -/obj/machinery/door/firedoor/glass, -/turf/simulated/floor/tiled/steel_grid, -/area/quartermaster/qm) +/obj/machinery/light{ + dir = 4 + }, +/obj/effect/floor_decal/borderfloor{ + dir = 4 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 4 + }, +/obj/effect/floor_decal/borderfloor/corner2{ + dir = 6 + }, +/obj/effect/floor_decal/corner/brown/bordercorner2{ + dir = 6 + }, +/turf/simulated/floor/tiled, +/area/quartermaster/office) "aew" = ( /obj/structure/grille, /obj/structure/window/reinforced/full, @@ -2786,13 +2782,17 @@ /turf/simulated/floor, /area/engineering/engine_monitoring) "aex" = ( -/obj/machinery/door/airlock/maintenance/cargo{ - req_access = list(50); - req_one_access = list(48) +/obj/effect/floor_decal/borderfloor, +/obj/effect/floor_decal/corner/lightgrey/border, +/obj/effect/floor_decal/steeldecal/steel_decals7{ + dir = 1 }, -/obj/machinery/door/firedoor/glass, -/turf/simulated/floor, -/area/quartermaster/delivery) +/obj/effect/floor_decal/steeldecal/steel_decals7{ + dir = 8 + }, +/obj/structure/disposalpipe/segment, +/turf/simulated/floor/tiled, +/area/quartermaster/foyer) "aey" = ( /obj/machinery/smartfridge/sheets/persistent_lossy, /turf/simulated/wall, @@ -3397,14 +3397,18 @@ /turf/simulated/floor/tiled, /area/hallway/station/docks) "afK" = ( -/obj/machinery/button/windowtint{ - id = "qm_office"; - pixel_x = 26; - pixel_y = 8 +/obj/structure/table/standard, +/obj/item/weapon/folder/yellow, +/obj/item/weapon/pen{ + pixel_x = 4; + pixel_y = 4 }, -/obj/machinery/light_switch{ - dir = 8; - pixel_x = 24 +/obj/item/weapon/pen/red{ + pixel_x = 2; + pixel_y = 6 + }, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 8 }, /turf/simulated/floor/wood, /area/quartermaster/qm) @@ -3522,7 +3526,6 @@ /turf/simulated/floor/tiled, /area/engineering/hallway) "afV" = ( -/obj/effect/floor_decal/industrial/hatch/yellow, /obj/structure/disposalpipe/segment{ dir = 2; icon_state = "pipe-c" @@ -3532,6 +3535,9 @@ d2 = 8; icon_state = "2-8" }, +/obj/effect/floor_decal/borderfloor, +/obj/effect/floor_decal/corner/brown/border, +/obj/effect/floor_decal/industrial/hatch/yellow, /turf/simulated/floor/tiled, /area/quartermaster/foyer) "afW" = ( @@ -3747,23 +3753,7 @@ /obj/structure/cable/green{ icon_state = "4-8" }, -/obj/structure/table/standard, -/obj/item/weapon/paper_bin{ - pixel_x = -3; - pixel_y = 7 - }, -/obj/item/weapon/clipboard, -/obj/item/weapon/pen/red{ - pixel_x = 2; - pixel_y = 6 - }, /obj/structure/disposalpipe/segment, -/obj/effect/floor_decal/borderfloor{ - dir = 4 - }, -/obj/effect/floor_decal/corner/brown/border{ - dir = 4 - }, /turf/simulated/floor/tiled, /area/quartermaster/office) "agB" = ( @@ -3782,10 +3772,8 @@ name = "\improper Telecomms Solar Field" }) "agE" = ( -/obj/structure/table/standard, -/obj/item/weapon/clipboard, -/obj/item/weapon/stamp/qm, -/obj/machinery/atmospherics/unary/vent_pump/on{ +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ dir = 8 }, /turf/simulated/floor/wood, @@ -3828,8 +3816,12 @@ /turf/simulated/wall/r_wall, /area/engineering/engine_room) "agK" = ( -/obj/structure/closet/secure_closet/quartermaster, -/obj/item/weapon/storage/backpack/dufflebag, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 5 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 5 + }, /turf/simulated/floor/wood, /area/quartermaster/qm) "agL" = ( @@ -3842,11 +3834,11 @@ /turf/simulated/floor/tiled, /area/engineering/engine_airlock) "agM" = ( -/obj/machinery/atmospherics/pipe/simple/hidden/supply, -/obj/structure/cable/green{ - d1 = 1; - d2 = 2; - icon_state = "1-2" +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 10 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 }, /turf/simulated/floor/wood, /area/quartermaster/qm) @@ -3888,8 +3880,11 @@ /turf/simulated/floor/tiled/steel, /area/shuttle/excursion/general) "agS" = ( -/obj/structure/filingcabinet, -/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/structure/closet/secure_closet/quartermaster, +/obj/item/weapon/storage/backpack/dufflebag, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 10 + }, /turf/simulated/floor/wood, /area/quartermaster/qm) "agT" = ( @@ -4100,10 +4095,16 @@ }, /obj/structure/disposalpipe/segment, /obj/effect/floor_decal/borderfloor{ - dir = 5 + dir = 1 }, /obj/effect/floor_decal/corner/brown/border{ - dir = 5 + dir = 1 + }, +/obj/effect/floor_decal/borderfloor/corner2{ + dir = 1 + }, +/obj/effect/floor_decal/corner/brown/bordercorner2{ + dir = 1 }, /turf/simulated/floor/tiled, /area/quartermaster/office) @@ -4118,16 +4119,17 @@ /turf/simulated/floor/tiled/techmaint, /area/engineering/gravity_gen) "ahj" = ( -/obj/structure/grille, -/obj/structure/window/reinforced/polarized/full{ - id = "qm_office" - }, -/obj/machinery/door/firedoor/glass, /obj/structure/disposalpipe/segment{ dir = 4 }, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 9 + }, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 4 + }, /turf/simulated/floor/tiled, -/area/quartermaster/qm) +/area/quartermaster/office) "ahk" = ( /obj/machinery/power/smes/buildable/point_of_interest, /obj/structure/cable/cyan{ @@ -4140,12 +4142,15 @@ /turf/simulated/floor/tiled/steel, /area/shuttle/excursion/power) "ahn" = ( -/obj/structure/disposalpipe/segment, -/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ - dir = 1 +/obj/structure/grille, +/obj/structure/window/reinforced/polarized/full{ + id = "qm_office" }, -/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, -/turf/simulated/floor/wood, +/obj/machinery/door/firedoor/glass, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/turf/simulated/floor/tiled, /area/quartermaster/qm) "aho" = ( /turf/simulated/floor, @@ -4649,16 +4654,12 @@ /turf/simulated/floor, /area/storage/tech) "aiH" = ( -/obj/machinery/atmospherics/pipe/simple/hidden/supply{ - dir = 10 - }, -/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ - dir = 8 +/obj/structure/disposalpipe/segment{ + dir = 8; + icon_state = "pipe-c" }, /obj/structure/cable/green{ - d1 = 2; - d2 = 8; - icon_state = "2-8" + icon_state = "4-8" }, /turf/simulated/floor/wood, /area/quartermaster/qm) @@ -7265,11 +7266,9 @@ /area/tcommsat/chamber) "apW" = ( /obj/structure/lattice, -/obj/structure/disposalpipe/trunk{ - dir = 8 - }, -/obj/structure/disposaloutlet{ - dir = 4 +/obj/structure/disposalpipe/segment{ + dir = 2; + icon_state = "pipe-c" }, /turf/space, /area/space) @@ -8381,19 +8380,13 @@ /obj/effect/floor_decal/corner/brown/border{ dir = 9 }, -/obj/effect/floor_decal/borderfloor/corner2{ - dir = 1 - }, -/obj/effect/floor_decal/corner/brown/bordercorner2{ - dir = 1 - }, -/obj/structure/sign/poster{ - dir = 8 - }, /obj/structure/disposalpipe/segment{ dir = 1; icon_state = "pipe-c" }, +/obj/structure/sign/poster{ + dir = 8 + }, /turf/simulated/floor/tiled, /area/quartermaster/delivery) "atn" = ( @@ -8402,10 +8395,15 @@ icon_state = "pipe-c" }, /obj/machinery/camera/network/cargo, +/obj/effect/floor_decal/borderfloor{ + dir = 5 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 5 + }, /turf/simulated/floor/tiled, /area/quartermaster/delivery) "atr" = ( -/obj/effect/floor_decal/industrial/outline/yellow, /obj/effect/floor_decal/steeldecal/steel_decals4{ dir = 1 }, @@ -8551,14 +8549,39 @@ /turf/simulated/floor, /area/maintenance/station/eng_lower) "atV" = ( -/obj/effect/floor_decal/industrial/hatch/yellow, /obj/structure/disposalpipe/segment{ dir = 4; icon_state = "pipe-c" }, -/obj/machinery/conveyor{ +/obj/machinery/power/apc{ dir = 8; - id = "crate-belt" + name = "west bump"; + pixel_x = -28 + }, +/obj/structure/cable/green{ + d2 = 4; + icon_state = "0-4" + }, +/obj/effect/floor_decal/borderfloor{ + dir = 10 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 10 + }, +/obj/effect/floor_decal/borderfloor/corner2{ + dir = 8 + }, +/obj/effect/floor_decal/borderfloor/corner2{ + dir = 9 + }, +/obj/effect/floor_decal/corner/brown/bordercorner2{ + dir = 8 + }, +/obj/effect/floor_decal/corner/brown/bordercorner2{ + dir = 9 + }, +/obj/structure/bed/chair{ + dir = 4 }, /turf/simulated/floor/tiled, /area/quartermaster/foyer) @@ -8663,6 +8686,18 @@ name = "Void"; sortType = "Void" }, +/obj/structure/cable/green{ + d1 = 4; + d2 = 8; + icon_state = "4-8" + }, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 5 + }, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 8 + }, +/obj/effect/floor_decal/industrial/hatch/yellow, /turf/simulated/floor/tiled, /area/quartermaster/foyer) "auy" = ( @@ -8692,18 +8727,18 @@ /turf/simulated/floor/tiled/monotile, /area/engineering/engine_eva) "auC" = ( -/obj/machinery/power/apc{ - name = "south bump"; - pixel_y = -32 - }, /obj/structure/disposalpipe/junction{ dir = 8 }, /obj/structure/cable/green{ - d2 = 4; - icon_state = "0-4" + d1 = 4; + d2 = 8; + icon_state = "4-8" }, -/obj/machinery/light, +/obj/effect/floor_decal/borderfloor, +/obj/effect/floor_decal/corner/brown/border, +/obj/effect/floor_decal/borderfloor/corner2, +/obj/effect/floor_decal/corner/brown/bordercorner2, /turf/simulated/floor/tiled, /area/quartermaster/foyer) "auH" = ( @@ -8945,6 +8980,12 @@ name = "Sorting Office"; sortType = "Sorting Office" }, +/obj/effect/floor_decal/borderfloor{ + dir = 4 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 4 + }, /turf/simulated/floor/tiled, /area/quartermaster/delivery) "avv" = ( @@ -8989,12 +9030,12 @@ /turf/simulated/floor/tiled, /area/engineering/hallway) "avy" = ( -/obj/structure/disposalpipe/segment, -/obj/structure/grille, /obj/machinery/door/firedoor/glass, +/obj/structure/grille, /obj/structure/window/reinforced/full, +/obj/structure/disposalpipe/segment, /turf/simulated/floor/plating, -/area/quartermaster/foyer) +/area/quartermaster/office) "avz" = ( /obj/machinery/atmospherics/pipe/simple/hidden/cyan, /obj/machinery/atmospherics/pipe/simple/hidden/supply, @@ -9090,6 +9131,9 @@ /obj/effect/floor_decal/corner/brown/border{ dir = 8 }, +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 4 + }, /turf/simulated/floor/tiled, /area/quartermaster/delivery) "avO" = ( @@ -9111,8 +9155,8 @@ }, /area/tcommsat/chamber) "avQ" = ( -/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ - dir = 10 +/obj/structure/cable/green{ + icon_state = "4-8" }, /turf/simulated/floor/wood, /area/quartermaster/qm) @@ -9148,24 +9192,16 @@ /turf/simulated/floor, /area/storage/emergency_storage/emergency4) "awe" = ( -/obj/machinery/light, /obj/structure/dogbed, /mob/living/simple_mob/animal/sif/fluffy/silky, /turf/simulated/floor/grass, /area/quartermaster/qm) "awh" = ( -/obj/machinery/power/apc{ - dir = 4; - name = "east bump"; - pixel_x = 28 - }, /obj/machinery/atmospherics/unary/vent_scrubber/on{ dir = 1 }, -/obj/structure/cable/green{ - d2 = 8; - icon_state = "0-8" - }, +/obj/structure/dogbed, +/mob/living/simple_mob/animal/sif/fluffy, /turf/simulated/floor/grass, /area/quartermaster/qm) "awj" = ( @@ -9182,8 +9218,17 @@ /obj/effect/floor_decal/corner/brown/border{ dir = 8 }, -/obj/machinery/atmospherics/unary/vent_scrubber/on{ - dir = 4 +/obj/structure/table/standard, +/obj/item/weapon/storage/box, +/obj/item/weapon/storage/box, +/obj/item/weapon/storage/box, +/obj/item/weapon/packageWrap, +/obj/item/weapon/packageWrap, +/obj/item/weapon/packageWrap, +/obj/item/weapon/packageWrap, +/obj/item/device/destTagger{ + pixel_x = 4; + pixel_y = 3 }, /turf/simulated/floor/tiled, /area/quartermaster/delivery) @@ -9212,8 +9257,21 @@ /turf/simulated/floor/tiled, /area/engineering/hallway) "awo" = ( -/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ - dir = 9 +/obj/machinery/atmospherics/pipe/simple/hidden/universal, +/obj/structure/bed/chair/office/dark{ + dir = 8 + }, +/obj/effect/floor_decal/borderfloor{ + dir = 4 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 4 + }, +/obj/effect/floor_decal/borderfloor/corner2{ + dir = 6 + }, +/obj/effect/floor_decal/corner/brown/bordercorner2{ + dir = 6 }, /turf/simulated/floor/tiled, /area/quartermaster/delivery) @@ -9280,23 +9338,6 @@ }, /turf/simulated/wall, /area/quartermaster/delivery) -"awL" = ( -/obj/effect/floor_decal/borderfloor, -/obj/effect/floor_decal/corner/brown/border, -/obj/effect/floor_decal/borderfloor/corner2, -/obj/effect/floor_decal/corner/brown/bordercorner2, -/obj/structure/table/steel, -/obj/item/weapon/paper_bin{ - pixel_x = -3; - pixel_y = 7 - }, -/obj/item/weapon/pen/red{ - pixel_x = 2; - pixel_y = 6 - }, -/obj/machinery/light, -/turf/simulated/floor/tiled, -/area/quartermaster/delivery) "awM" = ( /obj/machinery/atmospherics/portables_connector{ dir = 4 @@ -10103,10 +10144,26 @@ /turf/simulated/floor/tiled, /area/engineering/engineering_airlock) "azv" = ( -/obj/machinery/door/airlock/multi_tile/metal/mait, -/obj/machinery/door/firedoor/glass, -/turf/simulated/floor, -/area/maintenance/station/cargo) +/obj/effect/floor_decal/borderfloor{ + dir = 5 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 5 + }, +/obj/effect/floor_decal/borderfloor/corner2{ + dir = 5 + }, +/obj/effect/floor_decal/corner/brown/bordercorner2{ + dir = 5 + }, +/obj/structure/bed/chair{ + dir = 8 + }, +/obj/machinery/light{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/quartermaster/foyer) "azw" = ( /obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, /obj/machinery/atmospherics/pipe/simple/hidden/supply, @@ -10416,6 +10473,15 @@ /obj/structure/disposalpipe/sortjunction/untagged/flipped{ dir = 1 }, +/obj/effect/floor_decal/borderfloor{ + dir = 4 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 4 + }, +/obj/machinery/light{ + dir = 4 + }, /turf/simulated/floor/tiled, /area/quartermaster/delivery) "aAL" = ( @@ -10531,16 +10597,6 @@ /obj/structure/closet/secure_closet/engineering_chief, /turf/simulated/floor/tiled, /area/crew_quarters/heads/chief) -"aBi" = ( -/obj/structure/disposalpipe/segment, -/obj/effect/floor_decal/borderfloor/corner{ - dir = 4 - }, -/obj/effect/floor_decal/corner/brown/bordercorner{ - dir = 4 - }, -/turf/simulated/floor/tiled, -/area/quartermaster/office) "aBl" = ( /obj/structure/window/reinforced{ dir = 4 @@ -10560,13 +10616,13 @@ /turf/simulated/floor/tiled, /area/engineering/engine_eva) "aBo" = ( -/obj/effect/floor_decal/borderfloor{ - dir = 9 +/obj/effect/floor_decal/borderfloor/corner{ + dir = 1 }, -/obj/effect/floor_decal/corner/brown/border{ - dir = 9 +/obj/effect/floor_decal/corner/brown/bordercorner{ + dir = 1 }, -/obj/machinery/computer/stockexchange, +/obj/structure/disposalpipe/segment, /turf/simulated/floor/tiled, /area/quartermaster/office) "aBp" = ( @@ -10742,14 +10798,9 @@ /obj/structure/table/standard, /obj/item/weapon/storage/belt/utility, /obj/item/device/multitool, -/obj/fiftyspawner/steel, /obj/item/weapon/storage/belt/utility, -/obj/effect/floor_decal/borderfloor{ - dir = 10 - }, -/obj/effect/floor_decal/corner/brown/border{ - dir = 10 - }, +/obj/effect/floor_decal/borderfloor, +/obj/effect/floor_decal/corner/brown/border, /turf/simulated/floor/tiled, /area/quartermaster/office) "aBJ" = ( @@ -10764,28 +10815,10 @@ /turf/simulated/floor/tiled, /area/quartermaster/office) "aBK" = ( -/obj/structure/noticeboard{ - pixel_y = 32 - }, -/obj/effect/floor_decal/borderfloor{ - dir = 1 - }, -/obj/effect/floor_decal/corner/brown/border{ - dir = 1 - }, -/obj/effect/floor_decal/borderfloor/corner2{ - dir = 1 - }, -/obj/effect/floor_decal/corner/brown/bordercorner2{ - dir = 1 - }, -/turf/simulated/floor/tiled, -/area/quartermaster/office) +/obj/machinery/status_display/supply_display, +/turf/simulated/wall, +/area/quartermaster/qm) "aBL" = ( -/obj/effect/floor_decal/steeldecal/steel_decals4{ - dir = 10 - }, -/obj/effect/floor_decal/steeldecal/steel_decals4, /obj/machinery/atmospherics/pipe/simple/hidden/supply{ dir = 4 }, @@ -11225,11 +11258,9 @@ /turf/simulated/floor/tiled/white, /area/tether/station/restroom) "aDR" = ( -/obj/structure/grille, -/obj/structure/window/reinforced/full, -/obj/machinery/door/firedoor/glass, -/turf/simulated/floor/plating, -/area/quartermaster/office) +/obj/machinery/computer/supplycomp/control, +/turf/simulated/floor/wood, +/area/quartermaster/qm) "aDS" = ( /obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ dir = 4 @@ -14486,6 +14517,7 @@ d2 = 8; icon_state = "2-8" }, +/obj/effect/landmark/stardog, /turf/simulated/floor, /area/storage/emergency_storage/emergency4) "bqK" = ( @@ -15719,9 +15751,15 @@ /turf/simulated/floor, /area/maintenance/cargo) "chi" = ( -/obj/structure/sign/department/cargo, -/turf/simulated/wall, -/area/quartermaster/qm) +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/glass_mining{ + id_tag = "cargodoor"; + name = "Cargo Office"; + req_access = list(31); + req_one_access = list() + }, +/turf/simulated/floor/tiled/steel_grid, +/area/quartermaster/office) "chw" = ( /obj/effect/landmark/start{ name = "Assistant" @@ -16170,13 +16208,12 @@ /turf/simulated/floor/tiled/steel, /area/shuttle/excursion/cockpit) "cCL" = ( -/obj/structure/grille, -/obj/machinery/door/firedoor/glass, -/obj/structure/window/reinforced/polarized/full{ - id = "qm_office" +/obj/machinery/computer/security/mining, +/obj/structure/sign/painting/library_secure{ + pixel_x = 30 }, -/turf/simulated/floor/plating, -/area/quartermaster/delivery) +/turf/simulated/floor/wood, +/area/quartermaster/qm) "cCM" = ( /obj/machinery/atmospherics/portables_connector{ dir = 4 @@ -16950,9 +16987,6 @@ /obj/machinery/light/small{ dir = 4 }, -/obj/structure/railing{ - dir = 1 - }, /turf/simulated/floor, /area/maintenance/cargo) "doH" = ( @@ -17680,6 +17714,7 @@ /obj/machinery/camera/network/tether{ dir = 4 }, +/obj/structure/disposalpipe/segment, /turf/simulated/mineral/floor/vacuum, /area/mine/explored/upper_level) "eed" = ( @@ -17783,17 +17818,14 @@ /turf/simulated/floor/tiled, /area/storage/tools) "ekh" = ( -/obj/machinery/status_display{ - pixel_x = 32 - }, /obj/structure/window/reinforced{ dir = 1 }, -/obj/item/toy/plushie/squid/pink, /obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, /obj/effect/floor_decal/spline/fancy/wood{ dir = 1 }, +/obj/structure/curtain/open/privacy, /turf/simulated/floor/grass, /area/quartermaster/qm) "emi" = ( @@ -18269,19 +18301,17 @@ /turf/simulated/floor/tiled/steel_grid, /area/quartermaster/warehouse) "eQM" = ( -/obj/structure/table/standard, -/obj/item/weapon/folder/yellow, -/obj/item/weapon/pen{ - pixel_x = 4; - pixel_y = 4 - }, -/obj/item/weapon/pen/red{ - pixel_x = 2; - pixel_y = 6 - }, -/obj/machinery/atmospherics/unary/vent_scrubber/on{ +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ dir = 8 }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, +/obj/machinery/light{ + dir = 8 + }, +/obj/machinery/alarm{ + dir = 4; + pixel_x = -22 + }, /turf/simulated/floor/wood, /area/quartermaster/qm) "eSM" = ( @@ -18711,15 +18741,16 @@ /turf/simulated/floor/tiled/steel, /area/shuttle/excursion/cargo) "fsA" = ( -/obj/machinery/atmospherics/pipe/simple/hidden/supply{ - dir = 8 +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 4 }, -/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ - dir = 8 +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 4 + }, +/obj/structure/disposalpipe/segment{ + dir = 4 }, /obj/structure/cable/green{ - d1 = 4; - d2 = 8; icon_state = "4-8" }, /turf/simulated/floor/wood, @@ -18854,6 +18885,18 @@ /obj/machinery/camera/network/cargo{ dir = 8 }, +/obj/effect/floor_decal/borderfloor{ + dir = 4 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 4 + }, +/obj/effect/floor_decal/borderfloor/corner2{ + dir = 5 + }, +/obj/effect/floor_decal/corner/brown/bordercorner2{ + dir = 5 + }, /turf/simulated/floor/tiled, /area/quartermaster/office) "fxR" = ( @@ -19013,9 +19056,11 @@ /turf/simulated/floor, /area/maintenance/station/eng_lower) "fGL" = ( -/obj/machinery/light_construct/small, -/turf/simulated/floor, -/area/maintenance/cargo) +/obj/effect/floor_decal/borderfloor, +/obj/effect/floor_decal/corner/brown/border, +/obj/structure/table/standard, +/turf/simulated/floor/tiled, +/area/quartermaster/office) "fGW" = ( /obj/effect/floor_decal/fancy_shuttle{ fancy_shuttle_tag = "explo" @@ -19712,6 +19757,13 @@ }, /turf/simulated/floor/tiled, /area/quartermaster/foyer) +"gpz" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 4 + }, +/obj/effect/floor_decal/industrial/outline/yellow, +/turf/simulated/floor/tiled, +/area/quartermaster/office) "gqN" = ( /obj/machinery/atmospherics/pipe/simple/hidden, /obj/structure/cable/green{ @@ -19976,6 +20028,10 @@ fancy_shuttle_tag = "explo" }, /area/shuttle/excursion/cargo) +"gIU" = ( +/obj/structure/frame, +/turf/simulated/floor, +/area/maintenance/cargo) "gKa" = ( /obj/machinery/lapvend, /turf/simulated/floor/tiled, @@ -20040,6 +20096,7 @@ /obj/effect/floor_decal/fancy_shuttle{ fancy_shuttle_tag = "explo" }, +/obj/effect/landmark/stardog, /turf/simulated/floor/tiled/steel, /area/shuttle/excursion/cargo) "gMR" = ( @@ -20054,6 +20111,13 @@ /obj/effect/floor_decal/industrial/outline/red, /turf/simulated/floor/tiled, /area/tether/station/dock_two) +"gOE" = ( +/obj/structure/filingcabinet, +/obj/machinery/status_display{ + pixel_y = -32 + }, +/turf/simulated/floor/wood, +/area/quartermaster/qm) "gOT" = ( /obj/machinery/atmospherics/pipe/manifold/hidden/fuel{ dir = 1 @@ -20146,16 +20210,6 @@ }, /turf/simulated/floor, /area/quartermaster/storage) -"gVf" = ( -/obj/structure/disposalpipe/segment, -/obj/effect/floor_decal/borderfloor/corner{ - dir = 1 - }, -/obj/effect/floor_decal/corner/brown/bordercorner{ - dir = 1 - }, -/turf/simulated/floor/tiled, -/area/quartermaster/office) "gVl" = ( /obj/effect/floor_decal/industrial/warning/corner{ dir = 1 @@ -20224,6 +20278,10 @@ /obj/effect/floor_decal/corner/lightgrey/bordercorner2{ dir = 10 }, +/obj/item/device/radio/intercom{ + dir = 1; + pixel_y = 24 + }, /turf/simulated/floor/tiled, /area/quartermaster/foyer) "gWD" = ( @@ -20270,10 +20328,10 @@ name = "\improper Telecomms Storage" }) "gZJ" = ( -/obj/machinery/newscaster{ - pixel_x = 28 - }, -/obj/machinery/camera/network/cargo{ +/obj/structure/table/standard, +/obj/item/weapon/clipboard, +/obj/item/weapon/stamp/qm, +/obj/machinery/atmospherics/unary/vent_pump/on{ dir = 8 }, /turf/simulated/floor/wood, @@ -20321,11 +20379,8 @@ /turf/simulated/floor/tiled/monotile, /area/tether/exploration) "hbv" = ( -/obj/structure/disposalpipe/segment, -/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ - dir = 1 - }, -/turf/simulated/floor/wood, +/obj/structure/sign/department/cargo, +/turf/simulated/wall, /area/quartermaster/qm) "hcw" = ( /obj/structure/catwalk, @@ -20742,13 +20797,14 @@ }, /area/shuttle/securiship/general) "hsq" = ( -/obj/structure/catwalk, -/obj/random/junk, -/obj/machinery/light/small{ - dir = 1 +/obj/effect/floor_decal/borderfloor{ + dir = 9 }, -/turf/simulated/floor, -/area/maintenance/cargo) +/obj/effect/floor_decal/corner/brown/border{ + dir = 9 + }, +/turf/simulated/floor/tiled, +/area/quartermaster/office) "hss" = ( /obj/effect/floor_decal/borderfloor/corner{ dir = 1 @@ -21275,9 +21331,11 @@ /turf/simulated/wall, /area/hallway/station/atrium) "hLH" = ( -/obj/structure/table/standard, -/obj/machinery/photocopier/faxmachine{ - department = "Quartermaster-Office" +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 10 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 10 }, /turf/simulated/floor/wood, /area/quartermaster/qm) @@ -21424,6 +21482,13 @@ }, /turf/simulated/floor/tiled, /area/quartermaster/belterdock/gear) +"hQq" = ( +/obj/structure/disposalpipe/segment{ + dir = 8; + icon_state = "pipe-c" + }, +/turf/simulated/mineral/floor/vacuum, +/area/mine/explored/upper_level) "hRi" = ( /obj/machinery/atmospherics/pipe/manifold/hidden{ dir = 4 @@ -21525,9 +21590,6 @@ /obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, /obj/structure/disposalpipe/segment, /obj/machinery/atmospherics/pipe/simple/hidden/supply, -/obj/effect/floor_decal/steeldecal/steel_decals4{ - dir = 9 - }, /obj/effect/floor_decal/steeldecal/steel_decals4{ dir = 4 }, @@ -21536,6 +21598,12 @@ layer = 3.3; pixel_x = 26 }, +/obj/effect/floor_decal/borderfloor{ + dir = 4 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 4 + }, /turf/simulated/floor/tiled, /area/quartermaster/office) "hVz" = ( @@ -21613,10 +21681,15 @@ /turf/simulated/floor/carpet, /area/engineering/foyer) "hYT" = ( -/obj/machinery/door/airlock/maintenance/common, -/obj/machinery/door/firedoor/glass, -/turf/simulated/floor, -/area/maintenance/cargo) +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 8 + }, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 5 + }, +/obj/effect/floor_decal/industrial/hatch/yellow, +/turf/simulated/floor/tiled, +/area/quartermaster/foyer) "hZp" = ( /obj/structure/grille, /obj/structure/window/reinforced/full, @@ -21941,13 +22014,11 @@ /turf/simulated/wall, /area/maintenance/station/cargo) "iqs" = ( -/obj/machinery/photocopier, -/obj/effect/floor_decal/borderfloor{ - dir = 9 - }, -/obj/effect/floor_decal/corner/brown/border{ - dir = 9 +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 4 }, +/obj/effect/floor_decal/industrial/outline/yellow, +/obj/structure/closet/crate, /turf/simulated/floor/tiled, /area/quartermaster/office) "isr" = ( @@ -22162,7 +22233,6 @@ /turf/simulated/floor/tiled, /area/quartermaster/warehouse) "iDA" = ( -/obj/effect/floor_decal/industrial/outline/yellow, /obj/structure/disposalpipe/segment{ dir = 4 }, @@ -22171,6 +22241,10 @@ d2 = 8; icon_state = "4-8" }, +/obj/effect/floor_decal/borderfloor, +/obj/effect/floor_decal/corner/brown/border, +/obj/machinery/light, +/obj/effect/floor_decal/industrial/outline/yellow, /turf/simulated/floor/tiled, /area/quartermaster/foyer) "iEl" = ( @@ -22368,6 +22442,18 @@ }, /turf/simulated/floor/tiled, /area/tether/station/dock_two) +"iOU" = ( +/obj/machinery/atmospherics/pipe/simple/hidden, +/obj/structure/cable/green{ + icon_state = "1-2" + }, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "medbus"; + name = "medbus" + }, +/obj/effect/landmark/stardog, +/turf/simulated/floor/tiled, +/area/shuttle/medivac/general) "iOW" = ( /obj/structure/extinguisher_cabinet{ dir = 8; @@ -22514,21 +22600,16 @@ dir = 4; pixel_x = -23 }, +/obj/structure/table/standard, /obj/effect/floor_decal/borderfloor{ dir = 10 }, /obj/effect/floor_decal/corner/brown/border{ dir = 10 }, -/obj/effect/floor_decal/borderfloor/corner2{ - dir = 9 - }, -/obj/effect/floor_decal/corner/brown/bordercorner2{ - dir = 9 - }, -/obj/item/device/radio/intercom{ - pixel_y = -24 - }, +/obj/item/weapon/wrapping_paper, +/obj/item/weapon/wrapping_paper, +/obj/item/weapon/wrapping_paper, /turf/simulated/floor/tiled, /area/quartermaster/delivery) "iWB" = ( @@ -22570,12 +22651,37 @@ /turf/simulated/floor/tiled, /area/tcommsat/computer) "iYG" = ( -/obj/effect/floor_decal/steeldecal/steel_decals4{ - dir = 5 - }, /obj/effect/floor_decal/steeldecal/steel_decals4{ dir = 8 }, +/obj/structure/table/standard, +/obj/item/weapon/paper_bin{ + pixel_x = -3; + pixel_y = 7 + }, +/obj/item/weapon/folder/yellow, +/obj/item/weapon/pen{ + pixel_x = 4; + pixel_y = 4 + }, +/obj/item/weapon/pen/red{ + pixel_x = 2; + pixel_y = 6 + }, +/obj/machinery/light, +/obj/effect/floor_decal/borderfloor{ + dir = 6 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 6 + }, +/obj/machinery/atmospherics/unary/vent_pump/siphon/on/atmos{ + dir = 1; + external_pressure_bound = 101.3; + external_pressure_bound_default = 101.3; + pressure_checks = 1; + pressure_checks_default = 1 + }, /turf/simulated/floor/tiled, /area/quartermaster/delivery) "iZC" = ( @@ -22597,12 +22703,11 @@ /turf/simulated/floor/plating, /area/tether/station/dock_two) "iZJ" = ( -/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ +/obj/structure/bed/chair/office/dark{ dir = 8 }, -/obj/machinery/atmospherics/pipe/simple/hidden/supply, -/obj/machinery/light{ - dir = 8 +/obj/effect/landmark/start{ + name = "Quartermaster" }, /turf/simulated/floor/wood, /area/quartermaster/qm) @@ -22635,7 +22740,10 @@ /turf/simulated/floor/tiled, /area/hallway/station/atrium) "jfP" = ( -/turf/simulated/floor/tiled, +/obj/machinery/door/firedoor/glass, +/obj/structure/grille, +/obj/structure/window/reinforced/full, +/turf/simulated/floor/plating, /area/quartermaster/delivery) "jgd" = ( /obj/effect/floor_decal/borderfloorwhite{ @@ -22662,7 +22770,6 @@ /obj/machinery/atmospherics/pipe/simple/hidden/supply{ dir = 6 }, -/obj/effect/landmark/vermin, /turf/simulated/floor/tiled, /area/quartermaster/office) "jiq" = ( @@ -23466,6 +23573,16 @@ }, /turf/simulated/floor, /area/maintenance/station/eng_lower) +"jXk" = ( +/obj/effect/floor_decal/borderfloor{ + dir = 8 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 8 + }, +/obj/machinery/autolathe, +/turf/simulated/floor/tiled, +/area/quartermaster/office) "jXI" = ( /obj/machinery/atmospherics/unary/vent_pump/high_volume{ dir = 1; @@ -23996,10 +24113,25 @@ /turf/simulated/floor/tiled, /area/hallway/station/atrium) "kum" = ( -/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, -/obj/machinery/atmospherics/pipe/simple/hidden/supply, -/turf/simulated/floor/wood, -/area/quartermaster/qm) +/obj/structure/bed/chair{ + dir = 8 + }, +/obj/effect/floor_decal/borderfloor{ + dir = 6 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 6 + }, +/obj/effect/floor_decal/borderfloor/corner2{ + dir = 6 + }, +/obj/effect/floor_decal/borderfloor/corner2, +/obj/effect/floor_decal/corner/brown/bordercorner2{ + dir = 6 + }, +/obj/effect/floor_decal/corner/brown/bordercorner2, +/turf/simulated/floor/tiled, +/area/quartermaster/foyer) "kuo" = ( /obj/machinery/atmospherics/pipe/simple/hidden, /turf/simulated/floor/tiled, @@ -24171,11 +24303,7 @@ /obj/machinery/atmospherics/unary/vent_pump/on{ dir = 1 }, -/obj/structure/cable/green{ - d1 = 1; - d2 = 4; - icon_state = "1-4" - }, +/obj/item/toy/plushie/squid/pink, /turf/simulated/floor/grass, /area/quartermaster/qm) "kCD" = ( @@ -24493,29 +24621,29 @@ /turf/simulated/floor/tiled, /area/tether/station/dock_two) "kPu" = ( -/obj/structure/cable/green{ - d1 = 2; - d2 = 8; - icon_state = "2-8" - }, -/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ - dir = 4 - }, /obj/structure/disposalpipe/sortjunction{ dir = 1; name = "QM Office"; sortType = "QM Office" }, -/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ - dir = 4 - }, /obj/structure/cable/green{ d1 = 2; d2 = 4; icon_state = "2-4" }, -/turf/simulated/floor/wood, -/area/quartermaster/qm) +/obj/structure/cable/green{ + d1 = 2; + d2 = 8; + icon_state = "2-8" + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 1 + }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/quartermaster/office) "kPJ" = ( /obj/item/device/radio/intercom{ pixel_y = -24 @@ -24614,18 +24742,21 @@ dir = 4; pixel_x = -23 }, -/obj/structure/disposalpipe/trunk{ - dir = 4 - }, -/obj/machinery/disposal, /obj/effect/floor_decal/borderfloor/corner2{ dir = 10 }, /obj/effect/floor_decal/corner/brown/bordercorner2{ dir = 10 }, -/obj/machinery/light{ - dir = 8 +/obj/structure/disposalpipe/segment{ + dir = 1; + icon_state = "pipe-c" + }, +/obj/machinery/camera/network/tether{ + dir = 4 + }, +/obj/structure/bed/chair{ + dir = 4 }, /turf/simulated/floor/tiled, /area/quartermaster/foyer) @@ -24753,31 +24884,16 @@ /turf/simulated/floor/tiled, /area/hallway/station/docks) "lad" = ( -/obj/structure/bed/chair{ - dir = 8 - }, +/obj/machinery/atmospherics/unary/vent_scrubber/on, /obj/effect/floor_decal/borderfloor{ - dir = 5 + dir = 1 }, /obj/effect/floor_decal/corner/brown/border{ - dir = 5 - }, -/obj/machinery/atmospherics/unary/vent_scrubber/on, -/obj/effect/floor_decal/borderfloor/corner2{ - dir = 5 - }, -/obj/effect/floor_decal/corner/brown/bordercorner2{ - dir = 5 + dir = 1 }, /turf/simulated/floor/tiled, /area/quartermaster/foyer) "lbI" = ( -/obj/effect/floor_decal/steeldecal/steel_decals4{ - dir = 6 - }, -/obj/effect/floor_decal/steeldecal/steel_decals4{ - dir = 1 - }, /obj/machinery/atmospherics/pipe/simple/hidden/supply{ dir = 4 }, @@ -24789,8 +24905,6 @@ icon_state = "pipe-c" }, /obj/structure/cable/green{ - d1 = 4; - d2 = 8; icon_state = "4-8" }, /turf/simulated/floor/tiled, @@ -25077,6 +25191,19 @@ /area/tcomsat{ name = "\improper Telecomms Lobby" }) +"lsb" = ( +/obj/effect/floor_decal/borderfloor{ + dir = 8 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 8 + }, +/obj/structure/table/standard, +/obj/machinery/light{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/quartermaster/office) "lsw" = ( /obj/structure/table/rack, /obj/item/weapon/handcuffs, @@ -25492,12 +25619,19 @@ /turf/simulated/floor/tiled, /area/shuttle/medivac/general) "lJN" = ( -/obj/machinery/disposal, -/obj/structure/disposalpipe/trunk, -/obj/machinery/newscaster{ - pixel_y = 32 +/obj/machinery/door/firedoor/glass, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 }, -/turf/simulated/floor/wood, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/door/airlock/mining{ + name = "Quartermaster"; + req_access = list(41); + req_one_access = list() + }, +/turf/simulated/floor/tiled/steel_grid, /area/quartermaster/qm) "lJZ" = ( /obj/structure/cable/cyan{ @@ -25761,6 +25895,10 @@ /obj/structure/closet/emcloset, /turf/simulated/floor/tiled, /area/engineering/engineering_airlock) +"lUP" = ( +/obj/structure/reagent_dispensers/watertank, +/turf/simulated/floor, +/area/maintenance/cargo) "lUV" = ( /obj/structure/table/rack{ dir = 8; @@ -25838,11 +25976,6 @@ "lZz" = ( /obj/item/toy/plushie/squid/blue, /obj/machinery/atmospherics/pipe/simple/hidden/supply, -/obj/structure/cable/green{ - d1 = 1; - d2 = 2; - icon_state = "1-2" - }, /turf/simulated/floor/grass, /area/quartermaster/qm) "mbB" = ( @@ -26212,20 +26345,14 @@ /turf/simulated/floor/tiled, /area/hallway/station/docks) "mBY" = ( -/obj/machinery/door/firedoor/glass, /obj/machinery/atmospherics/pipe/simple/hidden/supply{ dir = 4 }, /obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ dir = 8 }, -/obj/machinery/door/airlock/mining{ - name = "Quartermaster"; - req_access = list(41); - req_one_access = list() - }, -/turf/simulated/floor/tiled/steel_grid, -/area/quartermaster/qm) +/turf/simulated/floor/tiled, +/area/quartermaster/foyer) "mCI" = ( /obj/machinery/atmospherics/pipe/simple/hidden/supply{ dir = 8 @@ -26711,16 +26838,31 @@ /turf/simulated/floor/tiled/steel, /area/shuttle/excursion/general) "nbO" = ( -/obj/structure/disposalpipe/segment{ - dir = 1; - icon_state = "pipe-c" - }, -/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ - dir = 6 - }, /obj/machinery/atmospherics/pipe/simple/hidden/supply{ dir = 10 }, +/obj/structure/disposalpipe/segment, +/obj/effect/floor_decal/borderfloor{ + dir = 4 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 4 + }, +/obj/effect/floor_decal/borderfloor/corner2{ + dir = 5 + }, +/obj/effect/floor_decal/corner/brown/bordercorner2{ + dir = 5 + }, +/obj/machinery/power/apc{ + dir = 4; + name = "east bump"; + pixel_x = 28 + }, +/obj/structure/cable/green{ + d2 = 2; + icon_state = "0-2" + }, /turf/simulated/floor/tiled, /area/quartermaster/delivery) "nct" = ( @@ -27059,12 +27201,25 @@ /turf/simulated/floor/tiled, /area/tether/station/dock_two) "nsz" = ( -/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ - dir = 8 - }, /obj/machinery/atmospherics/pipe/simple/hidden/supply{ dir = 5 }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers{ + dir = 1 + }, +/obj/structure/disposalpipe/segment{ + dir = 1; + icon_state = "pipe-c" + }, +/obj/structure/cable/green{ + d1 = 1; + d2 = 4; + icon_state = "1-4" + }, +/obj/effect/floor_decal/steeldecal/steel_decals4, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 10 + }, /turf/simulated/floor/tiled, /area/quartermaster/delivery) "nsH" = ( @@ -27105,12 +27260,12 @@ /turf/simulated/floor/tiled, /area/tether/station/dock_two) "nvM" = ( -/obj/machinery/light{ - dir = 4 - }, -/obj/structure/extinguisher_cabinet{ - pixel_x = 25 +/obj/structure/table/standard, +/obj/item/weapon/paper_bin{ + pixel_x = -3; + pixel_y = 7 }, +/obj/item/device/megaphone, /turf/simulated/floor/wood, /area/quartermaster/qm) "nwK" = ( @@ -27483,7 +27638,6 @@ /obj/structure/railing{ dir = 8 }, -/obj/structure/railing, /obj/effect/floor_decal/rust, /obj/random/maintenance/cargo, /obj/random/maintenance/cargo, @@ -27562,14 +27716,18 @@ /turf/space, /area/space) "nWo" = ( -/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ - dir = 10 - }, /obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/effect/floor_decal/steeldecal/steel_decals4, +/obj/effect/floor_decal/steeldecal/steel_decals4{ dir = 10 }, -/turf/simulated/floor/wood, -/area/quartermaster/qm) +/turf/simulated/floor/tiled, +/area/quartermaster/foyer) "nYA" = ( /obj/structure/grille, /obj/structure/window/reinforced/full, @@ -27581,6 +27739,9 @@ /turf/simulated/floor/tiled, /area/maintenance/cargo) "nZQ" = ( +/obj/machinery/light{ + dir = 8 + }, /turf/simulated/floor/grass, /area/quartermaster/qm) "oaR" = ( @@ -27611,13 +27772,21 @@ /obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ dir = 4 }, +/obj/structure/disposalpipe/segment{ + dir = 8; + icon_state = "pipe-c" + }, /obj/structure/cable/green{ - d1 = 4; - d2 = 8; icon_state = "4-8" }, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 6 + }, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 1 + }, /turf/simulated/floor/tiled, -/area/quartermaster/delivery) +/area/quartermaster/office) "obA" = ( /obj/machinery/suit_storage_unit/standard_unit, /obj/effect/floor_decal/industrial/outline/grey, @@ -27683,12 +27852,8 @@ /turf/simulated/floor/tiled/white, /area/tether/exploration/hallway) "ogK" = ( -/obj/structure/table/standard, -/obj/item/weapon/paper_bin{ - pixel_x = -3; - pixel_y = 7 - }, -/obj/item/device/megaphone, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, +/obj/machinery/atmospherics/pipe/simple/hidden/supply, /turf/simulated/floor/wood, /area/quartermaster/qm) "ohc" = ( @@ -27898,6 +28063,16 @@ }, /turf/simulated/floor, /area/storage/tech) +"owT" = ( +/obj/machinery/photocopier, +/obj/effect/floor_decal/borderfloor{ + dir = 1 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/quartermaster/office) "oxa" = ( /obj/effect/shuttle_landmark{ base_area = /area/space; @@ -28027,8 +28202,6 @@ icon_state = "1-4" }, /obj/structure/cable/green{ - d1 = 4; - d2 = 8; icon_state = "4-8" }, /turf/simulated/floor/tiled, @@ -28051,18 +28224,10 @@ /turf/simulated/floor/tiled, /area/gateway/prep_room) "oGI" = ( -/obj/structure/table/standard, -/obj/item/weapon/coin/silver, -/obj/item/weapon/coin/silver, -/obj/item/weapon/cartridge/quartermaster{ - pixel_x = 6; - pixel_y = 5 +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 8 }, -/obj/item/weapon/cartridge/quartermaster{ - pixel_x = -4; - pixel_y = 7 - }, -/obj/item/weapon/cartridge/quartermaster, /turf/simulated/floor/wood, /area/quartermaster/qm) "oIV" = ( @@ -28090,9 +28255,11 @@ /turf/simulated/floor/tiled/dark, /area/tether/station/dock_one) "oKz" = ( -/obj/structure/frame, -/turf/simulated/floor, -/area/maintenance/cargo) +/obj/effect/floor_decal/borderfloor, +/obj/effect/floor_decal/corner/brown/border, +/obj/structure/flora/pottedplant/stoutbush, +/turf/simulated/floor/tiled, +/area/quartermaster/office) "oMQ" = ( /obj/machinery/atmospherics/pipe/manifold4w/hidden/supply, /obj/machinery/atmospherics/pipe/manifold4w/hidden/scrubbers, @@ -28105,9 +28272,7 @@ /area/quartermaster/storage) "oQe" = ( /obj/machinery/atmospherics/pipe/simple/hidden/supply, -/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ - dir = 5 - }, +/obj/machinery/atmospherics/pipe/manifold/hidden/scrubbers, /turf/simulated/floor/tiled, /area/quartermaster/office) "oRf" = ( @@ -28129,6 +28294,10 @@ /obj/structure/flora/pottedplant/stoutbush, /turf/simulated/floor/tiled, /area/tether/station/dock_two) +"oRj" = ( +/obj/effect/landmark/stardog, +/turf/simulated/floor, +/area/maintenance/station/eng_lower) "oRC" = ( /obj/machinery/light/small{ dir = 8 @@ -28219,36 +28388,14 @@ /turf/simulated/floor/tiled, /area/hallway/station/docks) "oYq" = ( -/obj/structure/table/steel, -/obj/item/weapon/storage/box, -/obj/item/weapon/storage/box, -/obj/item/weapon/storage/box, -/obj/item/device/destTagger{ - pixel_x = 4; - pixel_y = 3 +/obj/machinery/light{ + dir = 4 }, -/obj/item/weapon/wrapping_paper, -/obj/item/weapon/wrapping_paper, -/obj/item/weapon/wrapping_paper, -/obj/item/weapon/wrapping_paper, -/obj/item/weapon/packageWrap, -/obj/item/weapon/packageWrap, -/obj/item/weapon/packageWrap, -/obj/item/weapon/packageWrap, -/obj/effect/floor_decal/borderfloor{ - dir = 6 +/obj/structure/extinguisher_cabinet{ + pixel_x = 25 }, -/obj/effect/floor_decal/corner/brown/border{ - dir = 6 - }, -/obj/effect/floor_decal/borderfloor/corner2{ - dir = 6 - }, -/obj/effect/floor_decal/corner/brown/bordercorner2{ - dir = 6 - }, -/turf/simulated/floor/tiled, -/area/quartermaster/delivery) +/turf/simulated/floor/wood, +/area/quartermaster/qm) "oYN" = ( /obj/structure/cable/green{ d1 = 4; @@ -28274,19 +28421,12 @@ /turf/simulated/floor, /area/storage/tech) "oZy" = ( -/obj/effect/floor_decal/borderfloor{ - dir = 1 - }, -/obj/effect/floor_decal/corner/brown/border{ - dir = 1 - }, /obj/machinery/atmospherics/pipe/simple/hidden/supply{ dir = 6 }, /obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ dir = 6 }, -/obj/structure/table/standard, /turf/simulated/floor/tiled, /area/quartermaster/office) "pbJ" = ( @@ -28329,6 +28469,10 @@ }, /turf/simulated/floor, /area/maintenance/cargo) +"pda" = ( +/obj/structure/disposalpipe/segment, +/turf/simulated/mineral/vacuum, +/area/mine/explored/upper_level) "pfh" = ( /obj/machinery/atmospherics/pipe/simple/hidden{ dir = 4 @@ -28623,12 +28767,10 @@ name = "\improper Telecomms Entrance" }) "pGq" = ( -/obj/effect/floor_decal/borderfloor/corner{ - dir = 1 - }, -/obj/effect/floor_decal/corner/brown/bordercorner{ - dir = 1 +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 4 }, +/obj/structure/disposalpipe/segment, /turf/simulated/floor/tiled, /area/quartermaster/office) "pGr" = ( @@ -28644,7 +28786,10 @@ /turf/simulated/floor/plating, /area/maintenance/station/cargo) "pJm" = ( -/obj/machinery/hologram/holopad, +/obj/structure/disposalpipe/segment, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, /turf/simulated/floor/wood, /area/quartermaster/qm) "pJT" = ( @@ -28693,14 +28838,10 @@ dir = 1 }, /obj/machinery/atmospherics/pipe/simple/hidden/supply, -/obj/structure/cable/green{ - d1 = 1; - d2 = 2; - icon_state = "1-2" - }, /obj/effect/floor_decal/spline/fancy/wood{ dir = 1 }, +/obj/structure/curtain/open/privacy, /turf/simulated/floor/grass, /area/quartermaster/qm) "pOQ" = ( @@ -28792,20 +28933,13 @@ /obj/machinery/atmospherics/pipe/simple/hidden, /turf/simulated/floor/tiled, /area/tether/station/dock_two) -"pTu" = ( -/obj/machinery/atmospherics/pipe/simple/hidden/supply{ - dir = 4 - }, -/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ - dir = 8 - }, -/obj/structure/cable/green{ - d1 = 4; - d2 = 8; - icon_state = "4-8" - }, -/turf/simulated/floor/tiled, -/area/quartermaster/office) +"pVd" = ( +/obj/structure/table/standard, +/obj/random/maintenance/medical, +/obj/random/plushie, +/obj/random/maintenance/cargo, +/turf/simulated/floor, +/area/maintenance/cargo) "pXr" = ( /obj/machinery/light, /obj/structure/cable/green{ @@ -28915,6 +29049,16 @@ "qdM" = ( /turf/simulated/wall, /area/tether/station/dock_one) +"qdV" = ( +/obj/effect/floor_decal/borderfloor{ + dir = 10 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 10 + }, +/obj/structure/table/standard, +/turf/simulated/floor/tiled, +/area/quartermaster/office) "qer" = ( /obj/structure/cable/green{ d1 = 1; @@ -29025,15 +29169,25 @@ dir = 8 }, /obj/structure/disposalpipe/segment, +/obj/effect/floor_decal/borderfloor, +/obj/effect/floor_decal/corner/brown/border, +/obj/effect/floor_decal/borderfloor/corner2{ + dir = 9 + }, +/obj/effect/floor_decal/corner/brown/bordercorner2{ + dir = 9 + }, +/obj/structure/window/reinforced{ + dir = 4 + }, /turf/simulated/floor/tiled, /area/quartermaster/foyer) "qmO" = ( -/obj/structure/railing{ +/obj/structure/bed/chair/office/dark{ dir = 1 }, -/obj/effect/floor_decal/rust, -/turf/simulated/floor, -/area/maintenance/cargo) +/turf/simulated/floor/tiled, +/area/quartermaster/office) "qnL" = ( /obj/structure/catwalk, /obj/machinery/alarm{ @@ -29205,6 +29359,10 @@ /obj/machinery/atmospherics/pipe/simple/hidden/supply, /turf/simulated/floor/tiled, /area/engineering/hallway) +"qsQ" = ( +/obj/structure/disposalpipe/segment, +/turf/simulated/mineral/floor/vacuum, +/area/mine/explored/upper_level) "qsV" = ( /obj/machinery/atmospherics/pipe/simple/hidden/black{ dir = 4 @@ -29326,31 +29484,30 @@ /turf/simulated/floor/tiled, /area/tether/station/dock_two) "qCY" = ( +/obj/structure/disposalpipe/segment, /obj/effect/floor_decal/borderfloor{ - dir = 1 + dir = 9 }, /obj/effect/floor_decal/corner/brown/border{ + dir = 9 + }, +/obj/effect/floor_decal/borderfloor/corner2{ + dir = 10 + }, +/obj/effect/floor_decal/corner/brown/bordercorner2{ + dir = 10 + }, +/obj/machinery/light{ + dir = 8 + }, +/obj/effect/floor_decal/borderfloor/corner2{ dir = 1 }, -/obj/structure/disposalpipe/segment{ - dir = 8; - icon_state = "pipe-c" +/obj/effect/floor_decal/corner/brown/bordercorner2{ + dir = 1 }, -/obj/machinery/atmospherics/unary/vent_pump/siphon/on/atmos{ - dir = 8; - external_pressure_bound = 101.3; - external_pressure_bound_default = 101.3; - pressure_checks = 1; - pressure_checks_default = 1 - }, -/obj/structure/table/steel, -/obj/item/weapon/pen{ - pixel_x = 4; - pixel_y = 4 - }, -/obj/item/weapon/folder/yellow, /turf/simulated/floor/tiled, -/area/quartermaster/delivery) +/area/quartermaster/office) "qDS" = ( /obj/structure/cable{ d1 = 1; @@ -29546,23 +29703,11 @@ /turf/simulated/floor, /area/maintenance/station/eng_lower) "qPV" = ( -/obj/machinery/requests_console{ - department = "Cargo Bay"; - departmentType = 2; - dir = 4; - pixel_x = -32; - pixel_y = 30 - }, -/obj/machinery/autolathe, -/obj/effect/floor_decal/borderfloor{ - dir = 8 - }, -/obj/effect/floor_decal/corner/brown/border{ - dir = 8 - }, -/obj/machinery/camera/network/cargo{ +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ dir = 4 }, +/obj/effect/floor_decal/industrial/outline/yellow, +/obj/effect/landmark/vermin, /turf/simulated/floor/tiled, /area/quartermaster/office) "qQt" = ( @@ -29573,9 +29718,7 @@ /turf/simulated/floor/tiled, /area/quartermaster/belterdock/refinery) "qQG" = ( -/obj/machinery/atmospherics/pipe/simple/hidden/supply{ - dir = 5 - }, +/obj/machinery/atmospherics/pipe/manifold/hidden/supply, /turf/simulated/floor/tiled, /area/quartermaster/office) "qSM" = ( @@ -29610,6 +29753,13 @@ }, /turf/simulated/floor/tiled/milspec, /area/tether/exploration/pilot_office) +"qUd" = ( +/obj/structure/disposaloutlet, +/obj/structure/disposalpipe/trunk{ + dir = 4 + }, +/turf/simulated/mineral/floor/vacuum, +/area/mine/explored/upper_level) "qVz" = ( /obj/effect/floor_decal/steeldecal/steel_decals7{ dir = 1 @@ -29643,10 +29793,21 @@ /turf/simulated/floor/tiled, /area/quartermaster/belterdock/gear) "qWq" = ( -/obj/effect/floor_decal/borderfloor/corner, -/obj/effect/floor_decal/corner/brown/bordercorner, +/obj/effect/floor_decal/borderfloor{ + dir = 8 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 8 + }, +/obj/effect/floor_decal/borderfloor/corner2{ + dir = 8 + }, +/obj/effect/floor_decal/corner/brown/bordercorner2{ + dir = 8 + }, +/obj/structure/table/standard, /turf/simulated/floor/tiled, -/area/quartermaster/delivery) +/area/quartermaster/office) "qWN" = ( /obj/structure/cable/green{ icon_state = "4-8" @@ -30064,12 +30225,9 @@ /turf/simulated/floor/tiled, /area/quartermaster/belterdock/gear) "rxW" = ( -/obj/structure/railing{ - dir = 1 - }, -/obj/random/trash_pile, -/turf/simulated/floor, -/area/maintenance/cargo) +/obj/machinery/status_display/supply_display, +/turf/simulated/wall, +/area/quartermaster/delivery) "rzz" = ( /obj/machinery/alarm{ dir = 1; @@ -30149,8 +30307,19 @@ /turf/simulated/floor/wood/broken, /area/maintenance/station/cargo) "rIt" = ( -/obj/machinery/status_display/supply_display, -/turf/simulated/wall, +/obj/effect/floor_decal/borderfloor{ + dir = 1 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 1 + }, +/obj/effect/floor_decal/borderfloor/corner2{ + dir = 4 + }, +/obj/effect/floor_decal/corner/brown/bordercorner2{ + dir = 4 + }, +/turf/simulated/floor/tiled, /area/quartermaster/office) "rIA" = ( /obj/machinery/light{ @@ -30198,11 +30367,18 @@ name = "\improper Telecomms Entrance" }) "rKX" = ( -/obj/structure/railing{ - dir = 1 +/obj/effect/floor_decal/borderfloor{ + dir = 8 }, -/turf/simulated/floor, -/area/maintenance/cargo) +/obj/machinery/firealarm{ + dir = 8; + pixel_x = -24 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 8 + }, +/turf/simulated/floor/tiled, +/area/quartermaster/office) "rLI" = ( /turf/simulated/floor/bluegrid{ name = "Mainframe Base"; @@ -30304,6 +30480,18 @@ }, /turf/simulated/floor/tiled, /area/tether/station/dock_one) +"rSD" = ( +/obj/structure/cable{ + icon_state = "1-2" + }, +/obj/machinery/atmospherics/pipe/simple/hidden, +/obj/effect/floor_decal/fancy_shuttle{ + fancy_shuttle_tag = "secbus"; + name = "secbus" + }, +/obj/effect/landmark/stardog, +/turf/simulated/floor/tiled, +/area/shuttle/securiship/general) "rSX" = ( /obj/machinery/atmospherics/pipe/simple/hidden{ dir = 4 @@ -30369,7 +30557,11 @@ /turf/simulated/floor/tiled/steel, /area/shuttle/excursion/general) "rWm" = ( -/obj/machinery/computer/supplycomp/control, +/obj/machinery/disposal, +/obj/structure/disposalpipe/trunk, +/obj/machinery/newscaster{ + pixel_y = 32 + }, /turf/simulated/floor/wood, /area/quartermaster/qm) "rWL" = ( @@ -30566,10 +30758,7 @@ /turf/simulated/floor/tiled, /area/shuttle/securiship/cockpit) "scE" = ( -/obj/structure/disposalpipe/segment, -/obj/structure/bed/chair/office/dark{ - dir = 4 - }, +/obj/machinery/hologram/holopad, /turf/simulated/floor/wood, /area/quartermaster/qm) "seg" = ( @@ -30609,20 +30798,37 @@ /turf/simulated/floor/tiled, /area/tether/station/dock_one) "sgp" = ( -/obj/structure/grille, -/obj/machinery/door/firedoor/glass, -/obj/structure/window/reinforced/polarized/full{ - id = "qm_office" +/obj/effect/floor_decal/borderfloor{ + dir = 8 }, -/turf/simulated/floor/plating, +/obj/effect/floor_decal/corner/brown/border{ + dir = 8 + }, +/obj/machinery/disposal/wall{ + dir = 4 + }, +/obj/structure/disposalpipe/trunk, +/obj/structure/table/standard, +/turf/simulated/floor/tiled, /area/quartermaster/office) "sgS" = ( -/obj/structure/table/standard, -/obj/random/maintenance/medical, -/obj/random/plushie, -/obj/random/maintenance/cargo, -/turf/simulated/floor, -/area/maintenance/cargo) +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/effect/floor_decal/industrial/outline/yellow, +/obj/structure/closet/crate, +/turf/simulated/floor/tiled, +/area/quartermaster/office) +"shO" = ( +/obj/machinery/computer/stockexchange, +/obj/effect/floor_decal/borderfloor{ + dir = 1 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/quartermaster/office) "shZ" = ( /obj/structure/table/standard, /obj/machinery/recharger, @@ -30650,42 +30856,17 @@ /turf/simulated/floor/tiled, /area/engineering/hallway) "sjc" = ( -/obj/machinery/power/apc{ - dir = 1; - name = "north bump"; - pixel_y = 28 - }, -/obj/effect/floor_decal/borderfloor{ - dir = 1 - }, -/obj/effect/floor_decal/corner/brown/border{ - dir = 1 - }, -/obj/structure/disposalpipe/segment{ - dir = 4 - }, -/obj/effect/floor_decal/borderfloor/corner2{ - dir = 4 - }, -/obj/effect/floor_decal/corner/brown/bordercorner2{ - dir = 4 - }, -/obj/machinery/atmospherics/pipe/simple/hidden/universal{ - dir = 4 - }, -/obj/machinery/conveyor_switch/oneway{ - id = "crate-belt" - }, -/obj/structure/cable/green{ - d2 = 2; - icon_state = "0-2" +/obj/machinery/button/windowtint{ + id = "qm_office"; + pixel_x = 26; + pixel_y = 8 }, /obj/machinery/light_switch{ - pixel_x = 12; - pixel_y = 30 + dir = 8; + pixel_x = 24 }, -/turf/simulated/floor/tiled, -/area/quartermaster/delivery) +/turf/simulated/floor/wood, +/area/quartermaster/qm) "smd" = ( /obj/machinery/door/firedoor/glass, /obj/machinery/door/airlock/maintenance/common{ @@ -30786,8 +30967,28 @@ /obj/effect/floor_decal/steeldecal/steel_decals4{ dir = 4 }, +/obj/effect/floor_decal/borderfloor{ + dir = 1 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 1 + }, +/obj/structure/table/standard, +/obj/item/weapon/paper_bin{ + pixel_x = -3; + pixel_y = 7 + }, +/obj/item/weapon/clipboard, +/obj/item/weapon/pen/red{ + pixel_x = 2; + pixel_y = 6 + }, /turf/simulated/floor/tiled, /area/quartermaster/office) +"stu" = ( +/obj/machinery/light_construct/small, +/turf/simulated/floor, +/area/maintenance/cargo) "stC" = ( /obj/machinery/door/firedoor/glass, /obj/structure/grille, @@ -30904,6 +31105,10 @@ /obj/structure/disposalpipe/segment{ dir = 4 }, +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 10 + }, +/obj/effect/floor_decal/steeldecal/steel_decals4, /turf/simulated/floor/tiled, /area/quartermaster/office) "sBQ" = ( @@ -31157,6 +31362,12 @@ }, /turf/space, /area/space) +"sMB" = ( +/obj/machinery/atmospherics/unary/vent_pump/on{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/quartermaster/office) "sMU" = ( /obj/structure/cable/green{ d1 = 4; @@ -31308,24 +31519,15 @@ /turf/simulated/floor/reinforced, /area/tether/exploration) "sVp" = ( -/obj/effect/floor_decal/borderfloor{ - dir = 5 - }, -/obj/effect/floor_decal/corner/brown/border{ - dir = 5 - }, /obj/structure/disposalpipe/segment, -/obj/effect/floor_decal/borderfloor/corner2{ - dir = 5 +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 9 }, -/obj/effect/floor_decal/corner/brown/bordercorner2{ - dir = 5 - }, -/obj/structure/bed/chair/office/dark{ - dir = 8 +/obj/effect/floor_decal/steeldecal/steel_decals4{ + dir = 4 }, /turf/simulated/floor/tiled, -/area/quartermaster/delivery) +/area/quartermaster/office) "sVz" = ( /obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, /obj/machinery/atmospherics/pipe/simple/hidden/supply, @@ -31338,6 +31540,19 @@ /obj/structure/firedoor_assembly, /turf/simulated/floor/tiled, /area/maintenance/cargo) +"sVB" = ( +/obj/effect/floor_decal/borderfloor{ + dir = 1 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 1 + }, +/obj/structure/table/standard, +/obj/machinery/light{ + dir = 1 + }, +/turf/simulated/floor/tiled, +/area/quartermaster/office) "sVZ" = ( /obj/structure/cable{ d1 = 4; @@ -31365,9 +31580,9 @@ /turf/simulated/floor/tiled/dark, /area/gateway/prep_room) "sYe" = ( -/obj/machinery/computer/security/mining, -/obj/structure/sign/painting/library_secure{ - pixel_x = 30 +/obj/structure/table/standard, +/obj/machinery/photocopier/faxmachine{ + department = "Quartermaster-Office" }, /turf/simulated/floor/wood, /area/quartermaster/qm) @@ -31421,11 +31636,9 @@ /turf/simulated/floor/tiled, /area/shuttle/securiship/cockpit) "tcS" = ( +/obj/structure/disposalpipe/segment, /obj/structure/bed/chair/office/dark{ - dir = 8 - }, -/obj/effect/landmark/start{ - name = "Quartermaster" + dir = 4 }, /turf/simulated/floor/wood, /area/quartermaster/qm) @@ -31528,6 +31741,7 @@ icon_state = "1-2" }, /obj/structure/catwalk, +/obj/machinery/door/airlock/maintenance/common, /turf/simulated/floor, /area/maintenance/station/cargo) "thI" = ( @@ -31652,28 +31866,27 @@ /obj/effect/floor_decal/corner/brown/border{ dir = 1 }, -/obj/effect/floor_decal/borderfloor/corner2{ - dir = 4 - }, -/obj/effect/floor_decal/corner/brown/bordercorner2{ - dir = 4 - }, /obj/item/weapon/stamp/accepted, +/obj/machinery/requests_console{ + department = "Cargo Bay"; + departmentType = 2; + pixel_y = 32 + }, /turf/simulated/floor/tiled, /area/quartermaster/office) "tos" = ( +/obj/effect/floor_decal/borderfloor{ + dir = 8 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 8 + }, +/obj/structure/table/standard, /obj/machinery/photocopier/faxmachine{ department = "Mailing-Room" }, -/obj/structure/table/steel, -/obj/effect/floor_decal/borderfloor{ - dir = 6 - }, -/obj/effect/floor_decal/corner/brown/border{ - dir = 6 - }, /turf/simulated/floor/tiled, -/area/quartermaster/delivery) +/area/quartermaster/office) "toy" = ( /obj/structure/symbol/lo{ pixel_y = 32 @@ -31687,12 +31900,6 @@ /turf/simulated/shuttle/floor/yellow/airless, /area/shuttle/belter) "tpj" = ( -/obj/effect/floor_decal/borderfloor/corner{ - dir = 1 - }, -/obj/effect/floor_decal/corner/brown/bordercorner{ - dir = 1 - }, /obj/machinery/atmospherics/pipe/simple/hidden/supply{ dir = 4 }, @@ -31895,6 +32102,11 @@ }, /turf/simulated/floor/tiled, /area/shuttle/medivac/general) +"tBb" = ( +/obj/machinery/door/airlock/maintenance/common, +/obj/machinery/door/firedoor/glass, +/turf/simulated/floor, +/area/maintenance/cargo) "tBl" = ( /obj/structure/closet/emcloset, /obj/effect/floor_decal/borderfloor{ @@ -31942,26 +32154,25 @@ /turf/simulated/floor/tiled/white, /area/tether/station/dock_two) "tCA" = ( -/obj/structure/disposalpipe/segment{ - dir = 8; - icon_state = "pipe-c" - }, -/obj/machinery/atmospherics/pipe/simple/hidden/supply{ - dir = 5 - }, -/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ - dir = 5 - }, -/obj/machinery/alarm{ - dir = 1; - pixel_y = -22 - }, /obj/structure/cable/green{ - d1 = 4; - d2 = 8; icon_state = "4-8" }, -/turf/simulated/floor/wood, +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ + dir = 8 + }, +/obj/machinery/door/airlock/mining{ + name = "Quartermaster"; + req_access = list(41); + req_one_access = list() + }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/door/firedoor/glass, +/turf/simulated/floor/tiled/steel_grid, /area/quartermaster/qm) "tCY" = ( /obj/structure/cable{ @@ -31996,6 +32207,24 @@ }, /turf/simulated/floor/tiled/white, /area/tether/station/dock_two) +"tEh" = ( +/obj/machinery/door/airlock/maintenance/cargo{ + req_access = list(50); + req_one_access = list(48) + }, +/obj/machinery/door/firedoor/glass, +/turf/simulated/floor, +/area/quartermaster/office) +"tFD" = ( +/obj/effect/floor_decal/borderfloor{ + dir = 1 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 1 + }, +/obj/structure/table/standard, +/turf/simulated/floor/tiled, +/area/quartermaster/office) "tFR" = ( /obj/random/junk, /obj/random/junk, @@ -32254,16 +32483,6 @@ }, /turf/simulated/floor/tiled, /area/shuttle/securiship/general) -"tOp" = ( -/obj/structure/disposalpipe/segment, -/obj/effect/floor_decal/borderfloor{ - dir = 8 - }, -/obj/effect/floor_decal/corner/brown/border{ - dir = 8 - }, -/turf/simulated/floor/tiled, -/area/quartermaster/office) "tOr" = ( /obj/structure/cable{ icon_state = "2-8" @@ -32302,15 +32521,20 @@ /turf/simulated/wall, /area/maintenance/cargo) "tVq" = ( -/obj/structure/railing{ - dir = 1 +/obj/structure/table/standard, +/obj/item/weapon/coin/silver, +/obj/item/weapon/coin/silver, +/obj/item/weapon/cartridge/quartermaster{ + pixel_x = 6; + pixel_y = 5 }, -/obj/machinery/firealarm{ - dir = 1; - pixel_y = -24 +/obj/item/weapon/cartridge/quartermaster{ + pixel_x = -4; + pixel_y = 7 }, -/turf/simulated/floor, -/area/maintenance/cargo) +/obj/item/weapon/cartridge/quartermaster, +/turf/simulated/floor/wood, +/area/quartermaster/qm) "tVZ" = ( /obj/effect/floor_decal/rust, /obj/structure/closet/emcloset, @@ -32327,22 +32551,17 @@ /turf/simulated/floor, /area/maintenance/station/exploration) "tWj" = ( -/obj/structure/cable/green{ - icon_state = "4-8" - }, /obj/machinery/atmospherics/pipe/simple/hidden/supply{ dir = 4 }, /obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ dir = 8 }, -/obj/structure/grille, -/obj/structure/window/reinforced/polarized/full{ - id = "qm_office" +/obj/structure/cable/green{ + icon_state = "4-8" }, -/obj/machinery/door/firedoor/glass, /turf/simulated/floor/tiled, -/area/quartermaster/qm) +/area/quartermaster/office) "tWo" = ( /obj/structure/disposalpipe/segment, /obj/structure/cable{ @@ -32568,6 +32787,13 @@ /obj/structure/catwalk, /turf/simulated/floor, /area/maintenance/station/eng_lower) +"ulC" = ( +/obj/structure/railing{ + dir = 1 + }, +/obj/random/trash_pile, +/turf/simulated/floor, +/area/maintenance/station/cargo) "uno" = ( /obj/machinery/status_display/supply_display, /turf/simulated/wall, @@ -32675,6 +32901,12 @@ }, /turf/simulated/floor/tiled, /area/shuttle/medivac/engines) +"uxm" = ( +/obj/machinery/atmospherics/unary/vent_scrubber/on{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/quartermaster/office) "uxR" = ( /obj/structure/disposalpipe/segment, /obj/structure/cable{ @@ -32851,15 +33083,14 @@ /turf/simulated/floor/tiled, /area/shuttle/medivac/general) "uLo" = ( -/obj/machinery/door/airlock/glass_mining{ - id_tag = "cargodoor"; - name = "Cargo Office"; - req_access = list(31); - req_one_access = list() +/obj/machinery/newscaster{ + pixel_x = 28 }, -/obj/machinery/door/firedoor/glass, -/turf/simulated/floor/tiled/steel_grid, -/area/quartermaster/office) +/obj/machinery/camera/network/cargo{ + dir = 8 + }, +/turf/simulated/floor/wood, +/area/quartermaster/qm) "uLr" = ( /obj/machinery/door/airlock/glass_external, /obj/effect/map_helper/airlock/door/ext_door, @@ -32901,22 +33132,6 @@ /obj/random/trash_pile, /turf/simulated/floor, /area/maintenance/station/cargo) -"uMR" = ( -/obj/effect/floor_decal/borderfloor{ - dir = 8 - }, -/obj/effect/floor_decal/corner/brown/border{ - dir = 8 - }, -/obj/machinery/firealarm{ - dir = 8; - pixel_x = -24 - }, -/obj/structure/bed/chair/office/dark{ - dir = 1 - }, -/turf/simulated/floor/tiled, -/area/quartermaster/office) "uOm" = ( /obj/effect/floor_decal/industrial/hatch/yellow, /obj/machinery/door/airlock/glass_external, @@ -33204,18 +33419,13 @@ /turf/simulated/floor/tiled, /area/hallway/station/docks) "vcy" = ( -/obj/effect/floor_decal/borderfloor{ - dir = 8 +/obj/structure/cable/green{ + d1 = 2; + d2 = 8; + icon_state = "2-8" }, -/obj/effect/floor_decal/corner/brown/border{ - dir = 8 - }, -/obj/structure/disposalpipe/trunk{ - dir = 4 - }, -/obj/machinery/disposal, -/turf/simulated/floor/tiled, -/area/quartermaster/office) +/turf/simulated/floor/wood, +/area/quartermaster/qm) "vcG" = ( /obj/structure/cable/green{ icon_state = "4-8" @@ -33285,9 +33495,19 @@ /turf/simulated/floor/tiled, /area/shuttle/securiship/general) "vez" = ( -/obj/structure/reagent_dispensers/watertank, -/turf/simulated/floor, -/area/maintenance/cargo) +/obj/effect/floor_decal/borderfloor{ + dir = 8 + }, +/obj/effect/floor_decal/corner/brown/border{ + dir = 8 + }, +/obj/machinery/camera/network/cargo{ + dir = 4 + }, +/obj/structure/table/standard, +/obj/fiftyspawner/steel, +/turf/simulated/floor/tiled, +/area/quartermaster/office) "veJ" = ( /turf/simulated/shuttle/floor/yellow, /area/shuttle/mining_outpost/shuttle) @@ -33859,8 +34079,7 @@ /turf/simulated/floor/tiled, /area/tether/station/dock_one) "vRI" = ( -/obj/machinery/status_display/supply_display, -/turf/simulated/wall, +/turf/simulated/floor/wood, /area/quartermaster/qm) "vSz" = ( /obj/effect/floor_decal/industrial/warning/corner, @@ -34284,17 +34503,24 @@ }, /area/shuttle/securiship/engines) "wwR" = ( -/obj/structure/cable/green{ - d1 = 1; - d2 = 4; - icon_state = "1-4" - }, /obj/machinery/atmospherics/pipe/simple/hidden/supply{ dir = 4 }, /obj/machinery/atmospherics/pipe/simple/hidden/scrubbers{ dir = 4 }, +/obj/structure/disposalpipe/segment{ + dir = 4 + }, +/obj/machinery/door/firedoor/glass, +/obj/machinery/door/airlock/glass_mining{ + name = "Delivery Office"; + req_access = list(50); + req_one_access = list() + }, +/obj/structure/cable/green{ + icon_state = "4-8" + }, /turf/simulated/floor/tiled, /area/quartermaster/delivery) "wAC" = ( @@ -34626,6 +34852,13 @@ }, /turf/simulated/wall/r_wall, /area/hallway/station/docks) +"wRk" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/structure/disposalpipe/segment, +/turf/simulated/floor/tiled, +/area/quartermaster/office) "wRI" = ( /obj/structure/bed/chair/shuttle{ dir = 4 @@ -34765,10 +34998,6 @@ /turf/simulated/floor/tiled, /area/storage/tools) "xbp" = ( -/obj/effect/floor_decal/steeldecal/steel_decals4, -/obj/effect/floor_decal/steeldecal/steel_decals4{ - dir = 10 - }, /obj/structure/disposalpipe/segment{ dir = 1; icon_state = "pipe-c" @@ -34780,12 +35009,10 @@ dir = 4 }, /obj/structure/cable/green{ - d1 = 4; - d2 = 8; icon_state = "4-8" }, /turf/simulated/floor/tiled, -/area/quartermaster/delivery) +/area/quartermaster/office) "xbz" = ( /obj/structure/window/basic{ dir = 8 @@ -34859,31 +35086,13 @@ }, /area/shuttle/securiship/engines) "xfN" = ( -/obj/structure/flora/pottedplant/stoutbush, -/obj/effect/floor_decal/borderfloor{ - dir = 9 +/obj/machinery/power/apc{ + name = "south bump"; + pixel_y = -32 }, -/obj/effect/floor_decal/corner/brown/border{ - dir = 9 - }, -/turf/simulated/floor/tiled, -/area/quartermaster/office) -"xgj" = ( -/obj/structure/disposalpipe/segment, -/obj/effect/floor_decal/borderfloor{ - dir = 8 - }, -/obj/effect/floor_decal/corner/brown/border{ - dir = 8 - }, -/obj/effect/floor_decal/borderfloor/corner2{ - dir = 8 - }, -/obj/effect/floor_decal/corner/brown/bordercorner2{ - dir = 8 - }, -/turf/simulated/floor/tiled, -/area/quartermaster/office) +/obj/structure/cable/green, +/turf/simulated/floor/wood, +/area/quartermaster/qm) "xgD" = ( /obj/machinery/conveyor{ dir = 4; @@ -34909,6 +35118,13 @@ }, /turf/simulated/floor, /area/maintenance/station/cargo) +"xhx" = ( +/obj/machinery/atmospherics/pipe/simple/hidden/supply{ + dir = 4 + }, +/obj/effect/floor_decal/industrial/outline/yellow, +/turf/simulated/floor/tiled, +/area/quartermaster/office) "xiy" = ( /obj/structure/cable/green{ d1 = 4; @@ -35048,16 +35264,31 @@ /turf/simulated/floor, /area/maintenance/substation/exploration) "xuc" = ( -/obj/machinery/atmospherics/pipe/simple/hidden/scrubbers, /obj/structure/disposalpipe/segment{ dir = 2; icon_state = "pipe-c" }, -/obj/machinery/atmospherics/pipe/manifold/hidden/supply{ - dir = 8 +/obj/effect/floor_decal/borderfloor{ + dir = 5 }, -/turf/simulated/floor/wood, -/area/quartermaster/qm) +/obj/effect/floor_decal/corner/brown/border{ + dir = 5 + }, +/obj/effect/floor_decal/borderfloor/corner2{ + dir = 5 + }, +/obj/effect/floor_decal/corner/brown/bordercorner2{ + dir = 5 + }, +/obj/structure/filingcabinet/filingcabinet, +/obj/effect/floor_decal/borderfloor/corner2{ + dir = 4 + }, +/obj/effect/floor_decal/corner/brown/bordercorner2{ + dir = 4 + }, +/turf/simulated/floor/tiled, +/area/quartermaster/office) "xuf" = ( /obj/item/weapon/storage/box/lights/mixed, /obj/item/weapon/storage/box/mousetraps, @@ -35203,7 +35434,6 @@ /turf/simulated/floor/tiled, /area/quartermaster/belterdock/refinery) "xCd" = ( -/obj/effect/floor_decal/industrial/outline/yellow, /obj/structure/disposalpipe/segment{ dir = 4 }, @@ -35218,6 +35448,9 @@ /obj/effect/floor_decal/steeldecal/steel_decals4{ dir = 8 }, +/obj/effect/floor_decal/borderfloor, +/obj/effect/floor_decal/corner/brown/border, +/obj/effect/floor_decal/industrial/outline/yellow, /turf/simulated/floor/tiled, /area/quartermaster/foyer) "xCp" = ( @@ -35299,16 +35532,6 @@ /area/maintenance/station/cargo) "xIq" = ( /obj/structure/disposalpipe/segment, -/obj/effect/floor_decal/borderfloor{ - dir = 4 - }, -/obj/effect/floor_decal/corner/brown/border{ - dir = 4 - }, -/obj/machinery/light{ - dir = 4 - }, -/obj/structure/filingcabinet/filingcabinet, /turf/simulated/floor/tiled, /area/quartermaster/office) "xMk" = ( @@ -44110,7 +44333,7 @@ mKL nrg ack ach -ack +oRj jou mEA bVP @@ -44131,10 +44354,10 @@ oAn wMb wBw tUh -aac -aac -aac -aac +pVd +pVd +gIU +tUh aac aac aac @@ -44273,10 +44496,10 @@ wBw wBw kLG tUh -aac -aac -aac -aac +kLG +wBw +stu +tUh aac aac aac @@ -44416,7 +44639,7 @@ iss toy tUh tUh -tUh +tBb tUh tUh tUh @@ -44554,7 +44777,7 @@ rdE tWo rdE aya -rdE +tWo rdE aQi rdE @@ -44563,8 +44786,8 @@ ayA aQi aQi fvt -azv -bQF +bYr +ulC ieQ mnj uMz @@ -44700,7 +44923,7 @@ bnl ijv ivU nKT -wBw +lUP doi tyi ayP @@ -44838,13 +45061,13 @@ aAD aAD aAD aAD -xyw -tVq -tUh -tUh -hYT -tUh -tUh +tEh +azc +azc +azc +azc +azc +azc aAc eqw aEi @@ -44982,11 +45205,11 @@ sqz awI hsq rKX -tUh +jXk vez -wBw -wBw -tUh +lsb +qdV +azc qrU azo hFo @@ -45122,13 +45345,13 @@ rXp aAD aAD awJ -bnl +shO qmO -tUh -wBw -wBw +uxm +sMB +aAB fGL -tUh +azc eXD axE aAb @@ -45264,13 +45487,13 @@ avM awj iWA awK -bnl -rxW -tUh -sgS +owT +aAB +gpz sgS +aAB oKz -tUh +azc ayT kWQ azx @@ -45405,13 +45628,13 @@ nbO nsz awo iYG -aex -bnl -azc -azc -azc -azc -azc +aAD +sVB +aAB +gpz +xhx +aAB +fGL azc aBe azq @@ -45541,18 +45764,18 @@ adT aec aAD aeg -aeo aAD -sjc +rxW +aAD wwR jfP -awL -azc -azc -azc +jfP +aAD +tFD +aAB iqs qPV -vcy +aAB aBI azc azV @@ -45679,8 +45902,8 @@ tmf ioz hLg fxR -wnV -aVY +aeo +aex kUL atr atV @@ -45691,10 +45914,10 @@ qWq tos sgp aBo -uMR +xIq pGq -aAB -fMr +wRk +dXC shZ azc kNs @@ -45829,9 +46052,9 @@ aux aep sVp xbp -oYq -cCL -sgp +aAB +aAB +aAB oZy ngC oQe @@ -45968,12 +46191,12 @@ rgE qoD qCg auC -azc +yjH rIt aeu -aDR -sgp -xfN +aAB +aAB +aAB tpj aAB gDW @@ -46110,12 +46333,12 @@ eFl auj rrB xCd -uLo +yjH srC lbI -xgj -tOp -gVf +xIq +xIq +xIq vZr bKM vuu @@ -46254,7 +46477,7 @@ mkL iDA yjH tnC -pTu +tWj jhJ vJw ngC @@ -46540,7 +46763,7 @@ hUc ahg agx xIq -aBi +xIq dXC avl awN @@ -46675,14 +46898,14 @@ aaD azA kVK lvh -vRI +auj mBY -ayY +hYT chi ahj tWj -aBM -aBK +aAB +aAB mtY avr kXF @@ -46817,10 +47040,10 @@ aaD epv kVK lvh -ayY +azv nWo kum -iZJ +yjH xuc kPu aev @@ -46959,9 +47182,9 @@ aaD rUS kVK lvh -aBM +aBK lJN -scE +ayY hbv ahn tCA @@ -47243,7 +47466,7 @@ aaD epv kVK lvh -ayY +aBM rWm tcS pJm @@ -47385,7 +47608,7 @@ aaD kPM kVK tne -aBM +ayY sYe nvM afK @@ -47527,14 +47750,14 @@ aaD lzd aAy ttH -aBM -aBM -aBM -aBM -aBM -ayY -ayY ayY +aDR +iZJ +scE +tVq +vcy +xfN +aBM aBM aBM aBM @@ -47669,14 +47892,14 @@ fLT yak kMF saf -fLT -aaa -aaa -aaa -aaa -aaa -aaa -aaa +aBM +cCL +oYq +sjc +uLo +vRI +gOE +aBM aaa aaa awN @@ -47811,14 +48034,14 @@ fLT knX qMM qVz -fLT -aaa -aaa -aaa -aaa -aaa -aaa -aaa +aBM +aBM +aBM +aBM +aBM +ayY +ayY +aBM aaa aaa ahW @@ -48422,7 +48645,7 @@ cHa yiu yiu aac -aam +qUd aam aaa aaa @@ -48545,26 +48768,26 @@ asG asG fwY apW -aac -aac -aac -aac -aac -aac -aac -aac -aac -aac +pda +pda +pda +pda +pda +pda +pda +pda +pda +pda edF -aam -aam -aam -aam -aam -aam -aac -aac -aam +qsQ +qsQ +qsQ +qsQ +qsQ +qsQ +pda +pda +hQq aaa aaa aaa @@ -50098,7 +50321,7 @@ udG bnG kEt kEt -kEt +iOU gqN smd weP @@ -52795,7 +53018,7 @@ tOr iEn wLR iEn -iEn +rSD iVi fNX xMQ diff --git a/maps/tether/tether_defines.dm b/maps/tether/tether_defines.dm index 320c5f6a09..5e042c60ee 100644 --- a/maps/tether/tether_defines.dm +++ b/maps/tether/tether_defines.dm @@ -190,7 +190,6 @@ list(list("Honleth Highlands A", "Honleth Highlands B")), list("Arynthi Lake Underground A","Arynthi Lake A"), list("Arynthi Lake Underground B","Arynthi Lake B"), - list("Eggnog Town Underground","Eggnog Town"), list("Wild West") ) @@ -202,7 +201,10 @@ list("Teppi Ranch"), list("Innland"), list("Abandoned Island"), - list("Dark Adventure") + list("Dark Adventure"), + list("Eggnog Town Underground","Eggnog Town"), + list("Star Dog"), + list("Hotsprings") ) ai_shell_restricted = TRUE @@ -309,6 +311,7 @@ ) levels_for_distress = list(Z_LEVEL_OFFMAP1, Z_LEVEL_BEACH, Z_LEVEL_AEROSTAT, Z_LEVEL_DEBRISFIELD, Z_LEVEL_FUELDEPOT) + var/mob_announce_cooldown = 0 /obj/effect/overmap/visitable/sector/virgo3b/Crossed(var/atom/movable/AM) . = ..() @@ -322,6 +325,11 @@ return list(Z_LEVEL_SPACE_LOW) /obj/effect/overmap/visitable/sector/virgo3b/proc/announce_atc(var/atom/movable/AM, var/going = FALSE) + if(istype(AM, /obj/effect/overmap/visitable/ship/simplemob)) + if(world.time < mob_announce_cooldown) + return + else + mob_announce_cooldown = world.time + 5 MINUTES var/message = "Sensor contact for vessel '[AM.name]' has [going ? "left" : "entered"] ATC control area." //For landables, we need to see if their shuttle is cloaked if(istype(AM, /obj/effect/overmap/visitable/ship/landable)) diff --git a/sound/ambience/star_dog/dark-cold-main-menu-loop-mild-mountain-sickness-marb7e.ogg b/sound/ambience/star_dog/dark-cold-main-menu-loop-mild-mountain-sickness-marb7e.ogg new file mode 100644 index 0000000000..e9cd708597 Binary files /dev/null and b/sound/ambience/star_dog/dark-cold-main-menu-loop-mild-mountain-sickness-marb7e.ogg differ diff --git a/sound/ambience/star_dog/dougcockpit.ogg b/sound/ambience/star_dog/dougcockpit.ogg new file mode 100644 index 0000000000..a23cbe2276 Binary files /dev/null and b/sound/ambience/star_dog/dougcockpit.ogg differ diff --git a/sound/ambience/star_dog/long_awoo.ogg b/sound/ambience/star_dog/long_awoo.ogg new file mode 100644 index 0000000000..18bdf0ae21 Binary files /dev/null and b/sound/ambience/star_dog/long_awoo.ogg differ diff --git a/sound/ambience/star_dog/ominous-ambience.ogg b/sound/ambience/star_dog/ominous-ambience.ogg new file mode 100644 index 0000000000..a1901f821d Binary files /dev/null and b/sound/ambience/star_dog/ominous-ambience.ogg differ diff --git a/sound/ambience/star_dog/woof.ogg b/sound/ambience/star_dog/woof.ogg new file mode 100644 index 0000000000..ed99b48647 Binary files /dev/null and b/sound/ambience/star_dog/woof.ogg differ diff --git a/sound/ambience/star_dog/woof2.ogg b/sound/ambience/star_dog/woof2.ogg new file mode 100644 index 0000000000..a2d86d1718 Binary files /dev/null and b/sound/ambience/star_dog/woof2.ogg differ diff --git a/sound/effects/ominous-hum-2.ogg b/sound/effects/ominous-hum-2.ogg new file mode 100644 index 0000000000..f590d2fdd8 Binary files /dev/null and b/sound/effects/ominous-hum-2.ogg differ diff --git a/sound/effects/tones/newplayerping.ogg b/sound/effects/tones/newplayerping.ogg new file mode 100644 index 0000000000..a33a710de1 Binary files /dev/null and b/sound/effects/tones/newplayerping.ogg differ diff --git a/sound/weapons/attributions.txt b/sound/weapons/attributions.txt index fe2911c873..c3ed487c9c 100644 --- a/sound/weapons/attributions.txt +++ b/sound/weapons/attributions.txt @@ -6,4 +6,10 @@ No changes were made to the sounds, and all credit goes to kMoon. batreflect sounds are by shadoWisp on freesound.org: https://www.freesound.org/people/shadoWisp/sounds/252044/ -Small parts of the sound are cut out and used. \ No newline at end of file +Small parts of the sound are cut out and used. + +ominous-ambience.ogg by -Hero_of_the_Winds- on freesound.org +https://freesound.org/people/-Hero_of_the_Winds-/sounds/221876/ + +dark-cold-main-menu-loop-mild-mountain-sickness-marb7e.ogg - Mild Mountain Sickness - by Marb7e on freesound.org +https://freesound.org/people/marb7e/sounds/674392/ diff --git a/tgui/packages/tgui/interfaces/Fax.js b/tgui/packages/tgui/interfaces/Fax.js index acd19b6189..86d8ea2982 100644 --- a/tgui/packages/tgui/interfaces/Fax.js +++ b/tgui/packages/tgui/interfaces/Fax.js @@ -7,21 +7,26 @@ import { LoginScreen } from './common/LoginScreen'; export const Fax = (props, context) => { const { data } = useBackend(context); - const { authenticated } = data; + const { authenticated, copyItem } = data; + + let variableHeight = 340; + if (copyItem) { + variableHeight = 358; + } if (!authenticated) { return ( - + ); } return ( - + @@ -34,7 +39,8 @@ export const Fax = (props, context) => { export const FaxContent = (props, context) => { const { act, data } = useBackend(context); - const { bossName, copyItem, cooldown, destination } = data; + const { bossName, copyItem, cooldown, destination, adminDepartments } = data; + const staffRequestDepartment = new Set(adminDepartments); return (
@@ -48,6 +54,7 @@ export const FaxContent = (props, context) => { {bossName} Quantum Entanglement Network + {(copyItem && ( @@ -70,6 +77,7 @@ export const FaxContent = (props, context) => { /> )) || Please insert item to transmit.} +
); }; @@ -94,3 +102,40 @@ const RemoveItem = (props, context) => { ); }; + +const AutomatedStaffRequest = (props, context) => { + const { act, data } = useBackend(context); + + const { adminDepartments, destination, copyItem } = data; + const staffRequestDepartment = new Set(adminDepartments); + + let flexiblePadding = '1rem'; + if (copyItem) { + flexiblePadding = '1.5rem'; + } + + if (!copyItem || (copyItem && staffRequestDepartment.has(destination))) { + return ( + + Or submit an automated staff request.

+ + The automated staff request form automatically populates the company + job board ((sends to discord, but does not ping.)) without requiring + intervention from central command clerks and officers.
+ It also works without requiring a written request to be composed. + +
+ +