diff --git a/_maps/map_files/SpookyStation/SpookyStation.dmm b/_maps/map_files/SpookyStation/SpookyStation.dmm
index b2c50a42c9..af78e0629c 100644
--- a/_maps/map_files/SpookyStation/SpookyStation.dmm
+++ b/_maps/map_files/SpookyStation/SpookyStation.dmm
@@ -1,2820 +1,82302 @@
-"aaa" = (/obj/vehicle/ridden/bicycle,/turf/open/floor/spooktime/beach,/area/eventmap/outside)
-"aab" = (/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"aac" = (/turf/closed/mineral/ash_rock,/area/eventmap/mountain)
-"aad" = (/obj/structure/bed,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aae" = (/obj/effect/spawner/structure/window/reinforced,/obj/structure/cable/white{icon_state = "0-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aaf" = (/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury01,/obj/effect/spawner/structure/window/reinforced,/turf/open/floor/wood,/area/eventmap/inside)
-"aag" = (/obj/structure/bed,/obj/item/bedsheet/random,/turf/open/floor/wood,/area/eventmap/inside)
-"aah" = (/obj/structure/closet/crate/grave,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"aai" = (/obj/machinery/vending/boozeomat{req_access = null},/turf/open/floor/wood,/area/eventmap/inside)
-"aaj" = (/obj/structure/dresser,/obj/machinery/light{dir = 1; light_color = "#e8eaff"},/turf/open/floor/wood,/area/eventmap/inside)
-"aak" = (/obj/structure/reagent_dispensers/keg/gargle,/turf/open/floor/wood/damturf/broken1,/area/eventmap/inside)
-"aal" = (/obj/structure/closet/secure_closet/freezer/meat,/turf/open/floor/wood,/area/eventmap/inside)
-"aam" = (/obj/structure/table/wood,/obj/item/reagent_containers/food/drinks/bottle/wine,/obj/machinery/light{dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"aan" = (/turf/open/floor/plasteel/showroomfloor,/area/eventmap/inside)
-"aao" = (/obj/machinery/door/airlock/silver{name = "Bathroom"},/obj/effect/turf_decal/stripes/line{dir = 8},/turf/open/floor/plasteel/showroomfloor,/area/eventmap/inside)
-"aap" = (/obj/structure/bed,/obj/effect/spawner/lootdrop/bedsheet,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"aaq" = (/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury02,/obj/effect/spawner/structure/window/reinforced,/turf/open/floor/wood,/area/eventmap/inside)
-"aar" = (/obj/effect/spawner/structure/window/reinforced,/turf/open/floor/wood,/area/eventmap/inside)
-"aas" = (/obj/structure/chair/comfy/shuttle{dir = 4; icon_state = ""},/obj/machinery/light/floor{alpha = 0; light_range = 20; max_integrity = 9999; mouse_opacity = 0},/turf/open/floor/plasteel/dark{icon_state = "bus"},/area/shuttle/arrival)
-"aat" = (/obj/item/flashlight/lantern{anchored = 1; can_be_unanchored = 1; light_color = "#EE9933"; light_range = 5; on = 1},/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"aau" = (/obj/structure/flora/junglebush{icon_state = "busha1"},/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"aav" = (/obj/structure/fluff/bus/passable,/obj/structure/window/reinforced{dir = 8},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"aaw" = (/turf/closed/wall,/area/eventmap/inside)
-"aax" = (/obj/structure/holohoop,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"aay" = (/obj/structure/rack,/obj/item/stack/sheet/mineral/wood/fifty,/turf/open/floor/wood,/area/eventmap/inside)
-"aaz" = (/obj/structure/reagent_dispensers/keg/milk,/turf/open/floor/wood/damturf/broken3,/area/eventmap/inside)
-"aaA" = (/obj/structure/fireplace{dir = 4; pixel_x = -8},/turf/open/floor/wood,/area/eventmap/inside)
-"aaB" = (/obj/structure/flora/tree/jungle,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"aaC" = (/obj/structure/signpost,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"aaD" = (/obj/structure/flora/junglebush,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"aaE" = (/obj/machinery/light/small,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"aaF" = (/obj/structure/flora/junglebush{icon_state = "bushb1"},/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"aaG" = (/obj/machinery/camera/emp_proof{c_tag = "Containment - Particle Accelerator"; dir = 1; network = list("singularity")},/obj/machinery/light/small,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"aaH" = (/obj/structure/chair/wood/normal,/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"aaI" = (/obj/structure/dresser,/obj/machinery/light{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"aaJ" = (/obj/structure/bed,/obj/item/bedsheet,/turf/open/floor/wood,/area/eventmap/inside)
-"aaK" = (/obj/structure/table/wood/fancy,/obj/item/clothing/head/hardhat/pumpkinhead/jaqc{light_range = 3},/turf/open/floor/wood/damturf/broken5,/area/eventmap/inside)
-"aaL" = (/obj/structure/bodycontainer/crematorium,/turf/open/floor/wood,/area/eventmap/inside)
-"aaM" = (/obj/structure/chair/comfy/plywood{dir = 8},/turf/open/floor/spooktime/cobble/cornerNE,/area/eventmap/outside)
-"aaN" = (/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aaO" = (/obj/machinery/rnd/production/techfab/department/cargo,/obj/effect/turf_decal/delivery,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aaP" = (/obj/structure/bodycontainer/morgue{icon_state = "morgue1"; dir = 2},/turf/open/floor/wood,/area/eventmap/inside)
-"aaQ" = (/obj/structure/chair/sofa/right,/turf/open/floor/wood,/area/eventmap/inside)
-"aaR" = (/obj/structure/chair/sofa/left,/turf/open/floor/wood,/area/eventmap/inside)
-"aaS" = (/obj/structure/mineral_door/woodrustic,/turf/open/floor/wood,/area/eventmap/inside)
-"aaT" = (/obj/machinery/button/door/dorms/luxury1,/obj/machinery/vending/coffee,/turf/open/floor/wood,/area/eventmap/inside)
-"aaU" = (/obj/structure/chair/wood/normal{dir = 4},/obj/structure/curtain{color = "#B22222"; pixel_y = -32},/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"aaV" = (/obj/structure/table/wood,/obj/item/clothing/head/festive,/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"aaW" = (/obj/structure/mirror{pixel_x = 28},/obj/effect/turf_decal/bot,/obj/machinery/shower{dir = 8; pixel_y = -4},/turf/open/floor/plasteel/showroomfloor,/area/eventmap/inside)
-"aaX" = (/obj/structure/table/wood,/obj/machinery/light{dir = 4},/obj/item/reagent_containers/food/drinks/bottle/wine,/turf/open/floor/wood,/area/eventmap/inside)
-"aaY" = (/obj/structure/table/wood/fancy,/obj/item/clothing/head/scarecrow_hat,/turf/open/floor/wood,/area/eventmap/inside)
-"aaZ" = (/obj/structure/table/wood/fancy,/obj/item/reagent_containers/food/snacks/pastatomato,/turf/open/floor/wood,/area/eventmap/inside)
-"aba" = (/obj/structure/table/wood/fancy,/obj/item/clothing/head/hardhat/pumpkinhead/jaqc{light_range = 3},/turf/open/floor/wood,/area/eventmap/inside)
-"abb" = (/obj/structure/closet/secure_closet/freezer/kitchen/maintenance,/turf/open/floor/wood,/area/eventmap/inside)
-"abc" = (/obj/structure/table/wood/fancy/red,/obj/machinery/microwave,/obj/machinery/light/small{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"abd" = (/obj/structure/chair/comfy/plywood{dir = 8},/turf/open/floor/spooktime/cobble/sideE,/area/eventmap/outside)
-"abe" = (/obj/structure/sign/poster/official/no_erp,/turf/closed/wall/mineral/wood,/area/eventmap/mountaininside)
-"abf" = (/obj/structure/table/wood/fancy/red,/obj/machinery/chem_dispenser/drinks/beer/fullupgrade,/turf/open/floor/wood,/area/eventmap/inside)
-"abg" = (/obj/structure/table/wood/fancy/red,/obj/machinery/chem_dispenser/drinks/fullupgrade,/turf/open/floor/wood,/area/eventmap/inside)
-"abh" = (/obj/structure/table/wood/fancy/red,/turf/open/floor/wood,/area/eventmap/inside)
-"abi" = (/obj/structure/mineral_door/woodrustic{name = "Event Hall"},/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury01,/turf/open/floor/wood,/area/eventmap/inside)
-"abj" = (/obj/effect/spawner/structure/window/reinforced,/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury01,/turf/open/floor/wood,/area/eventmap/inside)
-"abk" = (/obj/machinery/vending/wardrobe/cargo_wardrobe,/obj/effect/turf_decal/tile/brown{dir = 4},/obj/effect/turf_decal/tile/brown{icon_state = "tile_corner"; dir = 1},/turf/open/floor/plasteel,/area/eventmap/inside)
-"abl" = (/obj/structure/toilet{dir = 4},/turf/open/floor/plasteel/showroomfloor,/area/eventmap/inside)
-"abm" = (/obj/machinery/door/airlock/silver{name = "Bathroom"},/obj/effect/turf_decal/stripes/line{dir = 4},/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"abn" = (/obj/effect/spawner/structure/window/reinforced,/turf/open/floor/plasteel/elevatorshaft,/area/eventmap/inside)
-"abo" = (/obj/structure/fireplace{dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"abp" = (/obj/effect/landmark/start/chaplain,/turf/open/floor/wood,/area/eventmap/inside)
-"abq" = (/obj/structure/table/wood/fancy/red,/obj/item/reagent_containers/food/snacks/waffles,/turf/open/floor/wood,/area/eventmap/inside)
-"abr" = (/obj/structure/chair/comfy/plywood{dir = 1},/turf/open/floor/spooktime/cobble/sideS,/area/eventmap/outside)
-"abs" = (/obj/structure/fluff/bus/passable,/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"abt" = (/obj/effect/turf_decal/tile/brown{dir = 4},/obj/effect/turf_decal/tile/brown{icon_state = "tile_corner"; dir = 1},/obj/machinery/light/small{dir = 1},/turf/open/floor/plasteel,/area/eventmap/inside)
-"abu" = (/obj/structure/table/wood/fancy/red,/obj/machinery/light/small{dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"abv" = (/obj/structure/table/wood,/obj/item/phone,/turf/open/floor/wood,/area/eventmap/inside)
-"abw" = (/obj/structure/table/wood,/obj/item/clothing/head/festive,/obj/structure/curtain{color = "#B22222"; pixel_y = -32},/turf/open/floor/wood,/area/eventmap/inside)
-"abx" = (/obj/machinery/button/door/dorms/luxury2,/obj/machinery/vending/coffee,/turf/open/floor/wood/damturf/broken6,/area/eventmap/inside)
-"aby" = (/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"abz" = (/obj/structure/chair/wood/wings,/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"abA" = (/obj/effect/spawner/structure/window/reinforced,/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury02,/turf/open/floor/wood,/area/eventmap/inside)
-"abB" = (/obj/structure/mineral_door/woodrustic{name = "Event Hall"},/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury02,/turf/open/floor/wood,/area/eventmap/inside)
-"abC" = (/obj/structure/chair/sofa,/turf/open/floor/wood,/area/eventmap/inside)
-"abD" = (/obj/structure/closet/crate/coffin,/turf/open/floor/wood,/area/eventmap/inside)
-"abE" = (/obj/structure/bed,/obj/item/bedsheet/random,/turf/open/floor/carpet,/area/eventmap/inside)
-"abF" = (/obj/machinery/vending/donksofttoyvendor,/turf/open/floor/spooktime/cobble/cornerNW,/area/eventmap/outside)
-"abG" = (/obj/structure/table/wood,/obj/item/stack/sheet/plastic/fifty{pixel_x = 4; pixel_y = -4},/obj/item/stack/sheet/metal/fifty,/turf/open/floor/spooktime/cobble/sideN,/area/eventmap/outside)
-"abH" = (/turf/closed/wall/mineral/gold,/area/eventmap/mountain)
-"abI" = (/obj/structure/table/wood,/obj/effect/turf_decal/tile/brown{dir = 4},/obj/effect/turf_decal/tile/brown{icon_state = "tile_corner"; dir = 1},/obj/effect/turf_decal/tile/brown,/obj/item/storage/firstaid/regular,/obj/structure/sign/poster/contraband/masked_men{pixel_x = 32},/turf/open/floor/plasteel,/area/eventmap/inside)
-"abJ" = (/turf/open/floor/carpet,/area/eventmap/inside)
-"abK" = (/turf/closed/wall/mineral/iron,/area/eventmap/outside)
-"abL" = (/obj/structure/healingfountain,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"abM" = (/obj/structure/table/wood/fancy/red,/obj/item/reagent_containers/food/snacks/soup/hotchili,/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"abN" = (/obj/structure/table/wood/fancy/red,/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"abO" = (/obj/structure/table/wood/fancy/red,/obj/item/reagent_containers/food/snacks/sausage,/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"abP" = (/obj/structure/table/wood/fancy/red,/obj/item/reagent_containers/food/snacks/cubancarp,/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"abQ" = (/obj/structure/sink{dir = 8; pixel_x = -12},/obj/structure/mirror{dir = 8; pixel_x = -28},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"abR" = (/obj/effect/turf_decal/tile/blue{icon_state = "tile_corner"; dir = 4},/obj/effect/turf_decal/tile/yellow{icon_state = "tile_corner"; dir = 8},/turf/open/floor/plasteel/dark,/area/eventmap/mountain)
-"abS" = (/obj/structure/mineral_door/wood,/turf/open/floor/wood/damturf/broken7,/area/eventmap/inside)
-"abT" = (/obj/effect/landmark/start/chaplain,/turf/open/floor/carpet,/area/eventmap/inside)
-"abU" = (/obj/machinery/vending/wardrobe/chap_wardrobe,/turf/open/floor/carpet,/area/eventmap/inside)
-"abV" = (/obj/structure/table/wood/fancy/red,/obj/item/reagent_containers/food/snacks/taco,/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"abW" = (/obj/structure/chair/sofa/left{dir = 1; icon_state = "sofamiddle"},/turf/open/floor/wood,/area/eventmap/inside)
-"abX" = (/obj/structure/chair/sofa/left{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"abY" = (/turf/open/floor/wood{icon_state = "wood-broken2"},/area/eventmap/inside)
-"abZ" = (/obj/machinery/light/small,/turf/open/floor/wood,/area/eventmap/inside)
-"aca" = (/obj/structure/toilet{dir = 4},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"acb" = (/obj/machinery/power/apc{dir = 2; name = "Chapel Office APC"; areastring = "/area/chapel/office"; pixel_y = -24},/obj/structure/cable/yellow{icon_state = "0-8"},/turf/open/floor/carpet,/area/eventmap/inside)
-"acc" = (/obj/structure/dresser,/turf/open/floor/carpet,/area/eventmap/inside)
-"acd" = (/obj/structure/chair/wood/wings{dir = 1},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"ace" = (/obj/effect/spawner/structure/window/reinforced,/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03,/turf/open/floor/wood,/area/eventmap/inside)
-"acf" = (/obj/structure/mineral_door/woodrustic{name = "Event Hall"},/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03,/turf/open/floor/wood,/area/eventmap/inside)
-"acg" = (/obj/machinery/light/small,/obj/structure/chair/sofa/left{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"ach" = (/obj/structure/chair/sofa/right{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"aci" = (/obj/structure/cable/yellow{icon_state = "1-2"},/turf/closed/wall/mineral/wood,/area/eventmap/inside)
-"acj" = (/obj/structure/bookcase/random/adult,/turf/open/floor/wood,/area/eventmap/inside)
-"ack" = (/obj/structure/table/wood,/obj/machinery/light{dir = 1},/obj/item/phone,/turf/open/floor/wood,/area/eventmap/inside)
-"acl" = (/obj/structure/table/wood,/obj/item/clothing/head/festive,/obj/structure/curtain{color = "#B22222"; pixel_y = 32},/turf/open/floor/wood,/area/eventmap/inside)
-"acm" = (/obj/machinery/button/door/dorms/luxury3,/obj/machinery/vending/coffee,/turf/open/floor/wood/damturf/broken1,/area/eventmap/inside)
-"acn" = (/obj/item/barthpot{active = 0},/turf/open/floor/carpet,/area/eventmap/inside)
-"aco" = (/obj/machinery/holopad,/obj/effect/landmark/start/chaplain,/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/cable/yellow{icon_state = "2-8"},/turf/open/floor/carpet,/area/eventmap/inside)
-"acp" = (/mob/living/simple_animal/jacq{active = 0; spawn_cars = 0},/turf/open/floor/carpet,/area/eventmap/inside)
-"acq" = (/obj/structure/chair/wood/normal{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"acr" = (/obj/effect/spawner/structure/window,/turf/open/floor/plasteel/elevatorshaft,/area/eventmap/inside)
-"acs" = (/obj/effect/turf_decal/delivery,/obj/machinery/camera/emp_proof{c_tag = "Cargo Bay"},/obj/machinery/light/small{dir = 1},/turf/open/floor/plasteel,/area/eventmap/inside)
-"act" = (/turf/open/floor/plasteel{dir = 1; icon_state = "chapel"},/area/eventmap/inside)
-"acu" = (/obj/structure/dresser,/turf/open/floor/wood,/area/eventmap/inside)
-"acv" = (/turf/open/floor/plasteel{dir = 4; icon_state = "chapel"},/area/eventmap/inside)
-"acw" = (/obj/structure/table/wood/fancy,/obj/item/flashlight/lantern{anchored = 1; can_be_unanchored = 1; light_color = "#EE9933"; light_range = 5; on = 1},/turf/open/floor/carpet,/area/eventmap/inside)
-"acx" = (/obj/structure/table/wood/fancy,/turf/open/floor/carpet,/area/eventmap/inside)
-"acy" = (/obj/structure/mineral_door/wood,/turf/open/floor/wood,/area/eventmap/inside)
-"acz" = (/obj/structure/table/wood/fancy,/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/carpet,/area/eventmap/inside)
-"acA" = (/obj/effect/turf_decal/delivery,/obj/structure/closet/crate{icon_state = "crateopen"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"acB" = (/turf/open/floor/plasteel/stairs/left,/area/eventmap/inside)
-"acC" = (/obj/structure/bookcase/random/adult,/obj/machinery/light/small,/turf/open/floor/wood,/area/eventmap/inside)
-"acD" = (/turf/open/floor/plasteel/stairs/right,/area/eventmap/inside)
-"acE" = (/obj/structure/mineral_door/woodrustic{name = "Event Hall"},/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury04,/turf/open/floor/wood,/area/eventmap/inside)
-"acF" = (/obj/effect/turf_decal/tile/blue{icon_state = "tile_corner"; dir = 8},/turf/open/floor/plasteel/dark,/area/eventmap/mountain)
-"acG" = (/obj/machinery/door/airlock/mining{name = "Mining"; req_access_txt = "48"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"acH" = (/obj/effect/spawner/structure/window/reinforced,/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury04,/turf/open/floor/wood,/area/eventmap/inside)
-"acI" = (/obj/structure/flora/grass/jungle/b{icon_state = "busha2"},/obj/vehicle/ridden/atv,/obj/item/key,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"acJ" = (/obj/structure/flora/junglebush{icon_state = "bushb1"},/obj/vehicle/ridden/atv,/obj/item/key,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"acK" = (/obj/vehicle/ridden/atv,/obj/item/key,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"acL" = (/turf/open/floor/plasteel{dir = 8; icon_state = "chapel"},/area/eventmap/inside)
-"acM" = (/turf/open/floor/plasteel{icon_state = "chapel"},/area/eventmap/inside)
-"acN" = (/obj/structure/spacevine,/turf/closed/wall/rust,/area/eventmap/outside)
-"acO" = (/obj/structure/bed,/obj/item/bedsheet/cmo,/obj/item/restraints/handcuffs,/obj/item/reagent_containers/syringe,/obj/item/clothing/suit/straight_jacket,/turf/open/floor/carpet/green,/area/eventmap/inside)
-"acP" = (/obj/machinery/vending/kink,/turf/open/floor/wood,/area/eventmap/inside)
-"acQ" = (/obj/machinery/light/small{dir = 4; light_color = "#d8b1b1"},/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"acR" = (/obj/structure/table/wood,/obj/effect/turf_decal/tile/brown{dir = 4},/obj/effect/turf_decal/tile/brown,/obj/item/paper_bin,/obj/item/pen,/turf/open/floor/plasteel,/area/eventmap/inside)
-"acS" = (/obj/machinery/vending/clothing,/turf/open/floor/wood,/area/eventmap/inside)
-"acT" = (/obj/machinery/camera/emp_proof{c_tag = "Containment - Fore Port"; dir = 4; network = list("singularity")},/obj/machinery/light/small{dir = 8},/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"acU" = (/obj/structure/sign/departments/medbay/alt{pixel_x = 32},/obj/machinery/light/small{dir = 4; light_color = "#d8b1b1"},/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"acV" = (/turf/open/floor/plasteel/dark,/area/eventmap/mountain)
-"acW" = (/obj/structure/mineral_door/woodrustic,/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"acX" = (/obj/machinery/washing_machine,/turf/open/floor/wood,/area/eventmap/inside)
-"acY" = (/obj/machinery/button/door/dorms/luxury4,/turf/open/floor/wood,/area/eventmap/inside)
-"acZ" = (/obj/structure/flora/grass/jungle/b{icon_state = "grassa3"},/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"ada" = (/obj/structure/flora/grass/jungle/b{icon_state = "grassa1"},/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"adb" = (/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"adc" = (/obj/structure/cable/yellow{icon_state = "2-8"},/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"add" = (/obj/effect/landmark/start/cargo_technician,/turf/open/floor/plasteel,/area/eventmap/inside)
-"ade" = (/obj/machinery/cryopod{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"adf" = (/obj/structure/chair/wood/normal{dir = 4},/obj/structure/curtain{color = "#B22222"; pixel_y = 32},/turf/open/floor/carpet/red,/area/eventmap/inside)
-"adg" = (/obj/structure/closet/secure_closet/CMO,/turf/open/floor/carpet/green,/area/eventmap/inside)
-"adh" = (/obj/structure/table/wood,/obj/item/clothing/head/festive,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"adi" = (/obj/machinery/light{dir = 1},/obj/structure/chair/wood/normal{dir = 8},/turf/open/floor/carpet/red,/area/eventmap/inside)
-"adj" = (/obj/structure/cable/white{icon_state = "1-4"},/turf/open/floor/wood,/area/eventmap/inside)
-"adk" = (/obj/structure/cable/white{icon_state = "1-2"},/obj/structure/cable/white{icon_state = "2-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"adl" = (/obj/structure/window/reinforced/tinted/fulltile,/turf/closed/wall/mineral/wood,/area/eventmap/inside)
-"adm" = (/obj/structure/sign/poster/official/do_not_question{pixel_y = 32},/obj/structure/bookcase/random/nonfiction,/turf/open/floor/wood,/area/eventmap/inside)
-"adn" = (/obj/structure/spirit_board,/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/carpet,/area/eventmap/inside)
-"ado" = (/obj/structure/easel,/obj/machinery/light/small{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"adp" = (/obj/machinery/door/firedoor/border_only/closed{dir = 4; name = "Therapist's Office"},/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"adq" = (/obj/item/storage/briefcase,/turf/open/floor/wood,/area/eventmap/inside)
-"adr" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/wood{icon_state = "wood-broken3"},/area/eventmap/inside)
-"ads" = (/mob/living/simple_animal/pet/cat/Runtime,/turf/open/floor/wood,/area/eventmap/inside)
-"adt" = (/obj/effect/turf_decal/bot,/turf/open/floor/plasteel,/area/eventmap/inside)
-"adu" = (/obj/machinery/computer/crew,/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"adv" = (/obj/structure/table/wood/fancy/red,/obj/item/paper_bin,/obj/item/pen,/obj/item/storage/pill_bottle/mannitol,/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"adw" = (/obj/structure/table/wood/fancy/red,/obj/item/flashlight/lamp/green,/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"adx" = (/obj/structure/table/wood,/obj/effect/turf_decal/tile/brown{dir = 4},/obj/effect/turf_decal/tile/brown,/obj/machinery/firealarm{dir = 4; pixel_x = 24; pixel_y = 0},/turf/open/floor/plasteel,/area/eventmap/inside)
-"ady" = (/obj/machinery/light/small{dir = 8},/obj/effect/landmark/start/chief_medical_officer,/turf/open/floor/carpet/green,/area/eventmap/inside)
-"adz" = (/obj/effect/turf_decal/tile/blue,/turf/open/floor/plasteel/dark,/area/eventmap/mountain)
-"adA" = (/obj/structure/table/wood,/obj/item/phone,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"adB" = (/obj/structure/chair/pew/left{icon_state = "pewend_left"; dir = 1},/turf/open/floor/plasteel{icon_state = "chapel"},/area/eventmap/inside)
-"adC" = (/obj/structure/chair/pew{icon_state = "pewmiddle"; dir = 1},/turf/open/floor/plasteel{dir = 8; icon_state = "chapel"},/area/eventmap/inside)
-"adD" = (/obj/structure/flora/grass/jungle/b{icon_state = "busha2"},/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"adE" = (/obj/structure/chair/pew/right{icon_state = "pewend_right"; dir = 1},/turf/open/floor/plasteel{icon_state = "chapel"},/area/eventmap/inside)
-"adF" = (/obj/structure/cable/yellow{icon_state = "0-2"},/obj/machinery/power/apc{areastring = "/area/crew_quarters/heads/cmo"; dir = 1; name = "CM Quarters APC"; pixel_x = 24; pixel_y = 0},/turf/open/floor/carpet/green,/area/eventmap/inside)
-"adG" = (/obj/structure/chair/pew/left{icon_state = "pewend_left"; dir = 1},/turf/open/floor/plasteel{dir = 8; icon_state = "chapel"},/area/eventmap/inside)
-"adH" = (/obj/structure/cable/yellow{icon_state = "2-4"},/obj/structure/cable/white{icon_state = "1-4"},/turf/open/floor/wood,/area/eventmap/inside)
-"adI" = (/obj/structure/mineral_door/wood,/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"adJ" = (/obj/structure/cable/yellow{icon_state = "4-8"},/obj/effect/landmark/start/chief_medical_officer,/turf/open/floor/wood,/area/eventmap/inside)
-"adK" = (/obj/structure/window/reinforced/tinted/frosted{dir = 4},/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/cable/white{icon_state = "1-4"},/turf/open/floor/wood,/area/eventmap/inside)
-"adL" = (/obj/item/folder/white,/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"adM" = (/obj/structure/cable/yellow{icon_state = "2-8"},/obj/structure/cable/white{icon_state = "1-2"},/obj/structure/cable/white{icon_state = "2-4"},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"adN" = (/turf/open/floor/wood{icon_state = "wood-broken5"},/area/eventmap/inside)
-"adO" = (/obj/structure/chair/office/dark{dir = 4},/obj/effect/landmark/start/chief_medical_officer,/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"adP" = (/obj/structure/table/wood/fancy/red,/obj/machinery/computer/med_data/laptop{icon_state = "laptop"; dir = 8},/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"adQ" = (/obj/structure/chair/pew{icon_state = "pewmiddle"; dir = 1},/turf/open/floor/plasteel{icon_state = "chapel"},/area/eventmap/inside)
-"adR" = (/obj/effect/spawner/structure/window/reinforced,/obj/structure/cable/white{icon_state = "0-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"adS" = (/obj/structure/table/wood,/obj/item/paper/fluff/balls/spookyasylum/traffickingvictim,/obj/item/clothing/mask/muzzle,/obj/item/clothing/glasses/sunglasses/blindfold,/turf/open/floor/carpet/green,/area/eventmap/inside)
-"adT" = (/obj/structure/cable/yellow{icon_state = "1-4"},/turf/open/floor/carpet/green,/area/eventmap/inside)
-"adU" = (/obj/structure/chair/pew/right{icon_state = "pewend_right"; dir = 1},/turf/open/floor/plasteel{dir = 8; icon_state = "chapel"},/area/eventmap/inside)
-"adV" = (/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/cable/yellow{icon_state = "2-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"adW" = (/obj/item/toy/beach_ball/holoball,/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"adX" = (/obj/structure/chair/sofa/left{dir = 1},/turf/open/floor/wood{icon_state = "wood-broken7"},/area/eventmap/inside)
-"adY" = (/obj/structure/chair/sofa/right{dir = 1},/turf/open/floor/wood{icon_state = "wood-broken2"},/area/eventmap/inside)
-"adZ" = (/obj/structure/window/reinforced/tinted/frosted{dir = 4},/obj/structure/statue/silver/md,/turf/open/floor/wood,/area/eventmap/inside)
-"aea" = (/obj/machinery/suit_storage_unit/cmo,/turf/open/floor/wood,/area/eventmap/inside)
-"aeb" = (/obj/structure/chair/comfy/teal{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"aec" = (/obj/structure/filingcabinet/medical,/obj/structure/cable/yellow,/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"aed" = (/obj/machinery/computer/card/minor/cmo{dir = 1},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"aee" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"aef" = (/obj/structure/window/reinforced/tinted/fulltile,/turf/open/floor/wood,/area/eventmap/inside)
-"aeg" = (/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03,/obj/effect/spawner/structure/window/reinforced,/turf/open/floor/wood,/area/eventmap/inside)
-"aeh" = (/obj/machinery/door/airlock/command/glass{name = "Chief Medical Officer"; req_access_txt = "40"},/obj/machinery/door/firedoor,/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aei" = (/obj/effect/turf_decal/bot,/obj/structure/closet/cardboard,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aej" = (/obj/structure/filingcabinet/medical,/turf/open/floor/wood,/area/eventmap/inside)
-"aek" = (/obj/item/reagent_containers/spray/cleaner,/obj/machinery/light/small{dir = 1},/obj/structure/table/wood/fancy/purple,/obj/item/gun/magic/wand/resurrection,/turf/open/floor/wood,/area/eventmap/inside)
-"ael" = (/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury04,/obj/effect/spawner/structure/window/reinforced,/turf/open/floor/wood,/area/eventmap/inside)
-"aem" = (/obj/item/chair/wood,/turf/open/floor/plasteel{icon_state = "chapel"},/area/eventmap/inside)
-"aen" = (/obj/item/chair/wood,/turf/open/floor/carpet,/area/eventmap/inside)
-"aeo" = (/obj/effect/spawner/structure/window,/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aep" = (/obj/machinery/vending/wardrobe/cargo_wardrobe,/turf/open/floor/wood,/area/eventmap/inside)
-"aeq" = (/obj/machinery/vending/wardrobe/chap_wardrobe,/turf/open/floor/wood,/area/eventmap/inside)
-"aer" = (/obj/effect/turf_decal/tile/blue{icon_state = "tile_corner"; dir = 1},/obj/effect/turf_decal/tile/red,/turf/open/floor/plasteel/dark,/area/eventmap/mountain)
-"aes" = (/obj/effect/turf_decal/tile/yellow{icon_state = "tile_corner"; dir = 4},/turf/open/floor/plasteel/dark,/area/eventmap/mountain)
-"aet" = (/obj/effect/turf_decal/tile/blue,/obj/effect/turf_decal/tile/blue{icon_state = "tile_corner"; dir = 8},/obj/structure/chair/stool,/turf/open/floor/plasteel/dark,/area/eventmap/mountain)
-"aeu" = (/obj/effect/turf_decal/tile/red{icon_state = "tile_corner"; dir = 1},/turf/open/floor/plasteel/dark,/area/eventmap/mountain)
-"aev" = (/obj/effect/turf_decal/tile/yellow,/obj/effect/turf_decal/tile/yellow{icon_state = "tile_corner"; dir = 4},/obj/structure/chair/stool,/turf/open/floor/plasteel/dark,/area/eventmap/mountain)
-"aew" = (/obj/machinery/mineral/ore_redemption,/obj/effect/turf_decal/delivery,/obj/machinery/door/firedoor,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aex" = (/obj/structure/table/plasmaglass,/obj/item/toy/cards/deck/unum,/obj/machinery/light/floor,/turf/open/floor/plasteel/dark,/area/eventmap/mountain)
-"aey" = (/obj/effect/turf_decal/tile/red{icon_state = "tile_corner"; dir = 8},/obj/effect/turf_decal/tile/red{icon_state = "tile_corner"; dir = 1},/obj/structure/chair/stool,/turf/open/floor/plasteel/dark,/area/eventmap/mountain)
-"aez" = (/obj/machinery/light/small{dir = 1},/obj/machinery/vending/medical{req_access = null},/turf/open/floor/wood,/area/eventmap/inside)
-"aeA" = (/obj/machinery/rnd/production/techfab/department/medical,/turf/open/floor/wood,/area/eventmap/inside)
-"aeB" = (/obj/structure/window/reinforced,/obj/structure/table/wood/fancy/green,/obj/item/storage/firstaid/toxin{pixel_x = -3; pixel_y = 3},/obj/item/storage/firstaid/toxin,/obj/effect/decal/cleanable/cobweb,/obj/item/gun/syringe,/obj/item/gun/syringe,/obj/item/gun/syringe,/turf/open/floor/wood,/area/eventmap/inside)
-"aeC" = (/obj/structure/table/wood/fancy/green,/obj/item/storage/firstaid/fire{pixel_x = -3; pixel_y = 3},/obj/item/storage/firstaid/fire,/obj/machinery/door/window/southleft,/obj/item/holosign_creator/medical,/turf/open/floor/wood,/area/eventmap/inside)
-"aeD" = (/obj/machinery/light/small/broken{dir = 8},/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"aeE" = (/obj/structure/sign/departments/medbay/alt{pixel_x = 32},/obj/machinery/light/small/broken{dir = 4},/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"aeF" = (/obj/structure/table/wood/fancy/green,/obj/machinery/door/window/southright,/obj/item/storage/firstaid/regular{pixel_x = 3; pixel_y = 3},/obj/item/storage/firstaid/regular,/obj/item/clothing/accessory/medal/ribbon/medical_doctor,/obj/item/gun/magic/wand/resurrection,/turf/open/floor/wood,/area/eventmap/inside)
-"aeG" = (/obj/structure/window/reinforced,/obj/structure/window/reinforced{dir = 4},/obj/structure/table/wood/fancy/green,/obj/item/storage/firstaid/o2{pixel_x = 3; pixel_y = 3},/obj/item/storage/firstaid/o2,/obj/item/storage/firstaid/regular{pixel_x = -3; pixel_y = -3},/obj/item/gun/magic/staff/healing,/turf/open/floor/wood,/area/eventmap/inside)
-"aeH" = (/obj/machinery/door/airlock/gold,/turf/open/floor/plasteel/dark,/area/eventmap/mountain)
-"aeI" = (/obj/structure/closet/secure_closet/medical3,/obj/item/healthanalyzer/advanced,/obj/item/defibrillator/loaded,/obj/item/clothing/glasses/hud/health,/turf/open/floor/wood,/area/eventmap/inside)
-"aeJ" = (/obj/structure/closet/crate/medical{icon_state = "medicalcrateopen"},/obj/item/gun/magic/wand/resurrection,/obj/item/gun/magic/wand/resurrection,/obj/item/gun/magic/staff/healing,/obj/item/gun/magic/staff/healing,/obj/item/paper/fluff/balls/spookyasylum/healstaffnote,/turf/open/floor/wood,/area/eventmap/inside)
-"aeK" = (/obj/effect/decal/cleanable/dirt,/turf/open/floor/wood,/area/eventmap/inside)
-"aeL" = (/obj/machinery/vending/wardrobe/bar_wardrobe,/obj/machinery/light/small{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"aeM" = (/obj/machinery/vending/wardrobe/chef_wardrobe,/turf/open/floor/wood,/area/eventmap/inside)
-"aeN" = (/obj/structure/flora/grass/jungle/b,/turf/closed/wall/rust,/area/eventmap/outside)
-"aeO" = (/obj/machinery/vending/wardrobe/medi_wardrobe,/turf/open/floor/wood,/area/eventmap/inside)
-"aeP" = (/obj/machinery/vending/wardrobe/curator_wardrobe,/turf/open/floor/wood,/area/eventmap/inside)
-"aeQ" = (/obj/machinery/cryopod{dir = 4},/obj/machinery/light/small{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"aeR" = (/obj/machinery/cryopod,/turf/open/floor/wood,/area/eventmap/inside)
-"aeS" = (/obj/structure/table/wood,/obj/item/wrench/medical,/obj/item/storage/firstaid/regular,/obj/item/clothing/head/beret/cmo,/turf/open/floor/wood,/area/eventmap/inside)
-"aeT" = (/obj/structure/table/wood,/obj/item/storage/box/masks{pixel_x = 3; pixel_y = 3},/obj/item/storage/box/gloves,/obj/machinery/light/small{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"aeU" = (/obj/item/clothing/accessory/armband/medblue{pixel_x = 3; pixel_y = 3},/obj/item/clothing/accessory/armband/med,/obj/item/rack_parts,/obj/item/storage/briefcase/medical,/turf/open/floor/wood{icon_state = "wood-broken6"},/area/eventmap/inside)
-"aeV" = (/obj/structure/rack,/obj/effect/spawner/bundle/costume/plaguedoctor,/obj/item/stamp/cmo,/obj/item/gun/magic/staff/healing,/obj/item/gun/magic/wand/resurrection,/turf/open/floor/wood,/area/eventmap/inside)
-"aeW" = (/obj/structure/flora/junglebush{icon_state = "grassa4"},/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"aeX" = (/obj/machinery/hydroponics/soil,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/outside)
-"aeY" = (/obj/item/storage/crayons,/turf/open/floor/spooktime/beach,/area/eventmap/outside)
-"aeZ" = (/obj/machinery/camera/emp_proof{c_tag = "Containment - Fore Starboard"; dir = 8; network = list("singularity")},/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"afa" = (/obj/machinery/vending/clothing,/obj/machinery/light/small{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"afb" = (/obj/machinery/computer/arcade/minesweeper,/turf/open/floor/wood,/area/eventmap/inside)
-"afc" = (/obj/structure/rack,/obj/effect/spawner/lootdrop/maintenance{lootcount = 2; name = "2maintenance loot spawner"},/obj/structure/window/reinforced/tinted{dir = 4},/obj/item/reagent_containers/blood/random,/obj/item/clothing/neck/stethoscope,/turf/open/floor/wood,/area/eventmap/inside)
-"afd" = (/obj/machinery/shower{desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well..."; pixel_y = 24},/obj/structure/curtain,/obj/item/storage/pill_bottle/penis_enlargement,/obj/item/storage/pill_bottle/breast_enlargement,/obj/effect/decal/cleanable/cobweb/cobweb2,/obj/item/ectoplasm,/turf/open/floor/wood,/area/eventmap/inside)
-"afe" = (/obj/machinery/computer/arcade/orion_trail,/obj/structure/window/reinforced/tinted{dir = 4},/turf/open/floor/wood,/area/eventmap/inside)
-"aff" = (/obj/machinery/washing_machine,/obj/machinery/light/small{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"afg" = (/obj/machinery/cryopod{dir = 4},/turf/open/floor/wood,/area/eventmap/inside)
-"afh" = (/obj/effect/landmark/start/medical_doctor,/turf/open/floor/wood,/area/eventmap/inside)
-"afi" = (/obj/item/seeds/pumpkin,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"afj" = (/turf/open/floor/plasteel/stairs/left,/area/eventmap/outside)
-"afk" = (/obj/machinery/light{dir = 4},/turf/open/floor/wood,/area/eventmap/inside)
-"afl" = (/obj/machinery/light/small{dir = 4},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"afm" = (/obj/machinery/vending/wardrobe/viro_wardrobe,/turf/open/floor/wood,/area/eventmap/inside)
-"afn" = (/obj/effect/decal/cleanable/blood/old,/turf/open/floor/wood,/area/eventmap/inside)
-"afo" = (/obj/effect/decal/cleanable/blood/gibs/old,/obj/effect/decal/cleanable/glass,/obj/item/shard,/obj/item/organ/eyes,/obj/machinery/light/small/broken{dir = 4},/turf/open/floor/wood,/area/eventmap/inside)
-"afp" = (/obj/structure/closet/secure_closet/CMO,/turf/open/floor/wood,/area/eventmap/inside)
-"afq" = (/obj/structure/flora/bush,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"afr" = (/obj/structure/flora/ausbushes/sparsegrass,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"afs" = (/obj/structure/flora/ausbushes/leafybush,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"aft" = (/obj/structure/flora/ausbushes/lavendergrass,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"afu" = (/obj/structure/sign/poster/official/fruit_bowl,/turf/closed/wall/mineral/wood,/area/eventmap/inside)
-"afv" = (/obj/structure/spacevine,/turf/closed/wall/rust,/area/eventmap/inside)
-"afw" = (/turf/closed/wall/rust,/area/eventmap/inside)
-"afx" = (/obj/structure/urinal,/turf/closed/wall/rust,/area/eventmap/inside)
-"afy" = (/obj/structure/urinal,/obj/structure/spacevine,/turf/closed/wall/rust,/area/eventmap/inside)
-"afz" = (/obj/structure/chair/wood,/obj/item/toy/plush/borgplushie/medihound,/obj/item/clothing/glasses/hud/health/sunglasses{pixel_x = -4; pixel_y = 4},/turf/open/floor/wood,/area/eventmap/inside)
-"afA" = (/obj/effect/decal/cleanable/glass/plasma,/turf/open/floor/wood,/area/eventmap/inside)
-"afB" = (/obj/structure/window/reinforced/tinted{dir = 4},/turf/open/floor/wood,/area/eventmap/inside)
-"afC" = (/turf/open/floor/plasteel/stairs/right,/area/eventmap/outside)
-"afD" = (/obj/structure/window/reinforced/tinted,/turf/open/floor/wood,/area/eventmap/inside)
-"afE" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/machinery/light/small,/turf/open/floor/wood,/area/eventmap/inside)
-"afF" = (/obj/effect/decal/cleanable/cobweb,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"afG" = (/obj/machinery/vending/coffee,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"afH" = (/obj/structure/fireplace,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"afI" = (/obj/machinery/vending/snack/orange,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"afJ" = (/obj/machinery/vending/games,/turf/open/floor/wood,/area/eventmap/inside)
-"afK" = (/obj/structure/flora/rock/pile/icy,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"afL" = (/obj/structure/flora/ausbushes/ywflowers,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"afM" = (/obj/structure/toilet{dir = 4},/obj/effect/decal/cleanable/cobweb,/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"afN" = (/obj/structure/mineral_door/wood,/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"afO" = (/obj/machinery/shower{desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well..."; pixel_y = 24},/obj/structure/curtain,/obj/machinery/atmospherics/components/unary/vent_pump{icon_state = "vent_in"},/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"afP" = (/obj/machinery/shower{desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well..."; pixel_y = 24},/obj/structure/curtain,/obj/item/bikehorn/rubberducky,/obj/machinery/atmospherics/components/unary/vent_pump{icon_state = "vent_in"},/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"afQ" = (/obj/machinery/shower{desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well..."; pixel_y = 24},/obj/structure/curtain,/obj/item/bikehorn/rubberducky,/obj/item/soap/homemade,/obj/machinery/atmospherics/components/unary/vent_pump{icon_state = "vent_in"},/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"afR" = (/obj/machinery/shower{desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well..."; pixel_y = 24},/obj/structure/curtain,/obj/item/soap/homemade,/obj/machinery/atmospherics/components/unary/vent_pump{icon_state = "vent_in"},/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"afS" = (/obj/machinery/shower{desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well..."; pixel_y = 24},/obj/effect/decal/cleanable/cobweb,/obj/structure/curtain,/obj/item/bikehorn/rubberducky,/obj/item/soap/homemade,/obj/machinery/atmospherics/components/unary/vent_pump{icon_state = "vent_in"},/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"afT" = (/obj/machinery/vending/magivend,/turf/open/floor/wood,/area/eventmap/inside)
-"afU" = (/obj/machinery/vending/autodrobe,/turf/open/floor/wood,/area/eventmap/inside)
-"afV" = (/obj/effect/spawner/lootdrop/costume,/mob/living/simple_animal/hostile/skeleton{a_intent = "friendly"; attack_sound = 'sound/vox_fem/bone.ogg'; harm_intent_damage = -5; melee_damage_lower = 1; melee_damage_type = "brute"; melee_damage_upper = 10; name = "Closet Skeleton"},/turf/open/floor/wood,/area/eventmap/inside)
-"afW" = (/mob/living/simple_animal/hostile/skeleton{a_intent = "friendly"; attack_sound = 'sound/vox_fem/bone.ogg'; harm_intent_damage = -5; melee_damage_lower = 1; melee_damage_type = "brute"; melee_damage_upper = 10; name = "Closet Skeleton"},/turf/open/floor/wood,/area/eventmap/inside)
-"afX" = (/obj/item/clothing/head/hardhat/pumpkinhead,/turf/open/floor/wood,/area/eventmap/inside)
-"afY" = (/turf/open/floor/spooktime/cobble/sideW{icon_state = "cobble_corner_nw"},/area/eventmap/outside)
-"afZ" = (/turf/open/floor/wood{icon_state = "wood-broken4"},/area/eventmap/inside)
-"aga" = (/turf/open/floor/wood/damturf/broken7,/area/eventmap/inside)
-"agb" = (/obj/machinery/vending/medical{req_access = null},/turf/open/floor/wood,/area/eventmap/inside)
-"agc" = (/obj/structure/cable/white{icon_state = "0-2"},/obj/effect/spawner/structure/window/reinforced,/turf/open/floor/wood,/area/eventmap/inside)
-"agd" = (/obj/machinery/vending/coffee,/turf/open/floor/wood,/area/eventmap/inside)
-"age" = (/obj/effect/decal/cleanable/dirt,/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"agf" = (/obj/machinery/vending/wardrobe/gene_wardrobe,/turf/open/floor/wood,/area/eventmap/inside)
-"agg" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/structure/fireaxecabinet{pixel_y = -32},/turf/open/floor/wood,/area/eventmap/inside)
-"agh" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/machinery/light/small/built,/turf/open/floor/wood,/area/eventmap/inside)
-"agi" = (/obj/structure/chair/comfy/plywood,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"agj" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/carpet/red,/area/eventmap/inside)
-"agk" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"agl" = (/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"agm" = (/obj/item/stack/sheet/bone,/mob/living/simple_animal/hostile/skeleton{a_intent = "friendly"; attack_sound = 'sound/vox_fem/bone.ogg'; harm_intent_damage = -5; melee_damage_lower = 1; melee_damage_type = "brute"; melee_damage_upper = 10; name = "Closet Skeleton"},/turf/open/floor/wood,/area/eventmap/inside)
-"agn" = (/obj/item/stack/sheet/bone,/obj/effect/spawner/lootdrop/costume,/mob/living/simple_animal/hostile/skeleton{a_intent = "friendly"; attack_sound = 'sound/vox_fem/bone.ogg'; harm_intent_damage = -5; melee_damage_lower = 1; melee_damage_type = "brute"; melee_damage_upper = 10; name = "Closet Skeleton"},/turf/open/floor/wood,/area/eventmap/inside)
-"ago" = (/obj/item/shadowcloak,/mob/living/simple_animal/hostile/skeleton{a_intent = "friendly"; attack_sound = 'sound/vox_fem/bone.ogg'; harm_intent_damage = -5; melee_damage_lower = 1; melee_damage_type = "brute"; melee_damage_upper = 10; name = "Closet Skeleton"},/turf/open/floor/wood,/area/eventmap/inside)
-"agp" = (/obj/effect/decal/cleanable/generic,/turf/open/floor/wood,/area/eventmap/inside)
-"agq" = (/obj/structure/closet/secure_closet/medical3,/obj/item/healthanalyzer/advanced,/turf/open/floor/wood,/area/eventmap/inside)
-"agr" = (/obj/structure/flora/grass/jungle/b,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"ags" = (/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"agt" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/wood{icon_state = "wood-broken5"},/area/eventmap/inside)
-"agu" = (/obj/structure/table/wood,/obj/item/reagent_containers/glass/bottle/charcoal,/obj/item/reagent_containers/food/drinks/mug/tea,/turf/open/floor/wood,/area/eventmap/inside)
-"agv" = (/obj/machinery/computer/med_data{dir = 1},/obj/structure/window/reinforced,/turf/open/floor/wood,/area/eventmap/inside)
-"agw" = (/obj/machinery/cryopod{dir = 4},/obj/machinery/light/small,/turf/open/floor/wood,/area/eventmap/inside)
-"agx" = (/obj/machinery/door/airlock/medical/glass{name = "Medbay Storage"; req_access_txt = "5"},/turf/open/floor/wood,/area/eventmap/inside)
-"agy" = (/obj/structure/mineral_door/wood,/obj/effect/decal/cleanable/blood/old,/turf/open/floor/wood,/area/eventmap/inside)
-"agz" = (/obj/machinery/light/small{dir = 8},/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"agA" = (/obj/machinery/light/small{dir = 4},/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"agB" = (/obj/machinery/camera/emp_proof,/turf/open/floor/wood,/area/eventmap/inside)
-"agC" = (/obj/structure/chair/wood/wings{dir = 4},/turf/open/floor/carpet/red,/area/eventmap/inside)
-"agD" = (/obj/structure/table/wood/poker,/obj/item/toy/cards/deck,/obj/item/stamp/qm{pixel_x = -5; pixel_y = 3},/turf/open/floor/carpet/red,/area/eventmap/inside)
-"agE" = (/obj/structure/table/wood/poker,/obj/item/storage/fancy/donut_box,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"agF" = (/obj/structure/table/wood/poker,/obj/item/storage/fancy/candle_box,/obj/item/storage/fancy/candle_box,/obj/item/storage/fancy/candle_box,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"agG" = (/obj/structure/chair/wood/wings{dir = 8},/turf/open/floor/carpet/red,/area/eventmap/inside)
-"agH" = (/obj/structure/toilet{dir = 4},/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"agI" = (/mob/living/simple_animal/hostile/retaliate/nanotrasenpeace{a_intent = "friendly"; alpha = 150; attack_sound = 'sound/items/towelwipe.ogg'; desc = "A ghost who is intent on spraying you with purfume and toweling you, then expecting a tip after!! Spooky!!!"; icon_state = "paperwizard"; melee_damage_lower = 0; melee_damage_upper = 0; name = "Spooky Restroom attendant"},/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"agJ" = (/obj/structure/sink{dir = 4; pixel_x = 11},/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"agK" = (/obj/structure/mirror,/turf/closed/wall/mineral/wood,/area/eventmap/inside)
-"agL" = (/obj/structure/sink{dir = 8; pixel_x = -12},/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"agM" = (/obj/structure/mineral_door/wood{name = "closet"},/obj/structure/barricade/wooden/crude,/turf/open/floor/wood,/area/eventmap/inside)
-"agN" = (/obj/machinery/light/small{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"agO" = (/obj/structure/noticeboard/cmo{pixel_y = 32},/turf/open/floor/wood,/area/eventmap/inside)
-"agP" = (/obj/effect/spawner/lootdrop/costume,/obj/structure/table/wood/fancy/orange,/turf/open/floor/wood,/area/eventmap/inside)
-"agQ" = (/obj/structure/window/reinforced/spawner,/turf/open/floor/wood,/area/eventmap/inside)
-"agR" = (/obj/item/clothing/accessory/skullcodpiece,/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"agS" = (/turf/open/floor/wood{icon_state = "wood-broken3"},/area/eventmap/inside)
-"agT" = (/obj/machinery/light/small{dir = 4},/turf/open/floor/wood/damturf/broken5,/area/eventmap/inside)
-"agU" = (/obj/structure/closet/secure_closet/engineering_chief,/obj/item/stamp/ce,/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"agV" = (/obj/structure/window/fulltile,/obj/structure/barricade/wooden/crude,/turf/open/floor/wood,/area/eventmap/inside)
-"agW" = (/obj/structure/table/wood/poker,/obj/item/toy/cards/deck/cas,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"agX" = (/obj/structure/table/wood/poker,/obj/item/trash/candle,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"agY" = (/obj/structure/table/wood/poker,/obj/item/toy/cards/deck/syndicate,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"agZ" = (/obj/item/chair/wood/wings,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"aha" = (/obj/structure/sink{dir = 4; pixel_x = 11},/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"ahb" = (/obj/structure/mirror,/obj/structure/mirror{dir = 8},/turf/closed/wall/mineral/wood,/area/eventmap/inside)
-"ahc" = (/obj/effect/decal/cleanable/cobweb,/turf/closed/wall/mineral/wood,/area/eventmap/inside)
-"ahd" = (/obj/effect/decal/cleanable/cobweb,/turf/open/floor/wood{icon_state = "wood-broken7"},/area/eventmap/inside)
-"ahe" = (/obj/structure/fireplace,/turf/open/floor/wood,/area/eventmap/inside)
-"ahf" = (/obj/item/candle/infinite,/turf/open/floor/wood,/area/eventmap/inside)
-"ahg" = (/turf/open/floor/carpet/green,/area/eventmap/inside)
-"ahh" = (/obj/item/rupee,/turf/open/floor/wood,/area/eventmap/inside)
-"ahi" = (/obj/effect/meteor/pumpkin{lifetime = 2.14748e+009; light_color = "#FFCC66"; light_range = 3},/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"ahj" = (/obj/structure/sign/directions/command{dir = 8; icon_state = "direction_bridge"; pixel_y = 40},/obj/structure/sign/directions/security{dir = 8; icon_state = "direction_sec"; pixel_x = 0; pixel_y = 32},/turf/open/floor/wood,/area/eventmap/inside)
-"ahk" = (/obj/structure/sign/directions/science{pixel_x = 32; pixel_y = 32},/obj/structure/sign/directions/evac{pixel_x = 32; pixel_y = 24},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"ahl" = (/obj/structure/table/wood/fancy/green,/obj/item/clothing/suit/straight_jacket,/obj/machinery/light/broken{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"ahm" = (/obj/structure/table_frame/wood,/obj/item/stack/sheet/mineral/wood,/obj/effect/decal/cleanable/generic,/obj/item/gun/magic/staff/healing,/obj/item/gun/magic/wand/resurrection,/turf/open/floor/wood,/area/eventmap/inside)
-"ahn" = (/obj/structure/dresser,/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"aho" = (/obj/structure/table/wood/fancy/green,/obj/effect/decal/cleanable/cobweb/cobweb2,/obj/item/storage/backpack/satchel/med,/turf/open/floor/wood,/area/eventmap/inside)
-"ahp" = (/obj/effect/spawner/structure/window/reinforced,/obj/structure/sign/mining,/turf/open/floor/plating,/area/eventmap/inside)
-"ahq" = (/obj/structure/cable/white{icon_state = "4-8"},/obj/structure/cable/white{icon_state = "2-8"},/obj/structure/cable/white{icon_state = "2-4"},/turf/open/floor/wood,/area/eventmap/inside)
-"ahr" = (/obj/effect/spawner/structure/window,/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"ahs" = (/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/carpet/green,/area/eventmap/inside)
-"aht" = (/obj/structure/window/fulltile,/obj/structure/barricade/wooden/crude,/obj/structure/spacevine,/turf/open/floor/wood,/area/eventmap/inside)
-"ahu" = (/obj/structure/table/wood/poker,/obj/item/toy/cards/deck/cas/black,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"ahv" = (/obj/structure/table/wood/poker,/obj/item/dice/d6,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"ahw" = (/obj/structure/table/wood/poker,/obj/item/dice/d20,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"ahx" = (/obj/structure/cable/yellow{icon_state = "2-8"},/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/cable/yellow{icon_state = "2-4"},/turf/open/floor/carpet/green,/area/eventmap/inside)
-"ahy" = (/obj/structure/toilet{dir = 8},/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"ahz" = (/obj/structure/table/wood/fancy/royalblack,/obj/item/ship_in_a_bottle,/turf/open/floor/wood,/area/eventmap/inside)
-"ahA" = (/obj/structure/table/wood/fancy/royalblack,/obj/item/soapstone/infinite,/turf/open/floor/wood,/area/eventmap/inside)
-"ahB" = (/obj/structure/cable/white{icon_state = "4-8"},/obj/structure/cable/white{icon_state = "1-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"ahC" = (/obj/effect/spawner/structure/window/reinforced,/obj/structure/cable/white{icon_state = "0-4"},/turf/open/floor/wood,/area/eventmap/inside)
-"ahD" = (/obj/structure/cable/white{icon_state = "1-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"ahE" = (/obj/machinery/light,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/outside)
-"ahF" = (/obj/structure/closet/secure_closet/RD,/obj/structure/dresser,/turf/open/floor/carpet/purple,/area/eventmap/inside)
-"ahG" = (/obj/structure/closet/secure_closet/RD,/obj/item/stamp/rd,/turf/open/floor/carpet/purple,/area/eventmap/inside)
-"ahH" = (/obj/machinery/vending/wardrobe/law_wardrobe,/turf/open/floor/wood,/area/eventmap/inside)
-"ahI" = (/obj/machinery/vending/wardrobe/robo_wardrobe,/obj/machinery/light/small,/turf/open/floor/wood,/area/eventmap/inside)
-"ahJ" = (/obj/structure/spacevine,/turf/closed/mineral/ash_rock,/area/eventmap/mountain)
-"ahK" = (/obj/machinery/vending/wardrobe/science_wardrobe,/turf/open/floor/wood,/area/eventmap/inside)
-"ahL" = (/turf/open/floor/sepia,/area/eventmap/inside)
-"ahM" = (/obj/machinery/vending/wardrobe/engi_wardrobe,/turf/open/floor/wood,/area/eventmap/inside)
-"ahN" = (/obj/structure/table/wood/fancy/orange,/obj/item/clothing/suit/armor/riot/knight{pixel_x = 4; pixel_y = -4},/obj/item/clothing/suit/armor/riot/knight,/obj/item/clothing/suit/armor/riot/knight{pixel_x = -4; pixel_y = 4},/obj/item/clothing/head/helmet/knight{pixel_x = 4; pixel_y = -4},/obj/item/clothing/head/helmet/knight,/obj/item/clothing/head/helmet/knight{pixel_x = -4; pixel_y = 4},/turf/open/floor/wood,/area/eventmap/inside)
-"ahO" = (/obj/machinery/sleeper/syndie/fullupgrade{dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"ahP" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"ahQ" = (/obj/effect/decal/cleanable/dirt,/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"ahR" = (/obj/item/paper/fluff/balls/spookyasylum/healstaffnote,/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"ahS" = (/obj/structure/chair/wood/wings{dir = 1},/turf/open/floor/carpet/red,/area/eventmap/inside)
-"ahT" = (/obj/structure/table/wood/fancy/royalblack,/obj/item/clothing/head/hardhat/pumpkinhead/jaqc,/obj/item/seeds/pumpkin,/turf/open/floor/wood,/area/eventmap/inside)
-"ahU" = (/obj/item/candle/infinite,/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"ahV" = (/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/cable/yellow{icon_state = "1-4"},/obj/structure/cable/yellow{icon_state = "1-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"ahW" = (/obj/structure/cable/yellow{icon_state = "2-8"},/turf/open/floor/carpet/green,/area/eventmap/inside)
-"ahX" = (/obj/structure/cable/white{icon_state = "2-4"},/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"ahY" = (/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"ahZ" = (/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/spooktime/cobble/sideW,/area/eventmap/outside)
-"aia" = (/obj/structure/cable/white{icon_state = "4-8"},/obj/structure/curtain{color = "#B22222"; pixel_x = -32},/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"aib" = (/obj/structure/cable/white{icon_state = "2-8"},/obj/machinery/light/small{dir = 4; light_color = "#d8b1b1"},/obj/structure/bed,/obj/item/bedsheet/ce,/obj/effect/landmark/start/chief_engineer,/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"aic" = (/obj/structure/cable/white{icon_state = "1-2"},/turf/closed/wall/r_wall,/area/eventmap/inside)
-"aid" = (/obj/structure/cable/yellow{icon_state = "1-2"},/obj/machinery/door/airlock/command/glass{name = "Bridge"; req_access_txt = "19"},/turf/open/floor/wood,/area/eventmap/inside)
-"aie" = (/obj/structure/cable/white{icon_state = "2-4"},/obj/machinery/light/small{dir = 8},/turf/open/floor/carpet/purple,/area/eventmap/inside)
-"aif" = (/obj/machinery/vending/cola/red,/turf/open/floor/wood,/area/eventmap/inside)
-"aig" = (/obj/effect/turf_decal/caution,/turf/open/floor/carpet/green,/area/eventmap/inside)
-"aih" = (/obj/structure/chair/wood{dir = 1},/turf/open/floor/carpet/green,/area/eventmap/inside)
-"aii" = (/turf/open/floor/carpet/red,/area/eventmap/inside)
-"aij" = (/mob/living/simple_animal/mouse/brown/Tom,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"aik" = (/obj/machinery/computer/slot_machine,/turf/open/floor/wood{icon_state = "wood-broken2"},/area/eventmap/inside)
-"ail" = (/obj/machinery/computer/arcade/orion_trail/kobayashi,/turf/open/floor/wood,/area/eventmap/inside)
-"aim" = (/obj/machinery/computer/arcade/battle,/turf/open/floor/wood,/area/eventmap/inside)
-"ain" = (/obj/machinery/computer/arcade/minesweeper,/turf/open/floor/wood{icon_state = "wood-broken4"},/area/eventmap/inside)
-"aio" = (/obj/machinery/computer/arcade/amputation,/turf/open/floor/wood,/area/eventmap/inside)
-"aip" = (/obj/machinery/computer/arcade/orion_trail,/turf/open/floor/wood,/area/eventmap/inside)
-"aiq" = (/obj/structure/chair/wood{dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"air" = (/obj/structure/sign/departments/restroom{pixel_y = 32},/turf/open/floor/carpet/purple,/area/eventmap/inside)
-"ais" = (/obj/structure/closet/cabinet,/obj/item/camera/timefreeze,/obj/item/cane,/obj/item/cardboard_cutout,/turf/open/floor/wood,/area/eventmap/inside)
-"ait" = (/obj/structure/dresser,/turf/open/floor/carpet/cyan,/area/eventmap/inside)
-"aiu" = (/obj/structure/fireplace,/turf/open/floor/carpet/cyan,/area/eventmap/inside)
-"aiv" = (/turf/open/floor/carpet/cyan,/area/eventmap/inside)
-"aiw" = (/obj/structure/table/wood,/obj/item/flashlight/lamp,/turf/open/floor/carpet/cyan,/area/eventmap/inside)
-"aix" = (/obj/effect/temp_visual/cult/turf/floor,/turf/open/floor/wood,/area/eventmap/inside)
-"aiy" = (/obj/effect/decal/cleanable/blood/tracks,/turf/open/floor/wood,/area/eventmap/inside)
-"aiz" = (/obj/structure/cable/white{icon_state = "4-8"},/obj/structure/curtain{color = "#B22222"; pixel_x = 32},/turf/open/floor/carpet/purple,/area/eventmap/inside)
-"aiA" = (/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/carpet/green,/area/eventmap/inside)
-"aiB" = (/obj/structure/table/wood/fancy/orange,/obj/item/clothing/suit/armor/riot/knight/yellow{pixel_x = 4; pixel_y = -4},/obj/item/clothing/suit/armor/riot/knight/yellow,/obj/item/clothing/suit/armor/riot/knight/yellow{pixel_x = -4; pixel_y = 4},/obj/item/clothing/head/helmet/knight/yellow{pixel_x = 4; pixel_y = -4},/obj/item/clothing/head/helmet/knight/yellow,/obj/item/clothing/head/helmet/knight/yellow{pixel_x = -4; pixel_y = 4},/turf/open/floor/wood,/area/eventmap/inside)
-"aiC" = (/obj/structure/sign/departments/chemistry{pixel_y = -32},/turf/open/floor/wood,/area/eventmap/inside)
-"aiD" = (/obj/machinery/vending/snack/green,/turf/open/floor/wood,/area/eventmap/inside)
-"aiE" = (/obj/structure/table/wood,/obj/item/stack/medical/bruise_pack,/obj/item/stack/medical/ointment,/obj/item/candle/infinite,/obj/structure/cable/yellow{icon_state = "1-2"},/obj/machinery/door/firedoor,/turf/open/floor/wood,/area/eventmap/inside)
-"aiF" = (/obj/machinery/smartfridge/chemistry/preloaded,/turf/closed/wall/mineral/wood,/area/eventmap/inside)
-"aiG" = (/obj/structure/table/wood,/obj/item/folder/white,/obj/item/folder/blue,/obj/item/reagent_containers/food/drinks/mug/coco,/obj/machinery/door/firedoor,/turf/open/floor/wood,/area/eventmap/inside)
-"aiH" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/effect/turf_decal/tile/green{dir = 4},/obj/effect/turf_decal/tile/green{dir = 1},/obj/effect/turf_decal/tile/green{dir = 8},/obj/machinery/door/firedoor,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aiI" = (/obj/structure/cable/white{icon_state = "1-4"},/turf/open/floor/carpet/orange,/area/eventmap/inside)
-"aiJ" = (/obj/structure/cable/white{icon_state = "4-8"},/obj/structure/noticeboard/ce{pixel_y = 32},/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"aiK" = (/obj/structure/cable/white{icon_state = "2-4"},/obj/structure/cable/white{icon_state = "2-8"},/obj/structure/cable/white{icon_state = "4-8"},/obj/structure/cable/white{icon_state = "1-4"},/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"aiL" = (/obj/effect/turf_decal/tile/green{dir = 4},/obj/effect/turf_decal/tile/green,/obj/effect/turf_decal/tile/green{dir = 1},/obj/machinery/door/firedoor,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aiM" = (/obj/structure/mineral_door/wood,/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/sepia,/area/eventmap/inside)
-"aiN" = (/obj/structure/showcase/machinery/tv,/turf/open/floor/wood,/area/eventmap/inside)
-"aiO" = (/mob/living/simple_animal/mouse/brown,/turf/open/floor/wood,/area/eventmap/inside)
-"aiP" = (/obj/structure/bed,/obj/effect/spawner/lootdrop/bedsheet,/turf/open/floor/carpet/cyan,/area/eventmap/inside)
-"aiQ" = (/obj/structure/bed,/obj/item/bedsheet/cosmos,/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"aiR" = (/obj/effect/decal/cleanable/blood/tracks,/obj/item/candle/infinite,/turf/open/floor/wood,/area/eventmap/inside)
-"aiS" = (/obj/effect/turf_decal/tile/yellow,/turf/open/floor/plasteel/dark,/area/eventmap/mountain)
-"aiT" = (/obj/structure/cable/yellow{icon_state = "2-4"},/turf/open/indestructible/cobble,/area/eventmap/outside)
-"aiU" = (/obj/structure/chair/wood{dir = 4},/obj/item/chair/wood,/turf/open/floor/carpet/green,/area/eventmap/inside)
-"aiV" = (/obj/structure/table/wood/fancy/green,/obj/item/trash/plate,/turf/open/floor/wood,/area/eventmap/inside)
-"aiW" = (/obj/machinery/chem_master,/turf/open/floor/wood,/area/eventmap/inside)
-"aiX" = (/obj/structure/cable/white{icon_state = "4-8"},/obj/structure/cable/white{icon_state = "1-4"},/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"aiY" = (/obj/structure/cable/white{icon_state = "4-8"},/obj/machinery/light/small{dir = 1},/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"aiZ" = (/obj/machinery/light/small{dir = 1},/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"aja" = (/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/cable/white{icon_state = "2-8"},/obj/structure/cable/white{icon_state = "2-4"},/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"ajb" = (/obj/structure/chair/wood{dir = 1},/obj/effect/landmark/start/chemist,/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"ajc" = (/obj/structure/table/glass,/obj/item/reagent_containers/dropper,/obj/item/reagent_containers/dropper,/obj/item/reagent_containers/glass/beaker/large,/obj/item/reagent_containers/glass/beaker/large,/obj/item/stack/sheet/mineral/plasma,/obj/item/stack/sheet/mineral/plasma,/obj/item/storage/box/beakers,/obj/item/storage/box/beakers,/obj/item/storage/box/beakers/bluespace,/turf/open/floor/wood,/area/eventmap/inside)
-"ajd" = (/obj/structure/chair/wood{dir = 1},/obj/item/toy/plush/catgirl/fermis,/turf/open/floor/wood,/area/eventmap/inside)
-"aje" = (/turf/open/floor/wood{icon_state = "wood-broken"},/area/eventmap/inside)
-"ajf" = (/obj/structure/table/wood,/obj/item/pen,/obj/item/folder/documents,/turf/open/floor/wood,/area/eventmap/inside)
-"ajg" = (/obj/structure/chair/office/light{dir = 8},/turf/open/floor/carpet/cyan,/area/eventmap/inside)
-"ajh" = (/obj/structure/table/wood/fancy/royalblack,/obj/item/clothing/head/hardhat/pumpkinhead/jaqc,/turf/open/floor/wood,/area/eventmap/inside)
-"aji" = (/obj/item/toy/plush/mammal/dog,/turf/open/floor/wood,/area/eventmap/inside)
-"ajj" = (/obj/structure/table/wood,/obj/item/hemostat/supermatter,/turf/open/floor/carpet/cyan,/area/eventmap/inside)
-"ajk" = (/obj/effect/turf_decal/tile/green{dir = 1},/obj/effect/turf_decal/tile/green{dir = 8},/turf/open/floor/plasteel,/area/eventmap/inside)
-"ajl" = (/obj/structure/sign/directions/evac{dir = 8; icon_state = "direction_evac"; pixel_x = 32},/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"ajm" = (/obj/effect/turf_decal/tile/green{dir = 4},/obj/effect/turf_decal/tile/green,/turf/open/floor/plasteel,/area/eventmap/inside)
-"ajn" = (/obj/machinery/light/small{dir = 1},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"ajo" = (/obj/machinery/sleeper/syndie/fullupgrade{dir = 8},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"ajp" = (/obj/machinery/iv_drip,/obj/structure/closet/crate/freezer/blood,/turf/open/floor/sepia,/area/eventmap/inside)
-"ajq" = (/obj/structure/chair/sofa/right{dir = 1},/turf/open/floor/wood{icon_state = "wood-broken"},/area/eventmap/inside)
-"ajr" = (/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"ajs" = (/obj/structure/table/wood,/obj/item/toy/cards/deck/cas/black,/obj/item/toy/cards/deck/cas/black,/turf/open/floor/wood,/area/eventmap/inside)
-"ajt" = (/obj/structure/chair/comfy/plywood,/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"aju" = (/obj/structure/table/wood,/obj/item/toy/cards/deck/syndicate,/obj/item/toy/cards/deck/syndicate,/obj/item/toy/cards/deck/syndicate,/turf/open/floor/wood,/area/eventmap/inside)
-"ajv" = (/obj/structure/table/wood,/obj/item/toy/cards/deck/cas,/obj/item/toy/cards/deck/cas,/turf/open/floor/wood,/area/eventmap/inside)
-"ajw" = (/obj/structure/table/wood,/obj/item/toy/cards/deck,/obj/item/toy/cards/deck,/obj/item/toy/cards/deck,/turf/open/floor/wood,/area/eventmap/inside)
-"ajx" = (/obj/item/clothing/suit/ghost_sheet,/turf/open/floor/wood,/area/eventmap/inside)
-"ajy" = (/obj/structure/spacevine,/turf/closed/wall/mineral/wood,/area/eventmap/inside)
-"ajz" = (/obj/item/paper/pamphlet/ruin/originalcontent/yelling,/turf/closed/wall/mineral/wood,/area/eventmap/inside)
-"ajA" = (/obj/structure/table/wood/fancy/royalblack,/obj/item/key/collar,/turf/open/floor/wood,/area/eventmap/inside)
-"ajB" = (/obj/structure/table/wood/fancy/royalblack,/obj/item/lipstick,/turf/open/floor/wood,/area/eventmap/inside)
-"ajC" = (/obj/machinery/vending/wallmed{pixel_y = 32},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"ajD" = (/obj/effect/decal/cleanable/cobweb/cobweb2,/obj/structure/bed/roller,/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/item/clothing/suit/straight_jacket,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"ajE" = (/obj/effect/decal/cleanable/dirt,/obj/machinery/light/small{dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"ajF" = (/obj/structure/table/wood,/obj/item/reagent_containers/spray/cleaner{pixel_x = 8; pixel_y = 3},/obj/item/reagent_containers/glass/bucket,/obj/effect/decal/cleanable/cobweb,/turf/open/floor/wood,/area/eventmap/inside)
-"ajG" = (/obj/structure/cable/white{icon_state = "1-8"},/obj/structure/cable/white{icon_state = "1-4"},/turf/open/indestructible/cobble,/area/eventmap/outside)
-"ajH" = (/obj/structure/cable/white{icon_state = "4-8"},/obj/structure/cable/white{icon_state = "1-8"},/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"ajI" = (/obj/structure/cable/white{icon_state = "2-8"},/obj/structure/cable/white{icon_state = "2-4"},/obj/structure/cable/white{icon_state = "4-8"},/obj/structure/cable/white{icon_state = "1-8"},/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"ajJ" = (/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/spooktime/cobble/sideE,/area/eventmap/outside)
-"ajK" = (/obj/structure/cable/white{icon_state = "4-8"},/obj/structure/noticeboard/rd{pixel_y = 32},/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"ajL" = (/obj/structure/cable/white{icon_state = "1-8"},/turf/open/floor/carpet/purple,/area/eventmap/inside)
-"ajM" = (/obj/structure/chair/wood{dir = 4},/turf/open/floor/wood{icon_state = "wood-broken5"},/area/eventmap/inside)
-"ajN" = (/obj/item/clothing/suit/ghost_sheet,/turf/open/floor/carpet/purple,/area/eventmap/inside)
-"ajO" = (/turf/open/floor/carpet/purple,/area/eventmap/inside)
-"ajP" = (/obj/structure/table/wood,/obj/item/pen,/obj/item/storage/box/fountainpens,/obj/effect/decal/cleanable/cobweb,/turf/open/floor/wood,/area/eventmap/inside)
-"ajQ" = (/obj/structure/chair/office/dark{dir = 8},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"ajR" = (/obj/structure/table/wood,/obj/item/flashlight/lantern,/obj/item/folder/syndicate/red,/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"ajS" = (/obj/item/statuebust,/turf/open/floor/wood,/area/eventmap/inside)
-"ajT" = (/obj/item/statuebust,/turf/open/floor/wood{icon_state = "wood-broken2"},/area/eventmap/inside)
-"ajU" = (/obj/structure/table/wood/fancy/green,/obj/item/storage/fancy/donut_box,/turf/open/floor/wood,/area/eventmap/inside)
-"ajV" = (/obj/machinery/chem_dispenser,/turf/open/floor/wood,/area/eventmap/inside)
-"ajW" = (/obj/machinery/chem_heater,/obj/effect/decal/cleanable/greenglow,/turf/open/floor/wood,/area/eventmap/inside)
-"ajX" = (/obj/structure/closet/crate/freezer/surplus_limbs,/obj/structure/cable/yellow{icon_state = "0-4"},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"ajY" = (/obj/structure/cable/yellow{icon_state = "1-8"},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"ajZ" = (/obj/structure/table/wood,/obj/item/cautery{pixel_y = 3},/obj/item/retractor,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aka" = (/obj/item/mop,/obj/machinery/light/small{dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"akb" = (/obj/structure/bed,/obj/item/bedsheet/rd/royal_cape,/obj/effect/landmark/start/research_director,/turf/open/floor/carpet/purple,/area/eventmap/inside)
-"akc" = (/obj/structure/table/wood/fancy/orange,/obj/item/clothing/suit/armor/riot/knight/red{pixel_x = 4; pixel_y = -4},/obj/item/clothing/suit/armor/riot/knight/red,/obj/item/clothing/suit/armor/riot/knight/red{pixel_x = -4; pixel_y = 4},/obj/item/clothing/head/helmet/knight/red{pixel_x = 4; pixel_y = -4},/obj/item/clothing/head/helmet/knight/red,/obj/item/clothing/head/helmet/knight/red{pixel_x = -4; pixel_y = 4},/obj/machinery/light/small{dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"akd" = (/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/cable/white{icon_state = "2-8"},/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"ake" = (/obj/structure/sign/poster/official/no_erp,/turf/closed/wall/r_wall,/area/eventmap/inside)
-"akf" = (/obj/machinery/light/small{dir = 8},/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"akg" = (/obj/effect/decal/cleanable/cobweb,/turf/open/floor/wood,/area/eventmap/inside)
-"akh" = (/obj/structure/chair/wood/wings,/mob/living/simple_animal/astral,/turf/open/floor/wood{icon_state = "wood-broken5"},/area/eventmap/inside)
-"aki" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/mob/living/simple_animal/hostile/retaliate/bat,/turf/open/floor/wood,/area/eventmap/inside)
-"akj" = (/obj/structure/chair/wood/wings,/turf/open/floor/wood,/area/eventmap/inside)
-"akk" = (/obj/structure/chair/wood/wings,/turf/open/floor/wood{icon_state = "wood-broken2"},/area/eventmap/inside)
-"akl" = (/obj/structure/bed,/obj/effect/spawner/lootdrop/bedsheet,/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"akm" = (/obj/structure/mineral_door/woodrustic,/obj/structure/barricade/wooden/crude,/obj/structure/spacevine,/turf/open/floor/wood,/area/eventmap/inside)
-"akn" = (/obj/structure/table/wood/fancy/green,/obj/item/chair/wood,/obj/item/clothing/glasses/hud/health,/obj/item/clothing/glasses/hud/health,/obj/item/clothing/glasses/hud/health,/turf/open/floor/wood,/area/eventmap/inside)
-"ako" = (/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"akp" = (/obj/effect/landmark/start/chief_engineer,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"akq" = (/obj/effect/landmark/start/research_director,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"akr" = (/obj/machinery/light/small{dir = 4},/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"aks" = (/obj/structure/closet/wardrobe/chemistry_white,/obj/machinery/light/small{dir = 8},/obj/item/grenade/chem_grenade/glitter/blue,/obj/item/grenade/chem_grenade/glitter/pink,/obj/item/grenade/chem_grenade/glitter/white,/turf/open/floor/wood,/area/eventmap/inside)
-"akt" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/effect/decal/cleanable/chem_pile,/obj/machinery/light/small,/turf/open/floor/wood,/area/eventmap/inside)
-"aku" = (/obj/structure/closet/secure_closet/medical1,/turf/open/floor/wood,/area/eventmap/inside)
-"akv" = (/obj/machinery/light{dir = 8},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"akw" = (/obj/structure/chair/wood/wings{dir = 4},/turf/open/floor/wood,/area/eventmap/inside)
-"akx" = (/obj/structure/table/wood/fancy/red,/obj/item/book_of_babel,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"aky" = (/obj/structure/table/wood/fancy/red,/obj/item/candle/infinite,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"akz" = (/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"akA" = (/turf/open/floor/spooktime/riverwatermotion,/area/eventmap/outside)
-"akB" = (/obj/structure/table/wood/fancy/red,/obj/item/toy/plush/lampplushie,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"akC" = (/obj/structure/table/wood/fancy/red,/obj/item/book/granter/action/drink_fling,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"akD" = (/obj/structure/table/wood/fancy/red,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"akE" = (/obj/structure/table/wood/fancy/red,/obj/item/storage/bag/books,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"akF" = (/obj/structure/closet/cabinet,/obj/item/codespeak_manual/unlimited,/obj/item/cookiesynth,/obj/item/fugu_gland,/turf/open/floor/wood,/area/eventmap/inside)
-"akG" = (/obj/structure/dresser,/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"akH" = (/obj/item/ectoplasm,/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"akI" = (/obj/structure/table/wood,/obj/item/flashlight/lamp/bananalamp,/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"akJ" = (/obj/machinery/washing_machine,/obj/effect/decal/cleanable/cobweb,/turf/open/floor/wood,/area/eventmap/inside)
-"akK" = (/mob/living/simple_animal/hostile/retaliate/bat{attack_sound = 'sound/spookoween/ahaha.ogg'; desc = "A spooky, floating washing machine possesed by some specture! Responsibilities, clearly the scariest thing imaginable."; icon = 'icons/obj/machines/washing_machine.dmi'; icon_dead = "wm_1_0"; icon_gib = "wm_1_0"; icon_living = "wm_1_0"; icon_state = "wm_1_0"; melee_damage_lower = 0; melee_damage_upper = 0; name = "Posessed washing machine"},/turf/open/floor/wood,/area/eventmap/inside)
-"akL" = (/obj/structure/closet/cabinet,/obj/item/instrument/accordion,/obj/item/instrument/bikehorn,/obj/item/instrument/eguitar,/obj/item/instrument/glockenspiel,/turf/open/floor/wood,/area/eventmap/inside)
-"akM" = (/obj/structure/table/wood/fancy/monochrome,/obj/item/instrument/violin/golden,/turf/open/floor/wood,/area/eventmap/inside)
-"akN" = (/obj/structure/table/wood/fancy/monochrome,/obj/machinery/chem_dispenser/drinks/fullupgrade,/turf/open/floor/wood,/area/eventmap/inside)
-"akO" = (/obj/structure/table/wood/fancy/monochrome,/obj/machinery/chem_dispenser/drinks/beer/fullupgrade,/turf/open/floor/wood,/area/eventmap/inside)
-"akP" = (/obj/structure/table/wood/fancy/monochrome,/obj/item/instrument/trumpet/spectral,/obj/item/instrument/trombone/spectral,/obj/item/instrument/saxophone/spectral,/turf/open/floor/wood,/area/eventmap/inside)
-"akQ" = (/obj/structure/closet/cabinet,/obj/item/instrument/guitar,/obj/item/instrument/harmonica,/obj/item/instrument/piano_synth,/obj/item/instrument/recorder,/turf/open/floor/wood,/area/eventmap/inside)
-"akR" = (/obj/machinery/jukebox,/turf/open/floor/wood,/area/eventmap/inside)
-"akS" = (/obj/structure/bookcase/random/reference,/turf/open/floor/wood,/area/eventmap/inside)
-"akT" = (/obj/structure/table/wood/fancy/orange,/obj/item/clothing/suit/armor/riot/knight/blue{pixel_x = 4; pixel_y = -4},/obj/item/clothing/suit/armor/riot/knight/blue,/obj/item/clothing/suit/armor/riot/knight/blue{pixel_x = -4; pixel_y = 4},/obj/item/stamp/clown,/obj/item/clothing/head/helmet/knight/blue{pixel_x = 4; pixel_y = -4},/obj/item/clothing/head/helmet/knight/blue,/obj/item/clothing/head/helmet/knight/blue{pixel_x = -4; pixel_y = 4},/turf/open/floor/wood,/area/eventmap/inside)
-"akU" = (/obj/structure/dresser,/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/wood,/area/eventmap/inside)
-"akV" = (/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/cable/white{icon_state = "1-8"},/obj/structure/cable/white{icon_state = "1-4"},/obj/machinery/door/airlock/command/glass{name = "Bridge"; req_access_txt = "19"},/turf/open/floor/wood,/area/eventmap/inside)
-"akW" = (/obj/structure/table/wood/fancy,/turf/open/floor/wood,/area/eventmap/inside)
-"akX" = (/obj/effect/landmark/start/medical_doctor,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"akY" = (/obj/structure/chair/wood/wings{dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"akZ" = (/obj/machinery/computer/security{icon_state = "computer"; dir = 4},/obj/machinery/light/small{brightness = 3; dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"ala" = (/obj/machinery/computer/station_alert,/turf/open/floor/wood,/area/eventmap/inside)
-"alb" = (/obj/machinery/computer/monitor{name = "bridge power monitoring console"},/turf/open/floor/wood,/area/eventmap/inside)
-"alc" = (/obj/machinery/computer/bounty,/turf/open/floor/wood,/area/eventmap/inside)
-"ald" = (/obj/machinery/computer/cargo/request,/turf/open/floor/wood,/area/eventmap/inside)
-"ale" = (/obj/machinery/computer/communications,/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"alf" = (/obj/structure/table/wood,/obj/machinery/computer/med_data/laptop,/turf/open/floor/wood,/area/eventmap/inside)
-"alg" = (/obj/effect/turf_decal/stripes/asteroid/corner,/turf/open/floor/wood,/area/eventmap/inside)
-"alh" = (/obj/structure/table/wood,/obj/item/circular_saw,/obj/item/hemostat,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"ali" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood{icon_state = "wood-broken2"},/area/eventmap/inside)
-"alj" = (/obj/effect/decal/cleanable/glass,/obj/item/organ/tail/cat,/obj/machinery/light/broken{dir = 4},/turf/open/floor/wood,/area/eventmap/inside)
-"alk" = (/obj/effect/turf_decal/stripes/asteroid/line,/obj/structure/table/wood,/obj/item/paper_bin,/obj/item/pen,/turf/open/floor/wood,/area/eventmap/inside)
-"all" = (/obj/structure/table/wood/fancy/red,/obj/item/book/granter/crafting_recipe/under_the_oven,/obj/item/book/granter/crafting_recipe/cooking_sweets_101,/obj/item/book/granter/crafting_recipe/coldcooking,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"alm" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"aln" = (/obj/structure/table/wood/fancy/red,/obj/item/storage/book/bible/booze,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"alo" = (/obj/structure/table/wood/fancy/red,/obj/machinery/computer/libraryconsole,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"alp" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/carpet/purple,/area/eventmap/inside)
-"alq" = (/obj/structure/sign/poster/official/ian,/turf/closed/wall/mineral/wood,/area/eventmap/inside)
-"alr" = (/mob/living/simple_animal/crab/evil,/turf/open/floor/wood,/area/eventmap/inside)
-"als" = (/mob/living/simple_animal/mouse/gray,/turf/open/floor/wood,/area/eventmap/inside)
-"alt" = (/mob/living/simple_animal/hostile/retaliate/bat{attack_sound = 'sound/spookoween/ahaha.ogg'; desc = "A spooky, floating instrument possesed by some specture! Wooo~!"; icon = 'icons/obj/musician.dmi'; icon_dead = "synth"; icon_gib = "synth"; icon_living = "synth"; icon_state = "synth"; melee_damage_lower = 0; melee_damage_upper = 0; name = "Posessed synth"},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"alu" = (/mob/living/simple_animal/hostile/retaliate/bat{attack_sound = 'sound/spookoween/ahaha.ogg'; desc = "A spooky, floating instrument possesed by some specture! Wooo~!"; icon = 'icons/obj/musician.dmi'; icon_dead = "glockenspiel"; icon_gib = "glockenspiel"; icon_living = "glockenspiel"; icon_state = "glockenspiel"; melee_damage_lower = 0; melee_damage_upper = 0; name = "Posessed glockenspiel"},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"alv" = (/obj/machinery/light/small,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"alw" = (/obj/structure/table/wood,/obj/item/toy/cards/deck/syndicate,/turf/open/floor/wood/damturf/broken3,/area/eventmap/mountaininside)
-"alx" = (/obj/effect/turf_decal/stripes/asteroid/line,/obj/structure/table/wood,/turf/open/floor/wood,/area/eventmap/inside)
-"aly" = (/obj/effect/turf_decal/stripes/asteroid/line,/turf/open/floor/wood,/area/eventmap/inside)
-"alz" = (/obj/machinery/vending/wardrobe/chem_wardrobe,/turf/open/floor/wood,/area/eventmap/inside)
-"alA" = (/obj/structure/closet/cabinet,/turf/open/floor/carpet,/area/eventmap/inside)
-"alB" = (/obj/structure/window/fulltile,/obj/structure/barricade/wooden/crude,/obj/effect/spawner/structure/window,/turf/open/floor/wood,/area/eventmap/inside)
-"alC" = (/mob/living/simple_animal/hostile/retaliate/bat/secbat,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"alD" = (/obj/structure/chair/wood/wings{dir = 1},/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"alE" = (/mob/living/simple_animal/hostile/retaliate/bat,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"alF" = (/obj/item/toy/cattoy,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"alG" = (/obj/structure/dresser,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"alH" = (/obj/structure/closet/cabinet,/obj/item/storage/daki,/obj/item/valentine,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"alI" = (/obj/machinery/pdapainter,/turf/open/floor/wood,/area/eventmap/inside)
-"alJ" = (/mob/living/simple_animal/hostile/retaliate/bat{attack_sound = 'sound/spookoween/ahaha.ogg'; desc = "A floating shopping list. It has the words Milk, eggs and cheese on it."; icon = 'icons/obj/bureaucracy.dmi'; icon_dead = "paper_words"; icon_living = "paper_words"; icon_state = "paper_words"; melee_damage_lower = 0; melee_damage_upper = 0; name = "Floating Shopping List"},/turf/open/floor/wood,/area/eventmap/inside)
-"alK" = (/obj/structure/bedsheetbin/towel,/obj/structure/table/reinforced/brass,/obj/item/storage/fancy/heart_box,/turf/open/floor/wood,/area/eventmap/inside)
-"alL" = (/obj/structure/flora/ausbushes/sunnybush,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"alM" = (/obj/item/chair/wood/wings{dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"alN" = (/obj/structure/bookcase/manuals/engineering,/turf/open/floor/wood,/area/eventmap/inside)
-"alO" = (/obj/machinery/photocopier,/turf/open/floor/wood,/area/eventmap/inside)
-"alP" = (/obj/structure/mineral_door/wood{name = "Costumes and Luxury Dorms"},/turf/open/floor/wood,/area/eventmap/inside)
-"alQ" = (/obj/structure/table/wood,/obj/item/toy/cards/deck/cas/black,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"alR" = (/obj/effect/spawner/structure/window/reinforced/tinted,/turf/open/floor/wood,/area/eventmap/inside)
-"alS" = (/obj/effect/turf_decal/caution/white{dir = 1; icon_state = "caution_white"; pixel_y = -8},/turf/open/floor/wood/damturf/broken7,/area/eventmap/inside)
-"alT" = (/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/cable/yellow{icon_state = "1-4"},/obj/structure/cable/yellow{icon_state = "2-4"},/turf/open/floor/wood,/area/eventmap/inside)
-"alU" = (/obj/machinery/door/airlock/wood/dorms/dorm03,/turf/open/floor/wood,/area/eventmap/inside)
-"alV" = (/obj/structure/table/wood,/obj/machinery/computer/secure_data/laptop{icon_state = "laptop"; dir = 4; pixel_y = 6},/turf/open/floor/wood,/area/eventmap/inside)
-"alW" = (/obj/structure/chair/office/dark{dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"alX" = (/obj/structure/chair/office/dark{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"alY" = (/obj/structure/table/glass,/obj/machinery/reagentgrinder,/obj/item/reagent_containers/glass/beaker/large,/obj/structure/cable/yellow{icon_state = "0-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"alZ" = (/obj/structure/cloth_pile,/obj/effect/turf_decal/tile/green{dir = 4},/obj/effect/turf_decal/tile/green,/turf/open/floor/plasteel,/area/eventmap/inside)
-"ama" = (/obj/structure/chair/office/dark{dir = 1},/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"amb" = (/obj/structure/closet/secure_closet/medical2,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"amc" = (/obj/machinery/computer/operating{dir = 1},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"amd" = (/obj/structure/table/optable,/obj/item/healthanalyzer/advanced,/obj/item/clothing/gloves/color/latex/nitrile,/obj/item/clothing/mask/surgical,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"ame" = (/obj/structure/bookcase/random/adult,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"amf" = (/obj/structure/bookcase/random/fiction,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"amg" = (/obj/structure/bookcase/random/nonfiction{books_to_load = 5},/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"amh" = (/obj/structure/bookcase/random/reference,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"ami" = (/obj/structure/bookcase/random/religion,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"amj" = (/obj/structure/bookcase/manuals/medical,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"amk" = (/turf/open/floor/plasteel/stairs/medium,/area/eventmap/inside)
-"aml" = (/obj/structure/flora/grass/jungle/b,/obj/effect/wisp,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"amm" = (/obj/item/candle/infinite,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"amn" = (/obj/structure/flora/junglebush{icon_state = "grassa4"},/obj/effect/wisp,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"amo" = (/obj/item/toy/fluff/tennis_poly/tri/squeak/rainbow,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"amp" = (/obj/item/seeds/pumpkin,/turf/open/floor/wood,/area/eventmap/inside)
-"amq" = (/obj/structure/bedsheetbin/color,/obj/structure/table/reinforced/brass,/obj/item/storage/fancy/donut_box,/turf/open/floor/wood,/area/eventmap/inside)
-"amr" = (/obj/item/chair/wood/wings{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"ams" = (/mob/living/simple_animal/hostile/retaliate/bat{attack_sound = 'sound/spookoween/ahaha.ogg'; desc = "A spooky, floating instrument possesed by some specture! Wooo~!"; icon = 'icons/obj/musician.dmi'; icon_dead = "trumpet"; icon_gib = "trumpet"; icon_living = "trumpet"; icon_state = "trumpet"; melee_damage_lower = 0; melee_damage_upper = 0; name = "Posessed trumpet"},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"amt" = (/mob/living/simple_animal/hostile/retaliate/bat{attack_sound = 'sound/spookoween/ahaha.ogg'; desc = "A spooky, floating instrument possesed by some specture! Wooo~!"; icon = 'icons/obj/musician.dmi'; icon_dead = "guitar"; icon_gib = "guitar"; icon_living = "guitar"; icon_state = "guitar"; melee_damage_lower = 0; melee_damage_upper = 0; name = "Posessed Guitar"},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"amu" = (/mob/living/simple_animal/hostile/retaliate/bat{attack_sound = 'sound/spookoween/ahaha.ogg'; desc = "A spooky, floating instrument possesed by some specture! Wooo~!"; icon = 'icons/obj/musician.dmi'; icon_dead = "violin"; icon_gib = "violin"; icon_living = "violin"; icon_state = "violin"; melee_damage_lower = 0; melee_damage_upper = 0; name = "Posessed violin"},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"amv" = (/mob/living/simple_animal/hostile/retaliate/bat{attack_sound = 'sound/spookoween/ahaha.ogg'; desc = "A spooky, floating instrument possesed by some specture! Wooo~!"; icon = 'icons/obj/musician.dmi'; icon_dead = "saxophone"; icon_gib = "saxophone"; icon_living = "saxophone"; icon_state = "saxophone"; melee_damage_lower = 0; melee_damage_upper = 0; name = "Posessed saxophone"},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"amw" = (/obj/structure/chair/wood/wings{dir = 8},/turf/open/floor/wood{icon_state = "wood-broken6"},/area/eventmap/inside)
-"amx" = (/obj/structure/table/wood,/obj/item/scalpel,/obj/item/surgical_drapes,/obj/item/surgicaldrill,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"amy" = (/obj/structure/table/wood,/obj/item/storage/box/donkpockets,/obj/machinery/light/small{dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"amz" = (/obj/structure/bookcase/random/religion,/turf/open/floor/wood,/area/eventmap/inside)
-"amA" = (/obj/structure/bookcase/random/fiction,/turf/open/floor/wood,/area/eventmap/inside)
-"amB" = (/obj/structure/chair/wood{dir = 4},/turf/open/floor/carpet/green,/area/eventmap/inside)
-"amC" = (/obj/structure/table/wood/fancy/green,/turf/open/floor/wood,/area/eventmap/inside)
-"amD" = (/obj/structure/table/reinforced,/obj/structure/table/reinforced,/obj/item/paper/fluff/balls/spookyasylum{name = "paper - 10/7/2559"},/turf/open/floor/plating,/area/eventmap/mountaininside)
-"amE" = (/obj/machinery/door/airlock/medical/glass{name = "Chemistry Lab"; req_access_txt = "5; 33"},/obj/machinery/door/firedoor,/obj/machinery/door/firedoor,/turf/open/floor/wood,/area/eventmap/inside)
-"amF" = (/obj/structure/chair/wood/wings{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"amG" = (/obj/structure/table/wood,/obj/machinery/microwave,/turf/open/floor/wood,/area/eventmap/inside)
-"amH" = (/obj/structure/chair/wood{dir = 4},/turf/open/floor/wood,/area/eventmap/inside)
-"amI" = (/obj/structure/table/wood/fancy/green,/obj/item/toy/figure/cmo,/obj/item/megaphone/command,/turf/open/floor/wood,/area/eventmap/inside)
-"amJ" = (/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/cable/white{icon_state = "2-8"},/obj/structure/cable/white{icon_state = "2-4"},/obj/structure/cable/white{icon_state = "1-4"},/obj/structure/cable/white{icon_state = "1-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"amK" = (/obj/machinery/chem_heater,/turf/open/floor/wood,/area/eventmap/inside)
-"amL" = (/obj/item/candle/infinite,/obj/machinery/light/small/broken{dir = 8},/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"amM" = (/obj/structure/flora/ausbushes/palebush,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"amN" = (/obj/item/candle/infinite,/obj/structure/flora/grass/jungle/b,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"amO" = (/obj/structure/closet/wardrobe/chemistry_white,/obj/machinery/light/small{dir = 4; light_color = "#d8b1b1"},/turf/open/floor/wood,/area/eventmap/inside)
-"amP" = (/obj/structure/bookcase/random/nonfiction,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"amQ" = (/obj/structure/chair/wood{dir = 4},/obj/effect/landmark/start/virologist,/obj/structure/sign/departments/chemistry{pixel_x = -32},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"amR" = (/obj/structure/bookcase/manuals/research_and_development,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"amS" = (/obj/item/hot_potato/harmless/toy{name = "Rotato potato"},/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"amT" = (/obj/structure/bed/dogbed,/mob/living/simple_animal/pet/dog/corgi{icon_state = "corgigrey"; name = "Ghost corgi"},/turf/open/floor/wood,/area/eventmap/inside)
-"amU" = (/obj/item/stack/sheet/bone,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"amV" = (/obj/structure/bed/dogbed{name = "cat bed"},/mob/living/simple_animal/pet/cat/custom_cat{name = "Ghost cat"},/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"amW" = (/obj/structure/table/wood,/obj/item/flashlight/lamp,/obj/item/reagent_containers/food/snacks/grown/tea/catnip{icon_state = "coffee_robusta"},/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"amX" = (/obj/item/mop,/obj/item/mop/advanced,/obj/structure/closet/jcloset,/obj/item/reagent_containers/spray/cleaner,/obj/item/reagent_containers/spray/cleaner,/obj/item/reagent_containers/spray/cleaner,/obj/item/extinguisher/advanced,/turf/open/floor/wood,/area/eventmap/inside)
-"amY" = (/obj/structure/bedsheetbin,/obj/structure/table/reinforced/brass,/obj/item/storage/fancy/candle_box,/turf/open/floor/wood,/area/eventmap/inside)
-"amZ" = (/obj/structure/chair/wood/wings{dir = 4},/turf/open/floor/wood{icon_state = "wood-broken5"},/area/eventmap/inside)
-"ana" = (/obj/structure/flora/grass/jungle/b,/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"anb" = (/turf/open/floor/grass/fakebasalt,/area/eventmap/outside)
-"anc" = (/obj/structure/flora/grass/jungle/b,/turf/open/floor/grass/fakebasalt,/area/eventmap/outside)
-"and" = (/obj/structure/mineral_door/woodrustic,/turf/open/floor/spooktime/cobble/cornerNW,/area/eventmap/outside)
-"ane" = (/obj/structure/flora/grass/jungle/b{icon_state = "bushb"},/turf/open/floor/spooktime/cobble/sideN,/area/eventmap/outside)
-"anf" = (/obj/structure/flora/grass/jungle/b{icon_state = "grassb2"},/turf/open/floor/spooktime/cobble/cornerNE,/area/eventmap/outside)
-"ang" = (/obj/structure/table/wood/fancy/black,/obj/item/storage/box/gloves,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"anh" = (/obj/machinery/atmospherics/components/unary/cryo_cell,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"ani" = (/obj/structure/chair/office/dark{dir = 4},/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"anj" = (/obj/machinery/atmospherics/pipe/simple{dir = 6},/obj/machinery/light/small{dir = 1},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"ank" = (/obj/machinery/atmospherics/components/unary/thermomachine/freezer{dir = 8},/obj/effect/decal/cleanable/cobweb/cobweb2,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"anl" = (/obj/structure/table/wood/fancy/green,/obj/item/camera,/turf/open/floor/wood,/area/eventmap/inside)
-"anm" = (/obj/structure/chair/wood,/obj/effect/landmark/start/chemist,/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"ann" = (/obj/structure/table/glass,/obj/item/reagent_containers/dropper,/obj/item/reagent_containers/glass/beaker/large,/obj/item/stack/sheet/mineral/plasma,/obj/item/storage/box/beakers,/turf/open/floor/wood,/area/eventmap/inside)
-"ano" = (/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"anp" = (/obj/structure/chair/wood{dir = 4},/obj/machinery/light/small{dir = 8},/obj/effect/landmark/start/medical_doctor,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"anq" = (/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"anr" = (/obj/machinery/computer/card{dir = 8},/obj/structure/cable/white{icon_state = "2-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"ans" = (/obj/machinery/light/small,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"ant" = (/obj/structure/table/wood/fancy/black,/obj/item/stack/medical/bruise_pack,/obj/item/stack/medical/ointment,/obj/item/stack/medical/gauze,/obj/item/storage/pill_bottle/mutadone,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"anu" = (/obj/machinery/atmospherics/pipe/simple{dir = 5},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"anv" = (/obj/structure/spacevine,/obj/structure/spacevine,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/outside)
-"anw" = (/obj/structure/flora/rock/jungle,/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"anx" = (/obj/structure/flora/rock/pile/largejungle,/turf/open/indestructible/cobble,/area/eventmap/outside)
-"any" = (/obj/structure/mineral_door/woodrustic,/turf/open/floor/spooktime/cobble/sideW,/area/eventmap/outside)
-"anz" = (/obj/structure/flora/grass/jungle/b{icon_state = "bushb3"},/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"anA" = (/obj/structure/fluff/fokoff_sign{desc = "A crudely-made sign with the words 'too spooky' written in some sort of red paint."},/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"anB" = (/obj/structure/flora/grass/jungle/b{icon_state = "bushb2"},/turf/open/floor/spooktime/cobble/sideE,/area/eventmap/outside)
-"anC" = (/obj/machinery/atmospherics/pipe/manifold,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"anD" = (/obj/machinery/atmospherics/pipe/manifold4w,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"anE" = (/obj/machinery/atmospherics/components/unary/portables_connector/visible{dir = 8},/obj/machinery/portable_atmospherics/canister/oxygen,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"anF" = (/obj/structure/mineral_door/wood,/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"anG" = (/obj/structure/mineral_door/wood,/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"anH" = (/obj/structure/flora/ausbushes/leafybush,/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"anI" = (/obj/structure/flora/grass/jungle/b{icon_state = "grassa5"},/turf/open/floor/spooktime/cobble/sideS,/area/eventmap/outside)
-"anJ" = (/turf/open/floor/wood{icon_state = "wood-broken7"},/area/eventmap/inside)
-"anK" = (/obj/structure/bookcase/random/nonfiction,/turf/open/floor/wood{icon_state = "wood-broken"},/area/eventmap/inside)
-"anL" = (/obj/structure/bookcase/random/adult,/turf/open/floor/wood{icon_state = "wood-broken5"},/area/eventmap/inside)
-"anM" = (/mob/living/simple_animal/hostile/retaliate/bat{attack_sound = 'sound/spookoween/ahaha.ogg'; desc = "A spooky, floating instrument possesed by some specture! Wooo~!"; icon = 'icons/obj/musician.dmi'; icon_dead = "golden_violin"; icon_gib = "golden_violin"; icon_living = "golden_violin"; icon_state = "golden_violin"; melee_damage_lower = 0; melee_damage_upper = 0; name = "Posessed golden violin"},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"anN" = (/obj/machinery/jukebox/disco/indestructible{req_one_access = list()},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"anO" = (/mob/living/simple_animal/hostile/retaliate/bat{attack_sound = 'sound/spookoween/ahaha.ogg'; desc = "A spooky, floating instrument possesed by some specture! Wooo~!"; icon = 'icons/obj/musician.dmi'; icon_dead = "eguitar"; icon_gib = "eguitar"; icon_living = "eguitar"; icon_state = "eguitar"; melee_damage_lower = 0; melee_damage_upper = 0; name = "Posessed electric guitar"},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"anP" = (/obj/effect/spawner/structure/window,/turf/open/floor/wood,/area/eventmap/inside)
-"anQ" = (/obj/machinery/door/airlock{name = "Bar Backroom"; req_access_txt = "25"},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"anR" = (/obj/structure/mineral_door/wood,/obj/effect/decal/cleanable/dirt,/turf/open/floor/plasteel,/area/eventmap/inside)
-"anS" = (/obj/effect/turf_decal/stripes/asteroid/line{icon_state = "ast_warn"; dir = 4},/turf/open/floor/wood,/area/eventmap/inside)
-"anT" = (/obj/machinery/door/airlock/wood/dorms/dorm18,/turf/open/floor/wood,/area/eventmap/inside)
-"anU" = (/obj/structure/table/wood,/obj/structure/cable/yellow{icon_state = "1-2"},/obj/machinery/door/firedoor,/turf/open/floor/wood,/area/eventmap/inside)
-"anV" = (/obj/structure/curtain{color = "#B22222"; pixel_x = 32},/turf/open/floor/carpet,/area/eventmap/inside)
-"anW" = (/obj/structure/table/wood/fancy/purple,/obj/item/reagent_containers/syringe/charcoal,/obj/item/reagent_containers/glass/bottle/epinephrine,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"anX" = (/obj/effect/turf_decal/tile/green,/obj/effect/turf_decal/tile/green{dir = 4},/turf/open/floor/plasteel,/area/eventmap/inside)
-"anY" = (/obj/item/candle/infinite,/obj/structure/flora/grass/jungle/b{icon_state = "grassb2"},/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"anZ" = (/obj/structure/table/wood/fancy/purple,/obj/item/reagent_containers/glass/beaker/cryoxadone,/obj/item/reagent_containers/glass/beaker/cryoxadone,/obj/item/reagent_containers/glass/beaker/cryoxadone,/obj/item/reagent_containers/glass/beaker/cryoxadone,/obj/item/wrench/medical,/obj/item/storage/pill_bottle/mannitol,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aoa" = (/obj/machinery/vending/cigarette/beach,/turf/open/floor/wood,/area/eventmap/inside)
-"aob" = (/obj/structure/chair/wood,/turf/open/floor/carpet/green,/area/eventmap/inside)
-"aoc" = (/obj/machinery/libraryscanner,/turf/open/floor/wood,/area/eventmap/inside)
-"aod" = (/obj/structure/table/wood,/obj/machinery/computer/libraryconsole/bookmanagement,/obj/structure/window/spawner/east,/turf/open/floor/carpet,/area/eventmap/inside)
-"aoe" = (/obj/structure/chair/comfy/black,/turf/open/floor/wood,/area/eventmap/inside)
-"aof" = (/obj/structure/table/wood/fancy,/obj/machinery/light/small{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"aog" = (/obj/effect/decal/cleanable/blood/tracks,/obj/structure/falsewall/wood,/turf/open/floor/wood,/area/eventmap/inside)
-"aoh" = (/obj/machinery/light,/turf/open/floor/spooktime/cobble/sideS,/area/eventmap/outside)
-"aoi" = (/obj/machinery/camera/emp_proof{c_tag = "Containment - Particle Accelerator"; dir = 1; network = list("singularity")},/turf/open/floor/spooktime/cobble/sideS,/area/eventmap/outside)
-"aoj" = (/obj/machinery/light,/obj/item/banner/security,/obj/structure/sign/departments/security{pixel_y = -32},/turf/open/floor/spooktime/cobble/sideS,/area/eventmap/outside)
-"aok" = (/obj/structure/sign/departments/security{pixel_y = -32},/obj/item/banner/security,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"aol" = (/obj/structure/table/wood,/obj/item/clothing/glasses/regular,/obj/item/reagent_containers/food/drinks/bottle/rum{name = "Cookie's home made rum"},/obj/effect/decal/cleanable/cobweb,/obj/item/candle/infinite,/turf/open/floor/wood,/area/eventmap/inside)
-"aom" = (/obj/machinery/light{dir = 1},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aon" = (/obj/structure/table/wood,/turf/open/floor/wood,/area/eventmap/inside)
-"aoo" = (/obj/effect/decal/cleanable/dirt,/obj/effect/turf_decal/tile/green{dir = 4},/obj/effect/turf_decal/tile/green{dir = 8},/obj/effect/turf_decal/tile/green{dir = 1},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aop" = (/obj/effect/turf_decal/tile/green{dir = 4},/obj/effect/turf_decal/tile/green{dir = 1},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aoq" = (/obj/structure/reagent_dispensers/water_cooler,/turf/open/floor/carpet/blackred,/area/eventmap/inside)
-"aor" = (/obj/effect/turf_decal/tile/green{dir = 4},/obj/effect/turf_decal/tile/green{dir = 1},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aos" = (/obj/effect/turf_decal/tile/green{dir = 1},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aot" = (/obj/effect/turf_decal/tile/green{dir = 4},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aou" = (/obj/machinery/recharge_station,/obj/effect/turf_decal/tile/green{dir = 4},/obj/effect/turf_decal/tile/green{dir = 1},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aov" = (/obj/machinery/limbgrower,/obj/effect/turf_decal/tile/green{dir = 4},/obj/effect/turf_decal/tile/green{dir = 1},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aow" = (/obj/effect/turf_decal/tile/green,/obj/effect/turf_decal/tile/green{dir = 4},/obj/effect/turf_decal/tile/green{dir = 1},/obj/machinery/door/firedoor,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aox" = (/obj/machinery/vending/medical,/turf/open/floor/wood,/area/eventmap/inside)
-"aoy" = (/obj/effect/spawner/lootdrop/keg,/turf/open/floor/wood,/area/eventmap/inside)
-"aoz" = (/obj/structure/table/wood/fancy/green,/obj/effect/spawner/lootdrop/costume,/obj/machinery/light,/turf/open/floor/wood,/area/eventmap/inside)
-"aoA" = (/obj/structure/table/wood/fancy/green,/obj/item/defibrillator/loaded,/obj/item/defibrillator/loaded,/turf/open/floor/wood,/area/eventmap/inside)
-"aoB" = (/obj/structure/table_frame/wood,/obj/item/chair/wood,/obj/item/stack/sheet/mineral/wood,/obj/item/storage/backpack/satchel/vir,/turf/open/floor/wood,/area/eventmap/inside)
-"aoC" = (/obj/machinery/bookbinder,/turf/open/floor/wood,/area/eventmap/inside)
-"aoD" = (/obj/structure/cable/yellow{icon_state = "2-4"},/turf/open/floor/carpet,/area/eventmap/inside)
-"aoE" = (/obj/structure/cable/yellow{icon_state = "4-8"},/obj/effect/landmark/start/librarian,/turf/open/floor/carpet,/area/eventmap/inside)
-"aoF" = (/obj/effect/temp_visual/love_heart,/turf/open/floor/wood,/area/eventmap/inside)
-"aoG" = (/obj/effect/decal/cleanable/cobweb,/turf/open/floor/wood{icon_state = "wood-broken2"},/area/eventmap/inside)
-"aoH" = (/obj/structure/chair/bronze,/turf/open/floor/wood,/area/eventmap/inside)
-"aoI" = (/obj/structure/life_candle,/turf/open/floor/wood,/area/eventmap/inside)
-"aoJ" = (/obj/mecha/working/ripley/deathripley{equipment_disabled = 1; light_color = "#FAA019"; lights_power = 3},/turf/open/floor/wood,/area/eventmap/inside)
-"aoK" = (/obj/structure/chair/office/dark{dir = 1},/mob/living/simple_animal/astral{desc = "...Is haunting Space Station Three."; name = "Carmen Miranda"},/turf/open/floor/wood,/area/eventmap/inside)
-"aoL" = (/mob/living/simple_animal/hostile/retaliate/bat{attack_sound = 'sound/spookoween/ahaha.ogg'; desc = "A spooky, floating instrument possesed by some specture! Wooo~!"; icon = 'icons/obj/musician.dmi'; icon_dead = "bike_horn"; icon_living = "bike_horn"; icon_state = "bike_horn"; melee_damage_lower = 0; melee_damage_upper = 0; name = "Posessed Bike Horn"},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"aoM" = (/mob/living/simple_animal/hostile/retaliate/bat{attack_sound = 'sound/spookoween/ahaha.ogg'; desc = "A spooky, floating instrument possesed by some specture! Wooo~!"; icon = 'icons/obj/musician.dmi'; icon_dead = "pianobroken"; icon_gib = "pianobroken"; icon_living = "piano"; icon_state = "piano"; melee_damage_lower = 0; melee_damage_upper = 0; name = "Posessed piano"},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"aoN" = (/mob/living/simple_animal/hostile/retaliate/bat{attack_sound = 'sound/spookoween/ahaha.ogg'; desc = "A spooky, floating instrument possesed by some specture! Wooo~!"; icon = 'icons/obj/musician.dmi'; icon_dead = "recorder"; icon_gib = "recorder"; icon_living = "recorder"; icon_state = "recorder"; melee_damage_lower = 0; melee_damage_upper = 0; name = "Posessed recorder"},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"aoO" = (/obj/machinery/door/firedoor,/obj/machinery/door/airlock/mining{name = "Cargo Office"; req_one_access_txt = "48;50"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aoP" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/table/wood,/obj/structure/window/spawner/east,/obj/item/paper_bin,/obj/item/pen{desc = "A pen left over from the days this place used to be an asylum. Despite its age it appears perfectly usable when supplied with ink."; name = "Cyber & Sons Company Pen"},/turf/open/floor/carpet,/area/eventmap/inside)
-"aoQ" = (/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/cable/yellow{icon_state = "2-8"},/obj/structure/cable/yellow{icon_state = "1-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aoR" = (/turf/open/floor/light/colour_cycle/dancefloor_a,/area/eventmap/inside)
-"aoS" = (/obj/machinery/hydroponics/constructable,/turf/open/floor/wood,/area/eventmap/inside)
-"aoT" = (/obj/effect/turf_decal/tile/green{dir = 8},/obj/effect/turf_decal/tile/green{dir = 1},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aoU" = (/obj/effect/decal/cleanable/dirt,/turf/open/floor/wood{icon_state = "wood-broken2"},/area/eventmap/inside)
-"aoV" = (/obj/machinery/button/door/dorms/dorm03,/obj/effect/turf_decal/delivery/white,/turf/open/floor/wood,/area/eventmap/inside)
-"aoW" = (/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/cable/white{icon_state = "1-8"},/obj/structure/cable/white{icon_state = "1-4"},/turf/open/floor/wood,/area/eventmap/inside)
-"aoX" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aoY" = (/obj/structure/flora/rock/pile/icy,/obj/effect/wisp,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aoZ" = (/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/spooktime/cobble/cornerSW,/area/eventmap/outside)
-"apa" = (/obj/structure/cable/yellow{icon_state = "1-4"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"apb" = (/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"apc" = (/obj/structure/table/wood,/obj/machinery/recharger,/turf/open/floor/wood,/area/eventmap/inside)
-"apd" = (/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/cable/yellow{icon_state = "2-4"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"ape" = (/obj/machinery/computer/crew{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"apf" = (/obj/item/toy/plush/narplush/hugbox,/obj/item/toy/toy_dagger,/turf/open/floor/wood,/area/eventmap/inside)
-"apg" = (/obj/structure/table/wood/fancy/green,/obj/item/clothing/head/hardhat/pumpkinhead/jaqc,/turf/open/floor/wood{icon_state = "wood-broken2"},/area/eventmap/inside)
-"aph" = (/turf/open/floor/spooktime/cobble/sideW{icon_state = "cobble_side_n"},/area/eventmap/outside)
-"api" = (/obj/structure/table/wood/fancy/green,/obj/item/clothing/head/hardhat/pumpkinhead/jaqc,/turf/open/floor/wood,/area/eventmap/inside)
-"apj" = (/obj/structure/table/wood/fancy/green,/obj/item/gun/magic/staff/healing,/obj/item/gun/magic/staff/healing,/obj/item/gun/medbeam,/turf/open/floor/wood,/area/eventmap/inside)
-"apk" = (/obj/structure/life_candle,/turf/open/floor/wood{icon_state = "wood-broken5"},/area/eventmap/inside)
-"apl" = (/obj/structure/closet/cabinet,/obj/item/clothing/head/helmet/space/hardsuit/deathsquad,/obj/item/clothing/suit/space/hardsuit/deathsquad,/obj/item/circlegame,/obj/item/nullrod/scythe,/obj/item/card/id/silver/reaper,/turf/open/floor/wood,/area/eventmap/inside)
-"apm" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/wood{icon_state = "wood-broken6"},/area/eventmap/inside)
-"apn" = (/obj/item/chair/wood/wings{dir = 1},/turf/open/floor/wood{icon_state = "wood-broken"},/area/eventmap/inside)
-"apo" = (/mob/living/simple_animal/hostile/retaliate/bat{attack_sound = 'sound/spookoween/ahaha.ogg'; desc = "A spooky, floating instrument possesed by some specture! Wooo~!"; icon = 'icons/obj/musician.dmi'; icon_dead = "minimoogbroken"; icon_gib = "minimoogbroken"; icon_living = "minimoog"; icon_state = "minimoog"; melee_damage_lower = 0; melee_damage_upper = 0; name = "Posessed minimoog"},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"app" = (/obj/structure/chair/wood/wings{dir = 8},/turf/open/floor/wood{icon_state = "wood-broken5"},/area/eventmap/inside)
-"apq" = (/obj/structure/noticeboard/captain{pixel_y = -32},/turf/open/floor/wood,/area/eventmap/inside)
-"apr" = (/obj/effect/turf_decal/stripes/asteroid/line{icon_state = "ast_warn"; dir = 9},/turf/open/floor/wood,/area/eventmap/inside)
-"aps" = (/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/cable/yellow{icon_state = "2-4"},/obj/structure/cable/yellow{icon_state = "2-8"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"apt" = (/obj/item/banner/medical,/obj/effect/turf_decal/tile/green,/obj/effect/turf_decal/tile/green{dir = 4},/obj/machinery/door/firedoor,/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"apu" = (/obj/effect/spawner/trap,/turf/open/indestructible/airblock,/area/eventmap/mountaininside)
-"apv" = (/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/cable/yellow{icon_state = "2-8"},/turf/open/floor/carpet/green,/area/eventmap/inside)
-"apw" = (/obj/effect/decal/cleanable/dirt,/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/table/wood,/turf/open/floor/carpet,/area/eventmap/inside)
-"apx" = (/obj/structure/table/wood,/turf/open/floor/carpet,/area/eventmap/inside)
-"apy" = (/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"apz" = (/turf/open/floor/engine,/area/eventmap/inside)
-"apA" = (/obj/structure/sink{dir = 8; pixel_x = -12},/obj/machinery/camera/emp_proof{c_tag = "Containment - Fore Port"; dir = 4; network = list("singularity")},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"apB" = (/obj/machinery/biogenerator,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"apC" = (/mob/living/simple_animal/hostile/retaliate/bat{attack_sound = 'sound/spookoween/ahaha.ogg'; desc = "A spooky, floating instrument possesed by some specture! Wooo~!"; icon = 'icons/obj/musician.dmi'; icon_dead = "xylophone-broken"; icon_gib = "xylophone-broken"; icon_living = "xylophone"; icon_state = "xylophone"; melee_damage_lower = 0; melee_damage_upper = 0; name = "Posessed xylophone"},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"apD" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/mob/living/simple_animal/hostile/retaliate/bat{attack_sound = 'sound/spookoween/ahaha.ogg'; desc = "A spooky, floating instrument possesed by some specture! Wooo~!"; icon = 'icons/obj/musician.dmi'; icon_dead = "accordion"; icon_gib = "accordion"; icon_living = "accordion"; icon_state = "accordion"; melee_damage_lower = 0; melee_damage_upper = 0; name = "Posessed accordion"},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"apE" = (/obj/structure/sink{dir = 4; pixel_x = 11},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"apF" = (/obj/effect/turf_decal/stripes/asteroid/line{icon_state = "ast_warn"; dir = 5},/turf/open/floor/wood,/area/eventmap/inside)
-"apG" = (/obj/machinery/button/door/dorms/dorm18,/turf/open/floor/carpet,/area/eventmap/inside)
-"apH" = (/obj/machinery/button/door/dorms/luxury3{id = "C02"; pixel_y = -24},/turf/open/floor/wood,/area/eventmap/inside)
-"apI" = (/obj/effect/turf_decal/tile/green,/obj/effect/turf_decal/tile/green{dir = 8},/obj/effect/turf_decal/tile/green{dir = 1},/turf/open/floor/plasteel,/area/eventmap/inside)
-"apJ" = (/obj/effect/turf_decal/tile/green,/obj/effect/turf_decal/tile/green{dir = 8},/turf/open/floor/plasteel,/area/eventmap/inside)
-"apK" = (/obj/effect/decal/cleanable/dirt,/obj/effect/turf_decal/tile/green,/obj/effect/turf_decal/tile/green{dir = 8},/turf/open/floor/plasteel,/area/eventmap/inside)
-"apL" = (/obj/effect/turf_decal/tile/green,/obj/effect/turf_decal/tile/yellow{icon_state = "tile_corner"; dir = 1},/turf/open/floor/plasteel/dark,/area/eventmap/mountain)
-"apM" = (/obj/machinery/light/small,/obj/effect/turf_decal/tile/green,/obj/effect/turf_decal/tile/green{dir = 8},/turf/open/floor/plasteel,/area/eventmap/inside)
-"apN" = (/obj/structure/barricade/wooden,/obj/structure/spacevine,/obj/structure/mineral_door/woodrustic,/turf/open/floor/carpet/green,/area/eventmap/inside)
-"apO" = (/obj/structure/mineral_door/wood,/turf/open/floor/carpet/green,/area/eventmap/inside)
-"apP" = (/obj/item/stack/sheet/mineral/wood,/turf/open/floor/carpet/green,/area/eventmap/inside)
-"apQ" = (/mob/living/simple_animal/hostile/retaliate/bat,/turf/open/floor/carpet/green,/area/eventmap/inside)
-"apR" = (/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"apS" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/carpet/blackred,/area/eventmap/inside)
-"apT" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/mob/living/simple_animal/hostile/retaliate/bat{attack_sound = 'sound/spookoween/ahaha.ogg'; desc = "A spooky, floating instrument possesed by some specture! Wooo~!"; icon = 'icons/obj/musician.dmi'; icon_dead = "harmonica"; icon_gib = "harmonica"; icon_living = "harmonica"; icon_state = "harmonica"; melee_damage_lower = 0; melee_damage_upper = 0; name = "Posessed harmonica"},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"apU" = (/mob/living/simple_animal/hostile/retaliate/bat{attack_sound = 'sound/spookoween/ahaha.ogg'; desc = "A spooky, floating instrument possesed by some specture! Wooo~!"; icon = 'icons/obj/musician.dmi'; icon_dead = "trombone"; icon_gib = "trombone"; icon_living = "trombone"; icon_state = "trombone"; melee_damage_lower = 0; melee_damage_upper = 0; name = "Posessed trombone"},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"apV" = (/obj/effect/turf_decal/tile/green,/obj/effect/turf_decal/tile/green{dir = 8},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"apW" = (/obj/effect/turf_decal/bot_white,/obj/structure/plasticflaps/opaque,/turf/open/floor/wood,/area/eventmap/inside)
-"apX" = (/obj/effect/turf_decal/tile/green{dir = 1},/obj/effect/turf_decal/tile/green{dir = 4},/obj/structure/chair/stool,/turf/open/floor/plasteel/dark,/area/eventmap/mountain)
-"apY" = (/obj/effect/turf_decal/tile/green,/obj/effect/turf_decal/tile/green{dir = 8},/obj/effect/turf_decal/tile/green{dir = 4},/obj/machinery/door/firedoor,/turf/open/floor/plasteel,/area/eventmap/inside)
-"apZ" = (/obj/machinery/light/small{dir = 4},/obj/machinery/door/firedoor,/turf/open/floor/wood,/area/eventmap/inside)
-"aqa" = (/obj/machinery/door/airlock/command{name = "Captain's Office"; req_access_txt = "20"},/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aqb" = (/obj/effect/turf_decal/stripes/asteroid/line{icon_state = "ast_warn"; dir = 10},/turf/open/floor/wood,/area/eventmap/inside)
-"aqc" = (/mob/living/simple_animal/hostile/retaliate/bat{desc = "A spookster!"; icon_state = "flan0"; name = "Name"},/turf/open/floor/carpet/green,/area/eventmap/inside)
-"aqd" = (/obj/structure/table/wood,/obj/item/storage/box/bodybags{pixel_x = -3; pixel_y = 3},/obj/item/storage/box/bodybags,/turf/open/floor/wood,/area/eventmap/inside)
-"aqe" = (/obj/effect/turf_decal/stripes/asteroid/line{icon_state = "ast_warn"; dir = 6},/turf/open/floor/wood,/area/eventmap/inside)
-"aqf" = (/obj/machinery/light/small{dir = 8},/obj/machinery/door/firedoor,/turf/open/floor/wood,/area/eventmap/inside)
-"aqg" = (/obj/structure/table/wood,/obj/effect/decal/cleanable/dirt,/obj/item/paper/guides/jobs/medical/morgue,/obj/item/gun/magic/staff/healing,/obj/structure/cable/yellow{icon_state = "0-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aqh" = (/obj/structure/barricade/wooden,/turf/open/floor/carpet/green,/area/eventmap/inside)
-"aqi" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/carpet/green,/area/eventmap/inside)
-"aqj" = (/turf/open/floor/carpet/blackred,/area/eventmap/inside)
-"aqk" = (/obj/structure/sign/departments/cargo{pixel_y = 32},/turf/open/floor/spooktime/cobble/sideN,/area/eventmap/outside)
-"aql" = (/obj/structure/chair/wood/wings{dir = 8; icon_state = "brass_chair"},/turf/open/floor/wood,/area/eventmap/inside)
-"aqm" = (/obj/structure/table/reinforced,/obj/item/storage/box/ingredients/delights,/obj/item/reagent_containers/food/condiment/soysauce,/turf/open/floor/wood,/area/eventmap/inside)
-"aqn" = (/obj/structure/table/reinforced,/obj/item/storage/box/ingredients/carnivore,/turf/open/floor/wood,/area/eventmap/inside)
-"aqo" = (/obj/structure/table/reinforced,/obj/item/storage/box/ingredients/american,/turf/open/floor/wood,/area/eventmap/inside)
-"aqp" = (/obj/structure/table/reinforced,/obj/item/storage/box/donkpockets,/turf/open/floor/wood,/area/eventmap/inside)
-"aqq" = (/obj/structure/table/reinforced,/turf/open/floor/wood,/area/eventmap/inside)
-"aqr" = (/turf/closed/wall/mineral/wood,/area/eventmap/inside)
-"aqs" = (/obj/structure/table/wood,/obj/effect/decal/cleanable/dirt,/obj/structure/bedsheetbin,/turf/open/floor/wood,/area/eventmap/inside)
-"aqt" = (/obj/structure/sign/directions/security{dir = 8; icon_state = "direction_sec"; pixel_x = -32; pixel_y = 24},/obj/structure/sign/directions/supply{dir = 8; icon_state = "direction_supply"; pixel_x = -32; pixel_y = 32},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"aqu" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/structure/falsewall/wood,/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"aqv" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/wood,/area/eventmap/inside)
-"aqw" = (/turf/open/floor/carpet/monochrome,/area/eventmap/inside)
-"aqx" = (/mob/living/simple_animal/hostile/retaliate/bat,/turf/open/floor/carpet/monochrome,/area/eventmap/inside)
-"aqy" = (/obj/structure/mineral_door/wood,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"aqz" = (/obj/machinery/deepfryer,/turf/open/floor/plasteel/vaporwave,/area/eventmap/inside)
-"aqA" = (/turf/open/floor/plasteel/vaporwave,/area/eventmap/inside)
-"aqB" = (/obj/structure/reagent_dispensers/keg/milk,/turf/open/floor/plasteel/vaporwave,/area/eventmap/inside)
-"aqC" = (/obj/structure/sink/kitchen{pixel_y = 28},/turf/open/floor/plasteel/vaporwave,/area/eventmap/inside)
-"aqD" = (/obj/structure/cable/yellow{icon_state = "1-8"},/turf/open/floor/spooktime/cobble/sideS,/area/eventmap/outside)
-"aqE" = (/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"aqF" = (/obj/structure/table_frame/wood,/obj/item/stack/sheet/mineral/wood,/obj/effect/decal/cleanable/glass,/obj/item/shard,/turf/open/floor/wood,/area/eventmap/inside)
-"aqG" = (/obj/machinery/light/small/broken{dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"aqH" = (/obj/structure/table/wood,/obj/machinery/light/small{dir = 8},/turf/open/floor/carpet,/area/eventmap/inside)
-"aqI" = (/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"aqJ" = (/obj/structure/table/wood/fancy,/obj/item/clothing/head/HoS/beret/syndicate,/turf/open/floor/wood,/area/eventmap/inside)
-"aqK" = (/obj/structure/table/wood/fancy,/obj/machinery/light/small{dir = 4},/obj/item/reagent_containers/food/condiment/saltshaker,/obj/item/reagent_containers/food/condiment/peppermill,/turf/open/floor/wood,/area/eventmap/inside)
-"aqL" = (/obj/machinery/seed_extractor,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aqM" = (/obj/machinery/light{dir = 4},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aqN" = (/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"aqO" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"aqP" = (/obj/effect/decal/cleanable/dirt,/obj/machinery/door/airlock/medical/glass{name = "Chemistry Lab"; req_access_txt = "5; 33"},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aqQ" = (/obj/structure/mineral_door/wood,/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aqR" = (/obj/machinery/clonepod/experimental,/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"aqS" = (/obj/structure/showcase/horrific_experiment,/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"aqT" = (/obj/machinery/door/airlock/security/glass{name = "Security Office"; req_access_txt = "63"},/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aqU" = (/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/bookcase/random/nonfiction,/turf/open/floor/wood,/area/eventmap/inside)
-"aqV" = (/obj/structure/bookcase/random/nonfiction,/turf/open/floor/wood,/area/eventmap/inside)
-"aqW" = (/obj/structure/table/wood/fancy/green,/obj/item/clothing/head/hardhat/pumpkinhead/jaqc,/turf/open/floor/wood{icon_state = "wood-broken5"},/area/eventmap/inside)
-"aqX" = (/obj/structure/table/wood/fancy/blackred,/obj/item/reagent_containers/food/snacks/grown/tomato/blood,/obj/item/reagent_containers/food/snacks/grown/tomato/blood,/obj/item/reagent_containers/food/snacks/grown/tomato/blood,/obj/item/candle/infinite,/turf/open/floor/wood,/area/eventmap/inside)
-"aqY" = (/obj/structure/table/wood/fancy/blackred,/obj/item/reagent_containers/food/snacks/soup/blood,/obj/item/reagent_containers/food/snacks/soup/blood,/turf/open/floor/wood,/area/eventmap/inside)
-"aqZ" = (/obj/structure/table/reinforced,/obj/item/candle/infinite,/obj/item/reagent_containers/food/condiment/sugar,/turf/open/floor/plasteel/vaporwave,/area/eventmap/inside)
-"ara" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"arb" = (/obj/machinery/vending/wardrobe/cap_wardrobe,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"arc" = (/obj/structure/chair/sofa/left{dir = 4},/turf/open/floor/carpet,/area/eventmap/inside)
-"ard" = (/obj/effect/landmark/start/botanist,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"are" = (/obj/structure/closet/secure_closet/captains,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"arf" = (/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"arg" = (/obj/structure/fluff/broken_flooring,/obj/effect/decal/cleanable/cobweb,/turf/open/floor/plating{icon_state = "panelscorched"},/area/eventmap/inside)
-"arh" = (/obj/machinery/atmospherics/pipe/simple{dir = 5},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"ari" = (/obj/machinery/atmospherics/pipe/simple{dir = 8},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"arj" = (/obj/machinery/atmospherics/pipe/simple{dir = 9},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"ark" = (/obj/structure/table/glass,/obj/item/storage/box/pillbottles,/turf/open/floor/plasteel,/area/eventmap/inside)
-"arl" = (/obj/structure/table/wood,/obj/item/toy/cards/deck/cas,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"arm" = (/obj/effect/decal/cleanable/dirt,/turf/open/floor/plasteel,/area/eventmap/inside)
-"arn" = (/obj/item/toy/plush/plushvar,/obj/item/toy/clockwork_watch,/turf/open/floor/wood,/area/eventmap/inside)
-"aro" = (/obj/structure/chair/comfy{dir = 1; icon_state = "shuttle_chair"},/turf/open/floor/wood,/area/eventmap/inside)
-"arp" = (/turf/open/floor/wood{icon_state = "wood-broken6"},/area/eventmap/inside)
-"arq" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/carpet/monochrome,/area/eventmap/inside)
-"arr" = (/obj/structure/closet/crate/freezer/blood,/turf/open/floor/wood{icon_state = "wood-broken2"},/area/eventmap/inside)
-"ars" = (/obj/structure/chair/wood/wings,/mob/living/simple_animal/hostile/retaliate/bat,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"art" = (/obj/structure/chair/wood/wings,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"aru" = (/obj/structure/chair/wood/wings,/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/carpet/red,/area/eventmap/inside)
-"arv" = (/obj/structure/table/reinforced,/obj/item/storage/bag/tray,/obj/item/reagent_containers/food/snacks/kebab/human,/obj/item/reagent_containers/food/snacks/kebab/human,/obj/item/reagent_containers/food/snacks/kebab/human,/turf/open/floor/plasteel/vaporwave,/area/eventmap/inside)
-"arw" = (/obj/machinery/chem_heater,/obj/effect/decal/cleanable/greenglow,/turf/open/floor/plasteel,/area/eventmap/inside)
-"arx" = (/obj/machinery/clonepod,/turf/open/floor/plasteel,/area/eventmap/inside)
-"ary" = (/obj/machinery/computer/cloning,/turf/open/floor/plasteel/white/side,/area/eventmap/inside)
-"arz" = (/obj/machinery/dna_scannernew,/turf/open/floor/plasteel/white/side,/area/eventmap/inside)
-"arA" = (/obj/structure/cable/white{icon_state = "1-2"},/obj/machinery/door/airlock/command{name = "Head of Personnel's Office"; req_access_txt = "57"},/turf/open/floor/wood,/area/eventmap/inside)
-"arB" = (/obj/structure/sign/directions/medical{dir = 4; pixel_x = 32; pixel_y = 24},/obj/structure/sign/directions/evac{dir = 4; pixel_x = 32; pixel_y = 32},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"arC" = (/obj/structure/cable/white{icon_state = "0-2"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"arD" = (/obj/effect/turf_decal/loading_area,/obj/machinery/firealarm{dir = 8; pixel_x = -24},/turf/open/floor/plasteel,/area/eventmap/inside)
-"arE" = (/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"arF" = (/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"arG" = (/obj/structure/cable/yellow{icon_state = "2-8"},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"arH" = (/obj/item/book/manual/wiki/medical_cloning,/obj/structure/table/glass,/turf/open/floor/plasteel,/area/eventmap/inside)
-"arI" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/carpet,/area/eventmap/inside)
-"arJ" = (/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"arK" = (/obj/machinery/door/airlock/wood/dorms/dorm06,/turf/open/floor/wood,/area/eventmap/inside)
-"arL" = (/obj/structure/closet/secure_closet/security/med,/turf/open/floor/wood,/area/eventmap/inside)
-"arM" = (/obj/structure/mineral_door/wood,/obj/effect/decal/cleanable/blood/tracks{dir = 4},/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"arN" = (/obj/effect/decal/cleanable/dirt,/obj/machinery/light/small/broken{dir = 4},/turf/open/floor/wood,/area/eventmap/inside)
-"arO" = (/obj/effect/turf_decal/tile/brown{dir = 4},/turf/open/floor/plasteel,/area/eventmap/inside)
-"arP" = (/obj/effect/decal/cleanable/cobweb{icon_state = "stickyweb2"},/obj/structure/falsewall/wood,/turf/open/floor/wood,/area/eventmap/inside)
-"arQ" = (/obj/structure/table/wood/fancy/blackred,/obj/item/trash/plate,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"arR" = (/obj/structure/table/reinforced,/obj/item/storage/bag/tray,/obj/item/reagent_containers/food/snacks/pie/pumpkinpie,/turf/open/floor/plasteel/vaporwave,/area/eventmap/inside)
-"arS" = (/obj/structure/closet/secure_closet/freezer/fridge,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/soymilk,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/rice,/obj/item/reagent_containers/food/condiment/rice,/obj/item/reagent_containers/food/condiment/rice,/obj/item/storage/fancy/egg_box,/obj/item/storage/fancy/egg_box,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"arT" = (/obj/structure/table/reinforced,/obj/machinery/dish_drive,/obj/item/reagent_containers/food/condiment/enzyme,/turf/open/floor/plasteel/vaporwave,/area/eventmap/inside)
-"arU" = (/obj/structure/table/reinforced,/obj/machinery/reagentgrinder,/turf/open/floor/plasteel/vaporwave,/area/eventmap/inside)
-"arV" = (/obj/structure/table/reinforced,/obj/item/storage/box/condimentbottles,/turf/open/floor/plasteel/vaporwave,/area/eventmap/inside)
-"arW" = (/obj/structure/table/reinforced,/obj/item/storage/box/ingredients/wildcard,/obj/item/storage/box/ingredients/vegetarian,/turf/open/floor/plasteel/vaporwave,/area/eventmap/inside)
-"arX" = (/obj/structure/table/reinforced,/obj/item/storage/box/ingredients/sweets,/obj/item/storage/box/ingredients/italian,/turf/open/floor/plasteel/vaporwave,/area/eventmap/inside)
-"arY" = (/obj/structure/table/reinforced,/obj/item/storage/box/ingredients/grains,/obj/item/storage/box/ingredients/fruity,/turf/open/floor/plasteel/vaporwave,/area/eventmap/inside)
-"arZ" = (/obj/structure/table/reinforced,/obj/item/storage/box/ingredients/fiesta,/obj/item/storage/box/ingredients/exotic,/turf/open/floor/plasteel/vaporwave,/area/eventmap/inside)
-"asa" = (/obj/effect/landmark/start/captain,/obj/structure/cable/white{icon_state = "2-4"},/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"asb" = (/obj/structure/chair/sofa{dir = 4},/turf/open/floor/carpet,/area/eventmap/inside)
-"asc" = (/obj/effect/turf_decal/tile/brown{dir = 4},/obj/effect/turf_decal/tile/purple{dir = 1},/turf/open/floor/plasteel,/area/eventmap/inside)
-"asd" = (/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"ase" = (/obj/effect/landmark/start/assistant,/turf/open/floor/wood,/area/eventmap/inside)
-"asf" = (/obj/effect/decal/cleanable/dirt,/turf/open/floor/plasteel/white,/area/eventmap/inside)
-"asg" = (/obj/machinery/chem_dispenser,/turf/open/floor/plasteel,/area/eventmap/inside)
-"ash" = (/obj/machinery/door/airlock/command{name = "Captain's Quarters"; req_access_txt = "20"},/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"asi" = (/turf/open/floor/plasteel/white/side{dir = 6},/area/eventmap/inside)
-"asj" = (/turf/open/floor/plasteel/white,/area/eventmap/inside)
-"ask" = (/obj/structure/barricade/wooden/crude,/obj/effect/spawner/structure/window,/turf/open/floor/wood,/area/eventmap/inside)
-"asl" = (/obj/effect/decal/cleanable/cobweb{icon_state = "stickyweb2"},/turf/open/floor/wood,/area/eventmap/inside)
-"asm" = (/obj/structure/easel,/obj/item/paper/pamphlet/ruin/originalcontent/yelling,/turf/open/floor/wood,/area/eventmap/inside)
-"asn" = (/obj/structure/chair/wood/wings{dir = 4; icon_state = "brass_chair"},/mob/living/simple_animal/hostile/retaliate/bat,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"aso" = (/obj/structure/table/wood/fancy/blackred,/obj/item/candle/infinite,/obj/item/reagent_containers/food/condiment/saltshaker,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"asp" = (/obj/structure/table/wood/fancy/blackred,/obj/item/candle/infinite,/obj/item/reagent_containers/food/condiment/peppermill,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"asq" = (/obj/structure/table/wood/fancy/blackred,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"asr" = (/obj/structure/table/reinforced,/obj/item/storage/bag/tray,/obj/item/reagent_containers/food/snacks/store/cake/pumpkinspice,/turf/open/floor/plasteel/vaporwave,/area/eventmap/inside)
-"ass" = (/obj/structure/table/reinforced,/obj/machinery/microwave,/turf/open/floor/plasteel/vaporwave,/area/eventmap/inside)
-"ast" = (/obj/structure/mineral_door/iron,/turf/open/floor/wood,/area/eventmap/inside)
-"asu" = (/obj/structure/cable/white{icon_state = "2-8"},/obj/structure/cable/white{icon_state = "4-8"},/obj/structure/cable/white{icon_state = "2-4"},/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"asv" = (/obj/structure/cable/white{icon_state = "1-8"},/obj/structure/chair/wood,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"asw" = (/obj/structure/chair/wood,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"asx" = (/obj/structure/cable/yellow{icon_state = "1-4"},/turf/open/floor/plasteel/white/side{dir = 10},/area/eventmap/inside)
-"asy" = (/obj/item/storage/box/bodybags{pixel_x = 3; pixel_y = 3},/obj/item/storage/box/bodybags,/obj/structure/table/glass,/obj/structure/cable/yellow{icon_state = "0-8"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"asz" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/closed/wall/r_wall,/area/eventmap/inside)
-"asA" = (/obj/effect/landmark/start/depsec/medical,/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"asB" = (/obj/structure/bodycontainer/morgue,/turf/open/floor/wood,/area/eventmap/inside)
-"asC" = (/obj/structure/bodycontainer/morgue{dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"asD" = (/obj/structure/cable/yellow{icon_state = "1-8"},/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"asE" = (/obj/structure/cable/white{icon_state = "2-4"},/obj/effect/turf_decal/tile/purple{dir = 1},/turf/open/floor/plasteel,/area/eventmap/inside)
-"asF" = (/obj/structure/cable/white{icon_state = "4-8"},/obj/machinery/door/airlock/mining/glass{name = "Cargo Office"; req_access_txt = "50"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"asG" = (/obj/machinery/vending/cart,/turf/open/floor/wood,/area/eventmap/inside)
-"asH" = (/obj/structure/table/wood,/obj/item/paper_bin,/obj/item/pen/fourcolor,/obj/item/stamp/hop,/turf/open/floor/wood,/area/eventmap/inside)
-"asI" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/wood/damturf/broken7,/area/eventmap/inside)
-"asJ" = (/obj/machinery/door/airlock/wood/dorms/dorm15,/turf/open/floor/wood,/area/eventmap/inside)
-"asK" = (/obj/machinery/light/small{dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"asL" = (/obj/machinery/camera/emp_proof{c_tag = "Containment - Fore Starboard"; dir = 8; network = list("singularity")},/turf/open/floor/wood,/area/eventmap/inside)
-"asM" = (/obj/structure/fence{icon_state = "straight"; dir = 8},/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"asN" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/structure/bookcase/manuals/engineering,/turf/open/floor/wood,/area/eventmap/inside)
-"asO" = (/obj/structure/bookcase/manuals/medical,/turf/open/floor/wood,/area/eventmap/inside)
-"asP" = (/obj/structure/bookcase/manuals/research_and_development,/turf/open/floor/wood,/area/eventmap/inside)
-"asQ" = (/obj/item/toy/crayon/red,/turf/open/floor/wood,/area/eventmap/inside)
-"asR" = (/obj/item/paint/anycolor,/obj/item/toy/crayon/rainbow,/turf/open/floor/wood,/area/eventmap/inside)
-"asS" = (/obj/item/stack/spacecash/c20,/turf/open/floor/wood,/area/eventmap/inside)
-"asT" = (/obj/item/paper/crumpled/ruins/originalcontent,/turf/open/floor/wood,/area/eventmap/inside)
-"asU" = (/obj/item/paint/anycolor,/obj/item/toy/crayon/green,/turf/open/floor/wood{icon_state = "wood-broken3"},/area/eventmap/inside)
-"asV" = (/obj/item/toy/crayon/purple,/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/wood,/area/eventmap/inside)
-"asW" = (/obj/item/paint/anycolor,/obj/item/stack/spacecash/c50,/turf/open/floor/wood,/area/eventmap/inside)
-"asX" = (/obj/item/paint/anycolor,/obj/item/toy/crayon/blue,/turf/open/floor/wood,/area/eventmap/inside)
-"asY" = (/obj/item/toy/crayon/white,/turf/open/floor/wood,/area/eventmap/inside)
-"asZ" = (/obj/item/stack/spacecash/c1,/turf/open/floor/wood,/area/eventmap/inside)
-"ata" = (/obj/item/paint/anycolor,/turf/open/floor/wood,/area/eventmap/inside)
-"atb" = (/obj/item/stack/spacecash/c500,/obj/item/toy/crayon/mime,/turf/open/floor/wood,/area/eventmap/inside)
-"atc" = (/obj/item/toy/crayon/rainbow,/turf/open/floor/wood,/area/eventmap/inside)
-"atd" = (/obj/structure/table/reinforced,/obj/item/storage/bag/tray,/obj/item/reagent_containers/food/snacks/burger/ghost,/obj/item/reagent_containers/food/snacks/burger/ghost,/obj/item/reagent_containers/food/snacks/burger/ghost,/turf/open/floor/plasteel/vaporwave,/area/eventmap/inside)
-"ate" = (/obj/machinery/icecream_vat{name = "Spooky ice cream vat"},/obj/item/toy/snowball,/obj/effect/turf_decal/weather/snow/corner{dir = 9},/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"atf" = (/obj/structure/fluff/snowlegion,/obj/effect/turf_decal/weather/snow/corner,/obj/effect/turf_decal/weather/snow/corner{dir = 1},/turf/open/floor/spooktime/snow,/area/eventmap/inside)
-"atg" = (/obj/structure/reagent_dispensers/cooking_oil{name = "Chilled vat of hatmium"; reagent_id = "hatmium"},/obj/effect/turf_decal/weather/snow/corner{dir = 1},/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"ath" = (/obj/machinery/gibber/autogibber,/obj/effect/turf_decal/weather/snow/corner{dir = 1},/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"ati" = (/obj/structure/kitchenspike,/obj/item/toy/snowball,/obj/effect/turf_decal/weather/snow/corner{dir = 1},/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"atj" = (/obj/effect/turf_decal/weather/snow/corner{dir = 5},/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"atk" = (/turf/closed/wall/mineral/snow,/area/eventmap/inside)
-"atl" = (/obj/structure/chair/sofa/right{dir = 4},/turf/open/floor/carpet,/area/eventmap/inside)
-"atm" = (/obj/machinery/jukebox/disco/indestructible{req_one_access = list()},/turf/open/floor/engine,/area/eventmap/inside)
-"atn" = (/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/cable/yellow{icon_state = "2-4"},/obj/structure/cable/yellow{icon_state = "1-4"},/turf/open/floor/wood,/area/eventmap/inside)
-"ato" = (/obj/structure/table/wood/fancy,/obj/item/reagent_containers/food/condiment/saltshaker,/obj/item/reagent_containers/food/condiment/peppermill,/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"atp" = (/obj/structure/chair/wood/wings{dir = 8},/obj/machinery/light/small,/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"atq" = (/obj/structure/cable/yellow{icon_state = "2-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"atr" = (/obj/structure/table/wood/fancy,/obj/machinery/light/small,/turf/open/floor/wood,/area/eventmap/inside)
-"ats" = (/obj/structure/table/wood,/obj/machinery/plantgenes/seedvault,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"att" = (/obj/structure/sign/poster/contraband/ambrosia_vulgaris{pixel_x = 32},/turf/open/floor/plasteel,/area/eventmap/inside)
-"atu" = (/obj/structure/closet/secure_closet/personal/patient,/turf/open/floor/plasteel,/area/eventmap/inside)
-"atv" = (/turf/open/floor/plasteel/white/side{dir = 5},/area/eventmap/inside)
-"atw" = (/obj/structure/bed,/obj/effect/spawner/lootdrop/bedsheet,/obj/machinery/light/small,/mob/living/carbon/human/species/zombie{icon_state = "zombie"; lying = 1; name = "Romerol"; name_override = "Romerol"; resting = 1},/mob/living/carbon/human/species/zombie{gender = "female"; icon_state = "zombie"; lying = 1; name = "Juliet"; name_override = "Juliet"; resting = 1},/turf/open/floor/clockwork/reebe,/area/eventmap/inside)
-"atx" = (/obj/effect/landmark/start/geneticist,/turf/open/floor/plasteel/white,/area/eventmap/inside)
-"aty" = (/turf/open/floor/plasteel/white/side{dir = 9},/area/eventmap/inside)
-"atz" = (/obj/structure/table/wood/fancy/blackred,/obj/item/reagent_containers/blood/random,/obj/item/reagent_containers/blood/random,/turf/open/floor/wood,/area/eventmap/inside)
-"atA" = (/obj/structure/chair/wood/wings{dir = 1},/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/mob/living/simple_animal/hostile/retaliate/bat,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"atB" = (/obj/structure/chair/wood/wings{dir = 1},/mob/living/simple_animal/hostile/retaliate/bat,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"atC" = (/obj/structure/table/reinforced,/obj/item/storage/bag/tray,/obj/item/reagent_containers/food/snacks/candiedapple,/obj/item/reagent_containers/food/snacks/candiedapple,/obj/item/reagent_containers/food/snacks/candy,/obj/item/reagent_containers/food/snacks/candy_corn,/obj/item/reagent_containers/food/snacks/candyheart,/obj/item/reagent_containers/food/snacks/chocolatebanana,/obj/item/reagent_containers/food/snacks/chocolatebanana,/obj/item/reagent_containers/food/snacks/sugarcookie/spookycoffin,/obj/item/reagent_containers/food/snacks/sugarcookie/spookyskull,/turf/open/floor/plasteel/vaporwave,/area/eventmap/inside)
-"atD" = (/obj/effect/turf_decal/weather/snow/corner{dir = 8},/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"atE" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"atF" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/effect/turf_decal/weather/snow/corner{dir = 4},/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"atG" = (/obj/structure/cable/white{icon_state = "1-8"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"atH" = (/obj/item/storage/box/rxglasses,/obj/structure/table/glass,/turf/open/floor/plasteel,/area/eventmap/inside)
-"atI" = (/obj/structure/curtain{color = "#B22222"},/turf/open/floor/wood,/area/eventmap/inside)
-"atJ" = (/obj/structure/table/wood,/obj/machinery/computer/security/wooden_tv{pixel_y = 8},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/carpet/red,/area/eventmap/inside)
-"atK" = (/obj/machinery/computer/secure_data,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"atL" = (/obj/machinery/door/airlock{name = "Bar Staff Entrance"; req_access_txt = "25"},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"atM" = (/obj/machinery/door/airlock{name = "Kitchen"; req_access_txt = "28"},/obj/machinery/door/firedoor,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"atN" = (/obj/structure/table/wood,/obj/machinery/smartfridge/disks,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"atO" = (/obj/effect/decal/cleanable/generic,/turf/open/floor/plasteel,/area/eventmap/inside)
-"atP" = (/obj/machinery/chem_master,/obj/effect/decal/cleanable/dirt,/obj/machinery/light/small,/turf/open/floor/plasteel,/area/eventmap/inside)
-"atQ" = (/obj/machinery/shower{dir = 4},/obj/structure/window/reinforced/spawner/north,/turf/open/floor/plasteel,/area/eventmap/inside)
-"atR" = (/obj/machinery/door/window/northleft{name = "Cloning Shower"; req_access_txt = "24"},/obj/structure/mirror{pixel_y = -32},/turf/open/floor/plasteel,/area/eventmap/inside)
-"atS" = (/obj/machinery/door/window/northright{name = "Cloning Shower"},/obj/machinery/light/small,/obj/structure/window/reinforced/spawner/east,/turf/open/floor/plasteel/white/side{dir = 1},/area/eventmap/inside)
-"atT" = (/obj/item/toy/crayon/black,/turf/open/floor/wood{icon_state = "wood-broken6"},/area/eventmap/inside)
-"atU" = (/obj/item/paint/anycolor,/obj/item/toy/crayon/white,/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/wood,/area/eventmap/inside)
-"atV" = (/obj/item/toy/crayon/spraycan/infinite{icon_state = "deathcan2_cap"},/turf/open/floor/wood,/area/eventmap/inside)
-"atW" = (/obj/item/paint/anycolor,/obj/item/stack/spacecash/c100,/turf/open/floor/wood,/area/eventmap/inside)
-"atX" = (/obj/item/paper/crumpled/ruins/originalcontent,/obj/item/toy/crayon/orange,/turf/open/floor/wood,/area/eventmap/inside)
-"atY" = (/mob/living/carbon/monkey{color = "#009900"; icon_state = "monkey1"; name = "Painting Goblin"},/turf/open/floor/wood,/area/eventmap/inside)
-"atZ" = (/obj/item/paint/anycolor,/obj/item/toy/crayon/yellow,/turf/open/floor/wood,/area/eventmap/inside)
-"aua" = (/obj/item/paint/anycolor,/obj/item/stack/spacecash/c20,/turf/open/floor/wood,/area/eventmap/inside)
-"aub" = (/obj/item/paper/crumpled/ruins/originalcontent,/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/wood,/area/eventmap/inside)
-"auc" = (/obj/item/toy/crayon/blue,/turf/open/floor/wood,/area/eventmap/inside)
-"aud" = (/obj/item/paint/anycolor,/obj/item/toy/crayon/purple,/turf/open/floor/wood{icon_state = "wood-broken5"},/area/eventmap/inside)
-"aue" = (/obj/item/stack/spacecash/c50,/turf/open/floor/wood,/area/eventmap/inside)
-"auf" = (/obj/structure/table/wood/fancy/blackred,/obj/item/reagent_containers/blood/random,/obj/item/reagent_containers/blood/random,/obj/item/reagent_containers/blood/random,/obj/item/candle/infinite,/turf/open/floor/wood,/area/eventmap/inside)
-"aug" = (/obj/structure/table/reinforced,/obj/item/candle/infinite,/turf/open/floor/plasteel/vaporwave,/area/eventmap/inside)
-"auh" = (/obj/machinery/vending/dinnerware,/turf/open/floor/plasteel/vaporwave,/area/eventmap/inside)
-"aui" = (/obj/structure/closet/secure_closet/freezer/fridge,/obj/effect/turf_decal/weather/snow/corner{dir = 8},/obj/item/organ/liver,/obj/item/organ/liver,/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"auj" = (/obj/structure/closet/secure_closet/freezer/fridge,/obj/effect/turf_decal/weather/snow/corner,/obj/item/organ/heart,/obj/item/organ/heart,/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"auk" = (/obj/structure/closet/secure_closet/freezer/fridge,/obj/item/reagent_containers/food/snacks/snowcones/apple,/obj/item/reagent_containers/food/snacks/snowcones/blue,/obj/item/reagent_containers/food/snacks/snowcones/clown,/obj/item/reagent_containers/food/snacks/snowcones/fruitsalad,/obj/item/reagent_containers/food/snacks/snowcones/grape,/obj/item/reagent_containers/food/snacks/snowcones/honey,/obj/item/reagent_containers/food/snacks/snowcones/kiwi,/obj/item/reagent_containers/food/snacks/snowcones/lemon,/obj/item/reagent_containers/food/snacks/snowcones/lime,/obj/item/reagent_containers/food/snacks/snowcones/mime,/obj/item/reagent_containers/food/snacks/snowcones/orange,/obj/item/reagent_containers/food/snacks/snowcones/peach,/obj/item/reagent_containers/food/snacks/snowcones/pineapple,/obj/item/reagent_containers/food/snacks/snowcones/rainbow,/obj/item/reagent_containers/food/snacks/snowcones/red,/obj/item/reagent_containers/food/snacks/snowcones/soda,/obj/item/reagent_containers/food/snacks/snowcones/strawberry,/obj/effect/turf_decal/weather/snow/corner,/obj/effect/turf_decal/weather/snow/corner,/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"aul" = (/obj/structure/fluff/snowlegion,/obj/effect/turf_decal/weather/snow/corner,/obj/effect/turf_decal/weather/snow/corner,/turf/open/floor/spooktime/snow,/area/eventmap/inside)
-"aum" = (/obj/structure/closet/secure_closet/freezer/cream_pie,/obj/item/reagent_containers/food/snacks/pie/cream,/obj/item/reagent_containers/food/snacks/pie/cream,/obj/effect/turf_decal/weather/snow/corner,/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"aun" = (/obj/structure/closet/secure_closet/freezer/cream_pie,/obj/item/reagent_containers/food/snacks/pie/cream,/obj/item/reagent_containers/food/snacks/pie/cream,/obj/effect/turf_decal/weather/snow/corner,/obj/effect/turf_decal/weather/snow/corner{dir = 6},/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"auo" = (/turf/open/floor/plasteel/white/side{dir = 1},/area/eventmap/inside)
-"aup" = (/obj/structure/cable/yellow{icon_state = "2-4"},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"auq" = (/obj/item/gun/magic/staff/healing,/obj/structure/table/glass,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aur" = (/obj/machinery/light,/obj/structure/cable/yellow,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"aus" = (/obj/structure/chair/wood{dir = 1},/turf/open/floor/carpet/red,/area/eventmap/inside)
-"aut" = (/obj/effect/turf_decal/loading_area{dir = 8},/turf/open/floor/plasteel,/area/eventmap/inside)
-"auu" = (/obj/effect/decal/cleanable/cobweb,/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/wood,/area/eventmap/inside)
-"auv" = (/obj/effect/decal/cleanable/dirt,/obj/structure/cable/yellow{icon_state = "0-4"},/turf/open/floor/wood,/area/eventmap/inside)
-"auw" = (/obj/structure/sign/directions/security{dir = 8; icon_state = "direction_sec"; pixel_x = -32; pixel_y = -24},/obj/structure/sign/directions/supply{dir = 8; icon_state = "direction_supply"; pixel_x = -32; pixel_y = -32},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"aux" = (/obj/structure/chair/wood,/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/cable/yellow{icon_state = "1-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"auy" = (/obj/machinery/conveyor{dir = 8; icon_state = "conveyor_map"; id = "cargo_in"},/obj/effect/turf_decal/stripes/line{dir = 1},/obj/effect/turf_decal/stripes/line,/turf/open/floor/plating,/area/eventmap/inside)
-"auz" = (/obj/structure/chair/wood,/obj/effect/landmark/start/assistant,/turf/open/floor/wood/damturf/broken1,/area/eventmap/inside)
-"auA" = (/obj/machinery/button/door/dorms/dorm06,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"auB" = (/obj/structure/barricade/wooden/snowed,/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"auC" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/machinery/vending/games,/turf/open/floor/wood,/area/eventmap/inside)
-"auD" = (/obj/structure/chair/stool/bar,/turf/open/floor/wood,/area/eventmap/inside)
-"auE" = (/obj/effect/turf_decal/tile/red{icon_state = "tile_corner"; dir = 4},/obj/effect/turf_decal/tile/green{dir = 8},/turf/open/floor/plasteel/dark,/area/eventmap/mountain)
-"auF" = (/obj/structure/table/reinforced,/obj/machinery/door/firedoor,/turf/open/floor/wood,/area/eventmap/inside)
-"auG" = (/obj/machinery/camera/emp_proof,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"auH" = (/obj/structure/cable/white,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"auI" = (/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"auJ" = (/obj/machinery/chem_master/condimaster,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"auK" = (/obj/structure/table,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"auL" = (/obj/structure/table,/obj/machinery/reagentgrinder,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"auM" = (/obj/structure/table,/obj/effect/meteor/meaty{lifetime = 1e+009},/obj/effect/decal/cleanable/cobweb,/turf/open/floor/plasteel,/area/eventmap/inside)
-"auN" = (/obj/machinery/dominator,/turf/open/floor/plasteel,/area/eventmap/inside)
-"auO" = (/obj/machinery/sleeper,/turf/open/floor/plasteel,/area/eventmap/inside)
-"auP" = (/obj/machinery/hydroponics,/obj/effect/decal/cleanable/glass,/turf/open/floor/plasteel,/area/eventmap/inside)
-"auQ" = (/obj/machinery/computer/operating,/turf/open/floor/plasteel,/area/eventmap/inside)
-"auR" = (/obj/structure/table/optable,/obj/effect/decal/cleanable/blood/splatter{icon_state = "floor5"},/obj/effect/decal/cleanable/glass,/turf/open/floor/plasteel,/area/eventmap/inside)
-"auS" = (/obj/item/storage/backpack/duffelbag/med/surgery,/obj/item/book/manual/wiki/surgery,/obj/structure/table,/turf/open/floor/plasteel,/area/eventmap/inside)
-"auT" = (/obj/machinery/computer/crew,/turf/open/floor/plasteel,/area/eventmap/inside)
-"auU" = (/turf/open/floor/plasteel,/area/eventmap/inside)
-"auV" = (/obj/structure/spacevine,/turf/closed/indestructible/riveted,/area/eventmap/inside)
-"auW" = (/obj/structure/table,/obj/machinery/light/small{dir = 1},/obj/item/storage/box/ingredients/carnivore,/obj/item/reagent_containers/food/condiment/enzyme,/obj/item/reagent_containers/food/condiment/enzyme,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"auX" = (/obj/structure/alien/resin/membrane,/obj/structure/spacevine,/obj/structure/spacevine,/turf/open/floor/wood,/area/eventmap/inside)
-"auY" = (/obj/structure/alien/resin/membrane,/obj/structure/spacevine,/obj/structure/spacevine,/mob/living/simple_animal/hostile/venus_human_trap{a_intent = "friendly"; harm_intent_damage = 0; melee_damage_lower = 0; melee_damage_type = "arousal"; melee_damage_upper = 0},/turf/open/floor/wood,/area/eventmap/inside)
-"auZ" = (/obj/structure/kitchenspike,/obj/effect/decal/cleanable/blood/splatter{icon_state = "gib3"},/obj/effect/decal/cleanable/cobweb,/obj/item/stack/sheet/animalhide/human,/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 9},/turf/open/floor/plasteel/dark/corner,/area/eventmap/inside)
-"ava" = (/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 1},/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 1},/obj/machinery/iv_drip,/turf/open/floor/plasteel/dark/side,/area/eventmap/inside)
-"avb" = (/obj/structure/kitchenspike,/obj/effect/decal/cleanable/blood/splatter{icon_state = "floor5"},/obj/effect/decal/remains/xeno/larva,/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 1},/obj/effect/decal/cleanable/blood/splatter{icon_state = "xgiblarvahead"},/obj/effect/decal/cleanable/blood/splatter{icon_state = "xgibmid2"},/turf/open/floor/plasteel/dark/side,/area/eventmap/inside)
-"avc" = (/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 1},/obj/machinery/iv_drip,/turf/open/floor/plasteel/dark/side,/area/eventmap/inside)
-"avd" = (/obj/structure/kitchenspike,/obj/effect/decal/cleanable/blood/splatter,/obj/effect/decal/remains/human,/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 1},/turf/open/floor/plasteel/dark/side,/area/eventmap/inside)
-"ave" = (/obj/structure/kitchenspike,/obj/effect/decal/cleanable/blood/splatter{icon_state = "gibmid3"},/obj/effect/decal/cleanable/blood/splatter{icon_state = "remainsxeno"},/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 1},/turf/open/floor/plasteel/dark/side,/area/eventmap/inside)
-"avf" = (/obj/structure/kitchenspike,/obj/effect/decal/cleanable/blood/splatter{icon_state = "floor5"},/obj/item/stack/sheet/animalhide/human,/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 1},/turf/open/floor/plasteel/dark/side,/area/eventmap/inside)
-"avg" = (/obj/structure/kitchenspike,/obj/effect/decal/cleanable/blood/splatter{icon_state = "gibtorso"},/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 5},/turf/open/floor/plasteel/dark/corner{dir = 8},/area/eventmap/inside)
-"avh" = (/turf/closed/indestructible/necropolis,/area/eventmap/inside)
-"avi" = (/atom/movable/screen/alert/status_effect/blooddrunk{desc = "You see your disfigured skull screaming on the wall."; icon = 'icons/mob/screen_gen.dmi'; icon_state = "Devil-6"; name = "Foolish creature of meat and bone."},/turf/closed/indestructible/necropolis,/area/eventmap/inside)
-"avj" = (/atom/movable/screen/alert/status_effect/blooddrunk{desc = "You feel hollow and empy inside."; icon = 'icons/effects/cult_effects.dmi'; icon_state = "cultshield"; name = "You should not have come here."},/turf/closed/indestructible/necropolis,/area/eventmap/inside)
-"avk" = (/obj/structure/necropolis_gate,/obj/structure/mineral_door/iron,/turf/open/floor/wood,/area/eventmap/inside)
-"avl" = (/obj/structure/sink/kitchen{pixel_y = 28},/obj/structure/closet/crate/bin{storage_capacity = 300},/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"avm" = (/obj/structure/bed,/obj/item/bedsheet/captain,/turf/open/floor/carpet/royalblue,/area/eventmap/inside)
-"avn" = (/obj/machinery/camera/emp_proof{c_tag = "Containment - Fore Starboard"; dir = 8; network = list("singularity")},/obj/structure/sign/poster/official/hydro_ad{pixel_x = 32},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"avo" = (/obj/structure/table/wood,/obj/item/paper_bin,/obj/item/pen/fountain/captain,/obj/item/stamp/captain,/turf/open/floor/wood,/area/eventmap/inside)
-"avp" = (/obj/structure/life_candle,/turf/open/floor/carpet/green,/area/eventmap/inside)
-"avq" = (/turf/closed/wall/rust,/area/eventmap/outside)
-"avr" = (/obj/machinery/door/airlock{name = "Hydroponics Backroom"; req_access_txt = "35"},/turf/open/floor/wood,/area/eventmap/inside)
-"avs" = (/obj/effect/decal/cleanable/dirt,/obj/machinery/door/airlock/medical/glass{name = "Old Chemistry Lab"},/obj/machinery/door/firedoor,/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"avt" = (/obj/machinery/door/airlock/medical/glass{id_tag = "GeneticsDoor"; name = "Genetics"; req_access_txt = "5; 68"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"avu" = (/obj/effect/turf_decal/stripes/line,/obj/effect/turf_decal/stripes/line{dir = 1},/obj/machinery/conveyor{dir = 8; icon_state = "conveyor_map"; id = "cargo_in"},/turf/open/floor/plating,/area/eventmap/inside)
-"avv" = (/obj/structure/cable/white{icon_state = "1-2"},/obj/effect/landmark/start/head_of_personnel,/turf/open/floor/wood,/area/eventmap/inside)
-"avw" = (/obj/structure/table/wood,/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"avx" = (/obj/item/reagent_containers/food/condiment/saltshaker,/obj/item/reagent_containers/food/condiment/peppermill,/obj/structure/table/reinforced,/obj/machinery/door/firedoor,/turf/open/floor/wood,/area/eventmap/inside)
-"avy" = (/obj/effect/landmark/start/cook,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"avz" = (/obj/effect/decal/cleanable/plasma,/turf/closed/wall/mineral/wood,/area/eventmap/inside)
-"avA" = (/obj/machinery/doppler_array,/turf/open/floor/plasteel,/area/eventmap/inside)
-"avB" = (/obj/effect/decal/cleanable/blood/tracks,/obj/effect/decal/cleanable/blood/splatter,/mob/living/simple_animal/pet/cat/custom_cat{name = "Ghost cat"},/turf/open/floor/sepia,/area/eventmap/inside)
-"avC" = (/obj/machinery/iv_drip,/turf/open/floor/plasteel,/area/eventmap/inside)
-"avD" = (/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 8; name = "Blood"},/obj/effect/decal/cleanable/blood/splatter{icon_state = "floor2"},/turf/open/floor/plasteel/dark/side{dir = 4},/area/eventmap/inside)
-"avE" = (/obj/item/storage/box/donkpockets,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"avF" = (/obj/item/storage/box/fakesyndiesuit,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"avG" = (/obj/effect/turf_decal/weather/snow/corner{color = "#991111"},/obj/effect/decal/cleanable/blood/splatter{icon_state = "gib5"},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"avH" = (/obj/effect/turf_decal/weather/snow/corner{color = "#991111"},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"avI" = (/obj/effect/turf_decal/weather/snow/corner{color = "#991111"},/obj/effect/decal/cleanable/blood/splatter{icon_state = "floor5"},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"avJ" = (/obj/effect/decal/cleanable/blood/splatter{icon_state = "gib4"},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"avK" = (/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 4},/obj/effect/gibspawner/human,/turf/open/floor/plasteel/dark/side{dir = 8},/area/eventmap/inside)
-"avL" = (/atom/movable/screen/alert/status_effect/blooddrunk{desc = "I'M WATCHING YOU, COWARD."; name = "???"},/turf/open/indestructible/spooknecropolis,/area/eventmap/inside)
-"avM" = (/turf/open/indestructible/spooknecropolis,/area/eventmap/inside)
-"avN" = (/atom/movable/screen/alert/status_effect/blooddrunk{desc = "YOUR SOUL IS MINE, MORTAL."; name = "???"},/turf/open/indestructible/spooknecropolis,/area/eventmap/inside)
-"avO" = (/obj/item/reagent_containers/food/condiment/sugar,/obj/item/reagent_containers/food/condiment/sugar,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"avP" = (/obj/structure/bookcase/random/fiction,/turf/open/floor/wood{icon_state = "wood-broken3"},/area/eventmap/inside)
-"avQ" = (/obj/structure/bed,/obj/item/bedsheet/random,/obj/machinery/button/door/dorms/dorm15,/obj/effect/decal/cleanable/dirt,/turf/open/floor/wood,/area/eventmap/inside)
-"avR" = (/obj/effect/turf_decal/stripes/line,/obj/effect/turf_decal/stripes/line{dir = 1},/obj/structure/plasticflaps/opaque,/obj/machinery/conveyor{dir = 8; icon_state = "conveyor_map"; id = "cargo_in"},/turf/open/floor/plating,/area/eventmap/inside)
-"avS" = (/obj/structure/fence,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"avT" = (/obj/structure/fluff/empty_cryostasis_sleeper,/obj/effect/decal/cleanable/glass,/turf/open/floor/plasteel,/area/eventmap/inside)
-"avU" = (/mob/living/simple_animal/astral{desc = "...Is haunting Space Station Three."; name = "Ghost"},/turf/open/floor/sepia,/area/eventmap/inside)
-"avV" = (/obj/machinery/loot_locator,/turf/open/floor/sepia,/area/eventmap/inside)
-"avW" = (/obj/effect/decal/cleanable/blood/tracks,/obj/effect/decal/cleanable/blood/splatter{icon_state = "gib3"},/turf/open/floor/sepia,/area/eventmap/inside)
-"avX" = (/turf/closed/indestructible/riveted,/area/eventmap/inside)
-"avY" = (/obj/machinery/door/airlock/virology,/obj/structure/spacevine,/turf/open/floor/wood,/area/eventmap/inside)
-"avZ" = (/obj/structure/spacevine,/obj/effect/spawner/structure/window/reinforced,/turf/open/floor/clockwork/reebe,/area/eventmap/inside)
-"awa" = (/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 8; name = "Blood"},/obj/effect/gibspawner/human,/turf/open/floor/plasteel/dark/side{dir = 4},/area/eventmap/inside)
-"awb" = (/obj/effect/decal/cleanable/blood/splatter{icon_state = "floor2"},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"awc" = (/obj/structure/reagent_dispensers/cooking_oil,/obj/structure/showcase/horrific_experiment{icon_state = "cover-on"; layer = 4.5},/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 6},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"awd" = (/turf/closed/wall/r_wall/rust,/area/eventmap/inside)
-"awe" = (/obj/structure/reagent_dispensers/cooking_oil,/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 10},/obj/structure/showcase/horrific_experiment{icon_state = "cover-on"; layer = 4.5},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"awf" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 4},/obj/effect/decal/cleanable/blood/splatter{icon_state = "gibmid1"},/obj/item/organ/brain,/turf/open/floor/plasteel/dark/side{dir = 8},/area/eventmap/inside)
-"awg" = (/obj/structure/flora/junglebush{icon_state = "grassa4"},/obj/vehicle/ridden/atv,/obj/item/key,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"awh" = (/obj/machinery/light/small{dir = 1},/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"awi" = (/obj/structure/fluff/bus/dense,/turf/open/floor/spooktime/cobble/sideW{icon_state = "cobble_side_n"},/area/shuttle/arrival)
-"awj" = (/obj/structure/fluff/bus/dense{icon_state = "hoodtop"},/obj/docking_port/mobile/arrivals,/turf/open/floor/spooktime/cobble/sideS,/area/eventmap/outside)
-"awk" = (/turf/open/floor/spooktime/cobble/sideE,/area/eventmap/outside)
-"awl" = (/turf/open/floor/spooktime/cobble/sideW,/area/eventmap/outside)
-"awm" = (/obj/effect/landmark/observer_start,/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"awn" = (/turf/open/floor/spooktime/cobble/cornerSE,/area/eventmap/outside)
-"awo" = (/turf/open/floor/spooktime/cobble/cornerSW,/area/eventmap/outside)
-"awp" = (/mob/living/carbon/true_devil,/turf/open/indestructible/spooknecropolis,/area/eventmap/inside)
-"awq" = (/obj/item/reagent_containers/food/condiment/mayonnaise,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"awr" = (/obj/structure/table/reinforced,/obj/machinery/door/firedoor,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"aws" = (/obj/structure/mineral_door/wood,/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{id = "C02"},/turf/open/floor/wood,/area/eventmap/inside)
-"awt" = (/obj/machinery/light{dir = 8},/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"awu" = (/obj/machinery/vending/hydroseeds,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"awv" = (/obj/structure/sign/departments/medbay/alt{pixel_y = 32},/turf/open/floor/carpet,/area/eventmap/inside)
-"aww" = (/obj/structure/sign/directions/medical{dir = 4; pixel_x = 32; pixel_y = -24},/obj/structure/sign/directions/evac{dir = 4; pixel_x = 32; pixel_y = -32},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"awx" = (/obj/machinery/light/small{dir = 1},/turf/open/floor/carpet,/area/eventmap/inside)
-"awy" = (/obj/structure/table/wood,/obj/item/paper_bin/bundlenatural,/obj/item/pen,/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"awz" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/wood/damturf/broken4,/area/eventmap/inside)
-"awA" = (/obj/structure/chair/stool/bar,/obj/effect/landmark/start/assistant,/turf/open/floor/wood,/area/eventmap/inside)
-"awB" = (/obj/machinery/light/small{dir = 4},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"awC" = (/obj/item/storage/box/drinkingglasses,/obj/structure/table/reinforced,/obj/machinery/door/firedoor,/turf/open/floor/wood,/area/eventmap/inside)
-"awD" = (/obj/machinery/droneDispenser,/turf/open/floor/plasteel,/area/eventmap/inside)
-"awE" = (/obj/effect/decal/cleanable/salt,/turf/open/floor/sepia,/area/eventmap/inside)
-"awF" = (/obj/effect/decal/cleanable/blood/tracks,/turf/open/floor/sepia,/area/eventmap/inside)
-"awG" = (/obj/structure/mineral_door/wood,/turf/open/floor/plasteel/dark/side,/area/eventmap/inside)
-"awH" = (/turf/open/floor/plasteel/dark/side{dir = 6},/area/eventmap/inside)
-"awI" = (/obj/effect/decal/cleanable/blood/tracks{dir = 4},/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 4},/obj/effect/gibspawner/human,/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"awJ" = (/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 8; name = "Blood"},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"awK" = (/obj/effect/decal/cleanable/blood/splatter{icon_state = "gibup1"},/obj/item/organ/stomach,/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"awL" = (/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 8; name = "Blood"},/obj/effect/decal/cleanable/blood/splatter{icon_state = "coatblood"},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"awM" = (/obj/structure/table/wood/fancy/blackred,/obj/item/toy/toy_dagger,/turf/open/indestructible/spooknecropolis,/area/eventmap/inside)
-"awN" = (/obj/structure/table/wood/fancy/blackred,/obj/item/clothing/neck/devilwings,/turf/open/indestructible/spooknecropolis,/area/eventmap/inside)
-"awO" = (/obj/structure/table/wood/fancy/blackred,/obj/item/blood_beam,/turf/open/indestructible/spooknecropolis,/area/eventmap/inside)
-"awP" = (/obj/structure/fluff/drake_statue,/turf/open/indestructible/spooknecropolis,/area/eventmap/inside)
-"awQ" = (/obj/item/clothing/glasses/wraith_spectacles,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"awR" = (/obj/structure/mineral_door/wood,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"awS" = (/obj/effect/landmark/start/captain,/obj/structure/cable/white{icon_state = "1-2"},/obj/structure/cable/white,/turf/open/floor/wood,/area/eventmap/inside)
-"awT" = (/obj/structure/table,/obj/machinery/microwave,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"awU" = (/obj/structure/table,/obj/item/reagent_containers/food/condiment/enzyme,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"awV" = (/obj/structure/table,/obj/item/storage/box/ingredients/delights,/obj/item/storage/box/ingredients/exotic,/obj/item/storage/box/ingredients/italian,/obj/item/storage/box/ingredients/grains,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"awW" = (/obj/structure/bed/dogbed/ian,/obj/structure/cable/white{icon_state = "0-2"},/mob/living/simple_animal/pet/dog/corgi/Ian,/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"awX" = (/obj/structure/sink{dir = 8; pixel_x = -12},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"awY" = (/obj/machinery/vending/hydronutrients,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"awZ" = (/obj/structure/bodycontainer/morgue,/turf/open/floor/plasteel,/area/eventmap/inside)
-"axa" = (/obj/structure/showcase/horrific_experiment{icon_state = "pod_1"},/turf/open/floor/sepia,/area/eventmap/inside)
-"axb" = (/obj/structure/showcase/machinery/implanter,/turf/open/floor/sepia,/area/eventmap/inside)
-"axc" = (/obj/machinery/computer/cloning,/obj/effect/decal/cleanable/oil,/turf/open/floor/sepia,/area/eventmap/inside)
-"axd" = (/obj/structure/showcase/horrific_experiment,/obj/effect/decal/cleanable/glass,/turf/open/floor/sepia,/area/eventmap/inside)
-"axe" = (/obj/structure/showcase/machinery/oldpod,/obj/effect/decal/cleanable/oil,/turf/open/floor/sepia,/area/eventmap/inside)
-"axf" = (/obj/structure/mineral_door/wood,/turf/open/floor/plasteel/dark/side{dir = 1},/area/eventmap/inside)
-"axg" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/plasteel/dark/side{dir = 5},/area/eventmap/inside)
-"axh" = (/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 4},/obj/effect/decal/cleanable/blood/innards,/obj/effect/decal/cleanable/blood/splatter,/obj/structure/closet/secure_closet/freezer/fridge,/obj/item/clothing/head/hooded/human_head,/obj/item/reagent_containers/food/snacks/burger/human,/obj/item/reagent_containers/food/snacks/burger/human,/obj/item/reagent_containers/food/snacks/kebab/human,/obj/item/reagent_containers/food/snacks/meat/cutlet/plain/human,/obj/item/reagent_containers/food/snacks/meat/rawcutlet/plain/human,/obj/item/reagent_containers/food/snacks/meat/slab/human,/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/avian,/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/fly,/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/golem,/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/insect,/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/lizard,/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/plant,/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/shadow,/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/skeleton,/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/slime,/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"axi" = (/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 8; name = "Blood"},/obj/effect/decal/cleanable/blood/splatter{icon_state = "gibbearcore"},/obj/item/organ/tongue,/turf/open/floor/plasteel/dark/side{dir = 4},/area/eventmap/inside)
-"axj" = (/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 4},/turf/open/floor/plasteel/dark/side{dir = 8},/area/eventmap/inside)
-"axk" = (/obj/structure/healingfountain,/turf/open/indestructible/spooknecropolis,/area/eventmap/inside)
-"axl" = (/obj/structure/table/wood/fancy/blackred,/obj/item/tome,/turf/open/indestructible/spooknecropolis,/area/eventmap/inside)
-"axm" = (/obj/structure/table/wood/fancy/blackred,/obj/item/toy/spinningtoy{name = "Gate to hell"},/turf/open/indestructible/spooknecropolis,/area/eventmap/inside)
-"axn" = (/obj/structure/table/wood/fancy/blackred,/obj/item/organ/heart/demon,/turf/open/indestructible/spooknecropolis,/area/eventmap/inside)
-"axo" = (/obj/structure/bed,/obj/item/bedsheet/cult,/turf/open/indestructible/spooknecropolis,/area/eventmap/inside)
-"axp" = (/obj/machinery/light/small{dir = 8},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"axq" = (/obj/structure/toilet,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"axr" = (/obj/structure/closet/secure_closet/hydroponics,/obj/machinery/camera/emp_proof{c_tag = "Containment - Fore Port"; dir = 4; network = list("singularity")},/turf/open/floor/wood,/area/eventmap/inside)
-"axs" = (/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/cable/yellow{icon_state = "1-4"},/obj/structure/cable/yellow{icon_state = "1-8"},/turf/open/floor/carpet,/area/eventmap/inside)
-"axt" = (/obj/structure/cable/yellow{icon_state = "2-8"},/turf/open/floor/carpet,/area/eventmap/inside)
-"axu" = (/obj/machinery/camera/emp_proof{c_tag = "Library Game Room"; dir = 1; network = list("singularity")},/turf/open/floor/wood/damturf/broken2,/area/eventmap/inside)
-"axv" = (/obj/structure/chair/wood{dir = 1},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"axw" = (/obj/machinery/computer/communications{icon_state = "computer"; dir = 4},/turf/open/floor/wood,/area/eventmap/inside)
-"axx" = (/obj/structure/chair/wood{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"axy" = (/obj/item/storage/box/matches,/obj/structure/table/wood,/obj/item/storage/fancy/candle_box,/obj/item/storage/fancy/candle_box,/turf/open/floor/wood,/area/eventmap/inside)
-"axz" = (/obj/item/storage/box/ingredients/wildcard,/obj/item/storage/box/ingredients/wildcard,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"axA" = (/obj/machinery/deepfryer,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"axB" = (/obj/structure/cable/white{icon_state = "1-2"},/obj/structure/cable/white{icon_state = "1-4"},/turf/open/floor/wood,/area/eventmap/inside)
-"axC" = (/obj/structure/table/wood,/obj/machinery/recharger,/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"axD" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/sepia,/area/eventmap/inside)
-"axE" = (/obj/effect/decal/cleanable/glass,/mob/living/simple_animal/astral{desc = "...Is haunting Space Station Three."; name = "Ghost"},/turf/open/floor/sepia,/area/eventmap/inside)
-"axF" = (/obj/effect/decal/cleanable/plasma,/turf/open/floor/sepia,/area/eventmap/inside)
-"axG" = (/obj/machinery/door/airlock/virology,/turf/open/floor/clockwork/reebe,/area/eventmap/inside)
-"axH" = (/obj/structure/bed{desc = "A large structure used to break the femurs of traitors and treasonists."; icon = 'icons/obj/femur_breaker.dmi'; icon_state = "breaker_raised"; name = "Femur breaker"},/obj/effect/decal/cleanable/blood/gibs/limb{icon_state = "gibleg"},/obj/effect/decal/cleanable/blood/splatter{icon_state = "gib3"},/obj/effect/decal/cleanable/blood/splatter{icon_state = "floor2"},/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 4},/obj/item/organ/appendix,/turf/open/floor/plasteel/dark/side{dir = 8},/area/eventmap/inside)
-"axI" = (/obj/effect/decal/cleanable/blood/splatter{icon_state = "gib6"},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"axJ" = (/obj/structure/reagent_dispensers/cooking_oil,/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 5},/obj/structure/showcase/horrific_experiment{icon_state = "cover-on"; layer = 4.5},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"axK" = (/obj/structure/reagent_dispensers/cooking_oil,/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 9},/obj/structure/showcase/horrific_experiment{icon_state = "cover-on"; layer = 4.5},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"axL" = (/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 4},/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 4},/obj/effect/decal/cleanable/blood/splatter{icon_state = "gibmid3"},/obj/item/organ/eyes,/turf/open/floor/plasteel/dark/side{dir = 8},/area/eventmap/inside)
-"axM" = (/obj/structure/table,/obj/item/storage/box/ingredients/american,/obj/item/storage/box/ingredients/fiesta,/obj/item/storage/box/ingredients/grains,/obj/item/storage/box/ingredients/fruity,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"axN" = (/obj/structure/filingcabinet,/obj/structure/cable/white{icon_state = "2-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"axO" = (/obj/machinery/smartfridge/food,/turf/closed/wall/mineral/wood,/area/eventmap/inside)
-"axP" = (/obj/structure/filingcabinet/chestdrawer,/obj/structure/cable/white{icon_state = "2-4"},/turf/open/floor/wood,/area/eventmap/inside)
-"axQ" = (/obj/machinery/light/small{dir = 8},/obj/structure/closet/secure_closet/hydroponics,/obj/structure/cable/yellow{icon_state = "2-4"},/turf/open/floor/wood,/area/eventmap/inside)
-"axR" = (/obj/machinery/computer/card{dir = 4},/obj/structure/cable/white{icon_state = "4-8"},/obj/structure/cable/white{icon_state = "1-4"},/turf/open/floor/wood,/area/eventmap/inside)
-"axS" = (/obj/machinery/door/airlock{name = "Hydroponics Backroom"; req_access_txt = "35"},/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"axT" = (/obj/machinery/light/small,/turf/open/floor/carpet,/area/eventmap/inside)
-"axU" = (/obj/structure/sign/departments/restroom{pixel_y = -32},/obj/machinery/camera/emp_proof{c_tag = "Containment - Particle Accelerator"; dir = 1; network = list("singularity")},/turf/open/floor/carpet,/area/eventmap/inside)
-"axV" = (/obj/structure/sign/directions/science{pixel_x = 32; pixel_y = -40},/obj/structure/sign/directions/evac{dir = 4; pixel_x = 32; pixel_y = -24},/turf/open/floor/carpet,/area/eventmap/inside)
-"axW" = (/obj/structure/falsewall/wood,/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"axX" = (/obj/structure/cable/yellow{icon_state = "1-4"},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"axY" = (/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"axZ" = (/obj/item/reagent_containers/food/condiment/soysauce,/obj/structure/cable/yellow{icon_state = "2-8"},/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"aya" = (/obj/structure/cable/white{icon_state = "4-8"},/obj/structure/chair/wood,/obj/effect/landmark/start/head_of_personnel,/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"ayb" = (/obj/structure/cable/white{icon_state = "4-8"},/obj/structure/cable/white{icon_state = "1-8"},/obj/structure/cable/white{icon_state = "1-4"},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"ayc" = (/obj/item/storage/box/ingredients/sweets,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"ayd" = (/obj/item/storage/box/ingredients/vegetarian,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"aye" = (/obj/effect/landmark/start/mime,/turf/open/floor/wood,/area/eventmap/inside)
-"ayf" = (/obj/structure/table/wood/fancy/royalblack,/turf/open/floor/wood,/area/eventmap/inside)
-"ayg" = (/obj/structure/table/wood/fancy/royalblack,/obj/item/toy/dummy,/turf/open/floor/wood,/area/eventmap/inside)
-"ayh" = (/obj/effect/decal/cleanable/chem_pile,/turf/open/floor/sepia,/area/eventmap/inside)
-"ayi" = (/turf/open/floor/clockwork/reebe,/area/eventmap/inside)
-"ayj" = (/obj/item/ectoplasm,/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/zombie,/turf/open/floor/clockwork/reebe,/area/eventmap/inside)
-"ayk" = (/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 8; name = "Blood"},/obj/effect/decal/cleanable/plasma,/turf/open/floor/plasteel/dark/side{dir = 4},/area/eventmap/inside)
-"ayl" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/effect/decal/cleanable/blood/tracks,/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"aym" = (/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 1},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"ayn" = (/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 1},/obj/effect/decal/cleanable/blood/splatter{icon_state = "splatter1"},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"ayo" = (/obj/structure/table/plasmaglass,/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"ayp" = (/obj/structure/fluff/divine/convertaltar,/turf/open/indestructible/spooknecropolis,/area/eventmap/inside)
-"ayq" = (/obj/machinery/dna_scannernew,/turf/open/floor/plasteel,/area/eventmap/inside)
-"ayr" = (/obj/machinery/computer/cloning,/turf/open/floor/plasteel,/area/eventmap/inside)
-"ays" = (/obj/machinery/clonepod/experimental,/turf/open/floor/plasteel,/area/eventmap/inside)
-"ayt" = (/obj/structure/fluff/empty_terrarium,/obj/effect/decal/cleanable/oil,/obj/effect/decal/cleanable/glass,/turf/open/floor/plasteel,/area/eventmap/inside)
-"ayu" = (/obj/machinery/nuclearbomb/beer,/turf/open/floor/plasteel,/area/eventmap/inside)
-"ayv" = (/obj/structure/table,/obj/item/hand_labeler,/obj/item/defibrillator/loaded,/obj/item/extendohand/acme,/turf/open/floor/plasteel,/area/eventmap/inside)
-"ayw" = (/obj/structure/table,/obj/item/inducer/sci,/obj/item/defibrillator/loaded,/obj/item/defibrillator/loaded,/obj/item/storage/box/beakers/bluespace,/obj/item/storage/belt/medolier/full,/turf/open/floor/plasteel,/area/eventmap/inside)
-"ayx" = (/obj/structure/table,/obj/item/implanter/sad_trombone,/obj/item/implanter/sad_trombone,/obj/item/implanter/tracking/gps,/obj/item/implanter/tracking/gps,/obj/item/healthanalyzer/advanced,/obj/item/pneumatic_cannon/pie,/obj/item/storage/box/hug,/turf/open/floor/plasteel,/area/eventmap/inside)
-"ayy" = (/obj/item/organ/appendix{icon_state = "blacktumor"; name = "Festering ooze"},/turf/open/floor/clockwork/reebe,/area/eventmap/inside)
-"ayz" = (/obj/structure/cloth_pile,/turf/open/floor/clockwork/reebe,/area/eventmap/inside)
-"ayA" = (/obj/machinery/light/floor{alpha = 0; light_range = 20; mouse_opacity = 0},/obj/machinery/light/floor{alpha = 0; light_range = 20; max_integrity = 9999; mouse_opacity = 0},/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"ayB" = (/obj/machinery/recharge_station,/turf/open/floor/carpet/monochrome,/area/eventmap/inside)
-"ayC" = (/obj/item/clothing/suit/ghost_sheet,/turf/open/floor/carpet/monochrome,/area/eventmap/inside)
-"ayD" = (/obj/structure/kitchenspike,/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 10},/obj/effect/decal/remains/plasma,/obj/effect/decal/cleanable/plasma,/turf/open/floor/plasteel/dark/corner{dir = 4},/area/eventmap/inside)
-"ayE" = (/obj/effect/turf_decal/weather/snow/corner{color = "#991111"},/obj/machinery/iv_drip,/obj/effect/decal/cleanable/plasma,/turf/open/floor/plasteel/dark/side{dir = 1},/area/eventmap/inside)
-"ayF" = (/obj/structure/kitchenspike,/obj/item/stack/sheet/animalhide/corgi,/obj/effect/turf_decal/weather/snow/corner{color = "#991111"},/obj/effect/decal/cleanable/blood/tracks,/obj/effect/decal/cleanable/blood/splatter{icon_state = "itemblood"},/obj/item/reagent_containers/food/snacks/meat/slab/corgi,/turf/open/floor/plasteel/dark/side{dir = 1},/area/eventmap/inside)
-"ayG" = (/obj/effect/turf_decal/weather/snow/corner{color = "#991111"},/obj/machinery/iv_drip,/turf/open/floor/plasteel/dark/side{dir = 1},/area/eventmap/inside)
-"ayH" = (/obj/structure/kitchenspike,/obj/effect/turf_decal/weather/snow/corner{color = "#991111"},/obj/structure/spider/stickyweb,/obj/effect/decal/cleanable/blood/splatter{icon_state = "u_psycopath"},/obj/effect/decal/cleanable/blood/splatter{icon_state = "gibdown1"},/turf/open/floor/plasteel/dark/side{dir = 1},/area/eventmap/inside)
-"ayI" = (/obj/structure/kitchenspike,/obj/item/stack/sheet/animalhide/lizard,/obj/effect/turf_decal/weather/snow/corner{color = "#991111"},/obj/effect/decal/cleanable/blood/tracks,/obj/effect/decal/cleanable/blood/splatter{icon_state = "floor4-old"},/obj/effect/decal/cleanable/blood/splatter{icon_state = "splatter4"},/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/lizard,/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/lizard,/turf/open/floor/plasteel/dark/side{dir = 1},/area/eventmap/inside)
-"ayJ" = (/obj/structure/kitchenspike,/obj/item/stack/sheet/animalhide/monkey,/obj/effect/turf_decal/weather/snow/corner{color = "#991111"},/obj/effect/decal/cleanable/blood/tracks,/obj/effect/decal/cleanable/blood/splatter{icon_state = "gibmid3"},/obj/item/reagent_containers/food/snacks/meat/slab/monkey,/obj/item/reagent_containers/food/snacks/meat/slab/monkey,/turf/open/floor/plasteel/dark/side{dir = 1},/area/eventmap/inside)
-"ayK" = (/obj/structure/kitchenspike,/obj/item/stack/sheet/animalhide/xeno,/obj/effect/turf_decal/weather/snow/corner{color = "#991111"; dir = 6},/obj/effect/decal/cleanable/blood/tracks,/obj/effect/decal/cleanable/blood/splatter{icon_state = "xgib2"},/obj/effect/decal/cleanable/blood/splatter{icon_state = "xgiblarvahead"},/obj/item/reagent_containers/food/snacks/meat/slab/xeno,/obj/item/reagent_containers/food/snacks/meat/slab/xeno,/turf/open/floor/plasteel/dark/corner{dir = 1},/area/eventmap/inside)
-"ayL" = (/atom/movable/screen/alert/status_effect/blooddrunk{desc = "BEWARE, I LIVE."; name = "???"},/turf/open/indestructible/spooknecropolis,/area/eventmap/inside)
-"ayM" = (/atom/movable/screen/alert/status_effect/blooddrunk{desc = "WELCOME TO HELL, CURSED ONE."; name = "???"},/turf/open/indestructible/spooknecropolis,/area/eventmap/inside)
-"ayN" = (/turf/closed/indestructible/spookytime/matrixblocker,/area/eventmap/mountain)
-"ayO" = (/turf/open/floor/spooktime/cobble/sideS,/area/eventmap/outside)
-"ayP" = (/obj/structure/fluff/bus/passable{icon_state = "wheredahoodat"},/turf/open/floor/spooktime/cobble/sideW{icon_state = "cobble_side_n"},/area/eventmap/outside)
-"ayQ" = (/turf/open/floor/spooktime/cobble/sideW{icon_state = "cobble_corner_ne"},/area/eventmap/outside)
-"ayR" = (/obj/effect/landmark/start/research_director,/turf/open/floor/spooktime/cobble/sideS,/area/eventmap/outside)
-"ayS" = (/obj/effect/landmark/start/head_of_personnel,/turf/open/floor/spooktime/cobble/sideS,/area/eventmap/outside)
-"ayT" = (/obj/effect/landmark/start/captain,/turf/open/floor/spooktime/cobble/sideS,/area/eventmap/outside)
-"ayU" = (/obj/machinery/door/airlock/command{name = "Head of Personnel's Quarters"; req_access_txt = "57"},/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"ayV" = (/obj/structure/spacevine,/obj/structure/spacevine,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"ayW" = (/obj/machinery/light/small{dir = 1},/turf/open/floor/plating,/area/eventmap/mountaininside)
-"ayX" = (/obj/structure/cable/white{icon_state = "2-8"},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"ayY" = (/obj/structure/noticeboard{dir = 8; pixel_x = 32},/turf/open/floor/wood,/area/eventmap/inside)
-"ayZ" = (/obj/effect/landmark/start/librarian,/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"aza" = (/obj/effect/landmark/start/scientist,/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"azb" = (/obj/effect/landmark/start/assistant,/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"azc" = (/obj/effect/landmark/start/assistant,/turf/open/floor/spooktime/cobble/sideW,/area/eventmap/outside)
-"azd" = (/obj/effect/landmark/start/assistant,/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"aze" = (/obj/item/reagent_containers/food/drinks/bottle/trappist,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"azf" = (/obj/effect/landmark/start/lawyer,/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"azg" = (/obj/effect/landmark/start/roboticist,/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"azh" = (/obj/structure/punching_bag,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"azi" = (/obj/effect/landmark/start,/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"azj" = (/obj/effect/landmark/start,/turf/open/floor/spooktime/cobble/cornerSW,/area/eventmap/outside)
-"azk" = (/obj/effect/landmark/start,/turf/open/floor/spooktime/cobble/sideS,/area/eventmap/outside)
-"azl" = (/obj/effect/landmark/start/assistant,/turf/open/floor/spooktime/cobble/sideS,/area/eventmap/outside)
-"azm" = (/obj/effect/landmark/start/mime,/turf/open/floor/spooktime/cobble/sideS,/area/eventmap/outside)
-"azn" = (/obj/effect/landmark/start/chief_engineer,/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"azo" = (/obj/machinery/light/small{dir = 1},/obj/structure/table/wood/fancy/royalblack,/obj/item/camera/spooky,/turf/open/floor/wood,/area/eventmap/inside)
-"azp" = (/obj/item/reagent_containers/food/snacks/kebab/rat/double,/obj/structure/table/reinforced,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"azq" = (/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/plasteel/stairs/medium,/area/eventmap/outside)
-"azr" = (/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/spooktime/cobble/sideN,/area/eventmap/outside)
-"azs" = (/obj/effect/landmark/start/atmospheric_technician,/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"azt" = (/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"azu" = (/obj/machinery/light/small{dir = 8},/turf/open/floor/spooktime/cobble/sideW,/area/eventmap/outside)
-"azv" = (/obj/structure/flora/tree/jungle,/obj/structure/flora/tree/jungle,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"azw" = (/obj/machinery/autolathe,/obj/effect/turf_decal/bot,/turf/open/floor/plasteel,/area/eventmap/inside)
-"azx" = (/obj/structure/chair/wood{dir = 4},/obj/effect/landmark/start/geneticist,/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"azy" = (/obj/machinery/vending/coffee,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"azz" = (/obj/structure/dresser,/obj/structure/curtain{color = "#B22222"; pixel_x = 32},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"azA" = (/obj/structure/sign/directions/evac{dir = 4; pixel_x = 32; pixel_y = -24},/turf/open/floor/spooktime/cobble/cornerSE,/area/eventmap/outside)
-"azB" = (/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/indestructible/cobble,/area/eventmap/outside)
-"azC" = (/obj/effect/landmark/start/assistant,/turf/open/floor/spooktime/cobble/sideE,/area/eventmap/outside)
-"azD" = (/obj/effect/landmark/start/shaft_miner,/turf/open/floor/spooktime/cobble/sideE,/area/eventmap/outside)
-"azE" = (/obj/structure/flora/ausbushes/ywflowers,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"azF" = (/obj/effect/landmark/start/librarian,/turf/open/floor/spooktime/cobble/sideW,/area/eventmap/outside)
-"azG" = (/obj/structure/chair/wood/wings,/obj/effect/landmark/start/assistant,/turf/open/floor/wood,/area/eventmap/inside)
-"azH" = (/obj/machinery/computer/scan_consolenew{dir = 8},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"azI" = (/obj/effect/landmark/start/scientist,/turf/open/floor/spooktime/cobble/sideW,/area/eventmap/outside)
-"azJ" = (/obj/structure/closet/secure_closet/captains,/turf/open/floor/wood,/area/eventmap/inside)
-"azK" = (/obj/structure/flora/grass/jungle/b,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"azL" = (/obj/machinery/vending/wardrobe/jani_wardrobe,/turf/open/floor/plasteel,/area/eventmap/inside)
-"azM" = (/obj/structure/closet/l3closet/janitor,/turf/open/floor/plasteel,/area/eventmap/inside)
-"azN" = (/obj/structure/closet/jcloset,/turf/open/floor/plasteel,/area/eventmap/inside)
-"azO" = (/obj/machinery/vending/medical{req_access = null},/obj/machinery/light/small{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"azP" = (/turf/open/floor/spooktime/beach/coasts/coastW,/area/eventmap/outside)
-"azQ" = (/turf/closed/indestructible/spookytime/matrixblocker,/area/eventmap/mountaininside)
-"azR" = (/obj/structure/reagent_dispensers/watertank/high,/obj/structure/disposalpipe/segment{dir = 4},/turf/open/floor/plasteel,/area/eventmap/inside)
-"azS" = (/obj/effect/wisp,/turf/open/floor/carpet/green,/area/eventmap/inside)
-"azT" = (/obj/structure/table/wood/fancy/green,/obj/item/gun/magic/staff/healing,/obj/item/gun/magic/staff/healing,/turf/open/floor/wood,/area/eventmap/inside)
-"azU" = (/turf/open/floor/spooktime/beach/coasts/coastNE,/area/eventmap/outside)
-"azV" = (/obj/structure/barricade/wooden/crude,/obj/structure/spacevine,/obj/effect/spawner/structure/window,/turf/open/floor/wood,/area/eventmap/inside)
-"azW" = (/obj/item/flashlight/glowstick/orange,/turf/open/floor/spooktime/beach,/area/eventmap/outside)
-"azX" = (/obj/structure/curtain{color = "#B22222"; pixel_x = -32},/obj/structure/bookcase/random/adult,/turf/open/floor/wood,/area/eventmap/inside)
-"azY" = (/obj/structure/cable/yellow{icon_state = "2-4"},/turf/open/floor/wood,/area/eventmap/inside)
-"azZ" = (/obj/item/storage/pill_bottle/happy,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aAa" = (/obj/structure/disposalpipe/segment{dir = 4},/turf/closed/wall/mineral/wood,/area/eventmap/inside)
-"aAb" = (/turf/closed/mineral/ash_rock,/area/eventmap/mountaininside)
-"aAc" = (/obj/machinery/door/airlock/glass_large,/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{id = "C05"},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aAd" = (/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/disposalpipe/segment{dir = 4},/turf/open/floor/wood,/area/eventmap/inside)
-"aAe" = (/obj/structure/reagent_dispensers/beerkeg,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aAf" = (/obj/structure/disposalpipe/segment{dir = 10},/turf/open/floor/wood,/area/eventmap/inside)
-"aAg" = (/obj/structure/chair/comfy/black{dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"aAh" = (/obj/item/storage/fancy/cigarettes/cigpack_shadyjims,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aAi" = (/obj/structure/cable/pink{icon_state = "6-9"},/turf/open/floor/plating,/area/eventmap/mountain)
-"aAj" = (/obj/structure/table/wood/fancy,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aAk" = (/obj/machinery/camera/emp_proof{c_tag = "Containment - Particle Accelerator"; dir = 1; network = list("singularity")},/turf/open/floor/wood,/area/eventmap/inside)
-"aAl" = (/obj/machinery/chem_dispenser/drinks/beer/fullupgrade{dir = 1},/obj/structure/table,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"aAm" = (/obj/machinery/chem_dispenser/drinks/fullupgrade{dir = 1},/obj/structure/table,/obj/structure/cable/yellow,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"aAn" = (/obj/structure/closet/secure_closet/freezer/fridge,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/milk,/obj/item/reagent_containers/food/condiment/soymilk,/obj/item/reagent_containers/food/condiment/soymilk,/obj/item/reagent_containers/food/condiment/soymilk,/obj/item/reagent_containers/food/condiment/soymilk,/obj/item/reagent_containers/food/condiment/soymilk,/obj/item/reagent_containers/food/condiment/soymilk,/obj/item/reagent_containers/food/condiment/soymilk,/obj/item/reagent_containers/food/condiment/soymilk,/obj/item/reagent_containers/food/condiment/soymilk,/obj/item/reagent_containers/food/condiment/soymilk,/obj/item/reagent_containers/food/condiment/soymilk,/obj/item/reagent_containers/food/condiment/soymilk,/obj/item/reagent_containers/food/condiment/soymilk,/obj/item/reagent_containers/food/condiment/soymilk,/obj/item/storage/fancy/egg_box,/obj/item/storage/fancy/egg_box,/obj/item/storage/fancy/egg_box,/obj/item/storage/fancy/egg_box,/obj/item/storage/fancy/egg_box,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"aAo" = (/obj/item/chair,/turf/open/floor/plasteel/damturf/platdmg3,/area/eventmap/mountaininside)
-"aAp" = (/obj/item/stack/sheet/mineral/mythril,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aAq" = (/obj/machinery/processor,/obj/machinery/light/small,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"aAr" = (/obj/item/disk/tech_disk/debug,/obj/machinery/light/floor,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aAs" = (/obj/structure/noticeboard{dir = 1; pixel_y = -32},/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/item/reagent_containers/food/condiment/flour,/obj/structure/closet/secure_closet/freezer/fridge,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"aAt" = (/obj/item/reagent_containers/food/drinks/bottle/bottleofnothing,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aAu" = (/obj/structure/chair/comfy/beige{dir = 8},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aAv" = (/obj/structure/reagent_dispensers/watertank/high,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aAw" = (/obj/item/storage/pill_bottle/happiness,/obj/effect/decal/cleanable/dirt,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aAx" = (/obj/machinery/light,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aAy" = (/obj/structure/fermenting_barrel,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aAz" = (/obj/structure/closet/crate/hydroponics,/obj/structure/cable/yellow,/obj/structure/sign/poster/contraband/kudzu{pixel_y = -32},/turf/open/floor/wood,/area/eventmap/inside)
-"aAA" = (/obj/item/reagent_containers/food/snacks/chips,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aAB" = (/obj/structure/beebox/unwrenched,/turf/open/floor/wood,/area/eventmap/inside)
-"aAC" = (/obj/structure/table,/obj/structure/cable/white{icon_state = "0-4"},/obj/item/storage/box/bodybags{pixel_x = -3; pixel_y = 5},/obj/item/storage/box/rxglasses,/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"aAD" = (/obj/structure/flora/ausbushes/leafybush,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aAE" = (/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"aAF" = (/obj/machinery/light{dir = 4},/turf/open/floor/carpet,/area/eventmap/inside)
-"aAG" = (/obj/item/lighter,/turf/open/floor/carpet/purple,/area/eventmap/mountaininside)
-"aAH" = (/obj/structure/cable/white{icon_state = "1-8"},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"aAI" = (/obj/machinery/dna_scannernew,/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"aAJ" = (/turf/open/floor/spooktime/beach/coasts/watercoastNE,/area/eventmap/outside)
-"aAK" = (/obj/structure/falsewall/wood,/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"aAL" = (/obj/item/storage/pill_bottle/stimulant,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aAM" = (/obj/machinery/light/small{dir = 1},/obj/structure/toilet{dir = 4},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aAN" = (/obj/structure/bonfire,/turf/open/floor/engine,/area/eventmap/mountain)
-"aAO" = (/obj/machinery/door/airlock{name = "Toilet Unit"},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aAP" = (/obj/structure/sign/departments/showers{pixel_y = 32},/turf/open/floor/wood,/area/eventmap/inside)
-"aAQ" = (/obj/machinery/light/small{dir = 8},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aAR" = (/obj/structure/bed,/obj/item/bedsheet/centcom,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aAS" = (/obj/machinery/light/small{dir = 1},/obj/structure/toilet{dir = 8},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aAT" = (/obj/structure/table,/obj/item/storage/box/mousetraps,/obj/item/storage/box/lights/mixed{pixel_x = 4; pixel_y = 4},/obj/machinery/light/small{dir = 8},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aAU" = (/obj/item/reagent_containers/food/snacks/fudgedice,/turf/open/floor/wood{icon_state = "wood-broken4"},/area/eventmap/inside)
-"aAV" = (/obj/effect/landmark/start/janitor,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aAW" = (/obj/machinery/door/airlock{name = "Custodial Closet"; req_access_txt = "26"},/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aAX" = (/obj/machinery/door/airlock/maintenance,/turf/open/floor/wood,/area/eventmap/inside)
-"aAY" = (/obj/machinery/light{dir = 1},/obj/structure/table/plasmaglass,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aAZ" = (/obj/machinery/vending/kink,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aBa" = (/obj/machinery/door/airlock/freezer,/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"aBb" = (/obj/structure/cable/pink{icon_state = "6-8"},/turf/open/floor/plating,/area/eventmap/mountain)
-"aBc" = (/obj/machinery/door/airlock{name = "Bar Backroom"; req_access_txt = "25"},/obj/machinery/door/firedoor,/turf/open/floor/wood,/area/eventmap/inside)
-"aBd" = (/obj/structure/table,/obj/item/folder/white,/obj/item/storage/pill_bottle/mannitol{pixel_x = -5; pixel_y = 12},/obj/item/storage/pill_bottle/mutadone{pixel_x = -8; pixel_y = 10},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"aBe" = (/obj/effect/landmark/start/geneticist,/obj/structure/chair/wood,/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"aBf" = (/obj/structure/fluff/bus/passable/seat/driver,/obj/structure/chair/comfy/shuttle{dir = 4; icon_state = ""},/obj/machinery/light/floor{alpha = 0; light_range = 20; max_integrity = 9999; mouse_opacity = 0},/turf/open/floor/plasteel/dark{icon_state = "bus"},/area/shuttle/arrival)
-"aBg" = (/obj/machinery/light/floor,/obj/machinery/telecomms/broadcaster,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aBh" = (/obj/structure/window/reinforced/spawner/north,/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"aBi" = (/obj/machinery/light/small{dir = 4; light_color = "#d8b1b1"},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aBj" = (/obj/machinery/light/small{dir = 8},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aBk" = (/obj/structure/closet/secure_closet/injection,/obj/effect/decal/cleanable/cobweb{icon_state = "cobweb2"},/obj/effect/decal/cleanable/generic,/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/wood,/area/eventmap/inside)
-"aBl" = (/obj/structure/closet/secure_closet/personal,/turf/open/floor/wood,/area/eventmap/inside)
-"aBm" = (/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aBn" = (/obj/machinery/light/small{dir = 1},/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aBo" = (/obj/machinery/light{dir = 1},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aBp" = (/obj/structure/cable/white{icon_state = "4-8"},/obj/structure/cable/white{icon_state = "1-4"},/turf/open/floor/carpet/red,/area/eventmap/inside)
-"aBq" = (/obj/structure/cable/white{icon_state = "2-8"},/obj/structure/cable/white{icon_state = "2-4"},/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/carpet/red,/area/eventmap/inside)
-"aBr" = (/obj/structure/cable/white{icon_state = "1-8"},/obj/structure/dresser,/turf/open/floor/carpet/red,/area/eventmap/inside)
-"aBs" = (/obj/machinery/vending/assist,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aBt" = (/obj/structure/closet/crate/bin,/turf/open/floor/carpet,/area/eventmap/inside)
-"aBu" = (/obj/effect/turf_decal/tile/red{icon_state = "tile_corner"; dir = 8},/turf/open/floor/plasteel/dark,/area/eventmap/mountain)
-"aBv" = (/obj/structure/table,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aBw" = (/obj/structure/chair/comfy/brown{dir = 8},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aBx" = (/obj/machinery/shower{dir = 8},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aBy" = (/obj/item/storage/fancy/cigarettes/cigpack_midori,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aBz" = (/turf/open/floor/carpet/purple,/area/eventmap/mountaininside)
-"aBA" = (/obj/item/reagent_containers/pill/zoom,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aBB" = (/obj/effect/turf_decal/tile/green{dir = 1},/turf/open/floor/plasteel/dark,/area/eventmap/mountain)
-"aBC" = (/obj/structure/chair,/obj/effect/landmark/start/assistant,/turf/open/floor/wood,/area/eventmap/inside)
-"aBD" = (/obj/item/flashlight/lantern,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aBE" = (/obj/structure/bed,/obj/item/bedsheet/pirate,/turf/open/floor/wood,/area/eventmap/inside)
-"aBF" = (/obj/machinery/telecomms/allinone/indestructable{freq_listening = list(1347,1349,1351,1353,1355,1357,1359,1447)},/obj/machinery/light/floor,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aBG" = (/obj/machinery/nanite_chamber,/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aBH" = (/obj/item/storage/pill_bottle/penis_enlargement,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aBI" = (/obj/structure/chair,/obj/effect/landmark/start/lawyer,/turf/open/floor/wood,/area/eventmap/inside)
-"aBJ" = (/obj/structure/chair,/obj/effect/landmark/start/clown,/turf/open/floor/wood,/area/eventmap/inside)
-"aBK" = (/obj/structure/curtain{color = "#B22222"; pixel_y = -32},/turf/open/floor/wood/damturf/broken3,/area/eventmap/inside)
-"aBL" = (/turf/open/floor/plasteel/damturf/damage1,/area/eventmap/mountain)
-"aBM" = (/obj/machinery/light{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"aBN" = (/turf/open/floor/spooktime/beach/coasts/watercoastW,/area/eventmap/outside)
-"aBO" = (/obj/structure/table/wood,/obj/machinery/computer/security/wooden_tv{pixel_y = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"aBP" = (/obj/structure/table/wood,/obj/item/reagent_containers/food/snacks/donut/chaos,/obj/item/reagent_containers/food/snacks/donut/jelly{pixel_x = 4; pixel_y = 2},/obj/item/reagent_containers/food/snacks/donut{pixel_x = -3; pixel_y = 5},/obj/item/reagent_containers/food/snacks/donut{pixel_x = -2; pixel_y = -4},/obj/item/reagent_containers/food/snacks/donut{pixel_x = -4},/obj/item/reagent_containers/food/snacks/donut{pixel_x = 5; pixel_y = -1},/turf/open/floor/wood,/area/eventmap/inside)
-"aBQ" = (/obj/structure/table,/obj/item/watertank/janitor,/obj/item/mop/advanced,/obj/item/grenade/chem_grenade/cleaner,/obj/item/grenade/chem_grenade/cleaner,/obj/item/grenade/chem_grenade/cleaner,/obj/item/grenade/chem_grenade/cleaner,/obj/item/grenade/chem_grenade/cleaner,/obj/item/grenade/chem_grenade/cleaner,/obj/item/grenade/chem_grenade/cleaner,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aBR" = (/obj/structure/cable/pink{icon_state = "2-5"},/obj/structure/cable/pink{icon_state = "2-9"},/turf/open/floor/plating,/area/eventmap/mountain)
-"aBS" = (/obj/vehicle/ridden/janicart/upgraded,/obj/item/key/janitor,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aBT" = (/obj/structure/bed,/obj/item/bedsheet/pirate,/turf/open/floor/carpet,/area/eventmap/inside)
-"aBU" = (/obj/machinery/door/airlock/wood/dorms/dorm07,/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aBV" = (/obj/structure/janitorialcart,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aBW" = (/obj/item/lighter/greyscale,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aBX" = (/obj/structure/chair/comfy/black{dir = 4},/turf/open/floor/wood,/area/eventmap/inside)
-"aBY" = (/obj/structure/falsewall/wood,/turf/open/floor/wood,/area/eventmap/inside)
-"aBZ" = (/obj/structure/closet/secure_closet/freezer/meat,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aCa" = (/obj/structure/noticeboard{pixel_y = 32},/obj/structure/table/wood,/turf/open/floor/wood,/area/eventmap/inside)
-"aCb" = (/obj/machinery/camera/emp_proof,/obj/machinery/light{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"aCc" = (/obj/item/flashlight/lantern,/obj/structure/curtain{color = "#B22222"; pixel_x = -32},/turf/open/floor/wood,/area/eventmap/inside)
-"aCd" = (/obj/structure/closet/secure_closet/security,/obj/item/clothing/head/beret/sec/navyofficer,/obj/item/clothing/under/rank/security/officer/formal,/turf/open/floor/wood,/area/eventmap/inside)
-"aCe" = (/obj/machinery/shower{desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well..."; pixel_y = 24},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aCf" = (/obj/structure/plasticflaps/opaque,/obj/effect/turf_decal/bot,/turf/open/floor/plating,/area/eventmap/inside)
-"aCg" = (/obj/item/flashlight/flare/torch,/obj/item/flashlight/flare/torch,/obj/item/umbrella,/obj/item/pickaxe/mini,/obj/item/shovel,/obj/item/hatchet,/obj/item/storage/box/matches,/obj/item/storage/fancy/candle_box,/turf/open/floor/wood,/area/eventmap/inside)
-"aCh" = (/obj/structure/toilet,/turf/open/floor/plasteel/showroomfloor,/area/eventmap/mountaininside)
-"aCi" = (/obj/effect/turf_decal/delivery,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aCj" = (/obj/structure/closet/secure_closet/freezer/meat,/obj/item/reagent_containers/food/snacks/carpmeat,/obj/item/reagent_containers/food/snacks/carpmeat,/obj/item/reagent_containers/food/snacks/meat/slab/gorilla,/obj/item/reagent_containers/food/snacks/meat/slab/gorilla,/obj/item/reagent_containers/food/snacks/meat/slab/gondola,/obj/item/reagent_containers/food/snacks/meat/slab/gondola,/obj/item/reagent_containers/food/snacks/meat/slab/spider,/obj/item/reagent_containers/food/snacks/meat/slab/spider,/obj/item/reagent_containers/food/snacks/meat/slab/xeno,/obj/item/reagent_containers/food/snacks/meat/slab/xeno,/obj/item/reagent_containers/food/snacks/meat/slab/corgi,/obj/item/reagent_containers/food/snacks/meat/slab/corgi,/obj/item/reagent_containers/food/snacks/meat/slab/bear,/obj/item/reagent_containers/food/snacks/meat/slab/bear,/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/lizard,/obj/item/reagent_containers/food/snacks/meat/slab/monkey,/obj/item/reagent_containers/food/snacks/meat/slab/monkey,/obj/item/reagent_containers/food/snacks/meat/slab/pug,/obj/machinery/light/small{dir = 1},/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"aCk" = (/obj/item/storage/fancy/egg_box,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"aCl" = (/obj/item/scythe,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aCm" = (/obj/structure/chair/comfy/beige,/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aCn" = (/obj/structure/sink/kitchen{pixel_y = 28},/obj/machinery/light/small{dir = 4},/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"aCo" = (/obj/machinery/smartfridge/drinks,/turf/closed/wall/mineral/wood,/area/eventmap/inside)
-"aCp" = (/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/cable/yellow{icon_state = "2-8"},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"aCq" = (/obj/machinery/light{dir = 4},/obj/structure/closet/crate,/obj/item/clothing/neck/devilwings,/obj/item/clothing/gloves/bracer,/obj/item/clothing/accessory/skullcodpiece,/turf/open/floor/wood,/area/eventmap/inside)
-"aCr" = (/obj/structure/closet/secure_closet/bar,/obj/machinery/light/small{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"aCs" = (/turf/open/floor/spooktime/beach/coasts/coastSE,/area/eventmap/outside)
-"aCt" = (/obj/effect/turf_decal/tile/green{dir = 4},/turf/open/floor/plasteel/dark,/area/eventmap/mountain)
-"aCu" = (/obj/structure/closet/crate,/obj/item/clothing/mask/horsehead,/obj/item/clothing/mask/horsehead,/obj/item/clothing/mask/bandana/red,/obj/item/clothing/mask/rat/bat,/obj/item/clothing/mask/rat/bear,/obj/item/clothing/mask/rat/bee,/obj/item/clothing/mask/rat/fox,/obj/item/clothing/mask/rat/jackal,/obj/item/clothing/mask/rat/raven,/obj/item/clothing/mask/rat/tribal,/obj/item/clothing/mask/frog,/obj/item/clothing/mask/scarecrow,/obj/item/clothing/mask/gondola,/obj/item/clothing/head/rice_hat,/obj/item/clothing/head/pharaoh,/obj/item/clothing/head/hunter,/turf/open/floor/wood,/area/eventmap/inside)
-"aCv" = (/turf/open/floor/wood/damturf/broken3,/area/eventmap/inside)
-"aCw" = (/obj/structure/reagent_dispensers/beerkeg,/turf/open/floor/wood,/area/eventmap/inside)
-"aCx" = (/obj/structure/toilet{dir = 4},/turf/open/floor/plasteel/showroomfloor,/area/eventmap/mountaininside)
-"aCy" = (/obj/structure/table,/obj/item/storage/box/drinkingglasses,/obj/item/storage/box/drinkingglasses,/obj/item/storage/box/beakers,/obj/item/storage/box/donkpockets,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aCz" = (/obj/structure/reagent_dispensers/keg/mead,/turf/open/floor/wood,/area/eventmap/inside)
-"aCA" = (/obj/structure/table/wood,/obj/item/reagent_containers/food/drinks/bottle/wine,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aCB" = (/obj/structure/reagent_dispensers/keg/milk,/turf/open/floor/wood,/area/eventmap/inside)
-"aCC" = (/obj/structure/table,/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"aCD" = (/obj/machinery/computer/scan_consolenew{icon_state = "computer"; dir = 1},/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"aCE" = (/turf/open/floor/wood/damturf/broken2,/area/eventmap/mountaininside)
-"aCF" = (/obj/machinery/light{dir = 1},/obj/machinery/vending/kink,/turf/open/floor/wood/damturf/broken5,/area/eventmap/mountaininside)
-"aCG" = (/obj/structure/closet/toolcloset,/obj/item/storage/belt/durathread,/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aCH" = (/obj/structure/window/reinforced/spawner/west,/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"aCI" = (/turf/open/indestructible/cobble,/area/eventmap/outside)
-"aCJ" = (/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/carpet/red,/area/eventmap/inside)
-"aCK" = (/obj/structure/bed,/obj/effect/landmark/start/head_of_security,/obj/item/bedsheet/hos,/obj/structure/sign/poster/contraband/bountyhunters{pixel_x = 32},/turf/open/floor/carpet/red,/area/eventmap/inside)
-"aCL" = (/obj/structure/sink{dir = 8; pixel_x = -12},/obj/structure/mirror{pixel_x = -28},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aCM" = (/obj/structure/barricade/security,/turf/open/indestructible/airblock,/area/eventmap/mountaininside)
-"aCN" = (/obj/item/storage/fancy/cigarettes/cigpack_cannabis,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aCO" = (/obj/structure/healingfountain,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aCP" = (/obj/structure/table,/obj/structure/bedsheetbin/towel,/obj/machinery/light/small{dir = 8},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aCQ" = (/obj/item/aiModule/reset/purge,/obj/machinery/light/floor,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aCR" = (/obj/effect/landmark/start/head_of_security,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aCS" = (/obj/machinery/shower{dir = 8},/obj/item/soap,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aCT" = (/obj/structure/chair{dir = 4},/turf/open/floor/wood,/area/eventmap/inside)
-"aCU" = (/obj/structure/flora/ausbushes/leafybush,/obj/structure/flora/tree/spookytime,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aCV" = (/obj/structure/fluff/bus/dense{icon_state = "hoodbottom"},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"aCW" = (/obj/structure/fluff/bus/dense{icon_state = "frontwallbottomrear"},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"aCX" = (/obj/structure/fluff/bus/dense{icon_state = "frontwallbottom"},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"aCY" = (/obj/structure/fluff/bus/dense{icon_state = "reartire"},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"aCZ" = (/obj/structure/fluff/bus/passable{icon_state = "bottomdoor"; layer = 3},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"aDa" = (/obj/structure/fluff/bus/dense{icon_state = "fronttire"},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"aDb" = (/obj/effect/landmark/start/detective,/turf/open/floor/wood,/area/eventmap/inside)
-"aDc" = (/obj/structure/table/wood/bar,/obj/machinery/recharger,/turf/open/floor/wood,/area/eventmap/inside)
-"aDd" = (/obj/structure/chair/office/dark{dir = 8},/obj/effect/landmark/start/depsec/supply,/turf/open/floor/wood,/area/eventmap/inside)
-"aDe" = (/obj/machinery/door/airlock/security/glass{name = "Security Office"; req_access_txt = "63"},/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aDf" = (/obj/machinery/light/small{dir = 8},/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/cable/yellow{icon_state = "1-4"},/obj/structure/cable/yellow{icon_state = "2-4"},/turf/open/floor/carpet,/area/eventmap/inside)
-"aDg" = (/obj/machinery/recharge_station,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aDh" = (/obj/item/pizzabox/margherita,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aDi" = (/obj/machinery/door/airlock/maintenance{name = "Kitchen Maintenance"; req_access_txt = "28"},/turf/open/floor/plating,/area/eventmap/inside)
-"aDj" = (/obj/item/storage/fancy/cigarettes/dromedaryco,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aDk" = (/turf/open/floor/spooktime/beach,/area/eventmap/mountain)
-"aDl" = (/obj/item/reagent_containers/food/snacks/meat/slab/spider,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"aDm" = (/obj/structure/cable/white{icon_state = "1-2"},/obj/structure/filingcabinet/filingcabinet,/obj/machinery/light/small{dir = 4},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aDn" = (/obj/item/reagent_containers/food/snacks/meat/slab/pug,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"aDo" = (/obj/effect/landmark/start/cook,/obj/structure/cable/yellow{icon_state = "1-4"},/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"aDp" = (/obj/structure/trap/ctf/nomech,/turf/open/floor/spooktime/cobble/cornerSW,/area/eventmap/outside)
-"aDq" = (/obj/item/storage/fancy/egg_box,/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"aDr" = (/obj/machinery/door/airlock/freezer,/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"aDs" = (/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood/damturf/broken1,/area/eventmap/inside)
-"aDt" = (/obj/machinery/light/small{dir = 4},/obj/effect/landmark/start/captain,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aDu" = (/obj/structure/fluff/bus/passable/seat,/obj/structure/window/reinforced{dir = 8},/obj/structure/chair/comfy/shuttle{dir = 4; icon_state = ""},/obj/effect/landmark/start,/obj/machinery/light/floor{alpha = 0; light_range = 20; max_integrity = 9999; mouse_opacity = 0},/turf/open/floor/plasteel/dark{icon_state = "bus"},/area/shuttle/arrival)
-"aDv" = (/obj/structure/fluff/bus/passable/seat,/obj/structure/chair/comfy/shuttle{dir = 4; icon_state = ""},/obj/effect/landmark/start,/obj/machinery/light/floor{alpha = 0; light_range = 20; max_integrity = 9999; mouse_opacity = 0},/turf/open/floor/plasteel/dark{icon_state = "bus"},/area/shuttle/arrival)
-"aDw" = (/obj/machinery/door/airlock{name = "Bar Backroom"; req_access_txt = "25"},/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aDx" = (/obj/structure/fluff/bus/passable/seat{pixel_y = 15},/obj/structure/chair/comfy/shuttle{dir = 4; icon_state = ""},/obj/effect/landmark/start,/obj/machinery/light/floor{alpha = 0; light_range = 20; max_integrity = 9999; mouse_opacity = 0},/turf/open/floor/plasteel/dark{icon_state = "bus"},/area/shuttle/arrival)
-"aDy" = (/obj/structure/mineral_door/wood,/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{id = "C03"},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aDz" = (/obj/structure/sink/puddle,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aDA" = (/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood/damturf/broken3,/area/eventmap/inside)
-"aDB" = (/obj/item/reagent_containers/food/drinks/bottle/tequila,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aDC" = (/obj/item/reagent_containers/food/snacks/spiderlollipop,/obj/effect/decal/cleanable/cobweb,/turf/open/floor/plasteel/damturf/scorched2,/area/eventmap/mountaininside)
-"aDD" = (/obj/item/storage/pill_bottle/stimulant,/turf/open/floor/plasteel/damturf/platdmg1,/area/eventmap/mountaininside)
-"aDE" = (/obj/item/reagent_containers/pill/breast_enlargement,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aDF" = (/obj/machinery/door/airlock{name = "Bar Storage"; req_access_txt = "25"},/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aDG" = (/obj/structure/closet/cabinet,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aDH" = (/obj/structure/spacevine,/obj/structure/spacevine,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aDI" = (/turf/closed/wall/r_wall,/area/eventmap/inside)
-"aDJ" = (/obj/structure/chair/e_chair,/obj/effect/decal/cleanable/ash/large,/obj/effect/decal/cleanable/generic,/obj/effect/decal/cleanable/glass{dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"aDK" = (/obj/effect/landmark/start/head_of_security,/turf/open/floor/wood,/area/eventmap/inside)
-"aDL" = (/obj/item/stamp/hos,/obj/structure/table/wood/fancy,/turf/open/floor/wood,/area/eventmap/inside)
-"aDM" = (/obj/effect/spawner/structure/window/reinforced/tinted,/obj/structure/cable/white,/turf/open/floor/wood,/area/eventmap/inside)
-"aDN" = (/obj/machinery/vending/donksofttoyvendor,/turf/open/floor/spooktime/cobble/cornerNE,/area/eventmap/outside)
-"aDO" = (/obj/machinery/light/small{dir = 8},/obj/structure/cable/white,/obj/effect/landmark/start/head_of_personnel,/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"aDP" = (/obj/structure/table,/obj/structure/window/reinforced/tinted,/obj/item/reagent_containers/rag/towel,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aDQ" = (/obj/machinery/shower{dir = 8},/obj/structure/window/reinforced/tinted,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aDR" = (/obj/structure/chair/wood,/obj/effect/landmark/start/security_officer,/turf/open/floor/wood,/area/eventmap/inside)
-"aDS" = (/obj/structure/table/wood,/obj/machinery/light/small{dir = 4},/obj/machinery/recharger,/turf/open/floor/wood,/area/eventmap/inside)
-"aDT" = (/obj/machinery/door/airlock/maintenance,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aDU" = (/obj/machinery/door/airlock/wood/dorms/dorm16,/turf/open/floor/wood,/area/eventmap/inside)
-"aDV" = (/obj/machinery/icecream_vat,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"aDW" = (/obj/structure/closet/secure_closet/freezer/meat,/obj/item/reagent_containers/food/snacks/carpmeat,/obj/item/reagent_containers/food/snacks/carpmeat,/obj/item/reagent_containers/food/snacks/meat/slab/gorilla,/obj/item/reagent_containers/food/snacks/meat/slab/gorilla,/obj/item/reagent_containers/food/snacks/meat/slab/gondola,/obj/item/reagent_containers/food/snacks/meat/slab/gondola,/obj/item/reagent_containers/food/snacks/meat/slab/spider,/obj/item/reagent_containers/food/snacks/meat/slab/spider,/obj/item/reagent_containers/food/snacks/meat/slab/xeno,/obj/item/reagent_containers/food/snacks/meat/slab/xeno,/obj/item/reagent_containers/food/snacks/meat/slab/corgi,/obj/item/reagent_containers/food/snacks/meat/slab/corgi,/obj/item/reagent_containers/food/snacks/meat/slab/bear,/obj/item/reagent_containers/food/snacks/meat/slab/bear,/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/lizard,/obj/item/reagent_containers/food/snacks/meat/slab/monkey,/obj/item/reagent_containers/food/snacks/meat/slab/monkey,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"aDX" = (/obj/machinery/food_cart,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"aDY" = (/obj/machinery/door/airlock/wood/dorms/dorm19,/turf/open/floor/wood,/area/eventmap/inside)
-"aDZ" = (/obj/item/coin/diamond,/obj/item/stack/sheet/mineral/silver,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aEa" = (/obj/machinery/vending/wardrobe/chef_wardrobe,/obj/machinery/camera/emp_proof{c_tag = "Containment - Fore Starboard"; dir = 8; network = list("singularity")},/obj/structure/cable/yellow,/turf/open/floor/plasteel/cafeteria,/area/eventmap/inside)
-"aEb" = (/obj/item/lighter,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aEc" = (/obj/structure/cable/yellow,/turf/open/floor/wood,/area/eventmap/inside)
-"aEd" = (/obj/structure/reagent_dispensers/keg/gargle,/turf/open/floor/wood,/area/eventmap/inside)
-"aEe" = (/obj/machinery/light/small{dir = 1},/turf/open/floor/mineral/titanium/white{name = "padded floor"},/area/eventmap/inside)
-"aEf" = (/turf/open/floor/mineral/titanium/white{name = "padded floor"},/area/eventmap/inside)
-"aEg" = (/obj/effect/landmark/start/janitor,/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"aEh" = (/obj/machinery/light/small{dir = 1},/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/mineral/titanium/white{name = "padded floor"},/area/eventmap/inside)
-"aEi" = (/obj/item/bodypart/head,/obj/item/clothing/head/collectable/kitty,/obj/item/clothing/mask/scarecrow,/obj/effect/decal/cleanable/blood/splatter{icon_state = "gibbearcore"},/obj/item/stamp/ce,/turf/open/floor/mineral/titanium/white{name = "padded floor"},/area/eventmap/inside)
-"aEj" = (/obj/structure/closet/secure_closet/personal/cabinet,/turf/open/floor/wood,/area/eventmap/inside)
-"aEk" = (/obj/structure/sign/plaques/deempisi{pixel_y = 32},/obj/machinery/light/small{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"aEl" = (/obj/structure/bed,/obj/item/bedsheet/random,/obj/machinery/button/door/dorms/patient1,/turf/open/floor/wood,/area/eventmap/inside)
-"aEm" = (/obj/effect/decal/cleanable/shreds,/turf/open/floor/wood,/area/eventmap/inside)
-"aEn" = (/obj/structure/closet/secure_closet/hos,/obj/item/clothing/under/rank/security/head_of_security/formal,/turf/open/floor/wood,/area/eventmap/inside)
-"aEo" = (/obj/effect/decal/cleanable/cobweb/cobweb2,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aEp" = (/obj/structure/sign/poster/official/space_cops{pixel_y = -32},/turf/open/floor/wood/damturf/broken1,/area/eventmap/inside)
-"aEq" = (/obj/structure/curtain{color = "#B22222"},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aEr" = (/obj/machinery/button/door/dorms/luxury3{id = "C03"; pixel_y = -24},/turf/open/floor/wood/damturf/broken1,/area/eventmap/mountaininside)
-"aEs" = (/obj/machinery/light,/turf/open/floor/wood,/area/eventmap/inside)
-"aEt" = (/obj/structure/cable/yellow{icon_state = "0-4"},/turf/open/floor/wood,/area/eventmap/inside)
-"aEu" = (/obj/structure/table/wood/bar,/obj/machinery/computer/security/wooden_tv{pixel_y = 8},/obj/structure/window/reinforced/spawner,/turf/open/floor/wood,/area/eventmap/inside)
-"aEv" = (/obj/structure/table/wood/bar,/obj/machinery/computer/secure_data/laptop{dir = 1; icon_state = "laptop"; pixel_y = 6},/obj/structure/window/reinforced/spawner,/turf/open/floor/wood,/area/eventmap/inside)
-"aEw" = (/obj/structure/cable/pink{icon_state = "0-5"},/obj/structure/cable/pink{icon_state = "0-9"},/turf/open/floor/plating,/area/eventmap/mountain)
-"aEx" = (/obj/structure/toilet{dir = 4},/obj/machinery/light/small{dir = 1},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aEy" = (/obj/structure/cable/yellow{icon_state = "2-4"},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aEz" = (/obj/effect/decal/cleanable/cobweb/cobweb2,/turf/open/floor/spooktime/beach,/area/eventmap/outside)
-"aEA" = (/obj/effect/decal/cleanable/cobweb/cobweb2,/obj/structure/table/wood,/obj/structure/bedsheetbin/towel,/obj/structure/cable/yellow{icon_state = "0-8"},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aEB" = (/obj/structure/sign/poster/official/ian{pixel_y = 32},/turf/open/floor/wood,/area/eventmap/inside)
-"aEC" = (/obj/machinery/button/door/dorms/luxury3{id = "C09"; pixel_x = -8},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aED" = (/turf/closed/wall/mineral/wood,/area/eventmap/mountaininside)
-"aEE" = (/obj/structure/closet/secure_closet/freezer/meat,/obj/structure/window/reinforced/spawner/north,/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"aEF" = (/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aEG" = (/turf/open/floor/carpet/royalblack,/area/eventmap/mountain)
-"aEH" = (/obj/structure/closet/secure_closet/freezer/kitchen{req_access = null},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aEI" = (/obj/structure/window/reinforced/spawner/north,/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"aEJ" = (/obj/item/flashlight/glowstick/cyan,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aEK" = (/obj/structure/noticeboard/hop{pixel_x = 32},/turf/open/floor/wood,/area/eventmap/inside)
-"aEL" = (/obj/item/flashlight/glowstick/orange,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aEM" = (/obj/structure/kitchenspike,/obj/structure/window/reinforced/spawner/north,/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"aEN" = (/obj/item/reagent_containers/food/drinks/bottle/whiskey,/turf/open/floor/wood{icon_state = "wood-broken5"},/area/eventmap/inside)
-"aEO" = (/obj/machinery/light/floor,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aEP" = (/obj/structure/table/reinforced,/obj/machinery/door/firedoor,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aEQ" = (/obj/machinery/door/airlock{name = "Bar Backroom"; req_access_txt = "25"},/turf/open/floor/wood,/area/eventmap/inside)
-"aER" = (/obj/structure/chair/sofa/right,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aES" = (/obj/structure/table/optable,/obj/item/reagent_containers/glass/bowl,/obj/item/toy/fluff/tennis_poly/red,/obj/item/clothing/neck/petcollar,/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"aET" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/mineral/titanium/white{name = "padded floor"},/area/eventmap/inside)
-"aEU" = (/obj/structure/blob/normal{color = "#777777"; name = "peculiar goo"},/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aEV" = (/obj/structure/table/plasmaglass,/obj/item/stock_parts/cell/hyper,/obj/item/stock_parts/cell/hyper,/obj/item/stock_parts/cell/hyper,/obj/item/stock_parts/cell/hyper,/obj/item/stock_parts/cell/hyper,/obj/item/stock_parts/cell/hyper,/obj/machinery/light/floor{alpha = 0; light_range = 20; mouse_opacity = 0},/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aEW" = (/obj/effect/decal/cleanable/blood/splatter{icon_state = "floor4-old"},/turf/open/floor/mineral/titanium/white{name = "padded floor"},/area/eventmap/inside)
-"aEX" = (/obj/machinery/light{dir = 1},/turf/open/floor/plasteel/damturf/scorched1,/area/eventmap/mountaininside)
-"aEY" = (/obj/item/organ/heart,/obj/effect/decal/cleanable/blood/gibs/old,/turf/open/floor/mineral/titanium/white{name = "padded floor"},/area/eventmap/inside)
-"aEZ" = (/obj/item/storage/pill_bottle/breast_enlargement,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aFa" = (/obj/item/flashlight/glowstick/cyan,/turf/open/floor/wood,/area/eventmap/inside)
-"aFb" = (/obj/effect/decal/cleanable/cobweb/cobweb2,/obj/structure/spacevine,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aFc" = (/obj/structure/flora/tree/spookytimexl,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aFd" = (/turf/closed/wall/r_wall/rust,/area/cargo/miningstorage)
-"aFe" = (/obj/machinery/door/airlock/wood/dorms/patient1,/turf/open/floor/wood,/area/eventmap/inside)
-"aFf" = (/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood/damturf/broken3,/area/eventmap/inside)
-"aFg" = (/obj/machinery/door/airlock/security/glass{name = "Security Office"; req_access_txt = "63"},/obj/machinery/door/firedoor,/turf/open/floor/wood,/area/eventmap/inside)
-"aFh" = (/obj/structure/mineral_door/wood,/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{id = "C04"},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aFi" = (/turf/open/floor/spooktime/beach/coasts/innerW,/area/eventmap/outside)
-"aFj" = (/obj/machinery/door/airlock/security/glass{name = "Security Desk"; req_access_txt = "63"},/obj/structure/cable/yellow{icon_state = "1-2"},/obj/machinery/door/firedoor,/turf/open/floor/wood,/area/eventmap/inside)
-"aFk" = (/obj/structure/mirror{icon_state = "mirror_broke"; pixel_x = 28},/obj/structure/sink{dir = 4; pixel_x = 11},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aFl" = (/obj/structure/closet/secure_closet/freezer/cream_pie,/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"aFm" = (/obj/effect/decal/cleanable/dirt,/turf/open/floor/plating,/area/eventmap/mountaininside)
-"aFn" = (/obj/item/reagent_containers/food/snacks/sausage,/obj/structure/table/reinforced,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aFo" = (/obj/structure/kitchenspike,/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"aFp" = (/obj/structure/closet/chefcloset,/turf/open/floor/wood,/area/eventmap/inside)
-"aFq" = (/obj/item/autosurgeon/penis,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aFr" = (/obj/machinery/rnd/production/circuit_imprinter,/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aFs" = (/obj/item/storage/fancy/cigarettes,/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aFt" = (/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/carpet,/area/eventmap/inside)
-"aFu" = (/obj/machinery/vending/dinnerware,/turf/open/floor/wood,/area/eventmap/inside)
-"aFv" = (/obj/machinery/chem_dispenser/drinks/beer/fullupgrade{dir = 4},/obj/structure/table/wood/bar,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aFw" = (/turf/closed/wall/rust,/area/eventmap/mountaininside)
-"aFx" = (/obj/machinery/camera/emp_proof,/obj/machinery/light/small{dir = 1},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aFy" = (/obj/machinery/light/small{brightness = 3; dir = 8},/obj/structure/fireplace{dir = 4; pixel_x = -8},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aFz" = (/obj/machinery/door/airlock{name = "Bar Staff Entrance"; req_access_txt = "25"},/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aFA" = (/obj/item/restraints/handcuffs,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aFB" = (/obj/machinery/door/airlock/wood/glass,/turf/open/floor/wood,/area/eventmap/inside)
-"aFC" = (/obj/structure/closet/secure_closet/hop,/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"aFD" = (/obj/machinery/door/airlock/wood/glass,/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/wood,/area/eventmap/inside)
-"aFE" = (/turf/open/floor/spooktime/beach/coasts/coastN,/area/eventmap/outside)
-"aFF" = (/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aFG" = (/obj/machinery/door/airlock/wood/glass,/obj/effect/decal/cleanable/blood/old,/obj/effect/decal/cleanable/dirt,/turf/open/floor/wood,/area/eventmap/inside)
-"aFH" = (/obj/structure/curtain{color = "#B22222"},/obj/effect/spawner/structure/window/reinforced,/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{id = "C01"},/turf/open/floor/wood,/area/eventmap/inside)
-"aFI" = (/obj/structure/closet/secure_closet/warden,/obj/item/gun/ballistic/shotgun/automatic/combat/compact,/obj/item/gun/energy/pumpaction/defender,/obj/item/clothing/under/rank/security/warden/formal,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aFJ" = (/obj/effect/decal/cleanable/cobweb/cobweb2,/obj/item/storage/fancy/cigarettes/cigpack_cannabis,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aFK" = (/obj/item/reagent_containers/food/snacks/pastatomato,/obj/structure/table/reinforced,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aFL" = (/obj/effect/decal/cleanable/cobweb,/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/machinery/light/small/broken{dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"aFM" = (/obj/item/reagent_containers/food/snacks/toastedsandwich,/obj/structure/table/reinforced,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aFN" = (/obj/structure/chair/wood/normal,/turf/open/floor/wood,/area/eventmap/inside)
-"aFO" = (/obj/effect/decal/cleanable/ash/large,/obj/effect/decal/cleanable/generic,/obj/effect/decal/cleanable/glass{dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"aFP" = (/obj/machinery/light{dir = 1},/obj/machinery/button/door/dorms/luxury3{id = "C04"},/turf/open/floor/wood/damturf/broken5,/area/eventmap/mountaininside)
-"aFQ" = (/obj/machinery/computer/nanite_chamber_control{dir = 1},/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aFR" = (/obj/structure/sink/kitchen{pixel_y = 30},/turf/open/floor/sepia,/area/eventmap/mountaininside)
-"aFS" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/effect/decal/cleanable/ash/crematorium,/turf/open/floor/wood,/area/eventmap/inside)
-"aFT" = (/obj/machinery/light/small{dir = 4},/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aFU" = (/obj/machinery/light/small{dir = 1},/turf/open/floor/plasteel/showroomfloor,/area/eventmap/mountaininside)
-"aFV" = (/obj/item/reagent_containers/food/drinks/bottle/whiskey,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aFW" = (/obj/machinery/computer/rdconsole/robotics,/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aFX" = (/obj/effect/decal/cleanable/blood/splatter{icon_state = "splatter1"},/turf/open/floor/wood,/area/eventmap/inside)
-"aFY" = (/obj/item/storage/pill_bottle/breast_enlargement,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aFZ" = (/obj/structure/mirror{pixel_x = 28},/obj/structure/sink{dir = 4; pixel_x = 11},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aGa" = (/obj/structure/reagent_dispensers/cooking_oil,/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"aGb" = (/obj/structure/sign/poster/official/love_ian{pixel_y = -32},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"aGc" = (/obj/structure/bed,/obj/machinery/button/door/dorms/dorm16,/obj/item/bedsheet/hop,/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"aGd" = (/obj/item/reagent_containers/food/drinks/bottle/lizardwine,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aGe" = (/obj/structure/closet/cabinet,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aGf" = (/obj/machinery/button/door/dorms/dorm19,/turf/open/floor/carpet,/area/eventmap/inside)
-"aGg" = (/obj/structure/flora/rock/pile/icy,/obj/structure/flora/tree/spookytime,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aGh" = (/turf/closed/indestructible/riveted/boss,/area/eventmap/mountaininside)
-"aGi" = (/obj/item/storage/box/matches,/obj/item/shovel,/obj/item/flashlight/flare/torch,/obj/item/hatchet,/obj/item/pickaxe/mini,/obj/structure/rack,/obj/item/umbrella,/turf/open/floor/wood,/area/eventmap/inside)
-"aGj" = (/obj/item/storage/box/matches,/obj/machinery/light/small{dir = 8},/obj/item/shovel,/obj/item/flashlight/flare/torch,/obj/item/hatchet,/obj/item/pickaxe/mini,/obj/structure/rack,/obj/item/umbrella,/turf/open/floor/wood,/area/eventmap/inside)
-"aGk" = (/obj/machinery/door/airlock/survival_pod,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aGl" = (/obj/structure/closet/crate/freezer/blood,/obj/machinery/light/small,/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"aGm" = (/obj/machinery/gibber/autogibber,/turf/open/floor/plasteel/freezer,/area/eventmap/inside)
-"aGn" = (/obj/structure/closet/gimmick/tacticool,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aGo" = (/obj/structure/mineral_door/wood,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aGp" = (/obj/machinery/vending/wardrobe/bar_wardrobe,/turf/open/floor/wood,/area/eventmap/inside)
-"aGq" = (/obj/structure/bed,/obj/item/bedsheet/pirate,/turf/open/floor/wood/damturf/broken6,/area/eventmap/mountaininside)
-"aGr" = (/obj/structure/flora/rock/pile/icy,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aGs" = (/obj/machinery/chem_dispenser/drinks/fullupgrade{dir = 4},/obj/machinery/light/small{dir = 8},/obj/structure/table/wood/bar,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aGt" = (/obj/effect/landmark/start/bartender,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aGu" = (/obj/machinery/computer/mech_bay_power_console,/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aGv" = (/obj/structure/table,/obj/item/storage/toolbox/mechanical,/obj/item/stack/cable_coil,/obj/item/storage/box/lights/mixed,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aGw" = (/obj/structure/noticeboard{pixel_y = 32},/turf/open/floor/wood,/area/eventmap/inside)
-"aGx" = (/obj/structure/table,/obj/item/reagent_containers/food/drinks/bottle/whiskey,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aGy" = (/obj/item/stack/sheet/mineral/diamond,/obj/item/stack/sheet/mineral/plasma,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aGz" = (/turf/open/floor/plasteel/damturf/scorched2,/area/eventmap/mountaininside)
-"aGA" = (/obj/structure/noticeboard{pixel_y = 32},/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"aGB" = (/obj/structure/bed,/obj/item/bedsheet/hop,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aGC" = (/obj/item/aiModule/supplied/freeform,/obj/machinery/light/floor,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aGD" = (/obj/structure/flora/tree/spookytime,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"aGE" = (/obj/structure/destructible/cult/tome,/turf/open/floor/wood,/area/eventmap/inside)
-"aGF" = (/obj/effect/decal/cleanable/blood/tracks,/obj/effect/decal/cleanable/dirt,/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"aGG" = (/turf/closed/wall/rust,/area/cargo/miningstorage)
-"aGH" = (/obj/structure/bed,/obj/item/bedsheet/random,/obj/machinery/button/door/dorms/patient2,/turf/open/floor/wood,/area/eventmap/inside)
-"aGI" = (/obj/machinery/light{dir = 8},/obj/structure/table/wood/fancy,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aGJ" = (/obj/item/chair,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aGK" = (/obj/effect/turf_decal/stripes/line{dir = 8},/obj/effect/turf_decal/caution{icon_state = "caution"; dir = 4},/obj/structure/cable/white{icon_state = "1-4"},/obj/structure/cable/white{icon_state = "2-4"},/turf/open/floor/wood,/area/eventmap/inside)
-"aGL" = (/obj/item/chair/wood,/turf/open/floor/plasteel/damturf/scorched,/area/eventmap/mountaininside)
-"aGM" = (/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/spooktime/cobble/sideS,/area/eventmap/outside)
-"aGN" = (/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/cable/white{icon_state = "2-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aGO" = (/obj/machinery/door/airlock/security{aiControlDisabled = 1; name = "Prisoner Transfer Centre"; req_access_txt = "2"},/obj/effect/decal/cleanable/vomit/old,/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/wood,/area/eventmap/inside)
-"aGP" = (/obj/machinery/door/airlock/survival_pod,/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{id = "C07"},/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aGQ" = (/obj/effect/decal/cleanable/ash/crematorium,/turf/open/floor/wood{icon_state = "wood-broken2"},/area/eventmap/inside)
-"aGR" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/effect/decal/cleanable/shreds,/turf/open/floor/wood,/area/eventmap/inside)
-"aGS" = (/obj/effect/decal/cleanable/generic,/turf/open/floor/wood{icon_state = "wood-broken7"},/area/eventmap/inside)
-"aGT" = (/obj/item/clothing/mask/frog,/turf/open/floor/spooktime/beach/coasts/coastS,/area/eventmap/outside)
-"aGU" = (/obj/structure/cable/yellow{icon_state = "1-4"},/obj/structure/cable/yellow{icon_state = "2-4"},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aGV" = (/obj/machinery/light,/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aGW" = (/obj/structure/cable/yellow{icon_state = "2-4"},/obj/structure/cable/yellow{icon_state = "2-8"},/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aGX" = (/obj/machinery/door/airlock{name = "Bathroom"},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aGY" = (/obj/structure/sign/barsign,/turf/closed/wall/mineral/wood,/area/eventmap/inside)
-"aGZ" = (/obj/structure/table/wood/bar,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aHa" = (/obj/item/reagent_containers/food/condiment/saltshaker,/obj/item/reagent_containers/food/condiment/peppermill,/obj/structure/table/wood/bar,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aHb" = (/obj/item/candle/infinite,/obj/structure/table/wood/bar,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aHc" = (/obj/item/storage/box/drinkingglasses,/obj/structure/table/wood/bar,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aHd" = (/obj/effect/decal/cleanable/dirt,/obj/structure/table/reinforced,/obj/item/flashlight,/turf/open/floor/plating,/area/eventmap/mountaininside)
-"aHe" = (/obj/effect/decal/cleanable/blood/old,/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"aHf" = (/obj/effect/spawner/structure/window/reinforced,/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{id = "C02"},/turf/open/floor/wood,/area/eventmap/inside)
-"aHg" = (/obj/item/pizzabox/vegetable,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aHh" = (/obj/effect/decal/cleanable/blood/tracks{dir = 4},/obj/effect/decal/cleanable/dirt,/turf/open/floor/wood,/area/eventmap/inside)
-"aHi" = (/obj/structure/sign/directions/security{dir = 8; icon_state = "direction_sec"; pixel_x = -32; pixel_y = 40},/obj/structure/sign/directions/supply{dir = 8; icon_state = "direction_supply"; pixel_x = -32; pixel_y = 32},/obj/structure/sign/directions/engineering{pixel_x = -32; pixel_y = 24},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"aHj" = (/obj/structure/chair/comfy/beige,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aHk" = (/turf/open/floor/spooktime/beach/coasts/watercoastE,/area/eventmap/outside)
-"aHl" = (/obj/machinery/door/airlock/wood/dorms/patient2,/turf/open/floor/wood,/area/eventmap/inside)
-"aHm" = (/obj/machinery/light/small{dir = 1},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"aHn" = (/obj/machinery/computer/nanite_cloud_controller,/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aHo" = (/obj/effect/spawner/structure/window/reinforced,/obj/structure/cable/white,/obj/structure/cable/white{icon_state = "0-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aHp" = (/obj/item/storage/box/snappops,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aHq" = (/obj/machinery/computer/prisoner/management,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aHr" = (/obj/effect/decal/cleanable/blood/old,/obj/structure/barricade/wooden/crude,/obj/structure/mineral_door/wood,/turf/open/floor/wood,/area/eventmap/inside)
-"aHs" = (/obj/structure/sign/directions/medical{dir = 4; pixel_x = 32; pixel_y = 32},/obj/structure/sign/directions/evac{dir = 4; pixel_x = 32; pixel_y = 40},/obj/structure/sign/directions/science{pixel_x = 32; pixel_y = 24},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"aHt" = (/obj/structure/cable/yellow{icon_state = "1-2"},/obj/machinery/door/firedoor,/turf/open/floor/wood,/area/eventmap/inside)
-"aHu" = (/obj/item/flashlight/lantern{anchored = 1; can_be_unanchored = 1; light_color = "#EE9933"; light_range = 5; on = 1},/turf/open/floor/wood/damturf/broken1,/area/eventmap/inside)
-"aHv" = (/obj/item/reagent_containers/food/drinks/bottle/bottleofnothing,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aHw" = (/obj/structure/barricade/wooden/crude,/obj/machinery/door/firedoor,/turf/open/floor/wood,/area/eventmap/inside)
-"aHx" = (/obj/machinery/door/airlock/security{name = "Armoury"; req_access_txt = "3"},/turf/open/floor/wood,/area/eventmap/inside)
-"aHy" = (/obj/machinery/door/airlock/security/glass{name = "Security Office"; req_access_txt = "63"},/obj/structure/cable/yellow{icon_state = "1-2"},/obj/machinery/door/firedoor,/turf/open/floor/wood,/area/eventmap/inside)
-"aHz" = (/obj/structure/chair/wood/wings{dir = 4},/obj/machinery/light/small{dir = 1},/turf/open/floor/wood/damturf/broken1,/area/eventmap/inside)
-"aHA" = (/obj/item/reagent_containers/food/condiment/saltshaker,/obj/item/reagent_containers/food/condiment/peppermill,/obj/structure/table/wood/fancy,/turf/open/floor/wood,/area/eventmap/inside)
-"aHB" = (/obj/structure/chair/wood/wings{dir = 8},/obj/machinery/light/small{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"aHC" = (/obj/structure/sign/poster/official/high_class_martini{pixel_y = 32},/turf/open/floor/wood,/area/eventmap/inside)
-"aHD" = (/obj/structure/flora/ausbushes/lavendergrass,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aHE" = (/obj/structure/table/reinforced,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aHF" = (/obj/item/reagent_containers/food/snacks/khachapuri,/obj/structure/table/reinforced,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aHG" = (/obj/structure/chair/stool/bar,/turf/open/floor/wood/damturf/broken7,/area/eventmap/inside)
-"aHH" = (/obj/structure/closet/crate,/obj/item/flashlight/flare/torch,/obj/item/flashlight/flare/torch,/obj/item/flashlight/flare/torch,/obj/item/flashlight/flare/torch,/obj/item/flashlight/flare/torch,/obj/item/flashlight/flare/torch,/obj/item/flashlight/flare/torch,/obj/item/flashlight/flare/torch,/obj/item/flashlight/flare/torch,/obj/item/flashlight/flare/torch,/obj/item/flashlight/flare/torch,/obj/item/flashlight/flare/torch,/obj/item/flashlight/flare/torch,/obj/item/flashlight/flare/torch,/obj/item/flashlight/flare/torch,/obj/item/flashlight/flare/torch,/obj/item/flashlight/flare/torch,/obj/item/flashlight/flare/torch,/obj/item/flashlight/flare/torch,/obj/item/flashlight/flare/torch,/turf/open/floor/wood,/area/eventmap/inside)
-"aHI" = (/turf/open/floor/spooktime/cobble/cornerNW,/area/eventmap/outside)
-"aHJ" = (/obj/machinery/light/small{dir = 4; light_color = "#d8b1b1"},/turf/open/floor/wood,/area/eventmap/inside)
-"aHK" = (/obj/structure/table/wood/fancy/orange,/obj/item/clothing/suit/straight_jacket{pixel_x = -8; pixel_y = 8},/obj/item/clothing/suit/straight_jacket,/turf/open/floor/wood,/area/eventmap/inside)
-"aHL" = (/obj/structure/table/wood/fancy/orange,/obj/item/clothing/accessory/lawyers_badge,/obj/item/restraints/handcuffs/fake,/obj/item/stamp/law,/turf/open/floor/wood,/area/eventmap/inside)
-"aHM" = (/obj/item/pet_carrier,/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"aHN" = (/obj/item/chair/wood,/turf/open/floor/wood,/area/eventmap/inside)
-"aHO" = (/obj/effect/decal/cleanable/dirt,/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"aHP" = (/obj/effect/decal/cleanable/dirt,/obj/machinery/light/small,/turf/open/floor/wood,/area/eventmap/inside)
-"aHQ" = (/obj/structure/table/wood/fancy/orange,/obj/effect/decal/cleanable/dirt,/obj/item/clothing/head/scarecrow_hat,/turf/open/floor/wood,/area/eventmap/inside)
-"aHR" = (/obj/structure/curtain{color = "#B22222"; pixel_x = -32},/obj/effect/landmark/start/librarian,/turf/open/floor/wood,/area/eventmap/inside)
-"aHS" = (/obj/structure/window/reinforced{dir = 4},/obj/structure/table/wood/bar,/obj/machinery/computer/security/wooden_tv{pixel_y = 8},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aHT" = (/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aHU" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/machinery/light/small{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"aHV" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aHW" = (/obj/structure/rack,/obj/item/gun/ballistic/shotgun/automatic/combat,/obj/item/gun/ballistic/shotgun/automatic/combat,/obj/item/gun/ballistic/shotgun/automatic/combat,/obj/item/gun/ballistic/shotgun/automatic/combat,/turf/open/floor/wood,/area/eventmap/inside)
-"aHX" = (/obj/machinery/light{dir = 1},/obj/item/storage/box/rubbershot,/turf/open/floor/wood,/area/eventmap/inside)
-"aHY" = (/obj/structure/cable/yellow{icon_state = "4-8"},/turf/closed/wall/mineral/wood,/area/eventmap/inside)
-"aHZ" = (/obj/structure/table/wood/bar,/obj/machinery/recharger,/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aIa" = (/obj/structure/trap/ctf/nomech,/turf/closed/mineral/ash_rock,/area/eventmap/mountain)
-"aIb" = (/obj/item/clothing/head/helmet/justice,/obj/structure/closet/secure_closet/warden,/obj/item/clothing/suit/armor/hos/trenchcoat,/turf/open/floor/wood,/area/eventmap/inside)
-"aIc" = (/obj/item/stack/sheet/metal/fifty,/turf/open/floor/spooktime/beach/coasts/coastS,/area/eventmap/outside)
-"aId" = (/obj/structure/closet/secure_closet/security,/obj/machinery/light{dir = 1},/obj/item/clothing/head/beret/sec/navyofficer,/obj/item/clothing/under/rank/security/officer/formal,/turf/open/floor/wood,/area/eventmap/inside)
-"aIe" = (/obj/machinery/recharge_station,/turf/open/floor/wood,/area/eventmap/inside)
-"aIf" = (/obj/effect/landmark/start/lawyer,/turf/open/floor/wood,/area/eventmap/inside)
-"aIg" = (/obj/machinery/light{dir = 1},/obj/structure/chair/wood/wings{dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"aIh" = (/turf/open/floor/wood/damturf/broken6,/area/eventmap/inside)
-"aIi" = (/obj/structure/cable/yellow{icon_state = "1-4"},/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"aIj" = (/obj/structure/mineral_door/wood,/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/wood,/area/eventmap/inside)
-"aIk" = (/obj/structure/chair/office/dark{dir = 4},/obj/effect/landmark/start/warden,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aIl" = (/obj/item/chair/wood,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aIm" = (/obj/structure/rack,/obj/item/gun/ballistic/shotgun/automatic/dual_tube,/obj/item/gun/ballistic/shotgun/automatic/dual_tube,/turf/open/floor/wood,/area/eventmap/inside)
-"aIn" = (/obj/structure/flora/grass/jungle/b{icon_state = "grassa5"},/turf/open/floor/spooktime/cobble/cornerSE,/area/eventmap/outside)
-"aIo" = (/obj/item/storage/box/rubbershot,/obj/item/storage/box/rubbershot,/obj/item/storage/box/rubbershot,/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aIp" = (/turf/open/floor/spooktime/beach/coasts/coastSW,/area/eventmap/outside)
-"aIq" = (/turf/open/floor/sepia,/area/eventmap/mountaininside)
-"aIr" = (/obj/item/storage/box/rubbershot,/turf/open/floor/wood,/area/eventmap/inside)
-"aIs" = (/obj/structure/cable/yellow{icon_state = "2-8"},/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/cable/yellow{icon_state = "2-4"},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"aIt" = (/obj/item/storage/box/techsslug,/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aIu" = (/obj/structure/toilet{dir = 8},/turf/open/floor/plasteel/showroomfloor,/area/eventmap/mountaininside)
-"aIv" = (/obj/structure/closet/cardboard,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aIw" = (/obj/structure/cable/yellow{icon_state = "2-4"},/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/cable/yellow{icon_state = "2-8"},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"aIx" = (/obj/structure/curtain{color = "#B22222"; pixel_y = 32},/turf/open/floor/wood{icon_state = "wood-broken3"},/area/eventmap/inside)
-"aIy" = (/obj/machinery/button/door{id = "armory"; name = "Armory Shutters"; pixel_x = 26; req_access_txt = "3"},/obj/item/storage/box/rubbershot,/turf/open/floor/wood,/area/eventmap/inside)
-"aIz" = (/obj/machinery/door/airlock/wood,/turf/open/floor/carpet,/area/eventmap/mountaininside)
-"aIA" = (/obj/effect/landmark/start/security_officer,/turf/open/floor/wood,/area/eventmap/inside)
-"aIB" = (/obj/effect/landmark/start/security_officer,/turf/open/floor/carpet,/area/eventmap/inside)
-"aIC" = (/obj/effect/landmark/start/security_officer,/obj/structure/cable/white{icon_state = "2-4"},/turf/open/floor/carpet,/area/eventmap/inside)
-"aID" = (/obj/machinery/vending/coffee,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aIE" = (/obj/effect/turf_decal/loading_area,/obj/machinery/light/small{dir = 8},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aIF" = (/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/carpet,/area/eventmap/inside)
-"aIG" = (/obj/structure/cable/yellow{icon_state = "1-4"},/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aIH" = (/obj/item/storage/fancy/donut_box,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aII" = (/obj/vehicle/ridden/secway,/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aIJ" = (/obj/item/reagent_containers/food/snacks/pancakes,/obj/structure/table/reinforced,/turf/open/floor/plasteel/damturf/damage4,/area/eventmap/mountaininside)
-"aIK" = (/obj/structure/cable/yellow{icon_state = "1-8"},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"aIL" = (/obj/structure/falsewall/wood,/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aIM" = (/obj/structure/chair/wood/wings{dir = 4},/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aIN" = (/obj/structure/table/wood/fancy,/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aIO" = (/obj/machinery/computer/rdconsole{dir = 1},/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aIP" = (/obj/machinery/vending/kink,/turf/open/floor/plasteel/damturf/scorched2,/area/eventmap/mountaininside)
-"aIQ" = (/obj/structure/closet/secure_closet/freezer/fridge,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aIR" = (/obj/structure/chair/wood/wings{dir = 8},/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aIS" = (/obj/item/candle/infinite,/obj/structure/table/wood/fancy,/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aIT" = (/obj/structure/table,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aIU" = (/obj/structure/curtain{color = "#B22222"; pixel_y = 32},/turf/open/floor/wood,/area/eventmap/inside)
-"aIV" = (/obj/structure/spacevine,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aIW" = (/obj/structure/chair/wood/wings,/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aIX" = (/obj/machinery/door/airlock/wood/dorms/dorm20,/turf/open/floor/wood,/area/eventmap/inside)
-"aIY" = (/obj/structure/chair/wood/wings,/obj/structure/cable/yellow{icon_state = "4-8"},/obj/effect/landmark/start/assistant,/turf/open/floor/wood,/area/eventmap/inside)
-"aIZ" = (/obj/effect/turf_decal/stripes/line{dir = 8},/obj/effect/turf_decal/caution{icon_state = "caution"; dir = 4},/obj/structure/cable/white{icon_state = "2-4"},/obj/structure/cable/white{icon_state = "1-4"},/turf/open/floor/wood,/area/eventmap/inside)
-"aJa" = (/obj/structure/window/reinforced,/obj/machinery/computer/crew{dir = 1},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aJb" = (/obj/effect/decal/cleanable/cobweb,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aJc" = (/obj/structure/extinguisher_cabinet,/turf/closed/wall/mineral/wood,/area/eventmap/mountaininside)
-"aJd" = (/obj/structure/window/reinforced,/obj/structure/table/wood/bar,/obj/machinery/computer/secure_data/laptop{dir = 1; icon_state = "laptop"; pixel_y = 6},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aJe" = (/obj/machinery/vending/tool,/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aJf" = (/obj/structure/table/wood/bar,/obj/structure/window/reinforced,/obj/structure/window/reinforced{dir = 4},/obj/machinery/recharger,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aJg" = (/obj/structure/cable/yellow,/obj/structure/bed,/obj/item/bedsheet/brown,/turf/open/floor/wood,/area/eventmap/inside)
-"aJh" = (/obj/machinery/light/small,/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"aJi" = (/obj/machinery/camera/emp_proof{c_tag = "Containment - Particle Accelerator"; dir = 1; network = list("singularity")},/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"aJj" = (/obj/structure/table/wood,/obj/item/paper/fluff/balls/spookyasylum/cell04,/obj/item/paper/fluff/balls/spookyasylum/cell03,/turf/open/floor/plasteel/dark,/area/eventmap/inside)
-"aJk" = (/obj/item/reagent_containers/food/drinks/bottle/blazaam,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aJl" = (/turf/open/indestructible/airblock,/area/eventmap/mountaininside)
-"aJm" = (/obj/structure/mineral_door/woodrustic,/turf/open/floor/spooktime/cobble/cornerSW,/area/eventmap/outside)
-"aJn" = (/obj/structure/bonfire,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aJo" = (/obj/machinery/vending/kink,/turf/open/floor/carpet/blue,/area/eventmap/inside)
-"aJp" = (/obj/structure/cable/yellow{icon_state = "4-8"},/obj/machinery/door/firedoor,/obj/machinery/door/airlock/medical/glass{id_tag = "MedbayFoyer"; name = "Medbay"; req_access_txt = "5"},/turf/open/floor/wood,/area/eventmap/inside)
-"aJq" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/item/a_gift/anything,/turf/open/floor/carpet,/area/eventmap/inside)
-"aJr" = (/turf/closed/wall/rust,/area/eventmap/mountain)
-"aJs" = (/obj/structure/rack,/obj/item/gun/ballistic/automatic/shotgun/bulldog/unrestricted,/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aJt" = (/obj/structure/rack,/obj/item/storage/box/beanbag,/obj/item/storage/box/beanbag,/obj/item/storage/box/fireshot,/obj/item/storage/box/lethalshot,/obj/item/storage/box/lethalslugs,/obj/item/storage/box/lethalshot,/obj/item/storage/box/rubbershot,/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aJu" = (/obj/structure/rack,/obj/item/gun/energy/pulse{pixel_x = 4; pixel_y = -4},/obj/item/gun/energy/pulse,/obj/item/gun/energy/pulse{pixel_x = -4; pixel_y = 4},/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aJv" = (/obj/structure/rack,/obj/item/gun/ballistic/shotgun/riot{pixel_x = 4; pixel_y = -4},/obj/item/gun/ballistic/shotgun/riot,/obj/item/gun/ballistic/shotgun/riot{pixel_x = -4; pixel_y = 4},/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/wood/damturf/broken4,/area/eventmap/inside)
-"aJw" = (/turf/open/floor/wood/damturf/broken3,/area/eventmap/mountaininside)
-"aJx" = (/turf/closed/indestructible/rock,/area/eventmap/mountain)
-"aJy" = (/obj/machinery/light/small{dir = 8},/obj/machinery/vending/kink,/turf/open/floor/wood,/area/eventmap/inside)
-"aJz" = (/obj/structure/cable/white{icon_state = "4-8"},/obj/structure/cable/white{icon_state = "1-4"},/turf/open/floor/wood,/area/eventmap/inside)
-"aJA" = (/obj/machinery/door/airlock/security{name = "Armoury"; req_access_txt = "3"},/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aJB" = (/obj/structure/cable/white{icon_state = "1-2"},/obj/structure/cable/white{icon_state = "2-8"},/obj/structure/cable/white{icon_state = "1-8"},/turf/open/floor/carpet,/area/eventmap/inside)
-"aJC" = (/obj/effect/turf_decal/bot,/obj/machinery/shower{dir = 4},/obj/structure/mirror{pixel_x = -28},/turf/open/floor/plasteel/showroomfloor,/area/eventmap/mountaininside)
-"aJD" = (/obj/structure/bonfire,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"aJE" = (/obj/machinery/button/door/dorms/dorm20,/turf/open/floor/carpet,/area/eventmap/inside)
-"aJF" = (/obj/machinery/vending/coffee,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aJG" = (/obj/item/pizzabox/infinite,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aJH" = (/obj/machinery/conveyor_switch/oneway{dir = 8; id = "cargo_out"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aJI" = (/obj/effect/turf_decal/caution{icon_state = "caution"; dir = 8},/obj/effect/turf_decal/stripes/line{dir = 4},/obj/machinery/door/airlock/mining/glass{name = "Cargo Bay"; req_access_txt = "31"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aJJ" = (/obj/vehicle/ridden/secway,/turf/open/floor/wood,/area/eventmap/inside)
-"aJK" = (/turf/open/floor/spooktime/beach/coasts/innerN,/area/eventmap/outside)
-"aJL" = (/obj/structure/closet,/obj/item/stack/sheet/glass/fifty,/obj/item/stack/sheet/glass/fifty,/obj/item/stack/sheet/metal/fifty,/obj/item/stack/sheet/metal/fifty,/obj/item/stack/sheet/metal/fifty,/turf/open/floor/wood,/area/eventmap/inside)
-"aJM" = (/turf/open/floor/wood/damturf/broken1,/area/eventmap/inside)
-"aJN" = (/obj/machinery/computer/cargo{icon_state = "computer"; dir = 4},/obj/effect/turf_decal/delivery,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aJO" = (/obj/structure/falsewall/wood,/turf/closed/wall/mineral/wood,/area/eventmap/inside)
-"aJP" = (/obj/structure/table/wood/fancy/cyan,/turf/open/floor/wood,/area/eventmap/inside)
-"aJQ" = (/obj/machinery/door/firedoor,/turf/open/floor/wood/damturf/broken2,/area/eventmap/inside)
-"aJR" = (/obj/structure/chair/office/dark,/obj/effect/landmark/start/cargo_technician,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aJS" = (/obj/machinery/button/door/dorms/luxury3{id = "C07"; pixel_x = -8},/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aJT" = (/obj/machinery/computer/bounty{icon_state = "computer"; dir = 8},/obj/structure/cable/white{icon_state = "1-2"},/obj/effect/turf_decal/delivery,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aJU" = (/turf/open/floor/spooktime/beach/coasts/innerE,/area/eventmap/outside)
-"aJV" = (/obj/item/chair/wood,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aJW" = (/obj/structure/closet,/obj/item/stack/sheet/glass/fifty,/obj/item/stack/sheet/glass/fifty,/obj/item/stack/sheet/metal/fifty,/obj/item/stack/sheet/metal/fifty,/turf/open/floor/wood/damturf/broken5,/area/eventmap/inside)
-"aJX" = (/obj/structure/closet/crate/wooden,/obj/item/storage/box/matches,/obj/item/storage/box/matches,/obj/item/storage/box/matches,/obj/item/storage/fancy/candle_box,/obj/item/storage/fancy/candle_box,/obj/item/storage/fancy/candle_box,/obj/item/storage/fancy/candle_box,/obj/item/storage/fancy/candle_box,/obj/item/storage/fancy/candle_box,/turf/open/floor/wood,/area/eventmap/inside)
-"aJY" = (/obj/machinery/ore_silo,/obj/machinery/light/floor,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aJZ" = (/obj/item/reagent_containers/food/condiment/saltshaker,/obj/item/reagent_containers/food/condiment/peppermill,/obj/item/candle/infinite,/obj/structure/table/wood/fancy,/turf/open/floor/wood,/area/eventmap/inside)
-"aKa" = (/turf/open/floor/plasteel/damturf/damage2,/area/eventmap/mountaininside)
-"aKb" = (/obj/item/candle/infinite,/obj/structure/table/wood/fancy,/turf/open/floor/wood,/area/eventmap/inside)
-"aKc" = (/obj/item/soap/syndie,/obj/effect/decal/cleanable/blood/old,/turf/open/floor/plasteel/showroomfloor,/area/eventmap/mountaininside)
-"aKd" = (/obj/effect/spawner/structure/window/reinforced,/obj/structure/cable/white,/turf/open/floor/wood,/area/eventmap/inside)
-"aKe" = (/obj/machinery/door/firedoor,/obj/machinery/door/airlock/security{name = "Labor Shuttle"; req_access_txt = "2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aKf" = (/obj/machinery/light/small{dir = 4},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aKg" = (/obj/machinery/door/airlock/wood,/turf/open/floor/plasteel/showroomfloor,/area/eventmap/mountaininside)
-"aKh" = (/obj/structure/table,/obj/item/storage/pill_bottle/lsd,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aKi" = (/turf/open/floor/plasteel/damturf/damage1,/area/eventmap/mountaininside)
-"aKj" = (/obj/machinery/light{dir = 8},/obj/structure/table,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aKk" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/machinery/door/airlock/engineering{name = "Telecommunications Chamber"; req_access_txt = "61"},/turf/open/floor/carpet,/area/eventmap/inside)
-"aKl" = (/obj/effect/landmark/start/ai,/obj/machinery/light/floor,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aKm" = (/obj/structure/chair/sofa/left,/obj/effect/landmark/start/assistant,/turf/open/floor/wood,/area/eventmap/inside)
-"aKn" = (/obj/effect/decal/cleanable/dirt,/obj/structure/closet/secure_closet/RD,/turf/open/floor/carpet,/area/eventmap/inside)
-"aKo" = (/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/carpet,/area/eventmap/inside)
-"aKp" = (/obj/machinery/light/floor,/obj/item/stack/sheet/glass/fifty{amount = 10000; max_amount = 10000},/obj/item/stack/sheet/bluespace_crystal{amount = 10000; max_amount = 10000},/obj/item/stack/sheet/metal{amount = 10000; max_amount = 10000},/obj/item/stack/sheet/mineral/diamond{amount = 10000; max_amount = 10000},/obj/item/stack/sheet/mineral/gold{amount = 10000; max_amount = 10000},/obj/item/stack/sheet/mineral/plasma{amount = 10000; max_amount = 10000},/obj/item/stack/sheet/mineral/silver{amount = 10000; max_amount = 10000},/obj/item/stack/sheet/mineral/titanium{amount = 10000; max_amount = 10000},/obj/item/stack/sheet/mineral/uranium{amount = 10000; max_amount = 10000},/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aKq" = (/turf/open/floor/spooktime/cobble/roadsideS,/area/eventmap/outside)
-"aKr" = (/obj/item/gun/energy/e_gun/stun,/turf/open/floor/wood,/area/eventmap/inside)
-"aKs" = (/obj/effect/landmark/start/warden,/turf/open/floor/wood,/area/eventmap/inside)
-"aKt" = (/obj/item/reagent_containers/pill/stimulant,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aKu" = (/obj/structure/closet/crate,/obj/item/clothing/head/pirate,/obj/item/clothing/head/santa,/obj/item/clothing/head/magus,/obj/item/clothing/head/mailman,/obj/item/clothing/head/griffin,/obj/item/clothing/head/bearpelt,/obj/item/clothing/head/beret,/obj/item/clothing/head/bowler,/obj/item/clothing/head/fedora,/turf/open/floor/wood,/area/eventmap/inside)
-"aKv" = (/obj/item/storage/box/stunslug,/obj/item/storage/box/stunslug,/obj/item/storage/box/stunslug,/turf/open/floor/wood,/area/eventmap/inside)
-"aKw" = (/obj/structure/table/wood/bar,/obj/machinery/door/poddoor/shutters{id = "armory"; name = "Armoury Shutter"},/turf/open/floor/wood,/area/eventmap/inside)
-"aKx" = (/obj/machinery/door/airlock/silver{name = "Bathroom"},/turf/open/floor/sepia,/area/eventmap/mountaininside)
-"aKy" = (/obj/item/reagent_containers/food/drinks/bottle/lizardwine,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aKz" = (/obj/structure/urinal{pixel_y = 32},/turf/open/floor/plasteel/showroomfloor,/area/eventmap/mountaininside)
-"aKA" = (/obj/machinery/light/small{dir = 1},/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aKB" = (/obj/machinery/light{dir = 4},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aKC" = (/obj/item/reagent_containers/food/drinks/bottle/lizardwine,/turf/open/floor/wood,/area/eventmap/inside)
-"aKD" = (/obj/machinery/nanite_programmer,/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aKE" = (/obj/effect/landmark/start/depsec/engineering,/turf/open/floor/wood,/area/eventmap/inside)
-"aKF" = (/obj/effect/landmark/start/depsec/medical,/turf/open/floor/carpet,/area/eventmap/inside)
-"aKG" = (/obj/machinery/vending/snack/random,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aKH" = (/obj/effect/landmark/start/depsec/science,/turf/open/floor/wood,/area/eventmap/inside)
-"aKI" = (/obj/machinery/door/firedoor,/obj/structure/cable/white{icon_state = "4-8"},/obj/machinery/door/airlock/security{name = "Labor Shuttle"; req_access_txt = "2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aKJ" = (/obj/structure/chair/comfy/beige{dir = 1},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aKK" = (/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/wood{icon_state = "wood-broken4"},/area/eventmap/inside)
-"aKL" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/structure/cable/white{icon_state = "2-8"},/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aKM" = (/obj/machinery/button/door/dorms/luxury3{id = "C11"; pixel_y = -24},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aKN" = (/obj/machinery/door_timer{id = "Cell 1"; name = "Cell 1"; pixel_y = -32},/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aKO" = (/obj/machinery/door_timer{id = "Cell 2"; name = "Cell 2"; pixel_y = -32},/obj/effect/decal/cleanable/blood/tracks{dir = 4},/obj/structure/cable/white{icon_state = "4-8"},/obj/structure/cable/white{icon_state = "1-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aKP" = (/turf/open/floor/spooktime/cobble/sideN,/area/eventmap/outside)
-"aKQ" = (/turf/open/floor/spooktime/beach/coasts/coastE,/area/eventmap/outside)
-"aKR" = (/obj/structure/cable/white{icon_state = "2-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aKS" = (/turf/open/floor/spooktime/cobble/cornerNE,/area/eventmap/outside)
-"aKT" = (/obj/structure/rack,/obj/item/gun/ballistic/shotgun/boltaction{pixel_x = -4; pixel_y = 4},/obj/item/gun/ballistic/shotgun/boltaction{pixel_x = 4; pixel_y = -4},/obj/item/gun/ballistic/shotgun/boltaction,/turf/open/floor/wood,/area/eventmap/inside)
-"aKU" = (/obj/structure/rack,/obj/item/clothing/suit/armor/riot{pixel_x = 4; pixel_y = -4},/obj/item/clothing/suit/armor/riot,/obj/item/clothing/suit/armor/riot{pixel_x = -4; pixel_y = 4},/obj/item/clothing/head/helmet/riot{pixel_x = 4; pixel_y = -4},/obj/item/clothing/head/helmet/riot,/obj/item/clothing/head/helmet/riot{pixel_x = -4; pixel_y = 4},/turf/open/floor/wood,/area/eventmap/inside)
-"aKV" = (/obj/structure/rack,/obj/item/clothing/suit/armor/bulletproof{pixel_x = 4; pixel_y = -4},/obj/item/clothing/suit/armor/bulletproof,/obj/item/clothing/suit/armor/bulletproof{pixel_x = -4; pixel_y = 4},/obj/item/clothing/head/helmet/alt{pixel_x = 4; pixel_y = -4},/obj/item/clothing/head/helmet/alt,/obj/item/clothing/head/helmet/alt{pixel_x = -4; pixel_y = 4},/turf/open/floor/wood/damturf/broken6,/area/eventmap/inside)
-"aKW" = (/obj/structure/closet/secure_closet/hos,/obj/item/clothing/head/helmet/justice/escape{name = "justice helmet"},/turf/open/floor/wood,/area/eventmap/inside)
-"aKX" = (/obj/effect/turf_decal/stripes/line{dir = 8},/obj/effect/turf_decal/stripes/line{dir = 4},/obj/machinery/conveyor{id = "cargo_front"},/turf/open/floor/plating,/area/eventmap/inside)
-"aKY" = (/obj/machinery/light,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aKZ" = (/obj/machinery/light/small{brightness = 3; dir = 8},/turf/open/floor/carpet,/area/eventmap/mountaininside)
-"aLa" = (/obj/structure/closet/secure_closet/armory3,/turf/open/floor/wood,/area/eventmap/inside)
-"aLb" = (/obj/structure/closet/secure_closet/armory2,/turf/open/floor/wood,/area/eventmap/inside)
-"aLc" = (/obj/structure/closet/secure_closet/armory1,/turf/open/floor/wood,/area/eventmap/inside)
-"aLd" = (/obj/structure/closet/crate/wooden,/obj/item/storage/box/matches,/obj/item/storage/box/matches,/obj/item/storage/box/matches,/obj/item/storage/fancy/candle_box,/obj/item/storage/fancy/candle_box,/obj/item/storage/fancy/candle_box,/obj/item/storage/fancy/candle_box,/obj/item/storage/fancy/candle_box,/obj/item/storage/fancy/candle_box,/turf/open/floor/wood/damturf/broken7,/area/eventmap/inside)
-"aLe" = (/obj/structure/table/wood/bar,/obj/machinery/recharger,/obj/item/key/security,/obj/item/key/security,/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aLf" = (/obj/machinery/rnd/production/techfab/department/security,/turf/open/floor/wood,/area/eventmap/inside)
-"aLg" = (/obj/item/autosurgeon/gloweyes,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aLh" = (/obj/effect/decal/cleanable/cobweb,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aLi" = (/obj/structure/chair/wood/wings{dir = 4},/obj/machinery/light/small,/turf/open/floor/wood,/area/eventmap/inside)
-"aLj" = (/obj/structure/chair/wood/wings{dir = 8},/obj/machinery/light/small,/turf/open/floor/wood,/area/eventmap/inside)
-"aLk" = (/obj/machinery/door/window/brigdoor/security/cell{id = "Cell 1"; name = "Cell 1"},/obj/effect/decal/cleanable/blood/tracks,/turf/open/floor/wood,/area/eventmap/inside)
-"aLl" = (/obj/structure/sign/poster/official/no_erp,/turf/closed/wall/rust,/area/eventmap/mountaininside)
-"aLm" = (/obj/machinery/door/window/brigdoor/security/cell{id = "Cell 2"; name = "Cell 2"},/obj/effect/decal/cleanable/blood/old,/turf/open/floor/wood,/area/eventmap/inside)
-"aLn" = (/turf/closed/wall/mineral/iron,/area/eventmap/inside)
-"aLo" = (/obj/machinery/biogenerator,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/inside)
-"aLp" = (/obj/machinery/seed_extractor,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/inside)
-"aLq" = (/obj/item/radio/intercom{desc = "Talk through this. It looks like it has been modified to not broadcast."; name = "Prison Intercom (General)"; pixel_x = -25; pixel_y = -2; prison_radio = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"aLr" = (/obj/machinery/shower{dir = 8; pixel_y = -4},/obj/effect/turf_decal/bot,/turf/open/floor/sepia,/area/eventmap/mountaininside)
-"aLs" = (/obj/machinery/light/small{dir = 4; light_color = "#d8b1b1"},/turf/open/floor/wood{icon_state = "wood-broken6"},/area/eventmap/inside)
-"aLt" = (/obj/effect/decal/cleanable/cobweb/cobweb2,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aLu" = (/obj/effect/decal/cleanable/crayon,/obj/machinery/light/small{dir = 4; light_color = "#d8b1b1"},/turf/open/floor/wood,/area/eventmap/inside)
-"aLv" = (/turf/open/floor/spooktime/dirtpatch,/area/eventmap/inside)
-"aLw" = (/obj/machinery/light/small{dir = 4; light_color = "#d8b1b1"},/turf/open/floor/spooktime/dirtpatch,/area/eventmap/inside)
-"aLx" = (/obj/item/coin/antagtoken,/obj/structure/closet/crate/trashcart/moneywish,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aLy" = (/obj/structure/bed,/obj/item/bedsheet/pirate,/obj/machinery/flasher{id = "Cell 1"; pixel_x = -28},/obj/effect/decal/cleanable/blood/old,/turf/open/floor/wood,/area/eventmap/inside)
-"aLz" = (/obj/structure/closet/secure_closet/brig{id = "Cell 1"; name = "Cell 1 Locker"},/turf/open/floor/wood,/area/eventmap/inside)
-"aLA" = (/obj/structure/table/optable,/obj/effect/decal/cleanable/blood/old,/turf/open/floor/wood,/area/eventmap/inside)
-"aLB" = (/obj/structure/table/plasmaglass,/obj/item/storage/backpack/duffelbag/sec/surgery,/turf/open/floor/wood,/area/eventmap/inside)
-"aLC" = (/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aLD" = (/obj/structure/bed,/obj/item/bedsheet/cult,/obj/machinery/flasher{id = "Cell 2"; pixel_x = -28},/obj/effect/decal/cleanable/blood/gibs/old,/turf/open/floor/wood,/area/eventmap/inside)
-"aLE" = (/obj/structure/closet/secure_closet/brig{id = "Cell 2"; name = "Cell 2 Locker"},/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/item/toy/toy_dagger,/obj/item/clothing/suit/cultrobes,/turf/open/floor/wood,/area/eventmap/inside)
-"aLF" = (/obj/item/chair,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aLG" = (/obj/item/reagent_containers/food/drinks/bottle/whiskey,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aLH" = (/obj/structure/sink/puddle,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/inside)
-"aLI" = (/obj/machinery/hydroponics/soil,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/inside)
-"aLJ" = (/obj/machinery/light/small{dir = 1},/turf/open/floor/spooktime/dirtpatch,/area/eventmap/inside)
-"aLK" = (/obj/structure/holohoop,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/inside)
-"aLL" = (/obj/structure/table/wood/fancy,/obj/item/candle/infinite{pixel_x = -8},/obj/item/reagent_containers/food/snacks/meat/steak{pixel_y = 16},/obj/item/candle/infinite{pixel_x = 8},/turf/open/floor/carpet/royalblack,/area/eventmap/mountain)
-"aLM" = (/obj/structure/spacevine,/turf/open/floor/spooktime/beach/watersolid,/area/eventmap/mountain)
-"aLN" = (/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/inside)
-"aLO" = (/obj/structure/closet/crate/bin,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/inside)
-"aLP" = (/obj/structure/chair/wood,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/inside)
-"aLQ" = (/obj/structure/bed,/obj/item/bedsheet/blue,/turf/open/floor/carpet,/area/eventmap/mountaininside)
-"aLR" = (/obj/structure/curtain{color = "#B22222"; pixel_x = 32},/turf/open/floor/wood,/area/eventmap/inside)
-"aLS" = (/obj/structure/table/wood,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/inside)
-"aLT" = (/obj/structure/toilet{dir = 4},/turf/open/floor/wood,/area/eventmap/inside)
-"aLU" = (/turf/open/floor/spooktime/dirtpatch,/area/eventmap/outside)
-"aLV" = (/obj/item/stack/sheet/mineral/diamond,/obj/item/stack/sheet/mineral/adamantine,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aLW" = (/obj/structure/spacevine,/turf/open/floor/spooktime/beach/coasts/innerS,/area/eventmap/outside)
-"aLX" = (/obj/machinery/light/small,/turf/open/floor/wood{icon_state = "wood-broken4"},/area/eventmap/inside)
-"aLY" = (/obj/structure/barricade/wooden,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aLZ" = (/obj/item/storage/fancy/cigarettes/cigpack_mindbreaker,/obj/effect/decal/cleanable/dirt,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aMa" = (/obj/machinery/shower{desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well..."; dir = 8},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aMb" = (/obj/machinery/light/small{dir = 1},/turf/open/floor/sepia,/area/eventmap/mountaininside)
-"aMc" = (/obj/item/scythe,/turf/open/floor/wood{icon_state = "wood-broken5"},/area/eventmap/inside)
-"aMd" = (/obj/structure/table/wood,/obj/machinery/light/small{brightness = 3; dir = 8},/turf/open/floor/spooktime/dirtpatch,/area/eventmap/inside)
-"aMe" = (/obj/item/chair/wood,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/inside)
-"aMf" = (/obj/machinery/cryopod{dir = 8},/turf/open/floor/spooktime/dirtpatch,/area/eventmap/inside)
-"aMg" = (/obj/structure/chair/wood{dir = 1},/turf/open/floor/spooktime/dirtpatch,/area/eventmap/inside)
-"aMh" = (/turf/open/floor/spooktime/beach/coasts/watercoastSE,/area/eventmap/outside)
-"aMi" = (/obj/machinery/conveyor_switch/oneway{dir = 8; id = "cargo_front"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aMj" = (/obj/structure/table/reinforced,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aMk" = (/obj/structure/table/reinforced,/obj/item/stamp{pixel_x = -12; pixel_y = 16},/obj/item/stamp/denied{pixel_x = 12; pixel_y = 16},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aMl" = (/obj/structure/chair/sofa/right,/obj/item/storage/daki,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aMm" = (/obj/structure/table/reinforced,/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aMn" = (/obj/machinery/light/small{dir = 8},/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aMo" = (/obj/machinery/mecha_part_fabricator,/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aMp" = (/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aMq" = (/obj/machinery/light/floor{alpha = 0; light_range = 20; mouse_opacity = 0},/obj/machinery/light/floor{alpha = 0; light_range = 20; mouse_opacity = 0},/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aMr" = (/obj/effect/turf_decal/stripes/line{dir = 4},/obj/effect/turf_decal/stripes/line{dir = 8},/obj/structure/plasticflaps/opaque,/obj/machinery/conveyor{id = "cargo_front"},/turf/open/floor/plating,/area/eventmap/inside)
-"aMs" = (/obj/machinery/conveyor_switch/oneway{id = "cargo_out"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aMt" = (/obj/machinery/computer/cargo/request{icon_state = "computer"; dir = 4},/obj/effect/turf_decal/delivery,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aMu" = (/obj/item/storage/fancy/rollingpapers,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aMv" = (/obj/effect/spawner/structure/window/reinforced,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aMw" = (/obj/effect/turf_decal/tile/brown{icon_state = "tile_corner"; dir = 4},/obj/effect/turf_decal/tile/brown{icon_state = "tile_corner"; dir = 1},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aMx" = (/obj/effect/turf_decal/tile/brown{icon_state = "tile_corner"; dir = 4},/obj/effect/turf_decal/tile/brown{icon_state = "tile_corner"; dir = 1},/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aMy" = (/obj/structure/table/plasmaglass,/obj/item/integrated_electronics/analyzer,/obj/item/integrated_electronics/debugger,/obj/item/integrated_electronics/detailer,/obj/item/integrated_electronics/wirer,/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aMz" = (/obj/structure/bookcase/manuals/medical,/turf/closed/wall/mineral/wood,/area/eventmap/mountaininside)
-"aMA" = (/obj/effect/turf_decal/tile/brown{icon_state = "tile_corner"; dir = 4},/obj/effect/turf_decal/tile/brown{icon_state = "tile_corner"; dir = 1},/obj/structure/noticeboard/qm{pixel_y = 32},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aMB" = (/obj/item/reagent_containers/food/urinalcake,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aMC" = (/obj/effect/turf_decal/stripes/corner,/obj/effect/turf_decal/stripes/line{dir = 9},/obj/machinery/conveyor{dir = 5; id = "conveyor_out"},/turf/open/floor/plating,/area/eventmap/inside)
-"aMD" = (/obj/effect/turf_decal/stripes/line,/obj/effect/turf_decal/stripes/line{dir = 1},/obj/machinery/conveyor{dir = 4; icon_state = "conveyor_map"; id = "cargo_out"},/turf/open/floor/plating,/area/eventmap/inside)
-"aME" = (/turf/open/floor/carpet/red,/area/eventmap/mountaininside)
-"aMF" = (/obj/effect/turf_decal/stripes/line,/obj/effect/turf_decal/stripes/line{dir = 1},/obj/structure/plasticflaps/opaque,/obj/machinery/conveyor{dir = 4; icon_state = "conveyor_map"; id = "cargo_out"},/turf/open/floor/plating,/area/eventmap/inside)
-"aMG" = (/obj/structure/mineral_door/wood,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aMH" = (/obj/structure/chair{dir = 4},/obj/effect/turf_decal/tile/brown{icon_state = "tile_corner"; dir = 8},/obj/effect/turf_decal/tile/brown{icon_state = "tile_corner"; dir = 1},/obj/machinery/light/small{dir = 8},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aMI" = (/turf/open/floor/carpet/orange,/area/eventmap/mountaininside)
-"aMJ" = (/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aMK" = (/obj/machinery/processor,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aML" = (/obj/machinery/door/airlock/mining/glass{name = "Cargo Bay"; req_access_txt = "31"},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aMM" = (/obj/structure/flora/tree/jungle,/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"aMN" = (/obj/effect/landmark/start/assistant,/turf/open/floor/spooktime/cobble/roadsideS,/area/eventmap/outside)
-"aMO" = (/obj/effect/turf_decal/stripes/line{dir = 8},/obj/effect/turf_decal/stripes/line{dir = 4},/obj/machinery/conveyor{dir = 1; icon_state = "conveyor_map"; id = "cargo_out"},/turf/open/floor/plating,/area/eventmap/inside)
-"aMP" = (/obj/structure/chair{dir = 4},/obj/effect/turf_decal/tile/brown{icon_state = "tile_corner"; dir = 8},/obj/effect/turf_decal/tile/brown{icon_state = "tile_corner"; dir = 1},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aMQ" = (/obj/structure/cable/white{icon_state = "1-2"},/obj/effect/landmark/start/assistant/override,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aMR" = (/obj/item/switchblade,/turf/open/floor/wood{icon_state = "wood-broken2"},/area/eventmap/inside)
-"aMS" = (/obj/structure/table,/obj/item/storage/pill_bottle/penis_enlargement,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aMT" = (/obj/machinery/camera/emp_proof{c_tag = "Cargo Office"; dir = 8; network = list("singularity")},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aMU" = (/obj/effect/turf_decal/loading_area,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aMV" = (/obj/effect/turf_decal/bot,/obj/machinery/autolathe/toy,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aMW" = (/obj/machinery/light/floor{alpha = 0; light_range = 20; max_integrity = 9999; mouse_opacity = 0},/obj/machinery/vending/tool,/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aMX" = (/obj/item/storage/pill_bottle/breast_enlargement,/turf/open/floor/plasteel/damturf/scorched,/area/eventmap/mountaininside)
-"aMY" = (/obj/structure/closet/crate/bin,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aMZ" = (/obj/effect/turf_decal/stripes/line,/obj/effect/turf_decal/stripes/line{dir = 1},/obj/machinery/conveyor{dir = 4; icon_state = "conveyor_map"; id = "cargo_out"},/obj/machinery/light/small,/turf/open/floor/plating,/area/eventmap/inside)
-"aNa" = (/obj/machinery/vending/coffee,/turf/open/floor/wood/damturf/broken6,/area/eventmap/mountaininside)
-"aNb" = (/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{id = "C05"},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aNc" = (/obj/item/gun/magic/staff/healing,/obj/structure/table/wood/fancy/green,/turf/open/floor/carpet/orange,/area/eventmap/mountaininside)
-"aNd" = (/obj/item/storage/firstaid/regular,/turf/open/floor/carpet/orange,/area/eventmap/mountaininside)
-"aNe" = (/obj/structure/table,/obj/machinery/chem_dispenser/drinks/beer,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aNf" = (/obj/item/chair/wood,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"aNg" = (/obj/structure/table/wood,/obj/item/reagent_containers/food/drinks/mug/coco,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aNh" = (/obj/effect/turf_decal/stripes/corner{icon_state = "warninglinecorner"; dir = 4},/obj/effect/turf_decal/stripes/line{dir = 6},/obj/machinery/conveyor/inverted{dir = 10; id = "cargo_out"},/turf/open/floor/plating,/area/eventmap/inside)
-"aNi" = (/obj/item/flashlight/lantern{anchored = 1; can_be_unanchored = 1; light_color = "#EE9933"; light_range = 5; on = 1},/turf/open/floor/carpet/orange,/area/eventmap/mountaininside)
-"aNj" = (/obj/machinery/door/airlock/mining{name = "Mining"; req_access_txt = "48"},/obj/machinery/door/firedoor,/obj/effect/turf_decal/tile/brown{dir = 1},/obj/effect/turf_decal/tile/brown{icon_state = "tile_corner"; dir = 8},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aNk" = (/obj/machinery/shower{desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well..."; dir = 4},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aNl" = (/obj/structure/closet/athletic_mixed,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aNm" = (/obj/item/clothing/head/hardhat/pumpkinhead/jaqc,/obj/structure/table/wood/fancy/green,/obj/effect/spawner/lootdrop/welder_tools,/turf/open/floor/carpet/orange,/area/eventmap/mountaininside)
-"aNn" = (/obj/machinery/door/airlock/mining{name = "Mining"; req_access_txt = "48"},/obj/machinery/door/firedoor,/obj/effect/turf_decal/tile/brown{dir = 4},/obj/effect/turf_decal/tile/brown,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aNo" = (/obj/structure/mineral_door/wood,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aNp" = (/obj/effect/spawner/structure/window/reinforced,/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/plating,/area/eventmap/inside)
-"aNq" = (/obj/structure/chair/wood/wings{dir = 4},/turf/open/floor/carpet/royalblack,/area/eventmap/mountain)
-"aNr" = (/obj/effect/turf_decal/tile/brown{dir = 1},/obj/effect/turf_decal/tile/brown{icon_state = "tile_corner"; dir = 8},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aNs" = (/obj/effect/turf_decal/tile/brown{dir = 4},/obj/effect/turf_decal/tile/brown,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aNt" = (/obj/item/scythe,/obj/structure/curtain{color = "#B22222"; pixel_y = 32},/turf/open/floor/wood,/area/eventmap/inside)
-"aNu" = (/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aNv" = (/obj/structure/spacevine,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/outside)
-"aNw" = (/obj/structure/closet/crate/trashcart,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"aNx" = (/obj/structure/table/wood,/obj/structure/bedsheetbin/towel,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aNy" = (/obj/structure/rack,/obj/effect/turf_decal/bot,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aNz" = (/obj/structure/barricade/sandbags,/turf/open/indestructible/airblock,/area/eventmap/mountaininside)
-"aNA" = (/obj/item/storage/fancy/heart_box,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aNB" = (/obj/effect/turf_decal/delivery,/obj/machinery/mineral/equipment_vendor,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aNC" = (/obj/structure/holohoop{dir = 1},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"aND" = (/obj/effect/turf_decal/tile/brown{dir = 4},/obj/effect/turf_decal/tile/brown{dir = 1},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aNE" = (/obj/structure/cable/yellow{icon_state = "4-8"},/obj/machinery/door/firedoor,/turf/open/floor/wood,/area/eventmap/inside)
-"aNF" = (/obj/effect/decal/cleanable/cobweb/cobweb2,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aNG" = (/obj/structure/chair/sofa,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aNH" = (/obj/structure/bed,/obj/item/bedsheet/black,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aNI" = (/obj/item/bedsheet/blue,/obj/structure/bed,/turf/open/floor/carpet/green,/area/eventmap/mountaininside)
-"aNJ" = (/obj/structure/mirror{pixel_x = 28},/obj/structure/sink{dir = 4; pixel_x = 11},/turf/open/floor/plasteel/showroomfloor,/area/eventmap/mountaininside)
-"aNK" = (/obj/structure/mirror{pixel_x = -28},/turf/open/floor/wood,/area/eventmap/inside)
-"aNL" = (/obj/structure/table/wood,/obj/item/reagent_containers/rag/towel,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aNM" = (/obj/machinery/door/firedoor,/obj/effect/turf_decal/tile/brown{dir = 4},/obj/effect/turf_decal/tile/brown{dir = 1},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aNN" = (/obj/machinery/door/airlock/mining{name = "Mining"; req_access_txt = "48"},/obj/effect/turf_decal/tile/brown{dir = 4},/obj/effect/turf_decal/tile/brown{dir = 1},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aNO" = (/obj/machinery/light/floor,/obj/machinery/telecomms/bus{appearance_flags = "bus mainframe (NULL)"; freq_listening = list(1347,1349,1351,1353,1355,1357,1359,1447)},/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aNP" = (/obj/effect/turf_decal/tile/brown,/obj/effect/turf_decal/tile/brown{dir = 1},/obj/effect/turf_decal/tile/brown{icon_state = "tile_corner"; dir = 8},/obj/effect/landmark/start/shaft_miner,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aNQ" = (/obj/effect/turf_decal/tile/brown,/obj/effect/turf_decal/tile/brown{icon_state = "tile_corner"; dir = 8},/obj/effect/landmark/start/shaft_miner,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aNR" = (/obj/machinery/door/airlock/wood/glass,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aNS" = (/obj/structure/spacevine,/obj/structure/spacevine,/obj/structure/spacevine,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aNT" = (/obj/structure/table/plasmaglass,/obj/item/stock_parts/cell/hyper,/obj/item/stock_parts/cell/hyper,/obj/item/stock_parts/cell/hyper,/obj/item/stock_parts/cell/hyper,/obj/item/stock_parts/cell/hyper,/obj/item/stock_parts/cell/hyper,/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aNU" = (/obj/structure/cable/white{icon_state = "2-4"},/obj/effect/turf_decal/tile/brown{icon_state = "tile_corner"; dir = 8},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aNV" = (/obj/structure/table/wood/fancy/green,/obj/item/gun/magic/staff/healing,/turf/open/floor/carpet/orange,/area/eventmap/mountaininside)
-"aNW" = (/obj/structure/cable/white{icon_state = "4-8"},/obj/effect/turf_decal/tile/brown,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aNX" = (/obj/structure/cable/white{icon_state = "4-8"},/obj/machinery/door/firedoor,/obj/effect/turf_decal/tile/brown,/obj/effect/turf_decal/tile/brown{icon_state = "tile_corner"; dir = 8},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aNY" = (/obj/item/flashlight/lantern{anchored = 1; can_be_unanchored = 1; light_color = "#EE9933"; light_range = 5; on = 1},/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aNZ" = (/obj/vehicle/sealed/vectorcraft,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aOa" = (/obj/structure/cable/white{icon_state = "4-8"},/obj/machinery/door/airlock/mining{name = "Mining"; req_access_txt = "48"},/obj/effect/turf_decal/tile/brown,/obj/effect/turf_decal/tile/brown{icon_state = "tile_corner"; dir = 8},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aOb" = (/obj/machinery/light{dir = 1},/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aOc" = (/obj/machinery/light/small{dir = 1},/obj/structure/closet/secure_closet/quartermaster,/turf/open/floor/wood,/area/eventmap/inside)
-"aOd" = (/obj/structure/bed,/obj/item/bedsheet/qm,/obj/effect/landmark/start/quartermaster,/obj/structure/sign/poster/contraband/masked_men,/turf/open/floor/wood,/area/eventmap/inside)
-"aOe" = (/obj/machinery/light/small{dir = 1},/obj/structure/sink{dir = 8; pixel_x = -12},/turf/open/floor/plasteel/showroomfloor,/area/eventmap/inside)
-"aOf" = (/obj/vehicle/sealed/vectorcraft/ambulance,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aOg" = (/obj/structure/toilet{dir = 8},/turf/open/floor/plasteel/showroomfloor,/area/eventmap/inside)
-"aOh" = (/obj/effect/turf_decal/bot,/obj/structure/closet/secure_closet/miner,/obj/machinery/camera/emp_proof{c_tag = "Mining Entrance"; dir = 1; network = list("singularity")},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aOi" = (/obj/effect/turf_decal/bot,/obj/structure/closet/secure_closet/miner,/obj/machinery/light/small,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aOj" = (/obj/structure/toilet{dir = 4},/turf/open/floor/sepia,/area/eventmap/mountaininside)
-"aOk" = (/obj/machinery/light,/turf/open/floor/plasteel/showroomfloor,/area/eventmap/mountaininside)
-"aOl" = (/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood/damturf/broken5,/area/eventmap/inside)
-"aOm" = (/obj/effect/turf_decal/bot,/obj/structure/closet/secure_closet/miner,/turf/open/floor/plasteel,/area/eventmap/inside)
-"aOn" = (/obj/structure/cable/white{icon_state = "1-2"},/obj/effect/turf_decal/tile/brown{dir = 1},/obj/effect/turf_decal/tile/brown{icon_state = "tile_corner"; dir = 8},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aOo" = (/obj/structure/cable/white{icon_state = "2-4"},/turf/open/floor/wood,/area/eventmap/inside)
-"aOp" = (/obj/structure/cable/white{icon_state = "0-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aOq" = (/obj/effect/turf_decal/bot,/obj/machinery/shower{dir = 4},/obj/structure/mirror{pixel_x = -28},/turf/open/floor/plasteel/showroomfloor,/area/eventmap/inside)
-"aOr" = (/obj/machinery/light/small{dir = 1},/obj/machinery/autolathe/toy,/turf/open/floor/spooktime/cobble/sideN,/area/eventmap/outside)
-"aOs" = (/obj/effect/landmark/start/quartermaster,/turf/open/floor/plasteel/showroomfloor,/area/eventmap/inside)
-"aOt" = (/obj/machinery/door/airlock/mining{name = "Mining"; req_access_txt = "48"},/obj/machinery/door/firedoor,/obj/structure/cable/white{icon_state = "1-2"},/obj/effect/turf_decal/tile/brown{dir = 1},/obj/effect/turf_decal/tile/brown{icon_state = "tile_corner"; dir = 8},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aOu" = (/obj/machinery/door/airlock/wood,/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aOv" = (/obj/machinery/door/airlock/wood,/turf/open/floor/plasteel/showroomfloor,/area/eventmap/inside)
-"aOw" = (/obj/structure/bed,/obj/item/bedsheet/random,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aOx" = (/obj/structure/cable/white{icon_state = "1-2"},/obj/structure/cable/white{icon_state = "0-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aOy" = (/turf/open/floor/spooktime/beach/coasts/watercoastNW,/area/eventmap/outside)
-"aOz" = (/obj/machinery/light/floor,/obj/machinery/telecomms/processor{appearance_flags = "processor unit"; freq_listening = list(1347,1349,1351,1353,1355,1357,1359,1447); name = "processor unit (NULL)"},/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aOA" = (/obj/structure/cable/white{icon_state = "2-8"},/obj/structure/cable/white{icon_state = "4-8"},/turf/open/indestructible/cobble,/area/eventmap/outside)
-"aOB" = (/obj/structure/filingcabinet,/turf/open/floor/wood,/area/eventmap/inside)
-"aOC" = (/turf/open/floor/plasteel/damturf/platdmg3,/area/eventmap/mountaininside)
-"aOD" = (/obj/structure/fluff/broken_flooring,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aOE" = (/turf/open/floor/wood,/area/eventmap/inside)
-"aOF" = (/obj/machinery/grandfatherclock,/turf/open/floor/wood,/area/eventmap/inside)
-"aOG" = (/obj/machinery/light/small{dir = 1},/obj/structure/table/wood,/obj/item/paper_bin,/obj/item/pen/fountain,/obj/item/stamp/qm,/turf/open/floor/wood,/area/eventmap/inside)
-"aOH" = (/obj/structure/chair/comfy/black{dir = 4},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/carpet,/area/eventmap/inside)
-"aOI" = (/obj/machinery/light/small{dir = 4},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aOJ" = (/obj/structure/sign/poster/official/no_erp,/turf/closed/wall/mineral/wood,/area/eventmap/inside)
-"aOK" = (/obj/machinery/light/small{brightness = 3; dir = 8},/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aOL" = (/obj/effect/spawner/structure/window/reinforced,/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{id = "C01"},/turf/open/floor/wood,/area/eventmap/inside)
-"aOM" = (/obj/structure/chair/office/dark,/obj/effect/landmark/start/quartermaster,/turf/open/floor/wood,/area/eventmap/inside)
-"aON" = (/obj/machinery/button/door/dorms/luxury3{id = "C10"; pixel_x = 24; pixel_y = -12},/turf/open/floor/wood,/area/eventmap/inside)
-"aOO" = (/obj/structure/table,/obj/machinery/reagentgrinder,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aOP" = (/obj/structure/cable/white{icon_state = "1-4"},/obj/machinery/computer/card/minor/qm{icon_state = "computer"; dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"aOQ" = (/obj/vehicle/sealed/vectorcraft/cyber,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aOR" = (/obj/structure/table,/obj/machinery/light{dir = 1},/obj/machinery/chem_dispenser/drinks,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aOS" = (/obj/structure/cable/white{icon_state = "4-8"},/obj/machinery/computer/cargo{icon_state = "computer"; dir = 1},/turf/open/floor/wood/damturf/broken3,/area/eventmap/inside)
-"aOT" = (/obj/structure/cable/white{icon_state = "4-8"},/obj/machinery/computer/bounty{icon_state = "computer"; dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"aOU" = (/obj/structure/cable/white{icon_state = "4-8"},/obj/machinery/computer/security/qm{icon_state = "computer"; dir = 1},/obj/structure/sign/poster/official/twelve_gauge{pixel_y = -32},/turf/open/floor/wood,/area/eventmap/inside)
-"aOV" = (/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{id = "C10"; name = "Quartermaster's Shutters"},/obj/structure/cable/white{icon_state = "4-8"},/obj/machinery/door/airlock/mining{name = "Quartermaster's Quarters"; req_access_txt = "41"},/turf/open/floor/wood,/area/eventmap/inside)
-"aOW" = (/obj/structure/table/wood,/obj/item/storage/firstaid/brute,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aOX" = (/obj/structure/closet/secure_closet/personal,/obj/machinery/light/small{brightness = 3; dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"aOY" = (/obj/structure/closet/crate/bin,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aOZ" = (/obj/machinery/shower{desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well..."; dir = 8},/obj/item/soap,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aPa" = (/obj/structure/table,/obj/structure/bedsheetbin/towel,/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aPb" = (/obj/structure/bed,/obj/item/bedsheet/black,/turf/open/floor/carpet/purple,/area/eventmap/mountaininside)
-"aPc" = (/obj/structure/bookcase/random,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aPd" = (/obj/machinery/computer/rdconsole,/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aPe" = (/obj/vehicle/sealed/vectorcraft/CAPT,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aPf" = (/obj/vehicle/sealed/vectorcraft/CE,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aPg" = (/obj/vehicle/sealed/vectorcraft/CMO,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aPh" = (/obj/vehicle/sealed/vectorcraft/QM,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aPi" = (/turf/closed/indestructible/riveted/hierophant,/area/eventmap/mountaininside)
-"aPj" = (/obj/structure/filingcabinet/chestdrawer,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aPk" = (/obj/vehicle/sealed/vectorcraft/RD,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aPl" = (/obj/structure/rack,/obj/item/stack/sheet/mineral/wood/fifty,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aPm" = (/obj/item/candle/infinite,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aPn" = (/obj/vehicle/sealed/vectorcraft/hop,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aPo" = (/obj/structure/table/reinforced,/obj/item/storage/toolbox/syndicate,/obj/item/storage/toolbox/gold_real,/obj/item/storage/toolbox/syndicate,/obj/item/storage/toolbox/gold_real,/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aPp" = (/obj/vehicle/sealed/vectorcraft/hos,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aPq" = (/mob/living/simple_animal/jacq{active = 0},/turf/open/floor/carpet/orange,/area/eventmap/mountaininside)
-"aPr" = (/obj/structure/flora/grass/jungle/b,/turf/open/floor/spooktime/cobble/sideS,/area/eventmap/outside)
-"aPs" = (/obj/machinery/light/small{dir = 8},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"aPt" = (/obj/structure/chair/wood/wings,/turf/open/floor/carpet/orange,/area/eventmap/mountaininside)
-"aPu" = (/obj/structure/table/wood/fancy/green,/obj/item/reagent_containers/food/snacks/pizza/pineapple,/turf/open/floor/carpet/orange,/area/eventmap/mountaininside)
-"aPv" = (/obj/machinery/door/airlock/vault{name = "Mecha Battleground"},/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aPw" = (/obj/structure/table/wood/fancy/green,/obj/item/reagent_containers/food/snacks/pizza/margherita,/turf/open/floor/carpet/orange,/area/eventmap/mountaininside)
-"aPx" = (/obj/machinery/light{dir = 8},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aPy" = (/obj/structure/table/wood/fancy/green,/obj/item/reagent_containers/food/snacks/pizza/meat,/turf/open/floor/carpet/orange,/area/eventmap/mountaininside)
-"aPz" = (/obj/structure/table/wood/fancy/green,/obj/item/reagent_containers/food/snacks/pizza/mushroom,/turf/open/floor/carpet/orange,/area/eventmap/mountaininside)
-"aPA" = (/obj/item/skub,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aPB" = (/obj/structure/table/wood/fancy/green,/obj/item/reagent_containers/food/snacks/pizza/sassysage,/turf/open/floor/carpet/orange,/area/eventmap/mountaininside)
-"aPC" = (/obj/structure/table,/obj/machinery/microwave,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aPD" = (/obj/machinery/rnd/production/protolathe/department/science{acted_explosions = "Dumbasses"; allowed_department_flags = 126; name = "department protolathe (Dumb powergamers)"},/obj/machinery/light/floor,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aPE" = (/obj/structure/table/wood/fancy/green,/obj/item/reagent_containers/food/snacks/pizza/vegetable,/turf/open/floor/carpet/orange,/area/eventmap/mountaininside)
-"aPF" = (/obj/vehicle/sealed/vectorcraft/auto,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aPG" = (/obj/structure/table/wood/fancy/green,/obj/effect/spawner/lootdrop/welder_tools,/obj/item/clothing/head/welding,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aPH" = (/obj/effect/spawner/structure/window/reinforced,/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/mountaininside)
-"aPI" = (/obj/structure/spacevine,/turf/open/floor/spooktime/beach,/area/eventmap/outside)
-"aPJ" = (/obj/item/soap/homemade,/turf/open/floor/sepia,/area/eventmap/mountaininside)
-"aPK" = (/obj/item/clothing/neck/petcollar,/turf/open/floor/wood,/area/eventmap/inside)
-"aPL" = (/obj/structure/fluff/broken_flooring,/turf/open/floor/plating,/area/eventmap/mountaininside)
-"aPM" = (/obj/machinery/recycler/lumbermill,/turf/open/floor/plating,/area/eventmap/mountaininside)
-"aPN" = (/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/plating,/area/cargo/miningstorage)
-"aPO" = (/turf/open/floor/plasteel/damturf/platdmg2,/area/eventmap/mountaininside)
-"aPP" = (/obj/machinery/door/airlock/abandoned{name = "Filthy Powergame Shack"},/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aPQ" = (/turf/open/floor/plasteel,/area/cargo/miningstorage)
-"aPR" = (/obj/machinery/light/small{dir = 4; light_color = "#d8b1b1"},/turf/open/floor/plasteel,/area/cargo/miningstorage)
-"aPS" = (/obj/machinery/door/airlock/security,/turf/open/floor/wood,/area/eventmap/inside)
-"aPT" = (/turf/closed/wall,/area/eventmap/mountaininside)
-"aPU" = (/obj/item/clothing/head/hardhat/pumpkinhead/jaqc,/obj/structure/table/wood/fancy/green,/obj/effect/spawner/lootdrop/welder_tools,/turf/open/floor/wood,/area/eventmap/inside)
-"aPV" = (/obj/machinery/light/small/broken{dir = 1},/obj/effect/decal/cleanable/cobweb,/obj/effect/decal/cleanable/glass,/turf/open/floor/mineral/titanium/white{name = "padded floor"},/area/eventmap/inside)
-"aPW" = (/obj/machinery/light/small{dir = 1},/obj/item/reagent_containers/glass/bowl,/obj/item/clothing/neck/petcollar,/turf/open/floor/mineral/titanium/white{name = "padded floor"},/area/eventmap/inside)
-"aPX" = (/obj/item/pet_carrier,/obj/effect/decal/cleanable/semen,/turf/open/floor/mineral/titanium/white,/area/eventmap/inside)
-"aPY" = (/obj/item/reagent_containers/food/drinks/bottle/grappa,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aPZ" = (/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/indestructible/cobble,/area/eventmap/outside)
-"aQa" = (/obj/structure/cable/pink{icon_state = "2-5"},/turf/open/floor/plating,/area/eventmap/mountain)
-"aQb" = (/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/cable/yellow{icon_state = "2-4"},/obj/structure/cable/yellow{icon_state = "2-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aQc" = (/obj/machinery/light/small{dir = 1},/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aQd" = (/obj/item/lighter/gold,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aQe" = (/turf/open/floor/carpet/green,/area/eventmap/mountaininside)
-"aQf" = (/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood/damturf/broken2,/area/eventmap/inside)
-"aQg" = (/obj/structure/bookcase/manuals/research_and_development,/turf/closed/wall/mineral/wood,/area/eventmap/mountaininside)
-"aQh" = (/obj/item/toy/fluff/tennis_poly/red,/turf/open/floor/mineral/titanium/white,/area/eventmap/inside)
-"aQi" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/structure/noticeboard{pixel_y = 32},/obj/item/paper/fluff/balls/spookyasylum/cell03,/turf/open/floor/carpet/royalblack,/area/eventmap/inside)
-"aQj" = (/obj/effect/decal/cleanable/cobweb{icon_state = "cobweb2"},/obj/structure/noticeboard{pixel_y = 32},/obj/item/paper/fluff/balls/spookyasylum/cell04,/turf/open/floor/wood,/area/eventmap/inside)
-"aQk" = (/obj/structure/cable/pink{icon_state = "1-10"},/turf/open/floor/plating,/area/eventmap/mountain)
-"aQl" = (/obj/item/flashlight/lantern{anchored = 1; can_be_unanchored = 1; light_color = "#EE9933"; light_range = 5; on = 1},/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aQm" = (/obj/structure/table/wood/fancy/orange,/obj/item/reagent_containers/rag/towel,/turf/open/floor/wood,/area/eventmap/inside)
-"aQn" = (/obj/structure/table/wood/fancy,/obj/item/reagent_containers/food/snacks/donut/bungo,/turf/open/floor/wood,/area/eventmap/inside)
-"aQo" = (/obj/structure/table/wood/fancy,/obj/item/reagent_containers/food/snacks/donut/glaze,/turf/open/floor/wood,/area/eventmap/inside)
-"aQp" = (/obj/structure/table/wood/fancy,/obj/item/reagent_containers/food/snacks/donut/matcha,/turf/open/floor/carpet,/area/eventmap/inside)
-"aQq" = (/obj/effect/decal/cleanable/dirt,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aQr" = (/obj/structure/table/wood/fancy,/obj/item/reagent_containers/food/snacks/donut/apple,/turf/open/floor/wood,/area/eventmap/inside)
-"aQs" = (/obj/structure/bed,/obj/item/bedsheet/purple,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aQt" = (/obj/structure/table/wood/fancy,/obj/item/reagent_containers/food/snacks/donut/laugh,/turf/open/floor/carpet,/area/eventmap/inside)
-"aQu" = (/obj/structure/chair{dir = 8},/turf/open/floor/carpet,/area/eventmap/inside)
-"aQv" = (/obj/structure/cable/pink{icon_state = "2-9"},/turf/open/floor/plating,/area/eventmap/mountain)
-"aQw" = (/obj/structure/table/wood/fancy,/obj/item/reagent_containers/food/snacks/donut/jelly/berry,/turf/open/floor/wood,/area/eventmap/inside)
-"aQx" = (/obj/structure/table/wood,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aQy" = (/obj/structure/table/wood/fancy,/obj/item/reagent_containers/food/snacks/donut/caramel,/turf/open/floor/carpet,/area/eventmap/inside)
-"aQz" = (/obj/item/reagent_containers/food/snacks/roastparsnip,/obj/structure/table/reinforced,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aQA" = (/obj/structure/table/wood/fancy,/obj/item/reagent_containers/food/snacks/donut/laugh,/obj/item/reagent_containers/food/snacks/donut/laugh,/turf/open/floor/wood,/area/eventmap/inside)
-"aQB" = (/obj/structure/table/wood/fancy,/obj/item/reagent_containers/food/snacks/donut/laugh,/turf/open/floor/wood,/area/eventmap/inside)
-"aQC" = (/obj/machinery/light/small{dir = 4},/turf/open/floor/plasteel,/area/eventmap/inside)
-"aQD" = (/obj/item/barthpot{active = 0; BallTutorial = 1; light_range = 5},/turf/open/floor/spooktime/cobble/roadsideS,/area/eventmap/outside)
-"aQF" = (/obj/machinery/washing_machine,/turf/open/floor/plasteel/showroomfloor,/area/eventmap/mountaininside)
-"aQG" = (/obj/structure/sink{dir = 8; pixel_x = -12},/obj/structure/mirror{pixel_x = -28},/turf/open/floor/plasteel/showroomfloor,/area/eventmap/mountaininside)
-"aQI" = (/obj/structure/bookcase/random/adult,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aQK" = (/turf/open/floor/spooktime/beach,/area/eventmap/outside)
-"aQL" = (/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/carpet/purple,/area/eventmap/inside)
-"aQM" = (/obj/effect/landmark/start/clown,/turf/open/floor/wood,/area/eventmap/inside)
-"aQN" = (/obj/machinery/door/firedoor,/turf/open/floor/wood,/area/eventmap/inside)
-"aQO" = (/obj/structure/table/wood/bar,/turf/open/floor/wood,/area/eventmap/inside)
-"aQP" = (/obj/structure/table/plasmaglass,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aQQ" = (/obj/effect/spawner/structure/window/reinforced,/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aQR" = (/obj/structure/table/wood/bar,/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"aQS" = (/obj/structure/table,/obj/item/reagent_containers/food/drinks/bottle/tequila,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aQT" = (/obj/effect/landmark/start/clown,/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"aQU" = (/obj/structure/table,/obj/machinery/light{dir = 1},/obj/item/book/manual/wiki/barman_recipes,/obj/item/book/granter/action/drink_fling,/obj/item/reagent_containers/food/drinks/shaker,/obj/item/reagent_containers/rag,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aQV" = (/obj/structure/dresser,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aQW" = (/obj/item/reagent_containers/food/snacks/khinkali,/obj/structure/table/reinforced,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aQX" = (/obj/structure/table,/obj/item/reagent_containers/food/drinks/bottle/champagne,/obj/machinery/button/door/dorms/luxury3{id = "C08"; pixel_y = -24},/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aQY" = (/obj/machinery/washing_machine,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aQZ" = (/obj/structure/chair/wood/normal,/turf/open/floor/carpet/purple,/area/eventmap/inside)
-"aRa" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aRb" = (/obj/structure/cable/yellow{icon_state = "0-4"},/obj/structure/chair/wood/normal{dir = 4},/turf/open/floor/wood,/area/eventmap/inside)
-"aRc" = (/obj/item/reagent_containers/food/drinks/bottle/absinthe,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aRd" = (/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"aRe" = (/obj/item/restraints/handcuffs,/turf/open/floor/carpet/red,/area/eventmap/mountaininside)
-"aRf" = (/obj/structure/chair/wood/normal{dir = 4},/turf/open/floor/carpet/purple,/area/eventmap/inside)
-"aRg" = (/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/spooktime/cobble/sideE,/area/eventmap/outside)
-"aRh" = (/obj/structure/table/wood/poker,/obj/item/toy/cards/deck/cas/black{pixel_x = 4},/obj/item/toy/cards/deck/cas{pixel_x = -4},/obj/item/toy/cards/deck{pixel_y = 4},/obj/machinery/light/small,/turf/open/floor/carpet/purple,/area/eventmap/inside)
-"aRi" = (/obj/structure/fluff/broken_flooring,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aRj" = (/obj/structure/chair/wood/normal{dir = 8},/turf/open/floor/carpet/purple,/area/eventmap/inside)
-"aRk" = (/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/spooktime/cobble/sideW,/area/eventmap/outside)
-"aRl" = (/obj/structure/chair/wood/normal{dir = 8},/turf/open/floor/wood,/area/eventmap/inside)
-"aRm" = (/turf/open/floor/plasteel/damturf/damage5,/area/eventmap/mountaininside)
-"aRn" = (/obj/effect/spawner/structure/window/reinforced,/turf/open/floor/plating,/area/eventmap/inside)
-"aRo" = (/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"aRp" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/structure/curtain{color = "#B22222"; pixel_x = 32},/turf/open/floor/wood,/area/eventmap/inside)
-"aRq" = (/obj/machinery/light/small{dir = 4},/turf/open/floor/plasteel/showroomfloor,/area/eventmap/mountaininside)
-"aRr" = (/obj/structure/flora/grass/jungle/b,/turf/open/floor/spooktime/cobble/sideN,/area/eventmap/outside)
-"aRs" = (/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"aRt" = (/obj/effect/landmark/start/janitor,/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"aRu" = (/obj/structure/cable/yellow{icon_state = "1-2"},/obj/effect/landmark/start/scientist,/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"aRv" = (/obj/structure/flora/junglebush,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aRw" = (/obj/machinery/door/airlock/wood,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aRy" = (/obj/item/stack/sheet/metal/fifty,/turf/open/floor/spooktime/beach,/area/eventmap/outside)
-"aRz" = (/obj/machinery/door/airlock/survival_pod,/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{id = "C08"},/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aRB" = (/turf/open/floor/plating,/area/eventmap/mountaininside)
-"aRC" = (/obj/effect/decal/remains/human,/obj/effect/rune/apocalypse,/obj/effect/decal/cleanable/blood/splatter,/obj/item/toy/plush/catgirl/fermis{step_x = 0; step_y = 0},/turf/open/floor/wood,/area/eventmap/inside)
-"aRD" = (/obj/effect/landmark/start/janitor,/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/cable/yellow{icon_state = "1-8"},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"aRE" = (/obj/item/reagent_containers/food/drinks/trophy/gold_cup,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aRF" = (/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/spooktime/cobble/sideE,/area/eventmap/outside)
-"aRG" = (/turf/closed/wall/mineral/iron,/area/eventmap/mountain)
-"aRJ" = (/obj/effect/decal/cleanable/cobweb,/turf/open/floor/spooktime/cobble/sideW{icon_state = "cobble_side_n"},/area/eventmap/outside)
-"aRL" = (/obj/item/stack/sheet/metal/fifty,/turf/open/floor/spooktime/beach/coasts/coastNE,/area/eventmap/outside)
-"aRM" = (/obj/machinery/light/small{dir = 1},/turf/open/floor/spooktime/cobble/sideW{icon_state = "cobble_side_n"},/area/eventmap/outside)
-"aRN" = (/obj/item/flashlight/flare/torch,/obj/item/flashlight/flare/torch,/obj/machinery/light/floor{CanAtmosPass = 0; alpha = 0},/obj/item/umbrella,/obj/item/pickaxe/mini,/obj/item/shovel,/obj/item/hatchet,/obj/item/storage/box/matches,/obj/item/storage/fancy/candle_box,/turf/open/floor/wood,/area/eventmap/inside)
-"aRO" = (/obj/structure/cable/pink{icon_state = "4-10"},/turf/open/floor/plating,/area/eventmap/mountain)
-"aRP" = (/turf/open/floor/wood/damturf/broken2,/area/eventmap/inside)
-"aRQ" = (/obj/machinery/computer/rdconsole/core,/obj/machinery/light/floor,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aRS" = (/turf/open/floor/plasteel/damturf/damage4,/area/eventmap/mountaininside)
-"aRT" = (/obj/item/flashlight/lantern{anchored = 1; can_be_unanchored = 1; light_color = "#EE9933"; light_range = 5; on = 1},/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aRU" = (/obj/item/flashlight/lantern{anchored = 1; can_be_unanchored = 1; light_color = "#EE9933"; light_range = 5; on = 1},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/mountain)
-"aRV" = (/turf/open/floor/spooktime/beach/coasts/watercoastS,/area/eventmap/outside)
-"aRW" = (/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/mountain)
-"aRX" = (/obj/structure/closet/cabinet,/turf/open/floor/wood,/area/eventmap/inside)
-"aSb" = (/obj/item/scythe,/turf/open/floor/wood,/area/eventmap/inside)
-"aSe" = (/obj/effect/decal/cleanable/dirt,/obj/machinery/vending/clothing,/turf/open/floor/wood,/area/eventmap/inside)
-"aSg" = (/obj/effect/decal/cleanable/dirt,/obj/item/chair/stool,/turf/open/floor/plating,/area/eventmap/mountaininside)
-"aSi" = (/obj/structure/closet{name = "Official Clothing"},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aSj" = (/obj/item/chair/stool,/turf/open/floor/wood,/area/eventmap/inside)
-"aSk" = (/obj/structure/cable/yellow{icon_state = "1-8"},/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"aSl" = (/obj/structure/bonfire,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aSn" = (/obj/machinery/nanite_program_hub,/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aSo" = (/turf/open/floor/plating,/area/eventmap/outside)
-"aSq" = (/obj/machinery/autolathe/hacked,/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aSt" = (/obj/item/storage/pill_bottle/zoom,/turf/open/floor/plasteel/damturf/scorched1,/area/eventmap/mountaininside)
-"aSF" = (/obj/structure/curtain{color = "#B22222"; pixel_x = -32},/turf/open/floor/wood/damturf/broken5,/area/eventmap/inside)
-"aSH" = (/obj/machinery/button/door/dorms/luxury3{id = "C01"; pixel_x = -8},/turf/open/floor/wood,/area/eventmap/inside)
-"aSK" = (/obj/item/storage/daki,/turf/open/floor/plasteel/damturf/scorched2,/area/eventmap/mountaininside)
-"aSL" = (/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"aSM" = (/obj/effect/landmark/start/janitor,/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"aSN" = (/obj/structure/bonfire,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aSO" = (/obj/effect/landmark/start/station_engineer,/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"aSP" = (/obj/machinery/light{dir = 8},/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aSQ" = (/obj/effect/landmark/start/assistant,/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"aSR" = (/obj/item/flashlight/flare,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aSS" = (/obj/effect/landmark/start,/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"aST" = (/obj/effect/landmark/start/cyborg,/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"aSU" = (/obj/machinery/rnd/production/protolathe/department/science{acted_explosions = "Dumbasses"; allowed_department_flags = 126; name = "department protolathe (Dumb powergamers)"},/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aSV" = (/obj/structure/table/reinforced,/turf/open/floor/plating,/area/eventmap/mountaininside)
-"aSW" = (/obj/item/a_gift/anything,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aTc" = (/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/cable/yellow{icon_state = "1-8"},/obj/structure/cable/yellow{icon_state = "1-4"},/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"aTe" = (/obj/structure/mirror{pixel_x = 28},/turf/open/floor/sepia,/area/eventmap/mountaininside)
-"aTi" = (/obj/structure/chair/sofa/left,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aTj" = (/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/cable/yellow{icon_state = "2-4"},/turf/open/floor/wood,/area/eventmap/inside)
-"aTm" = (/obj/structure/sink/puddle,/turf/open/floor/spooktime/beach,/area/eventmap/outside)
-"aTn" = (/obj/item/integrated_circuit_printer,/obj/structure/table/plasmaglass,/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aTp" = (/obj/effect/decal/cleanable/cobweb,/obj/machinery/vending/kink,/turf/open/floor/wood,/area/eventmap/inside)
-"aTu" = (/obj/item/reagent_containers/food/drinks/bottle/champagne,/turf/open/floor/wood,/area/eventmap/inside)
-"aTv" = (/obj/structure/trap/ctf/nomech,/turf/open/floor/spooktime/cobble/cornerSE,/area/eventmap/outside)
-"aTw" = (/turf/open/floor/spooktime/beach/water,/area/eventmap/outside)
-"aTx" = (/obj/item/fugu_gland,/turf/open/floor/spooktime/beach/coasts/coastN,/area/eventmap/outside)
-"aTA" = (/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/cable/yellow{icon_state = "2-8"},/obj/structure/cable/yellow{icon_state = "1-8"},/turf/open/floor/carpet,/area/eventmap/inside)
-"aTC" = (/turf/closed/wall/r_wall/rust,/area/eventmap/mountain)
-"aTD" = (/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/cable/yellow{icon_state = "1-8"},/obj/structure/cable/yellow{icon_state = "1-4"},/obj/structure/sign/directions/security{dir = 8; icon_state = "direction_sec"; pixel_x = -32; pixel_y = 24},/turf/open/floor/carpet,/area/eventmap/inside)
-"aTE" = (/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/sign/directions/medical{dir = 4; pixel_x = 32; pixel_y = 24},/turf/open/floor/carpet,/area/eventmap/inside)
-"aTG" = (/obj/structure/flora/grass/jungle/b,/obj/structure/flora/tree/jungle,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"aTH" = (/obj/machinery/light/small,/turf/open/floor/plasteel/showroomfloor,/area/eventmap/mountaininside)
-"aTJ" = (/obj/structure/closet,/obj/item/clothing/suit/hooded/wintercoat/miner,/obj/item/clothing/shoes/sneakers/brown,/obj/item/clothing/under/pants/classicjeans,/obj/item/clothing/neck/scarf,/obj/item/clothing/neck/stripedgreenscarf,/obj/item/toy/fluff/tennis_poly/tri/squeak/rainbow,/obj/item/toy/fluff/tennis_poly,/obj/item/clothing/suit/hooded/wintercoat/miner,/obj/item/clothing/shoes/sneakers/brown,/obj/item/clothing/under/pants/classicjeans,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aTL" = (/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aTM" = (/obj/item/soap/syndie,/turf/open/floor/sepia,/area/eventmap/mountaininside)
-"aTN" = (/obj/item/storage/firstaid/tactical,/turf/open/floor/plasteel/damturf/platdmg1,/area/eventmap/mountaininside)
-"aTO" = (/obj/item/stack/sheet/metal/fifty,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aTP" = (/obj/structure/mineral_door/wood,/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/disposalpipe/segment,/turf/open/floor/plasteel/stairs,/area/eventmap/mountaininside)
-"aTQ" = (/obj/structure/flora/junglebush{icon_state = "busha1"},/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aTR" = (/obj/machinery/light/floor,/obj/machinery/telecomms/message_server,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aTS" = (/obj/structure/sign/departments/restroom{pixel_y = 32},/turf/open/floor/wood,/area/eventmap/inside)
-"aTT" = (/obj/structure/sign/barsign,/turf/closed/wall/mineral/wood,/area/eventmap/mountaininside)
-"aTU" = (/obj/machinery/power/port_gen/pacman/mrs,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aTV" = (/obj/machinery/computer/mech_bay_power_console{dir = 1},/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aTX" = (/turf/open/floor/plasteel/damturf/scorched1,/area/eventmap/mountaininside)
-"aTY" = (/obj/structure/cable/white{icon_state = "4-8"},/obj/structure/cable/yellow{icon_state = "2-4"},/turf/open/indestructible/cobble,/area/eventmap/outside)
-"aUe" = (/obj/item/flashlight/seclite,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aUf" = (/obj/structure/flora/ausbushes/lavendergrass,/obj/structure/flora/tree/spookytimexl,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aUi" = (/obj/item/storage/pill_bottle/zoom,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aUj" = (/obj/machinery/light/small{dir = 1},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aUl" = (/obj/structure/table,/obj/item/clothing/mask/gas,/obj/machinery/light/small{dir = 1},/obj/item/clothing/glasses/sunglasses/big,/obj/item/clothing/glasses/sunglasses/big,/obj/item/clothing/glasses/sunglasses/big,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aUn" = (/obj/structure/cable/pink{icon_state = "5-10"},/turf/open/floor/plating,/area/eventmap/mountain)
-"aUo" = (/obj/machinery/light/floor,/obj/machinery/telecomms/processor{freq_listening = list(1359,1441)},/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aUr" = (/turf/open/floor/plasteel/damturf/platdmg1,/area/eventmap/mountaininside)
-"aUt" = (/obj/item/stack/sheet/mineral/bananium,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aUu" = (/obj/item/storage/firstaid/ancient,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aUx" = (/obj/structure/chair/wood/wings{dir = 8},/turf/open/floor/carpet/royalblack,/area/eventmap/mountain)
-"aUy" = (/turf/open/floor/spooktime/beach/watersolid,/area/eventmap/outside)
-"aUz" = (/obj/structure/flora/grass/jungle/b{icon_state = "grassa1"},/turf/open/floor/spooktime/dirtpatch,/area/eventmap/outside)
-"aUD" = (/obj/structure/table,/obj/item/reagent_containers/food/drinks/bottle/kahlua,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aUE" = (/obj/item/reagent_containers/food/drinks/bottle/rum,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aUK" = (/turf/open/floor/plasteel/damturf/scorched,/area/eventmap/mountaininside)
-"aUL" = (/obj/structure/spacevine,/obj/structure/spacevine,/turf/open/floor/spooktime/beach/watersolid,/area/eventmap/mountain)
-"aUM" = (/obj/item/storage/pill_bottle/lsd,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aUP" = (/obj/structure/cable/white{icon_state = "2-8"},/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"aUQ" = (/obj/structure/cable/yellow{icon_state = "1-4"},/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"aUW" = (/obj/machinery/light/floor{alpha = 0; light_range = 20; max_integrity = 9999; mouse_opacity = 0},/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aUX" = (/obj/machinery/button/door/dorms/luxury3{id = "C05"; pixel_y = -24},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aUY" = (/obj/structure/trap/ctf/nomech,/turf/closed/mineral/ash_rock,/area/eventmap/outside)
-"aVd" = (/obj/structure/fluff/bus/passable{icon_state = "topdoor"},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"aVe" = (/obj/structure/sign/departments/botany{pixel_x = -32},/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/cable/yellow{icon_state = "2-4"},/turf/open/floor/carpet,/area/eventmap/inside)
-"aVf" = (/obj/machinery/vending/kink,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aVh" = (/turf/open/floor/wood/damturf/broken4,/area/eventmap/inside)
-"aVi" = (/obj/effect/spawner/structure/window/reinforced,/turf/open/floor/clockwork/reebe,/area/eventmap/inside)
-"aVj" = (/obj/item/coin/diamond,/obj/item/stack/sheet/mineral/adamantine,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aVk" = (/obj/structure/chair/stool,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aVm" = (/obj/item/reagent_containers/food/drinks/bottle/fernet,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aVn" = (/obj/machinery/light/small,/obj/structure/closet/crate/bin,/turf/open/floor/wood,/area/eventmap/inside)
-"aVo" = (/obj/structure/dresser,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aVq" = (/obj/item/gun/ballistic/shotgun/lethal,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aVr" = (/obj/structure/table/wood,/obj/item/reagent_containers/food/snacks/beans,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aVt" = (/obj/structure/flora/ausbushes/sparsegrass,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aVu" = (/obj/item/ammo_box/magazine/wt550m9/wtrubber,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aVv" = (/obj/structure/table,/obj/structure/table,/obj/item/reagent_containers/food/drinks/bottle/cognac,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aVy" = (/obj/item/lighter/greyscale,/turf/open/floor/wood,/area/eventmap/inside)
-"aVz" = (/obj/item/gun/ballistic/automatic/wt550,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aVC" = (/obj/item/storage/box/handcuffs,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aVD" = (/turf/open/floor/wood/damturf/broken1,/area/eventmap/mountaininside)
-"aVE" = (/obj/item/pizzabox/meat,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aVG" = (/turf/open/floor/spooktime/beach/watersolid,/area/eventmap/mountain)
-"aVJ" = (/turf/open/floor/wood/damturf/broken5,/area/eventmap/inside)
-"aVR" = (/obj/machinery/light{dir = 1},/turf/open/floor/plasteel/showroomfloor,/area/eventmap/mountaininside)
-"aVS" = (/obj/item/stack/sheet/bluespace_crystal,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aVW" = (/obj/machinery/light/small,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aVY" = (/obj/structure/spacevine,/turf/open/floor/spooktime/beach/coasts/coastE,/area/eventmap/outside)
-"aVZ" = (/obj/structure/bookcase/manuals/engineering,/turf/closed/wall/mineral/wood,/area/eventmap/mountaininside)
-"aWd" = (/turf/open/floor/spooktime/beach/coasts/coastNW,/area/eventmap/outside)
-"aWf" = (/obj/structure/spacevine,/turf/open/floor/spooktime/beach/water,/area/eventmap/outside)
-"aWi" = (/obj/item/reagent_containers/food/snacks/nachos,/obj/structure/table/reinforced,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aWj" = (/obj/structure/bed,/obj/item/bedsheet/black,/turf/open/floor/carpet/green,/area/eventmap/mountaininside)
-"aWk" = (/obj/item/clothing/head/squatter_hat,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aWl" = (/obj/structure/rack,/obj/item/gun/magic/staff/healing,/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aWo" = (/obj/structure/bed,/obj/item/bedsheet/syndie,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aWq" = (/obj/structure/curtain{color = "#B22222"; pixel_y = -32},/turf/open/floor/wood,/area/eventmap/inside)
-"aWs" = (/obj/structure/flora/tree/jungle,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aWt" = (/obj/structure/spacevine,/turf/open/floor/spooktime/beach/coasts/coastN,/area/eventmap/outside)
-"aWv" = (/obj/effect/turf_decal/stripes/line,/turf/open/floor/plasteel,/area/eventmap/mountain)
-"aWy" = (/obj/machinery/light/small{dir = 8},/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aWz" = (/obj/item/reagent_containers/pill/lsd,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aWA" = (/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"aWJ" = (/obj/structure/bed,/obj/item/bedsheet/hos,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aWK" = (/obj/machinery/light/floor,/obj/machinery/telecomms/bus{freq_listening = list(1459,1441)},/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aWL" = (/obj/structure/closet/gimmick/russian,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aWN" = (/obj/structure/table/plasmaglass,/obj/item/multitool,/obj/item/multitool,/obj/item/multitool,/obj/item/multitool,/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aWO" = (/obj/machinery/shower{dir = 8; pixel_y = -4},/obj/effect/turf_decal/bot_red,/obj/effect/turf_decal/bot,/turf/open/floor/sepia,/area/eventmap/mountaininside)
-"aWQ" = (/obj/item/stack/sheet/metal/fifty,/turf/open/floor/spooktime/beach/coasts/coastE,/area/eventmap/outside)
-"aWR" = (/obj/item/flashlight/seclite,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aWS" = (/turf/open/floor/carpet,/area/eventmap/mountaininside)
-"aWU" = (/obj/item/flashlight/glowstick/pink,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aWX" = (/obj/structure/closet/crate,/obj/item/clothing/head/pirate,/obj/item/clothing/head/santa,/obj/item/clothing/head/magus,/obj/item/clothing/head/mailman,/obj/item/clothing/head/griffin,/obj/item/clothing/head/bearpelt,/obj/item/clothing/head/beret,/obj/item/clothing/head/fedora,/turf/open/floor/wood,/area/eventmap/inside)
-"aWY" = (/obj/item/stack/sheet/mineral/bananium,/obj/item/stack/sheet/mineral/bananium,/obj/item/stack/sheet/mineral/bananium,/obj/item/stack/sheet/mineral/bananium,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aWZ" = (/turf/open/floor/spooktime/beach/coasts/innerS,/area/eventmap/outside)
-"aXa" = (/obj/machinery/light/floor,/obj/machinery/telecomms/receiver,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aXh" = (/obj/machinery/computer/upload/ai,/obj/machinery/light/floor,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aXj" = (/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/cable/white{icon_state = "2-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"aXn" = (/obj/effect/turf_decal/stripes/line{dir = 4},/turf/open/floor/plasteel,/area/eventmap/mountain)
-"aXo" = (/obj/item/toy/plush/borgplushie{pixel_w = -6; pixel_x = -3; pixel_y = -4},/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aXq" = (/obj/machinery/light/floor{alpha = 0; light_range = 20; mouse_opacity = 0},/turf/closed/indestructible/riveted/boss,/area/eventmap/mountaininside)
-"aXs" = (/obj/effect/spawner/structure/window/plasma/reinforced,/turf/open/indestructible/airblock,/area/eventmap/mountaininside)
-"aXv" = (/obj/structure/bookcase/random/adult,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aXw" = (/obj/machinery/door/airlock/vault,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aXy" = (/obj/item/flashlight/lantern{anchored = 1; can_be_unanchored = 1; light_color = "#EE9933"; light_range = 5; on = 1},/turf/open/floor/spooktime/dirtpatch,/area/eventmap/outside)
-"aXz" = (/obj/machinery/vending/assist,/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aXE" = (/obj/item/reagent_containers/food/drinks/bottle/tequila,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aXF" = (/obj/machinery/light{dir = 1},/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aXI" = (/obj/item/storage/pill_bottle/penis_enlargement,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aXJ" = (/obj/item/stack/sheet/mineral/sandstone,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aXK" = (/obj/item/reagent_containers/food/drinks/bottle/champagne,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aXM" = (/obj/structure/curtain{color = "#B22222"; pixel_x = -32},/turf/open/floor/wood,/area/eventmap/inside)
-"aXO" = (/obj/structure/table/plasmaglass,/obj/machinery/chem_dispenser/drinks/beer/fullupgrade{dir = 8},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aXP" = (/obj/structure/girder,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aXQ" = (/obj/item/flashlight/lantern,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aXR" = (/obj/machinery/vending/coffee,/obj/machinery/light/small{brightness = 3; dir = 8},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aXS" = (/turf/open/floor/spooktime/beach/coasts/coastS,/area/eventmap/outside)
-"aXU" = (/obj/structure/mirror{pixel_x = 28},/obj/effect/turf_decal/bot,/obj/machinery/shower{dir = 8; pixel_y = -4},/turf/open/floor/plasteel/showroomfloor,/area/eventmap/mountaininside)
-"aXX" = (/obj/structure/mineral_door/wood,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/inside)
-"aXZ" = (/obj/item/paicard,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aYa" = (/turf/open/floor/spooktime/beach/coasts/watercoastN,/area/eventmap/outside)
-"aYb" = (/obj/item/chair,/turf/open/floor/plasteel/damturf/scorched2,/area/eventmap/mountaininside)
-"aYd" = (/obj/machinery/light/small{dir = 8},/turf/open/floor/plasteel/showroomfloor,/area/eventmap/mountaininside)
-"aYf" = (/obj/item/reagent_containers/food/drinks/bottle/cream,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aYh" = (/obj/item/reagent_containers/food/snacks/sashimi,/obj/structure/table/reinforced,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aYi" = (/obj/structure/table/wood,/obj/item/flashlight/lamp,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aYp" = (/obj/structure/chair/sofa/left,/obj/item/flashlight/seclite,/turf/open/floor/carpet/red,/area/eventmap/mountaininside)
-"aYr" = (/obj/structure/chair/sofa,/turf/open/floor/carpet/red,/area/eventmap/mountaininside)
-"aYs" = (/obj/structure/table,/obj/item/reagent_containers/food/drinks/bottle/trappist,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aYw" = (/obj/item/restraints/handcuffs,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aYy" = (/turf/open/floor/plasteel/showroomfloor,/area/eventmap/mountaininside)
-"aYz" = (/obj/item/restraints/handcuffs,/turf/open/floor/plasteel/damturf/scorched2,/area/eventmap/mountaininside)
-"aYA" = (/obj/structure/table,/obj/item/lighter/greyscale,/turf/open/floor/wood,/area/eventmap/inside)
-"aYG" = (/obj/structure/spacevine,/obj/structure/spacevine,/obj/structure/spacevine,/obj/structure/spacevine,/obj/structure/spacevine,/obj/structure/spacevine,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aYH" = (/obj/item/reagent_containers/food/drinks/bottle/sake,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aYI" = (/obj/structure/flora/tree/spookytime,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aYJ" = (/obj/item/coin/diamond,/obj/item/stack/sheet/mineral/mythril,/turf/open/floor/plasteel/dark,/area/eventmap/mountaininside)
-"aYM" = (/obj/effect/decal/cleanable/dirt,/turf/open/floor/plasteel/damturf/scorched1,/area/eventmap/mountaininside)
-"aYO" = (/obj/item/stack/sheet/mineral/sandstone/thirty,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aYQ" = (/turf/open/floor/spooktime/beach/coasts/watercoastSW,/area/eventmap/outside)
-"aYT" = (/obj/structure/mineral_door/wood,/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{id = "C11"},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aYU" = (/obj/item/storage/fancy/cigarettes/cigpack_mindbreaker,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aYV" = (/obj/structure/table/wood,/obj/item/reagent_containers/food/drinks/bottle/tequila,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aYW" = (/obj/machinery/door/airlock/wood/glass,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aYY" = (/obj/item/reagent_containers/food/drinks/bottle/trappist,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aZa" = (/obj/structure/chair/comfy{dir = 1},/turf/open/floor/wood,/area/eventmap/inside)
-"aZb" = (/obj/item/reagent_containers/food/snacks/powercrepe,/obj/structure/table/reinforced,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aZg" = (/obj/machinery/light/small{dir = 4},/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aZi" = (/obj/machinery/light{dir = 4},/obj/structure/table/plasmaglass,/obj/machinery/chem_dispenser/drinks/fullupgrade{dir = 8},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aZj" = (/obj/structure/chair/comfy/brown{dir = 4},/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aZk" = (/obj/machinery/light/small{dir = 1},/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountaininside)
-"aZm" = (/obj/item/reagent_containers/food/snacks/scotchegg,/obj/structure/table/reinforced,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aZo" = (/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/spooktime/cobble/sideN,/area/eventmap/outside)
-"aZr" = (/obj/machinery/light/floor{alpha = 0; light_range = 20; max_integrity = 9999; mouse_opacity = 0},/turf/open/indestructible/airblock,/area/eventmap/mountaininside)
-"aZt" = (/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aZv" = (/obj/structure/bed,/obj/item/bedsheet/blue,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aZx" = (/obj/machinery/light/floor{alpha = 0; light_range = 20; mouse_opacity = 0},/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"aZz" = (/obj/item/reagent_containers/food/drinks/bottle/wine,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aZA" = (/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aZB" = (/obj/structure/bonfire,/turf/open/floor/wood,/area/eventmap/inside)
-"aZC" = (/obj/item/flashlight,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aZE" = (/obj/structure/bed/dogbed,/turf/open/floor/wood,/area/eventmap/mountaininside)
-"aZH" = (/obj/structure/sign/directions/security{dir = 1; pixel_x = 0; pixel_y = 0},/obj/structure/sign/directions/command{dir = 1; icon_state = "direction_bridge"; pixel_y = 8},/obj/structure/sign/directions/supply{dir = 1; icon_state = "direction_supply"; pixel_y = -8},/turf/closed/wall/mineral/wood,/area/eventmap/inside)
-"aZI" = (/obj/item/lighter,/turf/open/floor/carpet/green,/area/eventmap/mountaininside)
-"aZJ" = (/obj/item/lipstick/random,/turf/open/floor/plasteel,/area/eventmap/mountaininside)
-"aZK" = (/obj/structure/sign/directions/science{dir = 4; pixel_x = 0; pixel_y = 0},/obj/structure/sign/directions/engineering{pixel_y = -8},/obj/structure/sign/directions/medical{dir = 1; icon_state = "direction_med"; pixel_y = 8},/turf/closed/wall/mineral/wood,/area/eventmap/inside)
-"aZL" = (/obj/structure/cable/pink{icon_state = "1-6"},/turf/open/floor/plating,/area/eventmap/mountain)
-"aZM" = (/obj/structure/flora/bush,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"aZN" = (/obj/structure/fluff/broken_flooring,/obj/effect/decal/cleanable/dirt,/turf/open/floor/plating,/area/eventmap/mountaininside)
-"aZP" = (/obj/structure/trap/ctf/nomech,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/outside)
-"aZQ" = (/obj/structure/mineral_door/wood,/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{id = "C01"},/turf/open/floor/wood,/area/eventmap/inside)
-"aZS" = (/obj/structure/spacevine,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"aZU" = (/obj/machinery/vending/coffee,/turf/open/floor/wood{icon_state = "wood-broken3"},/area/eventmap/inside)
-"aZW" = (/obj/machinery/mech_bay_recharge_port,/obj/machinery/light/floor{alpha = 0; light_range = 20; max_integrity = 9999; mouse_opacity = 0},/turf/open/floor/circuit/off,/area/eventmap/mountaininside)
-"baa" = (/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/cable/white{icon_state = "1-4"},/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"baX" = (/obj/structure/cable/yellow{icon_state = "1-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"bbi" = (/obj/effect/turf_decal/caution/stand_clear{dir = 8; icon_state = "stand_clear"; pixel_x = -8},/obj/docking_port/stationary{dir = 4; dwidth = 8; height = 7; id = "supply_home"; name = "Cargo Bay"; width = 20},/turf/open/floor/plasteel,/area/eventmap/outside)
-"bbt" = (/obj/structure/fence/corner{icon_state = "corner"; dir = 4},/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"bbv" = (/obj/structure/fence{icon_state = "straight"; dir = 8},/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"bbx" = (/turf/open/floor/plasteel,/area/eventmap/outside)
-"bby" = (/obj/effect/turf_decal/caution/stand_clear{dir = 1; icon_state = "stand_clear"; pixel_y = 8},/turf/open/floor/plasteel,/area/eventmap/outside)
-"bbD" = (/obj/effect/turf_decal/caution/stand_clear{dir = 8; icon_state = "stand_clear"; pixel_x = -8},/turf/open/floor/plasteel,/area/eventmap/outside)
-"bbE" = (/obj/effect/turf_decal/caution/stand_clear{dir = 4; icon_state = "stand_clear"; pixel_x = 8},/turf/open/floor/plasteel,/area/eventmap/outside)
-"bbG" = (/obj/structure/sign/mining{pixel_x = 32},/turf/open/floor/spooktime/dirtpatch,/area/eventmap/outside)
-"bbI" = (/obj/effect/turf_decal/caution/stand_clear{pixel_y = -8},/turf/open/floor/plasteel,/area/eventmap/outside)
-"bbJ" = (/obj/structure/fence/corner{icon_state = "corner"; dir = 1},/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"bbK" = (/obj/structure/fence/corner,/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"bbL" = (/obj/structure/fence{icon_state = "straight"; dir = 8},/turf/open/floor/spooktime/cobble/sideS,/area/eventmap/outside)
-"bbM" = (/obj/structure/fence/corner{icon_state = "corner"; dir = 4},/turf/open/floor/spooktime/cobble/sideS,/area/eventmap/outside)
-"bbP" = (/obj/structure/fence/corner{icon_state = "corner"; dir = 9},/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"bbZ" = (/obj/structure/cable/white{icon_state = "1-4"},/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"bcb" = (/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/spooktime/cobble/sideS,/area/eventmap/outside)
-"bcd" = (/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"bce" = (/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 4},/obj/structure/cable/white{icon_state = "1-4"},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"bci" = (/obj/structure/cable/white{icon_state = "1-2"},/turf/open/indestructible/cobble,/area/eventmap/outside)
-"bck" = (/obj/structure/cable/white{icon_state = "4-8"},/turf/open/indestructible/cobble,/area/eventmap/outside)
-"bcn" = (/turf/open/floor/plating,/area/eventmap/mountain)
-"bco" = (/obj/effect/turf_decal/stripes/line{dir = 8},/obj/effect/turf_decal/caution{icon_state = "caution"; dir = 4},/turf/open/floor/plasteel,/area/eventmap/mountain)
-"bcp" = (/obj/effect/turf_decal/stripes/line{dir = 8},/turf/open/floor/plasteel,/area/eventmap/mountain)
-"bcq" = (/obj/structure/cable/white{icon_state = "1-4"},/obj/structure/cable/white{icon_state = "4-8"},/turf/open/indestructible/cobble,/area/eventmap/outside)
-"bcx" = (/obj/effect/turf_decal/stripes/line{dir = 1},/turf/open/floor/plasteel,/area/eventmap/mountain)
-"bcJ" = (/obj/structure/sign/directions/security{pixel_x = -32; pixel_y = -36},/obj/structure/sign/directions/supply{dir = 8; icon_state = "direction_supply"; pixel_x = -32; pixel_y = -28},/turf/open/floor/spooktime/cobble/sideW,/area/eventmap/outside)
-"bdh" = (/obj/structure/cable/white{icon_state = "1-2"},/turf/open/floor/plating,/area/eventmap/mountain)
-"bdm" = (/obj/effect/turf_decal/stripes/line{dir = 4},/turf/open/floor/plasteel,/area/eventmap/outside)
-"bds" = (/obj/effect/turf_decal/stripes/line{dir = 4},/obj/effect/turf_decal/caution{icon_state = "caution"; dir = 8},/turf/open/floor/plasteel,/area/eventmap/outside)
-"bdy" = (/obj/structure/cable/white{icon_state = "4-8"},/turf/open/floor/plating,/area/eventmap/mountain)
-"bdz" = (/obj/structure/cable/white{icon_state = "4-8"},/obj/structure/cable/white{icon_state = "2-4"},/turf/open/floor/plating,/area/eventmap/mountain)
-"bdA" = (/obj/structure/cable/white{icon_state = "1-8"},/turf/open/floor/plating,/area/eventmap/mountain)
-"bdC" = (/obj/structure/cable/white{icon_state = "1-4"},/turf/open/floor/plating,/area/eventmap/mountain)
-"bdI" = (/obj/machinery/light/small{dir = 1},/obj/structure/reagent_dispensers/fueltank,/turf/open/floor/plating,/area/eventmap/mountain)
-"bdL" = (/obj/structure/fence/door,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"bdN" = (/obj/structure/closet/crate/bin,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"bdO" = (/obj/structure/chair/sofa/right,/obj/item/toy/cards/deck/cas,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"bdP" = (/obj/structure/chair/sofa,/obj/item/toy/cards/deck/syndicate,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"bdQ" = (/obj/structure/chair/sofa/left,/obj/item/toy/cards/deck/cas/black,/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"bdR" = (/obj/effect/turf_decal/stripes/line{dir = 4},/obj/machinery/computer/shuttle/mining,/turf/open/floor/plasteel,/area/eventmap/outside)
-"bea" = (/obj/machinery/light/small{dir = 4; light_color = "#d8b1b1"},/turf/open/floor/spooktime/dirtpatch,/area/eventmap/mountain)
-"bef" = (/obj/structure/cable/yellow{icon_state = "1-2"},/obj/structure/cable/yellow{icon_state = "2-8"},/turf/open/floor/carpet,/area/eventmap/inside)
-"bey" = (/obj/machinery/light/small{dir = 8},/obj/structure/table/wood,/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"beA" = (/obj/structure/chair/sofa/left{dir = 4},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"beB" = (/obj/structure/chair/sofa{dir = 4},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"beE" = (/obj/structure/chair/sofa/right{dir = 4},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"beF" = (/obj/structure/table/wood,/obj/machinery/light/small{dir = 8},/obj/structure/cable/yellow{icon_state = "1-2"},/turf/open/floor/wood,/area/eventmap/inside)
-"beG" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/structure/cable/yellow{icon_state = "1-4"},/turf/open/floor/wood,/area/eventmap/inside)
-"beH" = (/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/wood/damturf/broken4,/area/eventmap/inside)
-"beI" = (/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/cable/yellow{icon_state = "2-8"},/obj/structure/cable/yellow{icon_state = "2-4"},/turf/open/floor/wood,/area/eventmap/inside)
-"beJ" = (/obj/structure/cable/yellow{icon_state = "4-8"},/turf/open/floor/carpet,/area/eventmap/inside)
-"beK" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/structure/cable/yellow{icon_state = "2-4"},/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/cable/yellow{icon_state = "2-8"},/turf/open/floor/wood,/area/eventmap/inside)
-"bfd" = (/obj/machinery/door/airlock{name = "Unisex Showers"},/turf/open/floor/plasteel{icon_state = "sepia"},/area/eventmap/inside)
-"bfA" = (/obj/structure/disposalpipe/segment,/turf/open/floor/carpet,/area/eventmap/inside)
-"bfB" = (/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/disposalpipe/segment,/turf/open/floor/carpet,/area/eventmap/inside)
-"bfC" = (/obj/structure/disposalpipe/segment,/turf/open/floor/wood,/area/eventmap/inside)
-"bfD" = (/obj/structure/chair/sofa/right,/obj/structure/disposalpipe/segment,/turf/open/floor/wood,/area/eventmap/inside)
-"bfE" = (/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/disposalpipe/segment,/turf/open/floor/wood,/area/eventmap/inside)
-"bfF" = (/obj/effect/decal/cleanable/dirt{desc = "A thin layer of dust coating the floor."; name = "dust"},/obj/structure/disposalpipe/segment,/turf/open/floor/wood,/area/eventmap/inside)
-"bfG" = (/obj/effect/spawner/structure/window/reinforced,/obj/structure/disposalpipe/segment,/turf/open/floor/wood,/area/eventmap/inside)
-"bfH" = (/obj/structure/disposalpipe/segment,/turf/open/floor/spooktime/nonspooktimegrass,/area/eventmap/outside)
-"bfI" = (/obj/structure/disposalpipe/segment,/turf/open/floor/spooktime/cobble/sideW{icon_state = "cobble_side_n"},/area/eventmap/outside)
-"bfJ" = (/obj/structure/disposalpipe/segment,/turf/open/floor/spooktime/cobble,/area/eventmap/outside)
-"bfK" = (/obj/structure/disposalpipe/segment,/turf/open/floor/spooktime/cobble/sideS,/area/eventmap/outside)
-"bfL" = (/obj/structure/disposalpipe/segment,/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"bfM" = (/obj/effect/landmark/start/janitor,/obj/structure/cable/yellow{icon_state = "4-8"},/obj/structure/disposalpipe/segment{dir = 9},/turf/open/floor/spooktime/cobble/roadmid,/area/eventmap/outside)
-"bgc" = (/obj/item/banner/cargo,/turf/open/floor/spooktime/cobble/sideN,/area/eventmap/outside)
-"bgu" = (/obj/machinery/light/small{brightness = 3; dir = 8},/turf/open/floor/spooktime/spooktimegrass,/area/eventmap/outside)
-"bgw" = (/obj/structure/sign/mining{pixel_x = -32},/obj/machinery/light/small{brightness = 3; dir = 8},/turf/open/floor/spooktime/cobble/sideN,/area/eventmap/outside)
-"bgx" = (/obj/machinery/light/small{dir = 1},/turf/open/floor/spooktime/cobble/sideN,/area/eventmap/outside)
-"bgA" = (/obj/effect/turf_decal/caution/stand_clear{dir = 8; icon_state = "stand_clear"; pixel_x = -8},/obj/docking_port/stationary{dir = 4; dwidth = 3; height = 5; id = "mining_home"; name = "mining shuttle bay"; roundstart_template = /datum/map_template/shuttle/mining/delta; width = 7},/turf/open/floor/plasteel,/area/eventmap/outside)
+//MAP CONVERTED BY dmm2tgm.py THIS HEADER COMMENT PREVENTS RECONVERSION, DO NOT REMOVE
+"aaa" = (
+/obj/vehicle/ridden/bicycle,
+/turf/open/floor/spooktime/beach,
+/area/eventmap/outside)
+"aab" = (
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"aac" = (
+/turf/closed/mineral/ash_rock,
+/area/eventmap/mountain)
+"aad" = (
+/obj/structure/bed,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aae" = (
+/obj/effect/spawner/structure/window/reinforced,
+/obj/structure/cable/white{
+	icon_state = "0-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aaf" = (
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury01,
+/obj/effect/spawner/structure/window/reinforced,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aag" = (
+/obj/structure/bed,
+/obj/item/bedsheet/random,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aah" = (
+/obj/structure/closet/crate/grave,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"aai" = (
+/obj/machinery/vending/boozeomat{
+	req_access = null
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aaj" = (
+/obj/structure/dresser,
+/obj/machinery/light{
+	dir = 1;
+	light_color = "#e8eaff"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aak" = (
+/obj/structure/reagent_dispensers/keg/gargle,
+/turf/open/floor/wood/damturf/broken1,
+/area/eventmap/inside)
+"aal" = (
+/obj/structure/closet/secure_closet/freezer/meat,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aam" = (
+/obj/structure/table/wood,
+/obj/item/reagent_containers/food/drinks/bottle/wine,
+/obj/machinery/light{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aan" = (
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/inside)
+"aao" = (
+/obj/machinery/door/airlock/silver{
+	name = "Bathroom"
+	},
+/obj/effect/turf_decal/stripes/line{
+	dir = 8
+	},
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/inside)
+"aap" = (
+/obj/structure/bed,
+/obj/effect/spawner/lootdrop/bedsheet,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"aaq" = (
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury02,
+/obj/effect/spawner/structure/window/reinforced,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aar" = (
+/obj/effect/spawner/structure/window/reinforced,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aas" = (
+/obj/structure/chair/comfy/shuttle{
+	dir = 4;
+	icon_state = ""
+	},
+/obj/machinery/light/floor{
+	alpha = 0;
+	light_range = 20;
+	max_integrity = 9999;
+	mouse_opacity = 0
+	},
+/turf/open/floor/plasteel/dark{
+	icon_state = "bus"
+	},
+/area/shuttle/arrival)
+"aat" = (
+/obj/item/flashlight/lantern{
+	anchored = 1;
+	can_be_unanchored = 1;
+	light_color = "#EE9933";
+	light_range = 5;
+	on = 1
+	},
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"aau" = (
+/obj/structure/flora/junglebush{
+	icon_state = "busha1"
+	},
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"aav" = (
+/obj/structure/fluff/bus/passable,
+/obj/structure/window/reinforced{
+	dir = 8
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"aaw" = (
+/turf/closed/wall,
+/area/eventmap/inside)
+"aax" = (
+/obj/structure/holohoop,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"aay" = (
+/obj/structure/rack,
+/obj/item/stack/sheet/mineral/wood/fifty,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aaz" = (
+/obj/structure/reagent_dispensers/keg/milk,
+/turf/open/floor/wood/damturf/broken3,
+/area/eventmap/inside)
+"aaA" = (
+/obj/structure/fireplace{
+	dir = 4;
+	pixel_x = -8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aaB" = (
+/obj/structure/flora/tree/jungle,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"aaC" = (
+/obj/structure/signpost,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"aaD" = (
+/obj/structure/flora/junglebush,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"aaE" = (
+/obj/machinery/light/small,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"aaF" = (
+/obj/structure/flora/junglebush{
+	icon_state = "bushb1"
+	},
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"aaG" = (
+/obj/machinery/camera/emp_proof{
+	c_tag = "Containment - Particle Accelerator";
+	dir = 1;
+	network = list("singularity")
+	},
+/obj/machinery/light/small,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"aaH" = (
+/obj/structure/chair/wood/normal,
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"aaI" = (
+/obj/structure/dresser,
+/obj/machinery/light{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aaJ" = (
+/obj/structure/bed,
+/obj/item/bedsheet,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aaK" = (
+/obj/structure/table/wood/fancy,
+/obj/item/clothing/head/hardhat/pumpkinhead/jaqc{
+	light_range = 3
+	},
+/turf/open/floor/wood/damturf/broken5,
+/area/eventmap/inside)
+"aaL" = (
+/obj/structure/bodycontainer/crematorium,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aaM" = (
+/obj/structure/chair/comfy/plywood{
+	dir = 8
+	},
+/turf/open/floor/spooktime/cobble/cornerNE,
+/area/eventmap/outside)
+"aaN" = (
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aaO" = (
+/obj/machinery/rnd/production/techfab/department/cargo,
+/obj/effect/turf_decal/delivery,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aaP" = (
+/obj/structure/bodycontainer/morgue{
+	dir = 2
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aaQ" = (
+/obj/structure/chair/sofa/right,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aaR" = (
+/obj/structure/chair/sofa/left,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aaS" = (
+/obj/structure/mineral_door/woodrustic,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aaT" = (
+/obj/machinery/button/door/dorms/luxury1,
+/obj/machinery/vending/coffee,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aaU" = (
+/obj/structure/chair/wood/normal{
+	dir = 4
+	},
+/obj/structure/curtain{
+	color = "#B22222";
+	pixel_y = -32
+	},
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"aaV" = (
+/obj/structure/table/wood,
+/obj/item/clothing/head/festive,
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"aaW" = (
+/obj/structure/mirror{
+	pixel_x = 28
+	},
+/obj/effect/turf_decal/bot,
+/obj/machinery/shower{
+	dir = 8;
+	pixel_y = -4
+	},
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/inside)
+"aaX" = (
+/obj/structure/table/wood,
+/obj/machinery/light{
+	dir = 4
+	},
+/obj/item/reagent_containers/food/drinks/bottle/wine,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aaY" = (
+/obj/structure/table/wood/fancy,
+/obj/item/clothing/head/scarecrow_hat,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aaZ" = (
+/obj/structure/table/wood/fancy,
+/obj/item/reagent_containers/food/snacks/pastatomato,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aba" = (
+/obj/structure/table/wood/fancy,
+/obj/item/clothing/head/hardhat/pumpkinhead/jaqc{
+	light_range = 3
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"abb" = (
+/obj/structure/closet/secure_closet/freezer/kitchen/maintenance,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"abc" = (
+/obj/structure/table/wood/fancy/red,
+/obj/machinery/microwave,
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"abd" = (
+/obj/structure/chair/comfy/plywood{
+	dir = 8
+	},
+/turf/open/floor/spooktime/cobble/sideE,
+/area/eventmap/outside)
+"abe" = (
+/obj/structure/sign/poster/official/no_erp,
+/turf/closed/wall/mineral/wood,
+/area/eventmap/mountaininside)
+"abf" = (
+/obj/structure/table/wood/fancy/red,
+/obj/machinery/chem_dispenser/drinks/beer/fullupgrade,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"abg" = (
+/obj/structure/table/wood/fancy/red,
+/obj/machinery/chem_dispenser/drinks/fullupgrade,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"abh" = (
+/obj/structure/table/wood/fancy/red,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"abi" = (
+/obj/structure/mineral_door/woodrustic{
+	name = "Event Hall"
+	},
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury01,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"abj" = (
+/obj/effect/spawner/structure/window/reinforced,
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury01,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"abk" = (
+/obj/machinery/vending/wardrobe/cargo_wardrobe,
+/obj/effect/turf_decal/tile/brown{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/brown{
+	dir = 1
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"abl" = (
+/obj/structure/toilet{
+	dir = 4
+	},
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/inside)
+"abm" = (
+/obj/machinery/door/airlock/silver{
+	name = "Bathroom"
+	},
+/obj/effect/turf_decal/stripes/line{
+	dir = 4
+	},
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"abn" = (
+/obj/effect/spawner/structure/window/reinforced,
+/turf/open/floor/plasteel/elevatorshaft,
+/area/eventmap/inside)
+"abo" = (
+/obj/structure/fireplace{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"abp" = (
+/obj/effect/landmark/start/chaplain,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"abq" = (
+/obj/structure/table/wood/fancy/red,
+/obj/item/reagent_containers/food/snacks/waffles,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"abr" = (
+/obj/structure/chair/comfy/plywood{
+	dir = 1
+	},
+/turf/open/floor/spooktime/cobble/sideS,
+/area/eventmap/outside)
+"abs" = (
+/obj/structure/fluff/bus/passable,
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"abt" = (
+/obj/effect/turf_decal/tile/brown{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/brown{
+	dir = 1
+	},
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"abu" = (
+/obj/structure/table/wood/fancy/red,
+/obj/machinery/light/small{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"abv" = (
+/obj/structure/table/wood,
+/obj/item/phone,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"abw" = (
+/obj/structure/table/wood,
+/obj/item/clothing/head/festive,
+/obj/structure/curtain{
+	color = "#B22222";
+	pixel_y = -32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"abx" = (
+/obj/machinery/button/door/dorms/luxury2,
+/obj/machinery/vending/coffee,
+/turf/open/floor/wood/damturf/broken6,
+/area/eventmap/inside)
+"aby" = (
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"abz" = (
+/obj/structure/chair/wood/wings,
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"abA" = (
+/obj/effect/spawner/structure/window/reinforced,
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury02,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"abB" = (
+/obj/structure/mineral_door/woodrustic{
+	name = "Event Hall"
+	},
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury02,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"abC" = (
+/obj/structure/chair/sofa,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"abD" = (
+/obj/structure/closet/crate/coffin,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"abE" = (
+/obj/structure/bed,
+/obj/item/bedsheet/random,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"abF" = (
+/obj/machinery/vending/donksofttoyvendor,
+/turf/open/floor/spooktime/cobble/cornerNW,
+/area/eventmap/outside)
+"abG" = (
+/obj/structure/table/wood,
+/obj/item/stack/sheet/plastic/fifty{
+	pixel_x = 4;
+	pixel_y = -4
+	},
+/obj/item/stack/sheet/metal/fifty,
+/turf/open/floor/spooktime/cobble/sideN,
+/area/eventmap/outside)
+"abH" = (
+/turf/closed/wall/mineral/gold,
+/area/eventmap/mountain)
+"abI" = (
+/obj/structure/table/wood,
+/obj/effect/turf_decal/tile/brown{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/brown{
+	dir = 1
+	},
+/obj/effect/turf_decal/tile/brown,
+/obj/item/storage/firstaid/regular,
+/obj/structure/sign/poster/contraband/masked_men{
+	pixel_x = 32
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"abJ" = (
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"abK" = (
+/turf/closed/wall/mineral/iron,
+/area/eventmap/outside)
+"abL" = (
+/obj/structure/healingfountain,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"abM" = (
+/obj/structure/table/wood/fancy/red,
+/obj/item/reagent_containers/food/snacks/soup/hotchili,
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"abN" = (
+/obj/structure/table/wood/fancy/red,
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"abO" = (
+/obj/structure/table/wood/fancy/red,
+/obj/item/reagent_containers/food/snacks/sausage,
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"abP" = (
+/obj/structure/table/wood/fancy/red,
+/obj/item/reagent_containers/food/snacks/cubancarp,
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"abQ" = (
+/obj/structure/sink{
+	dir = 8;
+	pixel_x = -12
+	},
+/obj/structure/mirror{
+	dir = 8;
+	pixel_x = -28
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"abR" = (
+/obj/effect/turf_decal/tile/blue{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/yellow{
+	dir = 8
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountain)
+"abS" = (
+/obj/structure/mineral_door/wood,
+/turf/open/floor/wood/damturf/broken7,
+/area/eventmap/inside)
+"abT" = (
+/obj/effect/landmark/start/chaplain,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"abU" = (
+/obj/machinery/vending/wardrobe/chap_wardrobe,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"abV" = (
+/obj/structure/table/wood/fancy/red,
+/obj/item/reagent_containers/food/snacks/taco,
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"abW" = (
+/obj/structure/chair/sofa/left{
+	dir = 1;
+	icon_state = "sofamiddle"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"abX" = (
+/obj/structure/chair/sofa/left{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"abY" = (
+/turf/open/floor/wood{
+	icon_state = "wood-broken2"
+	},
+/area/eventmap/inside)
+"abZ" = (
+/obj/machinery/light/small,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aca" = (
+/obj/structure/toilet{
+	dir = 4
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"acb" = (
+/obj/machinery/power/apc{
+	areastring = "/area/chapel/office";
+	name = "Chapel Office APC";
+	pixel_y = -24
+	},
+/obj/structure/cable/yellow{
+	icon_state = "0-8"
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"acc" = (
+/obj/structure/dresser,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"acd" = (
+/obj/structure/chair/wood/wings{
+	dir = 1
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"ace" = (
+/obj/effect/spawner/structure/window/reinforced,
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"acf" = (
+/obj/structure/mineral_door/woodrustic{
+	name = "Event Hall"
+	},
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"acg" = (
+/obj/machinery/light/small,
+/obj/structure/chair/sofa/left{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ach" = (
+/obj/structure/chair/sofa/right{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aci" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/closed/wall/mineral/wood,
+/area/eventmap/inside)
+"acj" = (
+/obj/structure/bookcase/random/adult,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ack" = (
+/obj/structure/table/wood,
+/obj/machinery/light{
+	dir = 1
+	},
+/obj/item/phone,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"acl" = (
+/obj/structure/table/wood,
+/obj/item/clothing/head/festive,
+/obj/structure/curtain{
+	color = "#B22222";
+	pixel_y = 32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"acm" = (
+/obj/machinery/button/door/dorms/luxury3,
+/obj/machinery/vending/coffee,
+/turf/open/floor/wood/damturf/broken1,
+/area/eventmap/inside)
+"acn" = (
+/obj/item/barthpot{
+	active = 0
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aco" = (
+/obj/machinery/holopad,
+/obj/effect/landmark/start/chaplain,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-8"
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"acp" = (
+/mob/living/simple_animal/jacq{
+	active = 0;
+	spawn_cars = 0
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"acq" = (
+/obj/structure/chair/wood/normal{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"acr" = (
+/obj/effect/spawner/structure/window,
+/turf/open/floor/plasteel/elevatorshaft,
+/area/eventmap/inside)
+"acs" = (
+/obj/effect/turf_decal/delivery,
+/obj/machinery/camera/emp_proof{
+	c_tag = "Cargo Bay"
+	},
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"act" = (
+/turf/open/floor/plasteel{
+	dir = 1;
+	icon_state = "chapel"
+	},
+/area/eventmap/inside)
+"acu" = (
+/obj/structure/dresser,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"acv" = (
+/turf/open/floor/plasteel{
+	dir = 4;
+	icon_state = "chapel"
+	},
+/area/eventmap/inside)
+"acw" = (
+/obj/structure/table/wood/fancy,
+/obj/item/flashlight/lantern{
+	anchored = 1;
+	can_be_unanchored = 1;
+	light_color = "#EE9933";
+	light_range = 5;
+	on = 1
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"acx" = (
+/obj/structure/table/wood/fancy,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"acy" = (
+/obj/structure/mineral_door/wood,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"acz" = (
+/obj/structure/table/wood/fancy,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"acA" = (
+/obj/effect/turf_decal/delivery,
+/obj/structure/closet/crate{
+	icon_state = "crateopen"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"acB" = (
+/turf/open/floor/plasteel/stairs/left,
+/area/eventmap/inside)
+"acC" = (
+/obj/structure/bookcase/random/adult,
+/obj/machinery/light/small,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"acD" = (
+/turf/open/floor/plasteel/stairs/right,
+/area/eventmap/inside)
+"acE" = (
+/obj/structure/mineral_door/woodrustic{
+	name = "Event Hall"
+	},
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury04,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"acF" = (
+/obj/effect/turf_decal/tile/blue{
+	dir = 8
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountain)
+"acG" = (
+/obj/machinery/door/airlock/mining{
+	name = "Mining";
+	req_access_txt = "48"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"acH" = (
+/obj/effect/spawner/structure/window/reinforced,
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury04,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"acI" = (
+/obj/structure/flora/grass/jungle/b{
+	icon_state = "busha2"
+	},
+/obj/vehicle/ridden/atv,
+/obj/item/key,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"acJ" = (
+/obj/structure/flora/junglebush{
+	icon_state = "bushb1"
+	},
+/obj/vehicle/ridden/atv,
+/obj/item/key,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"acK" = (
+/obj/vehicle/ridden/atv,
+/obj/item/key,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"acL" = (
+/turf/open/floor/plasteel{
+	dir = 8;
+	icon_state = "chapel"
+	},
+/area/eventmap/inside)
+"acM" = (
+/turf/open/floor/plasteel{
+	icon_state = "chapel"
+	},
+/area/eventmap/inside)
+"acN" = (
+/obj/structure/spacevine,
+/turf/closed/wall/rust,
+/area/eventmap/outside)
+"acO" = (
+/obj/structure/bed,
+/obj/item/bedsheet/cmo,
+/obj/item/restraints/handcuffs,
+/obj/item/reagent_containers/syringe,
+/obj/item/clothing/suit/straight_jacket,
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"acP" = (
+/obj/machinery/vending/kink,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"acQ" = (
+/obj/machinery/light/small{
+	dir = 4;
+	light_color = "#d8b1b1"
+	},
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"acR" = (
+/obj/structure/table/wood,
+/obj/effect/turf_decal/tile/brown{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/brown,
+/obj/item/paper_bin,
+/obj/item/pen,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"acS" = (
+/obj/machinery/vending/clothing,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"acT" = (
+/obj/machinery/camera/emp_proof{
+	c_tag = "Containment - Fore Port";
+	dir = 4;
+	network = list("singularity")
+	},
+/obj/machinery/light/small{
+	dir = 8
+	},
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"acU" = (
+/obj/structure/sign/departments/medbay/alt{
+	pixel_x = 32
+	},
+/obj/machinery/light/small{
+	dir = 4;
+	light_color = "#d8b1b1"
+	},
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"acV" = (
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountain)
+"acW" = (
+/obj/structure/mineral_door/woodrustic,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"acX" = (
+/obj/machinery/washing_machine,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"acY" = (
+/obj/machinery/button/door/dorms/luxury4,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"acZ" = (
+/obj/structure/flora/grass/jungle/b{
+	icon_state = "grassa3"
+	},
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"ada" = (
+/obj/structure/flora/grass/jungle/b{
+	icon_state = "grassa1"
+	},
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"adb" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"adc" = (
+/obj/structure/cable/yellow{
+	icon_state = "2-8"
+	},
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"add" = (
+/obj/effect/landmark/start/cargo_technician,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"ade" = (
+/obj/machinery/cryopod{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"adf" = (
+/obj/structure/chair/wood/normal{
+	dir = 4
+	},
+/obj/structure/curtain{
+	color = "#B22222";
+	pixel_y = 32
+	},
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"adg" = (
+/obj/structure/closet/secure_closet/CMO,
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"adh" = (
+/obj/structure/table/wood,
+/obj/item/clothing/head/festive,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"adi" = (
+/obj/machinery/light{
+	dir = 1
+	},
+/obj/structure/chair/wood/normal{
+	dir = 8
+	},
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"adj" = (
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"adk" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/white{
+	icon_state = "2-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"adl" = (
+/obj/structure/window/reinforced/tinted/fulltile,
+/turf/closed/wall/mineral/wood,
+/area/eventmap/inside)
+"adm" = (
+/obj/structure/sign/poster/official/do_not_question{
+	pixel_y = 32
+	},
+/obj/structure/bookcase/random/nonfiction,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"adn" = (
+/obj/structure/spirit_board,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"ado" = (
+/obj/structure/easel,
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"adp" = (
+/obj/machinery/door/firedoor/border_only/closed{
+	dir = 4;
+	name = "Therapist's Office"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"adq" = (
+/obj/item/storage/briefcase,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"adr" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/wood{
+	icon_state = "wood-broken3"
+	},
+/area/eventmap/inside)
+"ads" = (
+/mob/living/simple_animal/pet/cat/Runtime,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"adt" = (
+/obj/effect/turf_decal/bot,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"adu" = (
+/obj/machinery/computer/crew,
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"adv" = (
+/obj/structure/table/wood/fancy/red,
+/obj/item/paper_bin,
+/obj/item/pen,
+/obj/item/storage/pill_bottle/mannitol,
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"adw" = (
+/obj/structure/table/wood/fancy/red,
+/obj/item/flashlight/lamp/green,
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"adx" = (
+/obj/structure/table/wood,
+/obj/effect/turf_decal/tile/brown{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/brown,
+/obj/machinery/firealarm{
+	dir = 4;
+	pixel_x = 24
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"ady" = (
+/obj/machinery/light/small{
+	dir = 8
+	},
+/obj/effect/landmark/start/chief_medical_officer,
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"adz" = (
+/obj/effect/turf_decal/tile/blue,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountain)
+"adA" = (
+/obj/structure/table/wood,
+/obj/item/phone,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"adB" = (
+/obj/structure/chair/pew/left{
+	dir = 1
+	},
+/turf/open/floor/plasteel{
+	icon_state = "chapel"
+	},
+/area/eventmap/inside)
+"adC" = (
+/obj/structure/chair/pew{
+	dir = 1
+	},
+/turf/open/floor/plasteel{
+	dir = 8;
+	icon_state = "chapel"
+	},
+/area/eventmap/inside)
+"adD" = (
+/obj/structure/flora/grass/jungle/b{
+	icon_state = "busha2"
+	},
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"adE" = (
+/obj/structure/chair/pew/right{
+	dir = 1
+	},
+/turf/open/floor/plasteel{
+	icon_state = "chapel"
+	},
+/area/eventmap/inside)
+"adF" = (
+/obj/structure/cable/yellow{
+	icon_state = "0-2"
+	},
+/obj/machinery/power/apc{
+	areastring = "/area/crew_quarters/heads/cmo";
+	dir = 1;
+	name = "CM Quarters APC";
+	pixel_x = 24
+	},
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"adG" = (
+/obj/structure/chair/pew/left{
+	dir = 1
+	},
+/turf/open/floor/plasteel{
+	dir = 8;
+	icon_state = "chapel"
+	},
+/area/eventmap/inside)
+"adH" = (
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"adI" = (
+/obj/structure/mineral_door/wood,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"adJ" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/effect/landmark/start/chief_medical_officer,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"adK" = (
+/obj/structure/window/reinforced/tinted/frosted{
+	dir = 4
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"adL" = (
+/obj/item/folder/white,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"adM" = (
+/obj/structure/cable/yellow{
+	icon_state = "2-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/white{
+	icon_state = "2-4"
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"adN" = (
+/turf/open/floor/wood{
+	icon_state = "wood-broken5"
+	},
+/area/eventmap/inside)
+"adO" = (
+/obj/structure/chair/office/dark{
+	dir = 4
+	},
+/obj/effect/landmark/start/chief_medical_officer,
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"adP" = (
+/obj/structure/table/wood/fancy/red,
+/obj/machinery/computer/med_data/laptop{
+	dir = 8
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"adQ" = (
+/obj/structure/chair/pew{
+	dir = 1
+	},
+/turf/open/floor/plasteel{
+	icon_state = "chapel"
+	},
+/area/eventmap/inside)
+"adR" = (
+/obj/effect/spawner/structure/window/reinforced,
+/obj/structure/cable/white{
+	icon_state = "0-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"adS" = (
+/obj/structure/table/wood,
+/obj/item/paper/fluff/balls/spookyasylum/traffickingvictim,
+/obj/item/clothing/mask/muzzle,
+/obj/item/clothing/glasses/sunglasses/blindfold,
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"adT" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-4"
+	},
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"adU" = (
+/obj/structure/chair/pew/right{
+	dir = 1
+	},
+/turf/open/floor/plasteel{
+	dir = 8;
+	icon_state = "chapel"
+	},
+/area/eventmap/inside)
+"adV" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"adW" = (
+/obj/item/toy/beach_ball/holoball,
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"adX" = (
+/obj/structure/chair/sofa/left{
+	dir = 1
+	},
+/turf/open/floor/wood{
+	icon_state = "wood-broken7"
+	},
+/area/eventmap/inside)
+"adY" = (
+/obj/structure/chair/sofa/right{
+	dir = 1
+	},
+/turf/open/floor/wood{
+	icon_state = "wood-broken2"
+	},
+/area/eventmap/inside)
+"adZ" = (
+/obj/structure/window/reinforced/tinted/frosted{
+	dir = 4
+	},
+/obj/structure/statue/silver/md,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aea" = (
+/obj/machinery/suit_storage_unit/cmo,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aeb" = (
+/obj/structure/chair/comfy/teal{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aec" = (
+/obj/structure/filingcabinet/medical,
+/obj/structure/cable/yellow,
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"aed" = (
+/obj/machinery/computer/card/minor/cmo{
+	dir = 1
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"aee" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"aef" = (
+/obj/structure/window/reinforced/tinted/fulltile,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aeg" = (
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03,
+/obj/effect/spawner/structure/window/reinforced,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aeh" = (
+/obj/machinery/door/airlock/command/glass{
+	name = "Chief Medical Officer";
+	req_access_txt = "40"
+	},
+/obj/machinery/door/firedoor,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aei" = (
+/obj/effect/turf_decal/bot,
+/obj/structure/closet/cardboard,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aej" = (
+/obj/structure/filingcabinet/medical,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aek" = (
+/obj/item/reagent_containers/spray/cleaner,
+/obj/machinery/light/small{
+	dir = 1
+	},
+/obj/structure/table/wood/fancy/purple,
+/obj/item/gun/magic/wand/resurrection,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ael" = (
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury04,
+/obj/effect/spawner/structure/window/reinforced,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aem" = (
+/obj/item/chair/wood,
+/turf/open/floor/plasteel{
+	icon_state = "chapel"
+	},
+/area/eventmap/inside)
+"aen" = (
+/obj/item/chair/wood,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aeo" = (
+/obj/effect/spawner/structure/window,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aep" = (
+/obj/machinery/vending/wardrobe/cargo_wardrobe,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aeq" = (
+/obj/machinery/vending/wardrobe/chap_wardrobe,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aer" = (
+/obj/effect/turf_decal/tile/blue{
+	dir = 1
+	},
+/obj/effect/turf_decal/tile/red,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountain)
+"aes" = (
+/obj/effect/turf_decal/tile/yellow{
+	dir = 4
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountain)
+"aet" = (
+/obj/effect/turf_decal/tile/blue,
+/obj/effect/turf_decal/tile/blue{
+	dir = 8
+	},
+/obj/structure/chair/stool,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountain)
+"aeu" = (
+/obj/effect/turf_decal/tile/red{
+	dir = 1
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountain)
+"aev" = (
+/obj/effect/turf_decal/tile/yellow,
+/obj/effect/turf_decal/tile/yellow{
+	dir = 4
+	},
+/obj/structure/chair/stool,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountain)
+"aew" = (
+/obj/machinery/mineral/ore_redemption,
+/obj/effect/turf_decal/delivery,
+/obj/machinery/door/firedoor,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aex" = (
+/obj/structure/table/plasmaglass,
+/obj/item/toy/cards/deck/unum,
+/obj/machinery/light/floor,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountain)
+"aey" = (
+/obj/effect/turf_decal/tile/red{
+	dir = 8
+	},
+/obj/effect/turf_decal/tile/red{
+	dir = 1
+	},
+/obj/structure/chair/stool,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountain)
+"aez" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/obj/machinery/vending/medical{
+	req_access = null
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aeA" = (
+/obj/machinery/rnd/production/techfab/department/medical,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aeB" = (
+/obj/structure/window/reinforced,
+/obj/structure/table/wood/fancy/green,
+/obj/item/storage/firstaid/toxin{
+	pixel_x = -3;
+	pixel_y = 3
+	},
+/obj/item/storage/firstaid/toxin,
+/obj/effect/decal/cleanable/cobweb,
+/obj/item/gun/syringe,
+/obj/item/gun/syringe,
+/obj/item/gun/syringe,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aeC" = (
+/obj/structure/table/wood/fancy/green,
+/obj/item/storage/firstaid/fire{
+	pixel_x = -3;
+	pixel_y = 3
+	},
+/obj/item/storage/firstaid/fire,
+/obj/machinery/door/window/southleft,
+/obj/item/holosign_creator/medical,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aeD" = (
+/obj/machinery/light/small/broken{
+	dir = 8
+	},
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"aeE" = (
+/obj/structure/sign/departments/medbay/alt{
+	pixel_x = 32
+	},
+/obj/machinery/light/small/broken{
+	dir = 4
+	},
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"aeF" = (
+/obj/structure/table/wood/fancy/green,
+/obj/machinery/door/window/southright,
+/obj/item/storage/firstaid/regular{
+	pixel_x = 3;
+	pixel_y = 3
+	},
+/obj/item/storage/firstaid/regular,
+/obj/item/clothing/accessory/medal/ribbon/medical_doctor,
+/obj/item/gun/magic/wand/resurrection,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aeG" = (
+/obj/structure/window/reinforced,
+/obj/structure/window/reinforced{
+	dir = 4
+	},
+/obj/structure/table/wood/fancy/green,
+/obj/item/storage/firstaid/o2{
+	pixel_x = 3;
+	pixel_y = 3
+	},
+/obj/item/storage/firstaid/o2,
+/obj/item/storage/firstaid/regular{
+	pixel_x = -3;
+	pixel_y = -3
+	},
+/obj/item/gun/magic/staff/healing,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aeH" = (
+/obj/machinery/door/airlock/gold,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountain)
+"aeI" = (
+/obj/structure/closet/secure_closet/medical3,
+/obj/item/healthanalyzer/advanced,
+/obj/item/defibrillator/loaded,
+/obj/item/clothing/glasses/hud/health,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aeJ" = (
+/obj/structure/closet/crate/medical{
+	icon_state = "medicalcrateopen"
+	},
+/obj/item/gun/magic/wand/resurrection,
+/obj/item/gun/magic/wand/resurrection,
+/obj/item/gun/magic/staff/healing,
+/obj/item/gun/magic/staff/healing,
+/obj/item/paper/fluff/balls/spookyasylum/healstaffnote,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aeK" = (
+/obj/effect/decal/cleanable/dirt,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aeL" = (
+/obj/machinery/vending/wardrobe/bar_wardrobe,
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aeM" = (
+/obj/machinery/vending/wardrobe/chef_wardrobe,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aeN" = (
+/obj/structure/flora/grass/jungle/b,
+/turf/closed/wall/rust,
+/area/eventmap/outside)
+"aeO" = (
+/obj/machinery/vending/wardrobe/medi_wardrobe,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aeP" = (
+/obj/machinery/vending/wardrobe/curator_wardrobe,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aeQ" = (
+/obj/machinery/cryopod{
+	dir = 4
+	},
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aeR" = (
+/obj/machinery/cryopod,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aeS" = (
+/obj/structure/table/wood,
+/obj/item/wrench/medical,
+/obj/item/storage/firstaid/regular,
+/obj/item/clothing/head/beret/cmo,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aeT" = (
+/obj/structure/table/wood,
+/obj/item/storage/box/masks{
+	pixel_x = 3;
+	pixel_y = 3
+	},
+/obj/item/storage/box/gloves,
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aeU" = (
+/obj/item/clothing/accessory/armband/medblue{
+	pixel_x = 3;
+	pixel_y = 3
+	},
+/obj/item/clothing/accessory/armband/med,
+/obj/item/rack_parts,
+/obj/item/storage/briefcase/medical,
+/turf/open/floor/wood{
+	icon_state = "wood-broken6"
+	},
+/area/eventmap/inside)
+"aeV" = (
+/obj/structure/rack,
+/obj/effect/spawner/bundle/costume/plaguedoctor,
+/obj/item/stamp/cmo,
+/obj/item/gun/magic/staff/healing,
+/obj/item/gun/magic/wand/resurrection,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aeW" = (
+/obj/structure/flora/junglebush{
+	icon_state = "grassa4"
+	},
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"aeX" = (
+/obj/machinery/hydroponics/soil,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/outside)
+"aeY" = (
+/obj/item/storage/crayons,
+/turf/open/floor/spooktime/beach,
+/area/eventmap/outside)
+"aeZ" = (
+/obj/machinery/camera/emp_proof{
+	c_tag = "Containment - Fore Starboard";
+	dir = 8;
+	network = list("singularity")
+	},
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"afa" = (
+/obj/machinery/vending/clothing,
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afb" = (
+/obj/machinery/computer/arcade/minesweeper,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afc" = (
+/obj/structure/rack,
+/obj/effect/spawner/lootdrop/maintenance{
+	lootcount = 2;
+	name = "2maintenance loot spawner"
+	},
+/obj/structure/window/reinforced/tinted{
+	dir = 4
+	},
+/obj/item/reagent_containers/blood/random,
+/obj/item/clothing/neck/stethoscope,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afd" = (
+/obj/machinery/shower{
+	desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well...";
+	pixel_y = 24
+	},
+/obj/structure/curtain,
+/obj/item/storage/pill_bottle/penis_enlargement,
+/obj/item/storage/pill_bottle/breast_enlargement,
+/obj/effect/decal/cleanable/cobweb/cobweb2,
+/obj/item/ectoplasm,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afe" = (
+/obj/machinery/computer/arcade/orion_trail,
+/obj/structure/window/reinforced/tinted{
+	dir = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aff" = (
+/obj/machinery/washing_machine,
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afg" = (
+/obj/machinery/cryopod{
+	dir = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afh" = (
+/obj/effect/landmark/start/medical_doctor,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afi" = (
+/obj/item/seeds/pumpkin,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"afj" = (
+/turf/open/floor/plasteel/stairs/left,
+/area/eventmap/outside)
+"afk" = (
+/obj/machinery/light{
+	dir = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afl" = (
+/obj/machinery/light/small{
+	dir = 4
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afm" = (
+/obj/machinery/vending/wardrobe/viro_wardrobe,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afn" = (
+/obj/effect/decal/cleanable/blood/old,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afo" = (
+/obj/effect/decal/cleanable/blood/gibs/old,
+/obj/effect/decal/cleanable/glass,
+/obj/item/shard,
+/obj/item/organ/eyes,
+/obj/machinery/light/small/broken{
+	dir = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afp" = (
+/obj/structure/closet/secure_closet/CMO,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afq" = (
+/obj/structure/flora/bush,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"afr" = (
+/obj/structure/flora/ausbushes/sparsegrass,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"afs" = (
+/obj/structure/flora/ausbushes/leafybush,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"aft" = (
+/obj/structure/flora/ausbushes/lavendergrass,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"afu" = (
+/obj/structure/sign/poster/official/fruit_bowl,
+/turf/closed/wall/mineral/wood,
+/area/eventmap/inside)
+"afv" = (
+/obj/structure/spacevine,
+/turf/closed/wall/rust,
+/area/eventmap/inside)
+"afw" = (
+/turf/closed/wall/rust,
+/area/eventmap/inside)
+"afx" = (
+/obj/structure/urinal,
+/turf/closed/wall/rust,
+/area/eventmap/inside)
+"afy" = (
+/obj/structure/urinal,
+/obj/structure/spacevine,
+/turf/closed/wall/rust,
+/area/eventmap/inside)
+"afz" = (
+/obj/structure/chair/wood,
+/obj/item/toy/plush/borgplushie/medihound,
+/obj/item/clothing/glasses/hud/health/sunglasses{
+	pixel_x = -4;
+	pixel_y = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afA" = (
+/obj/effect/decal/cleanable/glass/plasma,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afB" = (
+/obj/structure/window/reinforced/tinted{
+	dir = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afC" = (
+/turf/open/floor/plasteel/stairs/right,
+/area/eventmap/outside)
+"afD" = (
+/obj/structure/window/reinforced/tinted,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afE" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/machinery/light/small,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afF" = (
+/obj/effect/decal/cleanable/cobweb,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"afG" = (
+/obj/machinery/vending/coffee,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"afH" = (
+/obj/structure/fireplace,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"afI" = (
+/obj/machinery/vending/snack/orange,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"afJ" = (
+/obj/machinery/vending/games,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afK" = (
+/obj/structure/flora/rock/pile/icy,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"afL" = (
+/obj/structure/flora/ausbushes/ywflowers,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"afM" = (
+/obj/structure/toilet{
+	dir = 4
+	},
+/obj/effect/decal/cleanable/cobweb,
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"afN" = (
+/obj/structure/mineral_door/wood,
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"afO" = (
+/obj/machinery/shower{
+	desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well...";
+	pixel_y = 24
+	},
+/obj/structure/curtain,
+/obj/machinery/atmospherics/components/unary/vent_pump{
+	icon_state = "vent_in"
+	},
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"afP" = (
+/obj/machinery/shower{
+	desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well...";
+	pixel_y = 24
+	},
+/obj/structure/curtain,
+/obj/item/bikehorn/rubberducky,
+/obj/machinery/atmospherics/components/unary/vent_pump{
+	icon_state = "vent_in"
+	},
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"afQ" = (
+/obj/machinery/shower{
+	desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well...";
+	pixel_y = 24
+	},
+/obj/structure/curtain,
+/obj/item/bikehorn/rubberducky,
+/obj/item/soap/homemade,
+/obj/machinery/atmospherics/components/unary/vent_pump{
+	icon_state = "vent_in"
+	},
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"afR" = (
+/obj/machinery/shower{
+	desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well...";
+	pixel_y = 24
+	},
+/obj/structure/curtain,
+/obj/item/soap/homemade,
+/obj/machinery/atmospherics/components/unary/vent_pump{
+	icon_state = "vent_in"
+	},
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"afS" = (
+/obj/machinery/shower{
+	desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well...";
+	pixel_y = 24
+	},
+/obj/effect/decal/cleanable/cobweb,
+/obj/structure/curtain,
+/obj/item/bikehorn/rubberducky,
+/obj/item/soap/homemade,
+/obj/machinery/atmospherics/components/unary/vent_pump{
+	icon_state = "vent_in"
+	},
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"afT" = (
+/obj/machinery/vending/magivend,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afU" = (
+/obj/machinery/vending/autodrobe,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afV" = (
+/obj/effect/spawner/lootdrop/costume,
+/mob/living/simple_animal/hostile/skeleton{
+	a_intent = "friendly";
+	attack_sound = 'sound/vox_fem/bone.ogg';
+	harm_intent_damage = -5;
+	melee_damage_lower = 1;
+	melee_damage_upper = 10;
+	name = "Closet Skeleton"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afW" = (
+/mob/living/simple_animal/hostile/skeleton{
+	a_intent = "friendly";
+	attack_sound = 'sound/vox_fem/bone.ogg';
+	harm_intent_damage = -5;
+	melee_damage_lower = 1;
+	melee_damage_upper = 10;
+	name = "Closet Skeleton"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afX" = (
+/obj/item/clothing/head/hardhat/pumpkinhead,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"afY" = (
+/turf/open/floor/spooktime/cobble/sideW{
+	icon_state = "cobble_corner_nw"
+	},
+/area/eventmap/outside)
+"afZ" = (
+/turf/open/floor/wood{
+	icon_state = "wood-broken4"
+	},
+/area/eventmap/inside)
+"aga" = (
+/turf/open/floor/wood/damturf/broken7,
+/area/eventmap/inside)
+"agb" = (
+/obj/machinery/vending/medical{
+	req_access = null
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"agc" = (
+/obj/structure/cable/white{
+	icon_state = "0-2"
+	},
+/obj/effect/spawner/structure/window/reinforced,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"agd" = (
+/obj/machinery/vending/coffee,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"age" = (
+/obj/effect/decal/cleanable/dirt,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"agf" = (
+/obj/machinery/vending/wardrobe/gene_wardrobe,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"agg" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/structure/fireaxecabinet{
+	pixel_y = -32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"agh" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/machinery/light/small/built,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"agi" = (
+/obj/structure/chair/comfy/plywood,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"agj" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"agk" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"agl" = (
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"agm" = (
+/obj/item/stack/sheet/bone,
+/mob/living/simple_animal/hostile/skeleton{
+	a_intent = "friendly";
+	attack_sound = 'sound/vox_fem/bone.ogg';
+	harm_intent_damage = -5;
+	melee_damage_lower = 1;
+	melee_damage_upper = 10;
+	name = "Closet Skeleton"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"agn" = (
+/obj/item/stack/sheet/bone,
+/obj/effect/spawner/lootdrop/costume,
+/mob/living/simple_animal/hostile/skeleton{
+	a_intent = "friendly";
+	attack_sound = 'sound/vox_fem/bone.ogg';
+	harm_intent_damage = -5;
+	melee_damage_lower = 1;
+	melee_damage_upper = 10;
+	name = "Closet Skeleton"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ago" = (
+/obj/item/shadowcloak,
+/mob/living/simple_animal/hostile/skeleton{
+	a_intent = "friendly";
+	attack_sound = 'sound/vox_fem/bone.ogg';
+	harm_intent_damage = -5;
+	melee_damage_lower = 1;
+	melee_damage_upper = 10;
+	name = "Closet Skeleton"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"agp" = (
+/obj/effect/decal/cleanable/generic,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"agq" = (
+/obj/structure/closet/secure_closet/medical3,
+/obj/item/healthanalyzer/advanced,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"agr" = (
+/obj/structure/flora/grass/jungle/b,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"ags" = (
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"agt" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/wood{
+	icon_state = "wood-broken5"
+	},
+/area/eventmap/inside)
+"agu" = (
+/obj/structure/table/wood,
+/obj/item/reagent_containers/glass/bottle/charcoal,
+/obj/item/reagent_containers/food/drinks/mug/tea,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"agv" = (
+/obj/machinery/computer/med_data{
+	dir = 1
+	},
+/obj/structure/window/reinforced,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"agw" = (
+/obj/machinery/cryopod{
+	dir = 4
+	},
+/obj/machinery/light/small,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"agx" = (
+/obj/machinery/door/airlock/medical/glass{
+	name = "Medbay Storage";
+	req_access_txt = "5"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"agy" = (
+/obj/structure/mineral_door/wood,
+/obj/effect/decal/cleanable/blood/old,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"agz" = (
+/obj/machinery/light/small{
+	dir = 8
+	},
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"agA" = (
+/obj/machinery/light/small{
+	dir = 4
+	},
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"agB" = (
+/obj/machinery/camera/emp_proof,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"agC" = (
+/obj/structure/chair/wood/wings{
+	dir = 4
+	},
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"agD" = (
+/obj/structure/table/wood/poker,
+/obj/item/toy/cards/deck,
+/obj/item/stamp/qm{
+	pixel_x = -5;
+	pixel_y = 3
+	},
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"agE" = (
+/obj/structure/table/wood/poker,
+/obj/item/storage/fancy/donut_box,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"agF" = (
+/obj/structure/table/wood/poker,
+/obj/item/storage/fancy/candle_box,
+/obj/item/storage/fancy/candle_box,
+/obj/item/storage/fancy/candle_box,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"agG" = (
+/obj/structure/chair/wood/wings{
+	dir = 8
+	},
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"agH" = (
+/obj/structure/toilet{
+	dir = 4
+	},
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"agI" = (
+/mob/living/simple_animal/hostile/retaliate/nanotrasenpeace{
+	a_intent = "friendly";
+	alpha = 150;
+	attack_sound = 'sound/items/towelwipe.ogg';
+	desc = "A ghost who is intent on spraying you with purfume and toweling you, then expecting a tip after!! Spooky!!!";
+	icon_state = "paperwizard";
+	melee_damage_lower = 0;
+	melee_damage_upper = 0;
+	name = "Spooky Restroom attendant"
+	},
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"agJ" = (
+/obj/structure/sink{
+	dir = 4;
+	pixel_x = 11
+	},
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"agK" = (
+/obj/structure/mirror,
+/turf/closed/wall/mineral/wood,
+/area/eventmap/inside)
+"agL" = (
+/obj/structure/sink{
+	dir = 8;
+	pixel_x = -12
+	},
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"agM" = (
+/obj/structure/mineral_door/wood{
+	name = "closet"
+	},
+/obj/structure/barricade/wooden/crude,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"agN" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"agO" = (
+/obj/structure/noticeboard/cmo{
+	pixel_y = 32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"agP" = (
+/obj/effect/spawner/lootdrop/costume,
+/obj/structure/table/wood/fancy/orange,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"agQ" = (
+/obj/structure/window/reinforced/spawner,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"agR" = (
+/obj/item/clothing/accessory/skullcodpiece,
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"agS" = (
+/turf/open/floor/wood{
+	icon_state = "wood-broken3"
+	},
+/area/eventmap/inside)
+"agT" = (
+/obj/machinery/light/small{
+	dir = 4
+	},
+/turf/open/floor/wood/damturf/broken5,
+/area/eventmap/inside)
+"agU" = (
+/obj/structure/closet/secure_closet/engineering_chief,
+/obj/item/stamp/ce,
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"agV" = (
+/obj/structure/window/fulltile,
+/obj/structure/barricade/wooden/crude,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"agW" = (
+/obj/structure/table/wood/poker,
+/obj/item/toy/cards/deck/cas,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"agX" = (
+/obj/structure/table/wood/poker,
+/obj/item/trash/candle,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"agY" = (
+/obj/structure/table/wood/poker,
+/obj/item/toy/cards/deck/syndicate,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"agZ" = (
+/obj/item/chair/wood/wings,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"aha" = (
+/obj/structure/sink{
+	dir = 4;
+	pixel_x = 11
+	},
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"ahb" = (
+/obj/structure/mirror,
+/obj/structure/mirror{
+	dir = 8
+	},
+/turf/closed/wall/mineral/wood,
+/area/eventmap/inside)
+"ahc" = (
+/obj/effect/decal/cleanable/cobweb,
+/turf/closed/wall/mineral/wood,
+/area/eventmap/inside)
+"ahd" = (
+/obj/effect/decal/cleanable/cobweb,
+/turf/open/floor/wood{
+	icon_state = "wood-broken7"
+	},
+/area/eventmap/inside)
+"ahe" = (
+/obj/structure/fireplace,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahf" = (
+/obj/item/candle/infinite,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahg" = (
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"ahh" = (
+/obj/item/rupee,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahi" = (
+/obj/effect/meteor/pumpkin{
+	lifetime = 2.14748e+009;
+	light_color = "#FFCC66";
+	light_range = 3
+	},
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"ahj" = (
+/obj/structure/sign/directions/command{
+	dir = 8;
+	pixel_y = 40
+	},
+/obj/structure/sign/directions/security{
+	dir = 8;
+	pixel_y = 32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahk" = (
+/obj/structure/sign/directions/science{
+	pixel_x = 32;
+	pixel_y = 32
+	},
+/obj/structure/sign/directions/evac{
+	pixel_x = 32;
+	pixel_y = 24
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahl" = (
+/obj/structure/table/wood/fancy/green,
+/obj/item/clothing/suit/straight_jacket,
+/obj/machinery/light/broken{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahm" = (
+/obj/structure/table_frame/wood,
+/obj/item/stack/sheet/mineral/wood,
+/obj/effect/decal/cleanable/generic,
+/obj/item/gun/magic/staff/healing,
+/obj/item/gun/magic/wand/resurrection,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahn" = (
+/obj/structure/dresser,
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"aho" = (
+/obj/structure/table/wood/fancy/green,
+/obj/effect/decal/cleanable/cobweb/cobweb2,
+/obj/item/storage/backpack/satchel/med,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahp" = (
+/obj/effect/spawner/structure/window/reinforced,
+/obj/structure/sign/mining,
+/turf/open/floor/plating,
+/area/eventmap/inside)
+"ahq" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "2-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "2-4"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahr" = (
+/obj/effect/spawner/structure/window,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahs" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"aht" = (
+/obj/structure/window/fulltile,
+/obj/structure/barricade/wooden/crude,
+/obj/structure/spacevine,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahu" = (
+/obj/structure/table/wood/poker,
+/obj/item/toy/cards/deck/cas/black,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"ahv" = (
+/obj/structure/table/wood/poker,
+/obj/item/dice/d6,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"ahw" = (
+/obj/structure/table/wood/poker,
+/obj/item/dice/d20,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"ahx" = (
+/obj/structure/cable/yellow{
+	icon_state = "2-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"ahy" = (
+/obj/structure/toilet{
+	dir = 8
+	},
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"ahz" = (
+/obj/structure/table/wood/fancy/royalblack,
+/obj/item/ship_in_a_bottle,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahA" = (
+/obj/structure/table/wood/fancy/royalblack,
+/obj/item/soapstone/infinite,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahB" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahC" = (
+/obj/effect/spawner/structure/window/reinforced,
+/obj/structure/cable/white{
+	icon_state = "0-4"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahD" = (
+/obj/structure/cable/white{
+	icon_state = "1-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahE" = (
+/obj/machinery/light,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/outside)
+"ahF" = (
+/obj/structure/closet/secure_closet/RD,
+/obj/structure/dresser,
+/turf/open/floor/carpet/purple,
+/area/eventmap/inside)
+"ahG" = (
+/obj/structure/closet/secure_closet/RD,
+/obj/item/stamp/rd,
+/turf/open/floor/carpet/purple,
+/area/eventmap/inside)
+"ahH" = (
+/obj/machinery/vending/wardrobe/law_wardrobe,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahI" = (
+/obj/machinery/vending/wardrobe/robo_wardrobe,
+/obj/machinery/light/small,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahJ" = (
+/obj/structure/spacevine,
+/turf/closed/mineral/ash_rock,
+/area/eventmap/mountain)
+"ahK" = (
+/obj/machinery/vending/wardrobe/science_wardrobe,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahL" = (
+/turf/open/floor/sepia,
+/area/eventmap/inside)
+"ahM" = (
+/obj/machinery/vending/wardrobe/engi_wardrobe,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahN" = (
+/obj/structure/table/wood/fancy/orange,
+/obj/item/clothing/suit/armor/riot/knight{
+	pixel_x = 4;
+	pixel_y = -4
+	},
+/obj/item/clothing/suit/armor/riot/knight,
+/obj/item/clothing/suit/armor/riot/knight{
+	pixel_x = -4;
+	pixel_y = 4
+	},
+/obj/item/clothing/head/helmet/knight{
+	pixel_x = 4;
+	pixel_y = -4
+	},
+/obj/item/clothing/head/helmet/knight,
+/obj/item/clothing/head/helmet/knight{
+	pixel_x = -4;
+	pixel_y = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahO" = (
+/obj/machinery/sleeper/syndie/fullupgrade{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahP" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahQ" = (
+/obj/effect/decal/cleanable/dirt,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahR" = (
+/obj/item/paper/fluff/balls/spookyasylum/healstaffnote,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahS" = (
+/obj/structure/chair/wood/wings{
+	dir = 1
+	},
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"ahT" = (
+/obj/structure/table/wood/fancy/royalblack,
+/obj/item/clothing/head/hardhat/pumpkinhead/jaqc,
+/obj/item/seeds/pumpkin,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahU" = (
+/obj/item/candle/infinite,
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"ahV" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-4"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ahW" = (
+/obj/structure/cable/yellow{
+	icon_state = "2-8"
+	},
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"ahX" = (
+/obj/structure/cable/white{
+	icon_state = "2-4"
+	},
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"ahY" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"ahZ" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/spooktime/cobble/sideW,
+/area/eventmap/outside)
+"aia" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/structure/curtain{
+	color = "#B22222";
+	pixel_x = -32
+	},
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"aib" = (
+/obj/structure/cable/white{
+	icon_state = "2-8"
+	},
+/obj/machinery/light/small{
+	dir = 4;
+	light_color = "#d8b1b1"
+	},
+/obj/structure/bed,
+/obj/item/bedsheet/ce,
+/obj/effect/landmark/start/chief_engineer,
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"aic" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/closed/wall/r_wall,
+/area/eventmap/inside)
+"aid" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/machinery/door/airlock/command/glass{
+	name = "Bridge";
+	req_access_txt = "19"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aie" = (
+/obj/structure/cable/white{
+	icon_state = "2-4"
+	},
+/obj/machinery/light/small{
+	dir = 8
+	},
+/turf/open/floor/carpet/purple,
+/area/eventmap/inside)
+"aif" = (
+/obj/machinery/vending/cola/red,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aig" = (
+/obj/effect/turf_decal/caution,
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"aih" = (
+/obj/structure/chair/wood{
+	dir = 1
+	},
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"aii" = (
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"aij" = (
+/mob/living/simple_animal/mouse/brown/Tom,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"aik" = (
+/obj/machinery/computer/slot_machine,
+/turf/open/floor/wood{
+	icon_state = "wood-broken2"
+	},
+/area/eventmap/inside)
+"ail" = (
+/obj/machinery/computer/arcade/orion_trail/kobayashi,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aim" = (
+/obj/machinery/computer/arcade/battle,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ain" = (
+/obj/machinery/computer/arcade/minesweeper,
+/turf/open/floor/wood{
+	icon_state = "wood-broken4"
+	},
+/area/eventmap/inside)
+"aio" = (
+/obj/machinery/computer/arcade/amputation,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aip" = (
+/obj/machinery/computer/arcade/orion_trail,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aiq" = (
+/obj/structure/chair/wood{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"air" = (
+/obj/structure/sign/departments/restroom{
+	pixel_y = 32
+	},
+/turf/open/floor/carpet/purple,
+/area/eventmap/inside)
+"ais" = (
+/obj/structure/closet/cabinet,
+/obj/item/camera/timefreeze,
+/obj/item/cane,
+/obj/item/cardboard_cutout,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ait" = (
+/obj/structure/dresser,
+/turf/open/floor/carpet/cyan,
+/area/eventmap/inside)
+"aiu" = (
+/obj/structure/fireplace,
+/turf/open/floor/carpet/cyan,
+/area/eventmap/inside)
+"aiv" = (
+/turf/open/floor/carpet/cyan,
+/area/eventmap/inside)
+"aiw" = (
+/obj/structure/table/wood,
+/obj/item/flashlight/lamp,
+/turf/open/floor/carpet/cyan,
+/area/eventmap/inside)
+"aix" = (
+/obj/effect/temp_visual/cult/turf/floor,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aiy" = (
+/obj/effect/decal/cleanable/blood/tracks,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aiz" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/structure/curtain{
+	color = "#B22222";
+	pixel_x = 32
+	},
+/turf/open/floor/carpet/purple,
+/area/eventmap/inside)
+"aiA" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"aiB" = (
+/obj/structure/table/wood/fancy/orange,
+/obj/item/clothing/suit/armor/riot/knight/yellow{
+	pixel_x = 4;
+	pixel_y = -4
+	},
+/obj/item/clothing/suit/armor/riot/knight/yellow,
+/obj/item/clothing/suit/armor/riot/knight/yellow{
+	pixel_x = -4;
+	pixel_y = 4
+	},
+/obj/item/clothing/head/helmet/knight/yellow{
+	pixel_x = 4;
+	pixel_y = -4
+	},
+/obj/item/clothing/head/helmet/knight/yellow,
+/obj/item/clothing/head/helmet/knight/yellow{
+	pixel_x = -4;
+	pixel_y = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aiC" = (
+/obj/structure/sign/departments/chemistry{
+	pixel_y = -32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aiD" = (
+/obj/machinery/vending/snack/green,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aiE" = (
+/obj/structure/table/wood,
+/obj/item/stack/medical/bruise_pack,
+/obj/item/stack/medical/ointment,
+/obj/item/candle/infinite,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/machinery/door/firedoor,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aiF" = (
+/obj/machinery/smartfridge/chemistry/preloaded,
+/turf/closed/wall/mineral/wood,
+/area/eventmap/inside)
+"aiG" = (
+/obj/structure/table/wood,
+/obj/item/folder/white,
+/obj/item/folder/blue,
+/obj/item/reagent_containers/food/drinks/mug/coco,
+/obj/machinery/door/firedoor,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aiH" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/effect/turf_decal/tile/green{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/green{
+	dir = 1
+	},
+/obj/effect/turf_decal/tile/green{
+	dir = 8
+	},
+/obj/machinery/door/firedoor,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aiI" = (
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/turf/open/floor/carpet/orange,
+/area/eventmap/inside)
+"aiJ" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/structure/noticeboard/ce{
+	pixel_y = 32
+	},
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"aiK" = (
+/obj/structure/cable/white{
+	icon_state = "2-4"
+	},
+/obj/structure/cable/white{
+	icon_state = "2-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"aiL" = (
+/obj/effect/turf_decal/tile/green{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/green,
+/obj/effect/turf_decal/tile/green{
+	dir = 1
+	},
+/obj/machinery/door/firedoor,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aiM" = (
+/obj/structure/mineral_door/wood,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/sepia,
+/area/eventmap/inside)
+"aiN" = (
+/obj/structure/showcase/machinery/tv,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aiO" = (
+/mob/living/simple_animal/mouse/brown,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aiP" = (
+/obj/structure/bed,
+/obj/effect/spawner/lootdrop/bedsheet,
+/turf/open/floor/carpet/cyan,
+/area/eventmap/inside)
+"aiQ" = (
+/obj/structure/bed,
+/obj/item/bedsheet/cosmos,
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"aiR" = (
+/obj/effect/decal/cleanable/blood/tracks,
+/obj/item/candle/infinite,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aiS" = (
+/obj/effect/turf_decal/tile/yellow,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountain)
+"aiT" = (
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/turf/open/indestructible/cobble,
+/area/eventmap/outside)
+"aiU" = (
+/obj/structure/chair/wood{
+	dir = 4
+	},
+/obj/item/chair/wood,
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"aiV" = (
+/obj/structure/table/wood/fancy/green,
+/obj/item/trash/plate,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aiW" = (
+/obj/machinery/chem_master,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aiX" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"aiY" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"aiZ" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"aja" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/white{
+	icon_state = "2-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "2-4"
+	},
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"ajb" = (
+/obj/structure/chair/wood{
+	dir = 1
+	},
+/obj/effect/landmark/start/chemist,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ajc" = (
+/obj/structure/table/glass,
+/obj/item/reagent_containers/dropper,
+/obj/item/reagent_containers/dropper,
+/obj/item/reagent_containers/glass/beaker/large,
+/obj/item/reagent_containers/glass/beaker/large,
+/obj/item/stack/sheet/mineral/plasma,
+/obj/item/stack/sheet/mineral/plasma,
+/obj/item/storage/box/beakers,
+/obj/item/storage/box/beakers,
+/obj/item/storage/box/beakers/bluespace,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ajd" = (
+/obj/structure/chair/wood{
+	dir = 1
+	},
+/obj/item/toy/plush/catgirl/fermis,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aje" = (
+/turf/open/floor/wood{
+	icon_state = "wood-broken"
+	},
+/area/eventmap/inside)
+"ajf" = (
+/obj/structure/table/wood,
+/obj/item/pen,
+/obj/item/folder/documents,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ajg" = (
+/obj/structure/chair/office/light{
+	dir = 8
+	},
+/turf/open/floor/carpet/cyan,
+/area/eventmap/inside)
+"ajh" = (
+/obj/structure/table/wood/fancy/royalblack,
+/obj/item/clothing/head/hardhat/pumpkinhead/jaqc,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aji" = (
+/obj/item/toy/plush/mammal/dog,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ajj" = (
+/obj/structure/table/wood,
+/obj/item/hemostat/supermatter,
+/turf/open/floor/carpet/cyan,
+/area/eventmap/inside)
+"ajk" = (
+/obj/effect/turf_decal/tile/green{
+	dir = 1
+	},
+/obj/effect/turf_decal/tile/green{
+	dir = 8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"ajl" = (
+/obj/structure/sign/directions/evac{
+	dir = 8;
+	pixel_x = 32
+	},
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"ajm" = (
+/obj/effect/turf_decal/tile/green{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/green,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"ajn" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"ajo" = (
+/obj/machinery/sleeper/syndie/fullupgrade{
+	dir = 8
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"ajp" = (
+/obj/machinery/iv_drip,
+/obj/structure/closet/crate/freezer/blood,
+/turf/open/floor/sepia,
+/area/eventmap/inside)
+"ajq" = (
+/obj/structure/chair/sofa/right{
+	dir = 1
+	},
+/turf/open/floor/wood{
+	icon_state = "wood-broken"
+	},
+/area/eventmap/inside)
+"ajr" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"ajs" = (
+/obj/structure/table/wood,
+/obj/item/toy/cards/deck/cas/black,
+/obj/item/toy/cards/deck/cas/black,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ajt" = (
+/obj/structure/chair/comfy/plywood,
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"aju" = (
+/obj/structure/table/wood,
+/obj/item/toy/cards/deck/syndicate,
+/obj/item/toy/cards/deck/syndicate,
+/obj/item/toy/cards/deck/syndicate,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ajv" = (
+/obj/structure/table/wood,
+/obj/item/toy/cards/deck/cas,
+/obj/item/toy/cards/deck/cas,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ajw" = (
+/obj/structure/table/wood,
+/obj/item/toy/cards/deck,
+/obj/item/toy/cards/deck,
+/obj/item/toy/cards/deck,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ajx" = (
+/obj/item/clothing/suit/ghost_sheet,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ajy" = (
+/obj/structure/spacevine,
+/turf/closed/wall/mineral/wood,
+/area/eventmap/inside)
+"ajz" = (
+/obj/item/paper/pamphlet/ruin/originalcontent/yelling,
+/turf/closed/wall/mineral/wood,
+/area/eventmap/inside)
+"ajA" = (
+/obj/structure/table/wood/fancy/royalblack,
+/obj/item/key/collar,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ajB" = (
+/obj/structure/table/wood/fancy/royalblack,
+/obj/item/lipstick,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ajC" = (
+/obj/machinery/vending/wallmed{
+	pixel_y = 32
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"ajD" = (
+/obj/effect/decal/cleanable/cobweb/cobweb2,
+/obj/structure/bed/roller,
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/item/clothing/suit/straight_jacket,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"ajE" = (
+/obj/effect/decal/cleanable/dirt,
+/obj/machinery/light/small{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ajF" = (
+/obj/structure/table/wood,
+/obj/item/reagent_containers/spray/cleaner{
+	pixel_x = 8;
+	pixel_y = 3
+	},
+/obj/item/reagent_containers/glass/bucket,
+/obj/effect/decal/cleanable/cobweb,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ajG" = (
+/obj/structure/cable/white{
+	icon_state = "1-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/turf/open/indestructible/cobble,
+/area/eventmap/outside)
+"ajH" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-8"
+	},
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"ajI" = (
+/obj/structure/cable/white{
+	icon_state = "2-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "2-4"
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-8"
+	},
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"ajJ" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/spooktime/cobble/sideE,
+/area/eventmap/outside)
+"ajK" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/structure/noticeboard/rd{
+	pixel_y = 32
+	},
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"ajL" = (
+/obj/structure/cable/white{
+	icon_state = "1-8"
+	},
+/turf/open/floor/carpet/purple,
+/area/eventmap/inside)
+"ajM" = (
+/obj/structure/chair/wood{
+	dir = 4
+	},
+/turf/open/floor/wood{
+	icon_state = "wood-broken5"
+	},
+/area/eventmap/inside)
+"ajN" = (
+/obj/item/clothing/suit/ghost_sheet,
+/turf/open/floor/carpet/purple,
+/area/eventmap/inside)
+"ajO" = (
+/turf/open/floor/carpet/purple,
+/area/eventmap/inside)
+"ajP" = (
+/obj/structure/table/wood,
+/obj/item/pen,
+/obj/item/storage/box/fountainpens,
+/obj/effect/decal/cleanable/cobweb,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ajQ" = (
+/obj/structure/chair/office/dark{
+	dir = 8
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"ajR" = (
+/obj/structure/table/wood,
+/obj/item/flashlight/lantern,
+/obj/item/folder/syndicate/red,
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"ajS" = (
+/obj/item/statuebust,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ajT" = (
+/obj/item/statuebust,
+/turf/open/floor/wood{
+	icon_state = "wood-broken2"
+	},
+/area/eventmap/inside)
+"ajU" = (
+/obj/structure/table/wood/fancy/green,
+/obj/item/storage/fancy/donut_box,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ajV" = (
+/obj/machinery/chem_dispenser,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ajW" = (
+/obj/machinery/chem_heater,
+/obj/effect/decal/cleanable/greenglow,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ajX" = (
+/obj/structure/closet/crate/freezer/surplus_limbs,
+/obj/structure/cable/yellow{
+	icon_state = "0-4"
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"ajY" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-8"
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"ajZ" = (
+/obj/structure/table/wood,
+/obj/item/cautery{
+	pixel_y = 3
+	},
+/obj/item/retractor,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aka" = (
+/obj/item/mop,
+/obj/machinery/light/small{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akb" = (
+/obj/structure/bed,
+/obj/item/bedsheet/rd/royal_cape,
+/obj/effect/landmark/start/research_director,
+/turf/open/floor/carpet/purple,
+/area/eventmap/inside)
+"akc" = (
+/obj/structure/table/wood/fancy/orange,
+/obj/item/clothing/suit/armor/riot/knight/red{
+	pixel_x = 4;
+	pixel_y = -4
+	},
+/obj/item/clothing/suit/armor/riot/knight/red,
+/obj/item/clothing/suit/armor/riot/knight/red{
+	pixel_x = -4;
+	pixel_y = 4
+	},
+/obj/item/clothing/head/helmet/knight/red{
+	pixel_x = 4;
+	pixel_y = -4
+	},
+/obj/item/clothing/head/helmet/knight/red,
+/obj/item/clothing/head/helmet/knight/red{
+	pixel_x = -4;
+	pixel_y = 4
+	},
+/obj/machinery/light/small{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akd" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/white{
+	icon_state = "2-8"
+	},
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"ake" = (
+/obj/structure/sign/poster/official/no_erp,
+/turf/closed/wall/r_wall,
+/area/eventmap/inside)
+"akf" = (
+/obj/machinery/light/small{
+	dir = 8
+	},
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"akg" = (
+/obj/effect/decal/cleanable/cobweb,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akh" = (
+/obj/structure/chair/wood/wings,
+/mob/living/simple_animal/astral,
+/turf/open/floor/wood{
+	icon_state = "wood-broken5"
+	},
+/area/eventmap/inside)
+"aki" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/mob/living/simple_animal/hostile/retaliate/bat,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akj" = (
+/obj/structure/chair/wood/wings,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akk" = (
+/obj/structure/chair/wood/wings,
+/turf/open/floor/wood{
+	icon_state = "wood-broken2"
+	},
+/area/eventmap/inside)
+"akl" = (
+/obj/structure/bed,
+/obj/effect/spawner/lootdrop/bedsheet,
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"akm" = (
+/obj/structure/mineral_door/woodrustic,
+/obj/structure/barricade/wooden/crude,
+/obj/structure/spacevine,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akn" = (
+/obj/structure/table/wood/fancy/green,
+/obj/item/chair/wood,
+/obj/item/clothing/glasses/hud/health,
+/obj/item/clothing/glasses/hud/health,
+/obj/item/clothing/glasses/hud/health,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ako" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"akp" = (
+/obj/effect/landmark/start/chief_engineer,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"akq" = (
+/obj/effect/landmark/start/research_director,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"akr" = (
+/obj/machinery/light/small{
+	dir = 4
+	},
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"aks" = (
+/obj/structure/closet/wardrobe/chemistry_white,
+/obj/machinery/light/small{
+	dir = 8
+	},
+/obj/item/grenade/chem_grenade/glitter/blue,
+/obj/item/grenade/chem_grenade/glitter/pink,
+/obj/item/grenade/chem_grenade/glitter/white,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akt" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/effect/decal/cleanable/chem_pile,
+/obj/machinery/light/small,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aku" = (
+/obj/structure/closet/secure_closet/medical1,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akv" = (
+/obj/machinery/light{
+	dir = 8
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"akw" = (
+/obj/structure/chair/wood/wings{
+	dir = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akx" = (
+/obj/structure/table/wood/fancy/red,
+/obj/item/book_of_babel,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"aky" = (
+/obj/structure/table/wood/fancy/red,
+/obj/item/candle/infinite,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"akz" = (
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"akA" = (
+/turf/open/floor/spooktime/riverwatermotion,
+/area/eventmap/outside)
+"akB" = (
+/obj/structure/table/wood/fancy/red,
+/obj/item/toy/plush/lampplushie,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"akC" = (
+/obj/structure/table/wood/fancy/red,
+/obj/item/book/granter/action/drink_fling,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"akD" = (
+/obj/structure/table/wood/fancy/red,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"akE" = (
+/obj/structure/table/wood/fancy/red,
+/obj/item/storage/bag/books,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"akF" = (
+/obj/structure/closet/cabinet,
+/obj/item/codespeak_manual/unlimited,
+/obj/item/cookiesynth,
+/obj/item/fugu_gland,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akG" = (
+/obj/structure/dresser,
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"akH" = (
+/obj/item/ectoplasm,
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"akI" = (
+/obj/structure/table/wood,
+/obj/item/flashlight/lamp/bananalamp,
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"akJ" = (
+/obj/machinery/washing_machine,
+/obj/effect/decal/cleanable/cobweb,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akK" = (
+/mob/living/simple_animal/hostile/retaliate/bat{
+	attack_sound = 'sound/spookoween/ahaha.ogg';
+	desc = "A spooky, floating washing machine possesed by some specture! Responsibilities, clearly the scariest thing imaginable.";
+	icon = 'icons/obj/machines/washing_machine.dmi';
+	icon_dead = "wm_1_0";
+	icon_gib = "wm_1_0";
+	icon_living = "wm_1_0";
+	icon_state = "wm_1_0";
+	melee_damage_lower = 0;
+	melee_damage_upper = 0;
+	name = "Posessed washing machine"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akL" = (
+/obj/structure/closet/cabinet,
+/obj/item/instrument/accordion,
+/obj/item/instrument/bikehorn,
+/obj/item/instrument/eguitar,
+/obj/item/instrument/glockenspiel,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akM" = (
+/obj/structure/table/wood/fancy/monochrome,
+/obj/item/instrument/violin/golden,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akN" = (
+/obj/structure/table/wood/fancy/monochrome,
+/obj/machinery/chem_dispenser/drinks/fullupgrade,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akO" = (
+/obj/structure/table/wood/fancy/monochrome,
+/obj/machinery/chem_dispenser/drinks/beer/fullupgrade,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akP" = (
+/obj/structure/table/wood/fancy/monochrome,
+/obj/item/instrument/trumpet/spectral,
+/obj/item/instrument/trombone/spectral,
+/obj/item/instrument/saxophone/spectral,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akQ" = (
+/obj/structure/closet/cabinet,
+/obj/item/instrument/guitar,
+/obj/item/instrument/harmonica,
+/obj/item/instrument/piano_synth,
+/obj/item/instrument/recorder,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akR" = (
+/obj/machinery/jukebox,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akS" = (
+/obj/structure/bookcase/random/reference,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akT" = (
+/obj/structure/table/wood/fancy/orange,
+/obj/item/clothing/suit/armor/riot/knight/blue{
+	pixel_x = 4;
+	pixel_y = -4
+	},
+/obj/item/clothing/suit/armor/riot/knight/blue,
+/obj/item/clothing/suit/armor/riot/knight/blue{
+	pixel_x = -4;
+	pixel_y = 4
+	},
+/obj/item/stamp/clown,
+/obj/item/clothing/head/helmet/knight/blue{
+	pixel_x = 4;
+	pixel_y = -4
+	},
+/obj/item/clothing/head/helmet/knight/blue,
+/obj/item/clothing/head/helmet/knight/blue{
+	pixel_x = -4;
+	pixel_y = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akU" = (
+/obj/structure/dresser,
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akV" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/obj/machinery/door/airlock/command/glass{
+	name = "Bridge";
+	req_access_txt = "19"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akW" = (
+/obj/structure/table/wood/fancy,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akX" = (
+/obj/effect/landmark/start/medical_doctor,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"akY" = (
+/obj/structure/chair/wood/wings{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"akZ" = (
+/obj/machinery/computer/security{
+	dir = 4
+	},
+/obj/machinery/light/small{
+	brightness = 3;
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ala" = (
+/obj/machinery/computer/station_alert,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alb" = (
+/obj/machinery/computer/monitor{
+	name = "bridge power monitoring console"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alc" = (
+/obj/machinery/computer/bounty,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ald" = (
+/obj/machinery/computer/cargo/request,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ale" = (
+/obj/machinery/computer/communications,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alf" = (
+/obj/structure/table/wood,
+/obj/machinery/computer/med_data/laptop,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alg" = (
+/obj/effect/turf_decal/stripes/asteroid/corner,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alh" = (
+/obj/structure/table/wood,
+/obj/item/circular_saw,
+/obj/item/hemostat,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"ali" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood{
+	icon_state = "wood-broken2"
+	},
+/area/eventmap/inside)
+"alj" = (
+/obj/effect/decal/cleanable/glass,
+/obj/item/organ/tail/cat,
+/obj/machinery/light/broken{
+	dir = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alk" = (
+/obj/effect/turf_decal/stripes/asteroid/line,
+/obj/structure/table/wood,
+/obj/item/paper_bin,
+/obj/item/pen,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"all" = (
+/obj/structure/table/wood/fancy/red,
+/obj/item/book/granter/crafting_recipe/under_the_oven,
+/obj/item/book/granter/crafting_recipe/cooking_sweets_101,
+/obj/item/book/granter/crafting_recipe/coldcooking,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"alm" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"aln" = (
+/obj/structure/table/wood/fancy/red,
+/obj/item/storage/book/bible/booze,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"alo" = (
+/obj/structure/table/wood/fancy/red,
+/obj/machinery/computer/libraryconsole,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"alp" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/carpet/purple,
+/area/eventmap/inside)
+"alq" = (
+/obj/structure/sign/poster/official/ian,
+/turf/closed/wall/mineral/wood,
+/area/eventmap/inside)
+"alr" = (
+/mob/living/simple_animal/crab/evil,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"als" = (
+/mob/living/simple_animal/mouse/gray,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alt" = (
+/mob/living/simple_animal/hostile/retaliate/bat{
+	attack_sound = 'sound/spookoween/ahaha.ogg';
+	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
+	icon = 'icons/obj/musician.dmi';
+	icon_dead = "synth";
+	icon_gib = "synth";
+	icon_living = "synth";
+	icon_state = "synth";
+	melee_damage_lower = 0;
+	melee_damage_upper = 0;
+	name = "Posessed synth"
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"alu" = (
+/mob/living/simple_animal/hostile/retaliate/bat{
+	attack_sound = 'sound/spookoween/ahaha.ogg';
+	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
+	icon = 'icons/obj/musician.dmi';
+	icon_dead = "glockenspiel";
+	icon_gib = "glockenspiel";
+	icon_living = "glockenspiel";
+	icon_state = "glockenspiel";
+	melee_damage_lower = 0;
+	melee_damage_upper = 0;
+	name = "Posessed glockenspiel"
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"alv" = (
+/obj/machinery/light/small,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"alw" = (
+/obj/structure/table/wood,
+/obj/item/toy/cards/deck/syndicate,
+/turf/open/floor/wood/damturf/broken3,
+/area/eventmap/mountaininside)
+"alx" = (
+/obj/effect/turf_decal/stripes/asteroid/line,
+/obj/structure/table/wood,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aly" = (
+/obj/effect/turf_decal/stripes/asteroid/line,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alz" = (
+/obj/machinery/vending/wardrobe/chem_wardrobe,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alA" = (
+/obj/structure/closet/cabinet,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"alB" = (
+/obj/structure/window/fulltile,
+/obj/structure/barricade/wooden/crude,
+/obj/effect/spawner/structure/window,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alC" = (
+/mob/living/simple_animal/hostile/retaliate/bat/secbat,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"alD" = (
+/obj/structure/chair/wood/wings{
+	dir = 1
+	},
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"alE" = (
+/mob/living/simple_animal/hostile/retaliate/bat,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"alF" = (
+/obj/item/toy/cattoy,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"alG" = (
+/obj/structure/dresser,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"alH" = (
+/obj/structure/closet/cabinet,
+/obj/item/storage/daki,
+/obj/item/valentine,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"alI" = (
+/obj/machinery/pdapainter,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alJ" = (
+/mob/living/simple_animal/hostile/retaliate/bat{
+	attack_sound = 'sound/spookoween/ahaha.ogg';
+	desc = "A floating shopping list. It has the words Milk, eggs and cheese on it.";
+	icon = 'icons/obj/bureaucracy.dmi';
+	icon_dead = "paper_words";
+	icon_living = "paper_words";
+	icon_state = "paper_words";
+	melee_damage_lower = 0;
+	melee_damage_upper = 0;
+	name = "Floating Shopping List"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alK" = (
+/obj/structure/bedsheetbin/towel,
+/obj/structure/table/reinforced/brass,
+/obj/item/storage/fancy/heart_box,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alL" = (
+/obj/structure/flora/ausbushes/sunnybush,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"alM" = (
+/obj/item/chair/wood/wings{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alN" = (
+/obj/structure/bookcase/manuals/engineering,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alO" = (
+/obj/machinery/photocopier,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alP" = (
+/obj/structure/mineral_door/wood{
+	name = "Costumes and Luxury Dorms"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alQ" = (
+/obj/structure/table/wood,
+/obj/item/toy/cards/deck/cas/black,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"alR" = (
+/obj/effect/spawner/structure/window/reinforced/tinted,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alS" = (
+/obj/effect/turf_decal/caution/white{
+	dir = 1;
+	pixel_y = -8
+	},
+/turf/open/floor/wood/damturf/broken7,
+/area/eventmap/inside)
+"alT" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-4"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alU" = (
+/obj/machinery/door/airlock/wood/dorms/dorm03,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alV" = (
+/obj/structure/table/wood,
+/obj/machinery/computer/secure_data/laptop{
+	dir = 4;
+	pixel_y = 6
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alW" = (
+/obj/structure/chair/office/dark{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alX" = (
+/obj/structure/chair/office/dark{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alY" = (
+/obj/structure/table/glass,
+/obj/machinery/reagentgrinder,
+/obj/item/reagent_containers/glass/beaker/large,
+/obj/structure/cable/yellow{
+	icon_state = "0-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"alZ" = (
+/obj/structure/cloth_pile,
+/obj/effect/turf_decal/tile/green{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/green,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"ama" = (
+/obj/structure/chair/office/dark{
+	dir = 1
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"amb" = (
+/obj/structure/closet/secure_closet/medical2,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"amc" = (
+/obj/machinery/computer/operating{
+	dir = 1
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"amd" = (
+/obj/structure/table/optable,
+/obj/item/healthanalyzer/advanced,
+/obj/item/clothing/gloves/color/latex/nitrile,
+/obj/item/clothing/mask/surgical,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"ame" = (
+/obj/structure/bookcase/random/adult,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"amf" = (
+/obj/structure/bookcase/random/fiction,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"amg" = (
+/obj/structure/bookcase/random/nonfiction{
+	books_to_load = 5
+	},
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"amh" = (
+/obj/structure/bookcase/random/reference,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"ami" = (
+/obj/structure/bookcase/random/religion,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"amj" = (
+/obj/structure/bookcase/manuals/medical,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"amk" = (
+/turf/open/floor/plasteel/stairs/medium,
+/area/eventmap/inside)
+"aml" = (
+/obj/structure/flora/grass/jungle/b,
+/obj/effect/wisp,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"amm" = (
+/obj/item/candle/infinite,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"amn" = (
+/obj/structure/flora/junglebush{
+	icon_state = "grassa4"
+	},
+/obj/effect/wisp,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"amo" = (
+/obj/item/toy/fluff/tennis_poly/tri/squeak/rainbow,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"amp" = (
+/obj/item/seeds/pumpkin,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"amq" = (
+/obj/structure/bedsheetbin/color,
+/obj/structure/table/reinforced/brass,
+/obj/item/storage/fancy/donut_box,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"amr" = (
+/obj/item/chair/wood/wings{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ams" = (
+/mob/living/simple_animal/hostile/retaliate/bat{
+	attack_sound = 'sound/spookoween/ahaha.ogg';
+	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
+	icon = 'icons/obj/musician.dmi';
+	icon_dead = "trumpet";
+	icon_gib = "trumpet";
+	icon_living = "trumpet";
+	icon_state = "trumpet";
+	melee_damage_lower = 0;
+	melee_damage_upper = 0;
+	name = "Posessed trumpet"
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"amt" = (
+/mob/living/simple_animal/hostile/retaliate/bat{
+	attack_sound = 'sound/spookoween/ahaha.ogg';
+	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
+	icon = 'icons/obj/musician.dmi';
+	icon_dead = "guitar";
+	icon_gib = "guitar";
+	icon_living = "guitar";
+	icon_state = "guitar";
+	melee_damage_lower = 0;
+	melee_damage_upper = 0;
+	name = "Posessed Guitar"
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"amu" = (
+/mob/living/simple_animal/hostile/retaliate/bat{
+	attack_sound = 'sound/spookoween/ahaha.ogg';
+	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
+	icon = 'icons/obj/musician.dmi';
+	icon_dead = "violin";
+	icon_gib = "violin";
+	icon_living = "violin";
+	icon_state = "violin";
+	melee_damage_lower = 0;
+	melee_damage_upper = 0;
+	name = "Posessed violin"
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"amv" = (
+/mob/living/simple_animal/hostile/retaliate/bat{
+	attack_sound = 'sound/spookoween/ahaha.ogg';
+	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
+	icon = 'icons/obj/musician.dmi';
+	icon_dead = "saxophone";
+	icon_gib = "saxophone";
+	icon_living = "saxophone";
+	icon_state = "saxophone";
+	melee_damage_lower = 0;
+	melee_damage_upper = 0;
+	name = "Posessed saxophone"
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"amw" = (
+/obj/structure/chair/wood/wings{
+	dir = 8
+	},
+/turf/open/floor/wood{
+	icon_state = "wood-broken6"
+	},
+/area/eventmap/inside)
+"amx" = (
+/obj/structure/table/wood,
+/obj/item/scalpel,
+/obj/item/surgical_drapes,
+/obj/item/surgicaldrill,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"amy" = (
+/obj/structure/table/wood,
+/obj/item/storage/box/donkpockets,
+/obj/machinery/light/small{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"amz" = (
+/obj/structure/bookcase/random/religion,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"amA" = (
+/obj/structure/bookcase/random/fiction,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"amB" = (
+/obj/structure/chair/wood{
+	dir = 4
+	},
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"amC" = (
+/obj/structure/table/wood/fancy/green,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"amD" = (
+/obj/structure/table/reinforced,
+/obj/structure/table/reinforced,
+/obj/item/paper/fluff/balls/spookyasylum{
+	name = "paper - 10/7/2559"
+	},
+/turf/open/floor/plating,
+/area/eventmap/mountaininside)
+"amE" = (
+/obj/machinery/door/airlock/medical/glass{
+	name = "Chemistry Lab";
+	req_access_txt = "5; 33"
+	},
+/obj/machinery/door/firedoor,
+/obj/machinery/door/firedoor,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"amF" = (
+/obj/structure/chair/wood/wings{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"amG" = (
+/obj/structure/table/wood,
+/obj/machinery/microwave,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"amH" = (
+/obj/structure/chair/wood{
+	dir = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"amI" = (
+/obj/structure/table/wood/fancy/green,
+/obj/item/toy/figure/cmo,
+/obj/item/megaphone/command,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"amJ" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/white{
+	icon_state = "2-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "2-4"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"amK" = (
+/obj/machinery/chem_heater,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"amL" = (
+/obj/item/candle/infinite,
+/obj/machinery/light/small/broken{
+	dir = 8
+	},
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"amM" = (
+/obj/structure/flora/ausbushes/palebush,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"amN" = (
+/obj/item/candle/infinite,
+/obj/structure/flora/grass/jungle/b,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"amO" = (
+/obj/structure/closet/wardrobe/chemistry_white,
+/obj/machinery/light/small{
+	dir = 4;
+	light_color = "#d8b1b1"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"amP" = (
+/obj/structure/bookcase/random/nonfiction,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"amQ" = (
+/obj/structure/chair/wood{
+	dir = 4
+	},
+/obj/effect/landmark/start/virologist,
+/obj/structure/sign/departments/chemistry{
+	pixel_x = -32
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"amR" = (
+/obj/structure/bookcase/manuals/research_and_development,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"amS" = (
+/obj/item/hot_potato/harmless/toy{
+	name = "Rotato potato"
+	},
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"amT" = (
+/obj/structure/bed/dogbed,
+/mob/living/simple_animal/pet/dog/corgi{
+	icon_state = "corgigrey";
+	name = "Ghost corgi"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"amU" = (
+/obj/item/stack/sheet/bone,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"amV" = (
+/obj/structure/bed/dogbed{
+	name = "cat bed"
+	},
+/mob/living/simple_animal/pet/cat/custom_cat{
+	name = "Ghost cat"
+	},
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"amW" = (
+/obj/structure/table/wood,
+/obj/item/flashlight/lamp,
+/obj/item/reagent_containers/food/snacks/grown/tea/catnip{
+	icon_state = "coffee_robusta"
+	},
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"amX" = (
+/obj/item/mop,
+/obj/item/mop/advanced,
+/obj/structure/closet/jcloset,
+/obj/item/reagent_containers/spray/cleaner,
+/obj/item/reagent_containers/spray/cleaner,
+/obj/item/reagent_containers/spray/cleaner,
+/obj/item/extinguisher/advanced,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"amY" = (
+/obj/structure/bedsheetbin,
+/obj/structure/table/reinforced/brass,
+/obj/item/storage/fancy/candle_box,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"amZ" = (
+/obj/structure/chair/wood/wings{
+	dir = 4
+	},
+/turf/open/floor/wood{
+	icon_state = "wood-broken5"
+	},
+/area/eventmap/inside)
+"ana" = (
+/obj/structure/flora/grass/jungle/b,
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"anb" = (
+/turf/open/floor/grass/fakebasalt,
+/area/eventmap/outside)
+"anc" = (
+/obj/structure/flora/grass/jungle/b,
+/turf/open/floor/grass/fakebasalt,
+/area/eventmap/outside)
+"and" = (
+/obj/structure/mineral_door/woodrustic,
+/turf/open/floor/spooktime/cobble/cornerNW,
+/area/eventmap/outside)
+"ane" = (
+/obj/structure/flora/grass/jungle/b{
+	icon_state = "bushb"
+	},
+/turf/open/floor/spooktime/cobble/sideN,
+/area/eventmap/outside)
+"anf" = (
+/obj/structure/flora/grass/jungle/b{
+	icon_state = "grassb2"
+	},
+/turf/open/floor/spooktime/cobble/cornerNE,
+/area/eventmap/outside)
+"ang" = (
+/obj/structure/table/wood/fancy/black,
+/obj/item/storage/box/gloves,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"anh" = (
+/obj/machinery/atmospherics/components/unary/cryo_cell,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"ani" = (
+/obj/structure/chair/office/dark{
+	dir = 4
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"anj" = (
+/obj/machinery/atmospherics/pipe/simple{
+	dir = 6
+	},
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"ank" = (
+/obj/machinery/atmospherics/components/unary/thermomachine/freezer{
+	dir = 8
+	},
+/obj/effect/decal/cleanable/cobweb/cobweb2,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"anl" = (
+/obj/structure/table/wood/fancy/green,
+/obj/item/camera,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"anm" = (
+/obj/structure/chair/wood,
+/obj/effect/landmark/start/chemist,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ann" = (
+/obj/structure/table/glass,
+/obj/item/reagent_containers/dropper,
+/obj/item/reagent_containers/glass/beaker/large,
+/obj/item/stack/sheet/mineral/plasma,
+/obj/item/storage/box/beakers,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ano" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"anp" = (
+/obj/structure/chair/wood{
+	dir = 4
+	},
+/obj/machinery/light/small{
+	dir = 8
+	},
+/obj/effect/landmark/start/medical_doctor,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"anq" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"anr" = (
+/obj/machinery/computer/card{
+	dir = 8
+	},
+/obj/structure/cable/white{
+	icon_state = "2-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ans" = (
+/obj/machinery/light/small,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"ant" = (
+/obj/structure/table/wood/fancy/black,
+/obj/item/stack/medical/bruise_pack,
+/obj/item/stack/medical/ointment,
+/obj/item/stack/medical/gauze,
+/obj/item/storage/pill_bottle/mutadone,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"anu" = (
+/obj/machinery/atmospherics/pipe/simple{
+	dir = 5
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"anv" = (
+/obj/structure/spacevine,
+/obj/structure/spacevine,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/outside)
+"anw" = (
+/obj/structure/flora/rock/jungle,
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"anx" = (
+/obj/structure/flora/rock/pile/largejungle,
+/turf/open/indestructible/cobble,
+/area/eventmap/outside)
+"any" = (
+/obj/structure/mineral_door/woodrustic,
+/turf/open/floor/spooktime/cobble/sideW,
+/area/eventmap/outside)
+"anz" = (
+/obj/structure/flora/grass/jungle/b{
+	icon_state = "bushb3"
+	},
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"anA" = (
+/obj/structure/fluff/fokoff_sign{
+	desc = "A crudely-made sign with the words 'too spooky' written in some sort of red paint."
+	},
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"anB" = (
+/obj/structure/flora/grass/jungle/b{
+	icon_state = "bushb2"
+	},
+/turf/open/floor/spooktime/cobble/sideE,
+/area/eventmap/outside)
+"anC" = (
+/obj/machinery/atmospherics/pipe/manifold,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"anD" = (
+/obj/machinery/atmospherics/pipe/manifold4w,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"anE" = (
+/obj/machinery/atmospherics/components/unary/portables_connector/visible{
+	dir = 8
+	},
+/obj/machinery/portable_atmospherics/canister/oxygen,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"anF" = (
+/obj/structure/mineral_door/wood,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"anG" = (
+/obj/structure/mineral_door/wood,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"anH" = (
+/obj/structure/flora/ausbushes/leafybush,
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"anI" = (
+/obj/structure/flora/grass/jungle/b{
+	icon_state = "grassa5"
+	},
+/turf/open/floor/spooktime/cobble/sideS,
+/area/eventmap/outside)
+"anJ" = (
+/turf/open/floor/wood{
+	icon_state = "wood-broken7"
+	},
+/area/eventmap/inside)
+"anK" = (
+/obj/structure/bookcase/random/nonfiction,
+/turf/open/floor/wood{
+	icon_state = "wood-broken"
+	},
+/area/eventmap/inside)
+"anL" = (
+/obj/structure/bookcase/random/adult,
+/turf/open/floor/wood{
+	icon_state = "wood-broken5"
+	},
+/area/eventmap/inside)
+"anM" = (
+/mob/living/simple_animal/hostile/retaliate/bat{
+	attack_sound = 'sound/spookoween/ahaha.ogg';
+	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
+	icon = 'icons/obj/musician.dmi';
+	icon_dead = "golden_violin";
+	icon_gib = "golden_violin";
+	icon_living = "golden_violin";
+	icon_state = "golden_violin";
+	melee_damage_lower = 0;
+	melee_damage_upper = 0;
+	name = "Posessed golden violin"
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"anN" = (
+/obj/machinery/jukebox/disco/indestructible{
+	req_one_access = list()
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"anO" = (
+/mob/living/simple_animal/hostile/retaliate/bat{
+	attack_sound = 'sound/spookoween/ahaha.ogg';
+	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
+	icon = 'icons/obj/musician.dmi';
+	icon_dead = "eguitar";
+	icon_gib = "eguitar";
+	icon_living = "eguitar";
+	icon_state = "eguitar";
+	melee_damage_lower = 0;
+	melee_damage_upper = 0;
+	name = "Posessed electric guitar"
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"anP" = (
+/obj/effect/spawner/structure/window,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"anQ" = (
+/obj/machinery/door/airlock{
+	name = "Bar Backroom";
+	req_access_txt = "25"
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"anR" = (
+/obj/structure/mineral_door/wood,
+/obj/effect/decal/cleanable/dirt,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"anS" = (
+/obj/effect/turf_decal/stripes/asteroid/line{
+	dir = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"anT" = (
+/obj/machinery/door/airlock/wood/dorms/dorm18,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"anU" = (
+/obj/structure/table/wood,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/machinery/door/firedoor,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"anV" = (
+/obj/structure/curtain{
+	color = "#B22222";
+	pixel_x = 32
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"anW" = (
+/obj/structure/table/wood/fancy/purple,
+/obj/item/reagent_containers/syringe/charcoal,
+/obj/item/reagent_containers/glass/bottle/epinephrine,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"anX" = (
+/obj/effect/turf_decal/tile/green,
+/obj/effect/turf_decal/tile/green{
+	dir = 4
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"anY" = (
+/obj/item/candle/infinite,
+/obj/structure/flora/grass/jungle/b{
+	icon_state = "grassb2"
+	},
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"anZ" = (
+/obj/structure/table/wood/fancy/purple,
+/obj/item/reagent_containers/glass/beaker/cryoxadone,
+/obj/item/reagent_containers/glass/beaker/cryoxadone,
+/obj/item/reagent_containers/glass/beaker/cryoxadone,
+/obj/item/reagent_containers/glass/beaker/cryoxadone,
+/obj/item/wrench/medical,
+/obj/item/storage/pill_bottle/mannitol,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aoa" = (
+/obj/machinery/vending/cigarette/beach,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aob" = (
+/obj/structure/chair/wood,
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"aoc" = (
+/obj/machinery/libraryscanner,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aod" = (
+/obj/structure/table/wood,
+/obj/machinery/computer/libraryconsole/bookmanagement,
+/obj/structure/window/spawner/east,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aoe" = (
+/obj/structure/chair/comfy/black,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aof" = (
+/obj/structure/table/wood/fancy,
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aog" = (
+/obj/effect/decal/cleanable/blood/tracks,
+/obj/structure/falsewall/wood,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aoh" = (
+/obj/machinery/light,
+/turf/open/floor/spooktime/cobble/sideS,
+/area/eventmap/outside)
+"aoi" = (
+/obj/machinery/camera/emp_proof{
+	c_tag = "Containment - Particle Accelerator";
+	dir = 1;
+	network = list("singularity")
+	},
+/turf/open/floor/spooktime/cobble/sideS,
+/area/eventmap/outside)
+"aoj" = (
+/obj/machinery/light,
+/obj/item/banner/security,
+/obj/structure/sign/departments/security{
+	pixel_y = -32
+	},
+/turf/open/floor/spooktime/cobble/sideS,
+/area/eventmap/outside)
+"aok" = (
+/obj/structure/sign/departments/security{
+	pixel_y = -32
+	},
+/obj/item/banner/security,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"aol" = (
+/obj/structure/table/wood,
+/obj/item/clothing/glasses/regular,
+/obj/item/reagent_containers/food/drinks/bottle/rum{
+	name = "Cookie's home made rum"
+	},
+/obj/effect/decal/cleanable/cobweb,
+/obj/item/candle/infinite,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aom" = (
+/obj/machinery/light{
+	dir = 1
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aon" = (
+/obj/structure/table/wood,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aoo" = (
+/obj/effect/decal/cleanable/dirt,
+/obj/effect/turf_decal/tile/green{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/green{
+	dir = 8
+	},
+/obj/effect/turf_decal/tile/green{
+	dir = 1
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aop" = (
+/obj/effect/turf_decal/tile/green{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/green{
+	dir = 1
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aoq" = (
+/obj/structure/reagent_dispensers/water_cooler,
+/turf/open/floor/carpet/blackred,
+/area/eventmap/inside)
+"aor" = (
+/obj/effect/turf_decal/tile/green{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/green{
+	dir = 1
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aos" = (
+/obj/effect/turf_decal/tile/green{
+	dir = 1
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aot" = (
+/obj/effect/turf_decal/tile/green{
+	dir = 4
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aou" = (
+/obj/machinery/recharge_station,
+/obj/effect/turf_decal/tile/green{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/green{
+	dir = 1
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aov" = (
+/obj/machinery/limbgrower,
+/obj/effect/turf_decal/tile/green{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/green{
+	dir = 1
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aow" = (
+/obj/effect/turf_decal/tile/green,
+/obj/effect/turf_decal/tile/green{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/green{
+	dir = 1
+	},
+/obj/machinery/door/firedoor,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aox" = (
+/obj/machinery/vending/medical,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aoy" = (
+/obj/effect/spawner/lootdrop/keg,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aoz" = (
+/obj/structure/table/wood/fancy/green,
+/obj/effect/spawner/lootdrop/costume,
+/obj/machinery/light,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aoA" = (
+/obj/structure/table/wood/fancy/green,
+/obj/item/defibrillator/loaded,
+/obj/item/defibrillator/loaded,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aoB" = (
+/obj/structure/table_frame/wood,
+/obj/item/chair/wood,
+/obj/item/stack/sheet/mineral/wood,
+/obj/item/storage/backpack/satchel/vir,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aoC" = (
+/obj/machinery/bookbinder,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aoD" = (
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aoE" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/effect/landmark/start/librarian,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aoF" = (
+/obj/effect/temp_visual/love_heart,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aoG" = (
+/obj/effect/decal/cleanable/cobweb,
+/turf/open/floor/wood{
+	icon_state = "wood-broken2"
+	},
+/area/eventmap/inside)
+"aoH" = (
+/obj/structure/chair/bronze,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aoI" = (
+/obj/structure/life_candle,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aoJ" = (
+/obj/mecha/working/ripley/deathripley{
+	equipment_disabled = 1;
+	light_color = "#FAA019";
+	lights_power = 3
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aoK" = (
+/obj/structure/chair/office/dark{
+	dir = 1
+	},
+/mob/living/simple_animal/astral{
+	desc = "...Is haunting Space Station Three.";
+	name = "Carmen Miranda"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aoL" = (
+/mob/living/simple_animal/hostile/retaliate/bat{
+	attack_sound = 'sound/spookoween/ahaha.ogg';
+	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
+	icon = 'icons/obj/musician.dmi';
+	icon_dead = "bike_horn";
+	icon_living = "bike_horn";
+	icon_state = "bike_horn";
+	melee_damage_lower = 0;
+	melee_damage_upper = 0;
+	name = "Posessed Bike Horn"
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"aoM" = (
+/mob/living/simple_animal/hostile/retaliate/bat{
+	attack_sound = 'sound/spookoween/ahaha.ogg';
+	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
+	icon = 'icons/obj/musician.dmi';
+	icon_dead = "pianobroken";
+	icon_gib = "pianobroken";
+	icon_living = "piano";
+	icon_state = "piano";
+	melee_damage_lower = 0;
+	melee_damage_upper = 0;
+	name = "Posessed piano"
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"aoN" = (
+/mob/living/simple_animal/hostile/retaliate/bat{
+	attack_sound = 'sound/spookoween/ahaha.ogg';
+	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
+	icon = 'icons/obj/musician.dmi';
+	icon_dead = "recorder";
+	icon_gib = "recorder";
+	icon_living = "recorder";
+	icon_state = "recorder";
+	melee_damage_lower = 0;
+	melee_damage_upper = 0;
+	name = "Posessed recorder"
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"aoO" = (
+/obj/machinery/door/firedoor,
+/obj/machinery/door/airlock/mining{
+	name = "Cargo Office";
+	req_one_access_txt = "48;50"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aoP" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/table/wood,
+/obj/structure/window/spawner/east,
+/obj/item/paper_bin,
+/obj/item/pen{
+	desc = "A pen left over from the days this place used to be an asylum. Despite its age it appears perfectly usable when supplied with ink.";
+	name = "Cyber & Sons Company Pen"
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aoQ" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aoR" = (
+/turf/open/floor/light/colour_cycle/dancefloor_a,
+/area/eventmap/inside)
+"aoS" = (
+/obj/machinery/hydroponics/constructable,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aoT" = (
+/obj/effect/turf_decal/tile/green{
+	dir = 8
+	},
+/obj/effect/turf_decal/tile/green{
+	dir = 1
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aoU" = (
+/obj/effect/decal/cleanable/dirt,
+/turf/open/floor/wood{
+	icon_state = "wood-broken2"
+	},
+/area/eventmap/inside)
+"aoV" = (
+/obj/machinery/button/door/dorms/dorm03,
+/obj/effect/turf_decal/delivery/white,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aoW" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aoX" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aoY" = (
+/obj/structure/flora/rock/pile/icy,
+/obj/effect/wisp,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aoZ" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/spooktime/cobble/cornerSW,
+/area/eventmap/outside)
+"apa" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-4"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"apb" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"apc" = (
+/obj/structure/table/wood,
+/obj/machinery/recharger,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"apd" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"ape" = (
+/obj/machinery/computer/crew{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"apf" = (
+/obj/item/toy/plush/narplush/hugbox,
+/obj/item/toy/toy_dagger,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"apg" = (
+/obj/structure/table/wood/fancy/green,
+/obj/item/clothing/head/hardhat/pumpkinhead/jaqc,
+/turf/open/floor/wood{
+	icon_state = "wood-broken2"
+	},
+/area/eventmap/inside)
+"aph" = (
+/turf/open/floor/spooktime/cobble/sideW{
+	icon_state = "cobble_side_n"
+	},
+/area/eventmap/outside)
+"api" = (
+/obj/structure/table/wood/fancy/green,
+/obj/item/clothing/head/hardhat/pumpkinhead/jaqc,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"apj" = (
+/obj/structure/table/wood/fancy/green,
+/obj/item/gun/magic/staff/healing,
+/obj/item/gun/magic/staff/healing,
+/obj/item/gun/medbeam,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"apk" = (
+/obj/structure/life_candle,
+/turf/open/floor/wood{
+	icon_state = "wood-broken5"
+	},
+/area/eventmap/inside)
+"apl" = (
+/obj/structure/closet/cabinet,
+/obj/item/clothing/head/helmet/space/hardsuit/deathsquad,
+/obj/item/clothing/suit/space/hardsuit/deathsquad,
+/obj/item/circlegame,
+/obj/item/nullrod/scythe,
+/obj/item/card/id/silver/reaper,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"apm" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/wood{
+	icon_state = "wood-broken6"
+	},
+/area/eventmap/inside)
+"apn" = (
+/obj/item/chair/wood/wings{
+	dir = 1
+	},
+/turf/open/floor/wood{
+	icon_state = "wood-broken"
+	},
+/area/eventmap/inside)
+"apo" = (
+/mob/living/simple_animal/hostile/retaliate/bat{
+	attack_sound = 'sound/spookoween/ahaha.ogg';
+	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
+	icon = 'icons/obj/musician.dmi';
+	icon_dead = "minimoogbroken";
+	icon_gib = "minimoogbroken";
+	icon_living = "minimoog";
+	icon_state = "minimoog";
+	melee_damage_lower = 0;
+	melee_damage_upper = 0;
+	name = "Posessed minimoog"
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"app" = (
+/obj/structure/chair/wood/wings{
+	dir = 8
+	},
+/turf/open/floor/wood{
+	icon_state = "wood-broken5"
+	},
+/area/eventmap/inside)
+"apq" = (
+/obj/structure/noticeboard/captain{
+	pixel_y = -32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"apr" = (
+/obj/effect/turf_decal/stripes/asteroid/line{
+	dir = 9
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aps" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-8"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"apt" = (
+/obj/item/banner/medical,
+/obj/effect/turf_decal/tile/green,
+/obj/effect/turf_decal/tile/green{
+	dir = 4
+	},
+/obj/machinery/door/firedoor,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"apu" = (
+/obj/effect/spawner/trap,
+/turf/open/indestructible/airblock,
+/area/eventmap/mountaininside)
+"apv" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-8"
+	},
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"apw" = (
+/obj/effect/decal/cleanable/dirt,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/table/wood,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"apx" = (
+/obj/structure/table/wood,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"apy" = (
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"apz" = (
+/turf/open/floor/engine,
+/area/eventmap/inside)
+"apA" = (
+/obj/structure/sink{
+	dir = 8;
+	pixel_x = -12
+	},
+/obj/machinery/camera/emp_proof{
+	c_tag = "Containment - Fore Port";
+	dir = 4;
+	network = list("singularity")
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"apB" = (
+/obj/machinery/biogenerator,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"apC" = (
+/mob/living/simple_animal/hostile/retaliate/bat{
+	attack_sound = 'sound/spookoween/ahaha.ogg';
+	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
+	icon = 'icons/obj/musician.dmi';
+	icon_dead = "xylophone-broken";
+	icon_gib = "xylophone-broken";
+	icon_living = "xylophone";
+	icon_state = "xylophone";
+	melee_damage_lower = 0;
+	melee_damage_upper = 0;
+	name = "Posessed xylophone"
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"apD" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/mob/living/simple_animal/hostile/retaliate/bat{
+	attack_sound = 'sound/spookoween/ahaha.ogg';
+	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
+	icon = 'icons/obj/musician.dmi';
+	icon_dead = "accordion";
+	icon_gib = "accordion";
+	icon_living = "accordion";
+	icon_state = "accordion";
+	melee_damage_lower = 0;
+	melee_damage_upper = 0;
+	name = "Posessed accordion"
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"apE" = (
+/obj/structure/sink{
+	dir = 4;
+	pixel_x = 11
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"apF" = (
+/obj/effect/turf_decal/stripes/asteroid/line{
+	dir = 5
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"apG" = (
+/obj/machinery/button/door/dorms/dorm18,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"apH" = (
+/obj/machinery/button/door/dorms/luxury3{
+	id = "C02";
+	pixel_y = -24
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"apI" = (
+/obj/effect/turf_decal/tile/green,
+/obj/effect/turf_decal/tile/green{
+	dir = 8
+	},
+/obj/effect/turf_decal/tile/green{
+	dir = 1
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"apJ" = (
+/obj/effect/turf_decal/tile/green,
+/obj/effect/turf_decal/tile/green{
+	dir = 8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"apK" = (
+/obj/effect/decal/cleanable/dirt,
+/obj/effect/turf_decal/tile/green,
+/obj/effect/turf_decal/tile/green{
+	dir = 8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"apL" = (
+/obj/effect/turf_decal/tile/green,
+/obj/effect/turf_decal/tile/yellow{
+	dir = 1
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountain)
+"apM" = (
+/obj/machinery/light/small,
+/obj/effect/turf_decal/tile/green,
+/obj/effect/turf_decal/tile/green{
+	dir = 8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"apN" = (
+/obj/structure/barricade/wooden,
+/obj/structure/spacevine,
+/obj/structure/mineral_door/woodrustic,
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"apO" = (
+/obj/structure/mineral_door/wood,
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"apP" = (
+/obj/item/stack/sheet/mineral/wood,
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"apQ" = (
+/mob/living/simple_animal/hostile/retaliate/bat,
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"apR" = (
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"apS" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/carpet/blackred,
+/area/eventmap/inside)
+"apT" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/mob/living/simple_animal/hostile/retaliate/bat{
+	attack_sound = 'sound/spookoween/ahaha.ogg';
+	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
+	icon = 'icons/obj/musician.dmi';
+	icon_dead = "harmonica";
+	icon_gib = "harmonica";
+	icon_living = "harmonica";
+	icon_state = "harmonica";
+	melee_damage_lower = 0;
+	melee_damage_upper = 0;
+	name = "Posessed harmonica"
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"apU" = (
+/mob/living/simple_animal/hostile/retaliate/bat{
+	attack_sound = 'sound/spookoween/ahaha.ogg';
+	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
+	icon = 'icons/obj/musician.dmi';
+	icon_dead = "trombone";
+	icon_gib = "trombone";
+	icon_living = "trombone";
+	icon_state = "trombone";
+	melee_damage_lower = 0;
+	melee_damage_upper = 0;
+	name = "Posessed trombone"
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"apV" = (
+/obj/effect/turf_decal/tile/green,
+/obj/effect/turf_decal/tile/green{
+	dir = 8
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"apW" = (
+/obj/effect/turf_decal/bot_white,
+/obj/structure/plasticflaps/opaque,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"apX" = (
+/obj/effect/turf_decal/tile/green{
+	dir = 1
+	},
+/obj/effect/turf_decal/tile/green{
+	dir = 4
+	},
+/obj/structure/chair/stool,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountain)
+"apY" = (
+/obj/effect/turf_decal/tile/green,
+/obj/effect/turf_decal/tile/green{
+	dir = 8
+	},
+/obj/effect/turf_decal/tile/green{
+	dir = 4
+	},
+/obj/machinery/door/firedoor,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"apZ" = (
+/obj/machinery/light/small{
+	dir = 4
+	},
+/obj/machinery/door/firedoor,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqa" = (
+/obj/machinery/door/airlock/command{
+	name = "Captain's Office";
+	req_access_txt = "20"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqb" = (
+/obj/effect/turf_decal/stripes/asteroid/line{
+	dir = 10
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqc" = (
+/mob/living/simple_animal/hostile/retaliate/bat{
+	desc = "A spookster!";
+	icon_state = "flan0";
+	name = "Name"
+	},
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"aqd" = (
+/obj/structure/table/wood,
+/obj/item/storage/box/bodybags{
+	pixel_x = -3;
+	pixel_y = 3
+	},
+/obj/item/storage/box/bodybags,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqe" = (
+/obj/effect/turf_decal/stripes/asteroid/line{
+	dir = 6
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqf" = (
+/obj/machinery/light/small{
+	dir = 8
+	},
+/obj/machinery/door/firedoor,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqg" = (
+/obj/structure/table/wood,
+/obj/effect/decal/cleanable/dirt,
+/obj/item/paper/guides/jobs/medical/morgue,
+/obj/item/gun/magic/staff/healing,
+/obj/structure/cable/yellow{
+	icon_state = "0-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqh" = (
+/obj/structure/barricade/wooden,
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"aqi" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"aqj" = (
+/turf/open/floor/carpet/blackred,
+/area/eventmap/inside)
+"aqk" = (
+/obj/structure/sign/departments/cargo{
+	pixel_y = 32
+	},
+/turf/open/floor/spooktime/cobble/sideN,
+/area/eventmap/outside)
+"aql" = (
+/obj/structure/chair/wood/wings{
+	dir = 8;
+	icon_state = "brass_chair"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqm" = (
+/obj/structure/table/reinforced,
+/obj/item/storage/box/ingredients/delights,
+/obj/item/reagent_containers/food/condiment/soysauce,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqn" = (
+/obj/structure/table/reinforced,
+/obj/item/storage/box/ingredients/carnivore,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqo" = (
+/obj/structure/table/reinforced,
+/obj/item/storage/box/ingredients/american,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqp" = (
+/obj/structure/table/reinforced,
+/obj/item/storage/box/donkpockets,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqq" = (
+/obj/structure/table/reinforced,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqr" = (
+/turf/closed/wall/mineral/wood,
+/area/eventmap/inside)
+"aqs" = (
+/obj/structure/table/wood,
+/obj/effect/decal/cleanable/dirt,
+/obj/structure/bedsheetbin,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqt" = (
+/obj/structure/sign/directions/security{
+	dir = 8;
+	pixel_x = -32;
+	pixel_y = 24
+	},
+/obj/structure/sign/directions/supply{
+	dir = 8;
+	pixel_x = -32;
+	pixel_y = 32
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"aqu" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/structure/falsewall/wood,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"aqv" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqw" = (
+/turf/open/floor/carpet/monochrome,
+/area/eventmap/inside)
+"aqx" = (
+/mob/living/simple_animal/hostile/retaliate/bat,
+/turf/open/floor/carpet/monochrome,
+/area/eventmap/inside)
+"aqy" = (
+/obj/structure/mineral_door/wood,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"aqz" = (
+/obj/machinery/deepfryer,
+/turf/open/floor/plasteel/vaporwave,
+/area/eventmap/inside)
+"aqA" = (
+/turf/open/floor/plasteel/vaporwave,
+/area/eventmap/inside)
+"aqB" = (
+/obj/structure/reagent_dispensers/keg/milk,
+/turf/open/floor/plasteel/vaporwave,
+/area/eventmap/inside)
+"aqC" = (
+/obj/structure/sink/kitchen{
+	pixel_y = 28
+	},
+/turf/open/floor/plasteel/vaporwave,
+/area/eventmap/inside)
+"aqD" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-8"
+	},
+/turf/open/floor/spooktime/cobble/sideS,
+/area/eventmap/outside)
+"aqE" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"aqF" = (
+/obj/structure/table_frame/wood,
+/obj/item/stack/sheet/mineral/wood,
+/obj/effect/decal/cleanable/glass,
+/obj/item/shard,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqG" = (
+/obj/machinery/light/small/broken{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqH" = (
+/obj/structure/table/wood,
+/obj/machinery/light/small{
+	dir = 8
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aqI" = (
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"aqJ" = (
+/obj/structure/table/wood/fancy,
+/obj/item/clothing/head/HoS/beret/syndicate,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqK" = (
+/obj/structure/table/wood/fancy,
+/obj/machinery/light/small{
+	dir = 4
+	},
+/obj/item/reagent_containers/food/condiment/saltshaker,
+/obj/item/reagent_containers/food/condiment/peppermill,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqL" = (
+/obj/machinery/seed_extractor,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aqM" = (
+/obj/machinery/light{
+	dir = 4
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aqN" = (
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"aqO" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"aqP" = (
+/obj/effect/decal/cleanable/dirt,
+/obj/machinery/door/airlock/medical/glass{
+	name = "Chemistry Lab";
+	req_access_txt = "5; 33"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aqQ" = (
+/obj/structure/mineral_door/wood,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aqR" = (
+/obj/machinery/clonepod/experimental,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"aqS" = (
+/obj/structure/showcase/horrific_experiment,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"aqT" = (
+/obj/machinery/door/airlock/security/glass{
+	name = "Security Office";
+	req_access_txt = "63"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aqU" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/bookcase/random/nonfiction,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqV" = (
+/obj/structure/bookcase/random/nonfiction,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqW" = (
+/obj/structure/table/wood/fancy/green,
+/obj/item/clothing/head/hardhat/pumpkinhead/jaqc,
+/turf/open/floor/wood{
+	icon_state = "wood-broken5"
+	},
+/area/eventmap/inside)
+"aqX" = (
+/obj/structure/table/wood/fancy/blackred,
+/obj/item/reagent_containers/food/snacks/grown/tomato/blood,
+/obj/item/reagent_containers/food/snacks/grown/tomato/blood,
+/obj/item/reagent_containers/food/snacks/grown/tomato/blood,
+/obj/item/candle/infinite,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqY" = (
+/obj/structure/table/wood/fancy/blackred,
+/obj/item/reagent_containers/food/snacks/soup/blood,
+/obj/item/reagent_containers/food/snacks/soup/blood,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aqZ" = (
+/obj/structure/table/reinforced,
+/obj/item/candle/infinite,
+/obj/item/reagent_containers/food/condiment/sugar,
+/turf/open/floor/plasteel/vaporwave,
+/area/eventmap/inside)
+"ara" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"arb" = (
+/obj/machinery/vending/wardrobe/cap_wardrobe,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"arc" = (
+/obj/structure/chair/sofa/left{
+	dir = 4
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"ard" = (
+/obj/effect/landmark/start/botanist,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"are" = (
+/obj/structure/closet/secure_closet/captains,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"arf" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"arg" = (
+/obj/structure/fluff/broken_flooring,
+/obj/effect/decal/cleanable/cobweb,
+/turf/open/floor/plating{
+	icon_state = "panelscorched"
+	},
+/area/eventmap/inside)
+"arh" = (
+/obj/machinery/atmospherics/pipe/simple{
+	dir = 5
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"ari" = (
+/obj/machinery/atmospherics/pipe/simple{
+	dir = 8
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"arj" = (
+/obj/machinery/atmospherics/pipe/simple{
+	dir = 9
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"ark" = (
+/obj/structure/table/glass,
+/obj/item/storage/box/pillbottles,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"arl" = (
+/obj/structure/table/wood,
+/obj/item/toy/cards/deck/cas,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"arm" = (
+/obj/effect/decal/cleanable/dirt,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"arn" = (
+/obj/item/toy/plush/plushvar,
+/obj/item/toy/clockwork_watch,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aro" = (
+/obj/structure/chair/comfy{
+	dir = 1;
+	icon_state = "shuttle_chair"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"arp" = (
+/turf/open/floor/wood{
+	icon_state = "wood-broken6"
+	},
+/area/eventmap/inside)
+"arq" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/carpet/monochrome,
+/area/eventmap/inside)
+"arr" = (
+/obj/structure/closet/crate/freezer/blood,
+/turf/open/floor/wood{
+	icon_state = "wood-broken2"
+	},
+/area/eventmap/inside)
+"ars" = (
+/obj/structure/chair/wood/wings,
+/mob/living/simple_animal/hostile/retaliate/bat,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"art" = (
+/obj/structure/chair/wood/wings,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"aru" = (
+/obj/structure/chair/wood/wings,
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"arv" = (
+/obj/structure/table/reinforced,
+/obj/item/storage/bag/tray,
+/obj/item/reagent_containers/food/snacks/kebab/human,
+/obj/item/reagent_containers/food/snacks/kebab/human,
+/obj/item/reagent_containers/food/snacks/kebab/human,
+/turf/open/floor/plasteel/vaporwave,
+/area/eventmap/inside)
+"arw" = (
+/obj/machinery/chem_heater,
+/obj/effect/decal/cleanable/greenglow,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"arx" = (
+/obj/machinery/clonepod,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"ary" = (
+/obj/machinery/computer/cloning,
+/turf/open/floor/plasteel/white/side,
+/area/eventmap/inside)
+"arz" = (
+/obj/machinery/dna_scannernew,
+/turf/open/floor/plasteel/white/side,
+/area/eventmap/inside)
+"arA" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/obj/machinery/door/airlock/command{
+	name = "Head of Personnel's Office";
+	req_access_txt = "57"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"arB" = (
+/obj/structure/sign/directions/medical{
+	dir = 4;
+	pixel_x = 32;
+	pixel_y = 24
+	},
+/obj/structure/sign/directions/evac{
+	dir = 4;
+	pixel_x = 32;
+	pixel_y = 32
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"arC" = (
+/obj/structure/cable/white{
+	icon_state = "0-2"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"arD" = (
+/obj/effect/turf_decal/loading_area,
+/obj/machinery/firealarm{
+	dir = 8;
+	pixel_x = -24
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"arE" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"arF" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"arG" = (
+/obj/structure/cable/yellow{
+	icon_state = "2-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"arH" = (
+/obj/item/book/manual/wiki/medical_cloning,
+/obj/structure/table/glass,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"arI" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"arJ" = (
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"arK" = (
+/obj/machinery/door/airlock/wood/dorms/dorm06,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"arL" = (
+/obj/structure/closet/secure_closet/security/med,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"arM" = (
+/obj/structure/mineral_door/wood,
+/obj/effect/decal/cleanable/blood/tracks{
+	dir = 4
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"arN" = (
+/obj/effect/decal/cleanable/dirt,
+/obj/machinery/light/small/broken{
+	dir = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"arO" = (
+/obj/effect/turf_decal/tile/brown{
+	dir = 4
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"arP" = (
+/obj/effect/decal/cleanable/cobweb{
+	icon_state = "stickyweb2"
+	},
+/obj/structure/falsewall/wood,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"arQ" = (
+/obj/structure/table/wood/fancy/blackred,
+/obj/item/trash/plate,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"arR" = (
+/obj/structure/table/reinforced,
+/obj/item/storage/bag/tray,
+/obj/item/reagent_containers/food/snacks/pie/pumpkinpie,
+/turf/open/floor/plasteel/vaporwave,
+/area/eventmap/inside)
+"arS" = (
+/obj/structure/closet/secure_closet/freezer/fridge,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/soymilk,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/rice,
+/obj/item/reagent_containers/food/condiment/rice,
+/obj/item/reagent_containers/food/condiment/rice,
+/obj/item/storage/fancy/egg_box,
+/obj/item/storage/fancy/egg_box,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"arT" = (
+/obj/structure/table/reinforced,
+/obj/machinery/dish_drive,
+/obj/item/reagent_containers/food/condiment/enzyme,
+/turf/open/floor/plasteel/vaporwave,
+/area/eventmap/inside)
+"arU" = (
+/obj/structure/table/reinforced,
+/obj/machinery/reagentgrinder,
+/turf/open/floor/plasteel/vaporwave,
+/area/eventmap/inside)
+"arV" = (
+/obj/structure/table/reinforced,
+/obj/item/storage/box/condimentbottles,
+/turf/open/floor/plasteel/vaporwave,
+/area/eventmap/inside)
+"arW" = (
+/obj/structure/table/reinforced,
+/obj/item/storage/box/ingredients/wildcard,
+/obj/item/storage/box/ingredients/vegetarian,
+/turf/open/floor/plasteel/vaporwave,
+/area/eventmap/inside)
+"arX" = (
+/obj/structure/table/reinforced,
+/obj/item/storage/box/ingredients/sweets,
+/obj/item/storage/box/ingredients/italian,
+/turf/open/floor/plasteel/vaporwave,
+/area/eventmap/inside)
+"arY" = (
+/obj/structure/table/reinforced,
+/obj/item/storage/box/ingredients/grains,
+/obj/item/storage/box/ingredients/fruity,
+/turf/open/floor/plasteel/vaporwave,
+/area/eventmap/inside)
+"arZ" = (
+/obj/structure/table/reinforced,
+/obj/item/storage/box/ingredients/fiesta,
+/obj/item/storage/box/ingredients/exotic,
+/turf/open/floor/plasteel/vaporwave,
+/area/eventmap/inside)
+"asa" = (
+/obj/effect/landmark/start/captain,
+/obj/structure/cable/white{
+	icon_state = "2-4"
+	},
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"asb" = (
+/obj/structure/chair/sofa{
+	dir = 4
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"asc" = (
+/obj/effect/turf_decal/tile/brown{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/purple{
+	dir = 1
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"asd" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"ase" = (
+/obj/effect/landmark/start/assistant,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asf" = (
+/obj/effect/decal/cleanable/dirt,
+/turf/open/floor/plasteel/white,
+/area/eventmap/inside)
+"asg" = (
+/obj/machinery/chem_dispenser,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"ash" = (
+/obj/machinery/door/airlock/command{
+	name = "Captain's Quarters";
+	req_access_txt = "20"
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asi" = (
+/turf/open/floor/plasteel/white/side{
+	dir = 6
+	},
+/area/eventmap/inside)
+"asj" = (
+/turf/open/floor/plasteel/white,
+/area/eventmap/inside)
+"ask" = (
+/obj/structure/barricade/wooden/crude,
+/obj/effect/spawner/structure/window,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asl" = (
+/obj/effect/decal/cleanable/cobweb{
+	icon_state = "stickyweb2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asm" = (
+/obj/structure/easel,
+/obj/item/paper/pamphlet/ruin/originalcontent/yelling,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asn" = (
+/obj/structure/chair/wood/wings{
+	dir = 4;
+	icon_state = "brass_chair"
+	},
+/mob/living/simple_animal/hostile/retaliate/bat,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"aso" = (
+/obj/structure/table/wood/fancy/blackred,
+/obj/item/candle/infinite,
+/obj/item/reagent_containers/food/condiment/saltshaker,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"asp" = (
+/obj/structure/table/wood/fancy/blackred,
+/obj/item/candle/infinite,
+/obj/item/reagent_containers/food/condiment/peppermill,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"asq" = (
+/obj/structure/table/wood/fancy/blackred,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"asr" = (
+/obj/structure/table/reinforced,
+/obj/item/storage/bag/tray,
+/obj/item/reagent_containers/food/snacks/store/cake/pumpkinspice,
+/turf/open/floor/plasteel/vaporwave,
+/area/eventmap/inside)
+"ass" = (
+/obj/structure/table/reinforced,
+/obj/machinery/microwave,
+/turf/open/floor/plasteel/vaporwave,
+/area/eventmap/inside)
+"ast" = (
+/obj/structure/mineral_door/iron,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asu" = (
+/obj/structure/cable/white{
+	icon_state = "2-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "2-4"
+	},
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"asv" = (
+/obj/structure/cable/white{
+	icon_state = "1-8"
+	},
+/obj/structure/chair/wood,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"asw" = (
+/obj/structure/chair/wood,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"asx" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-4"
+	},
+/turf/open/floor/plasteel/white/side{
+	dir = 10
+	},
+/area/eventmap/inside)
+"asy" = (
+/obj/item/storage/box/bodybags{
+	pixel_x = 3;
+	pixel_y = 3
+	},
+/obj/item/storage/box/bodybags,
+/obj/structure/table/glass,
+/obj/structure/cable/yellow{
+	icon_state = "0-8"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"asz" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/closed/wall/r_wall,
+/area/eventmap/inside)
+"asA" = (
+/obj/effect/landmark/start/depsec/medical,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asB" = (
+/obj/structure/bodycontainer/morgue,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asC" = (
+/obj/structure/bodycontainer/morgue{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asD" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-8"
+	},
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"asE" = (
+/obj/structure/cable/white{
+	icon_state = "2-4"
+	},
+/obj/effect/turf_decal/tile/purple{
+	dir = 1
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"asF" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/machinery/door/airlock/mining/glass{
+	name = "Cargo Office";
+	req_access_txt = "50"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"asG" = (
+/obj/machinery/vending/cart,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asH" = (
+/obj/structure/table/wood,
+/obj/item/paper_bin,
+/obj/item/pen/fourcolor,
+/obj/item/stamp/hop,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asI" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/wood/damturf/broken7,
+/area/eventmap/inside)
+"asJ" = (
+/obj/machinery/door/airlock/wood/dorms/dorm15,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asK" = (
+/obj/machinery/light/small{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asL" = (
+/obj/machinery/camera/emp_proof{
+	c_tag = "Containment - Fore Starboard";
+	dir = 8;
+	network = list("singularity")
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asM" = (
+/obj/structure/fence{
+	dir = 8
+	},
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"asN" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/structure/bookcase/manuals/engineering,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asO" = (
+/obj/structure/bookcase/manuals/medical,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asP" = (
+/obj/structure/bookcase/manuals/research_and_development,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asQ" = (
+/obj/item/toy/crayon/red,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asR" = (
+/obj/item/paint/anycolor,
+/obj/item/toy/crayon/rainbow,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asS" = (
+/obj/item/stack/spacecash/c20,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asT" = (
+/obj/item/paper/crumpled/ruins/originalcontent,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asU" = (
+/obj/item/paint/anycolor,
+/obj/item/toy/crayon/green,
+/turf/open/floor/wood{
+	icon_state = "wood-broken3"
+	},
+/area/eventmap/inside)
+"asV" = (
+/obj/item/toy/crayon/purple,
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asW" = (
+/obj/item/paint/anycolor,
+/obj/item/stack/spacecash/c50,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asX" = (
+/obj/item/paint/anycolor,
+/obj/item/toy/crayon/blue,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asY" = (
+/obj/item/toy/crayon/white,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"asZ" = (
+/obj/item/stack/spacecash/c1,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ata" = (
+/obj/item/paint/anycolor,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"atb" = (
+/obj/item/stack/spacecash/c500,
+/obj/item/toy/crayon/mime,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"atc" = (
+/obj/item/toy/crayon/rainbow,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"atd" = (
+/obj/structure/table/reinforced,
+/obj/item/storage/bag/tray,
+/obj/item/reagent_containers/food/snacks/burger/ghost,
+/obj/item/reagent_containers/food/snacks/burger/ghost,
+/obj/item/reagent_containers/food/snacks/burger/ghost,
+/turf/open/floor/plasteel/vaporwave,
+/area/eventmap/inside)
+"ate" = (
+/obj/machinery/icecream_vat{
+	name = "Spooky ice cream vat"
+	},
+/obj/item/toy/snowball,
+/obj/effect/turf_decal/weather/snow/corner{
+	dir = 9
+	},
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"atf" = (
+/obj/structure/fluff/snowlegion,
+/obj/effect/turf_decal/weather/snow/corner,
+/obj/effect/turf_decal/weather/snow/corner{
+	dir = 1
+	},
+/turf/open/floor/spooktime/snow,
+/area/eventmap/inside)
+"atg" = (
+/obj/structure/reagent_dispensers/cooking_oil{
+	name = "Chilled vat of hatmium";
+	reagent_id = "hatmium"
+	},
+/obj/effect/turf_decal/weather/snow/corner{
+	dir = 1
+	},
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"ath" = (
+/obj/machinery/gibber/autogibber,
+/obj/effect/turf_decal/weather/snow/corner{
+	dir = 1
+	},
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"ati" = (
+/obj/structure/kitchenspike,
+/obj/item/toy/snowball,
+/obj/effect/turf_decal/weather/snow/corner{
+	dir = 1
+	},
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"atj" = (
+/obj/effect/turf_decal/weather/snow/corner{
+	dir = 5
+	},
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"atk" = (
+/turf/closed/wall/mineral/snow,
+/area/eventmap/inside)
+"atl" = (
+/obj/structure/chair/sofa/right{
+	dir = 4
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"atm" = (
+/obj/machinery/jukebox/disco/indestructible{
+	req_one_access = list()
+	},
+/turf/open/floor/engine,
+/area/eventmap/inside)
+"atn" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-4"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ato" = (
+/obj/structure/table/wood/fancy,
+/obj/item/reagent_containers/food/condiment/saltshaker,
+/obj/item/reagent_containers/food/condiment/peppermill,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"atp" = (
+/obj/structure/chair/wood/wings{
+	dir = 8
+	},
+/obj/machinery/light/small,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"atq" = (
+/obj/structure/cable/yellow{
+	icon_state = "2-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"atr" = (
+/obj/structure/table/wood/fancy,
+/obj/machinery/light/small,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ats" = (
+/obj/structure/table/wood,
+/obj/machinery/plantgenes/seedvault,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"att" = (
+/obj/structure/sign/poster/contraband/ambrosia_vulgaris{
+	pixel_x = 32
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"atu" = (
+/obj/structure/closet/secure_closet/personal/patient,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"atv" = (
+/turf/open/floor/plasteel/white/side{
+	dir = 5
+	},
+/area/eventmap/inside)
+"atw" = (
+/obj/structure/bed,
+/obj/effect/spawner/lootdrop/bedsheet,
+/obj/machinery/light/small,
+/mob/living/carbon/human/species/zombie{
+	icon_state = "zombie";
+	lying = 1;
+	name = "Romerol";
+	name_override = "Romerol";
+	resting = 1
+	},
+/mob/living/carbon/human/species/zombie{
+	gender = "female";
+	icon_state = "zombie";
+	lying = 1;
+	name = "Juliet";
+	name_override = "Juliet";
+	resting = 1
+	},
+/turf/open/floor/clockwork/reebe,
+/area/eventmap/inside)
+"atx" = (
+/obj/effect/landmark/start/geneticist,
+/turf/open/floor/plasteel/white,
+/area/eventmap/inside)
+"aty" = (
+/turf/open/floor/plasteel/white/side{
+	dir = 9
+	},
+/area/eventmap/inside)
+"atz" = (
+/obj/structure/table/wood/fancy/blackred,
+/obj/item/reagent_containers/blood/random,
+/obj/item/reagent_containers/blood/random,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"atA" = (
+/obj/structure/chair/wood/wings{
+	dir = 1
+	},
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/mob/living/simple_animal/hostile/retaliate/bat,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"atB" = (
+/obj/structure/chair/wood/wings{
+	dir = 1
+	},
+/mob/living/simple_animal/hostile/retaliate/bat,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"atC" = (
+/obj/structure/table/reinforced,
+/obj/item/storage/bag/tray,
+/obj/item/reagent_containers/food/snacks/candiedapple,
+/obj/item/reagent_containers/food/snacks/candiedapple,
+/obj/item/reagent_containers/food/snacks/candy,
+/obj/item/reagent_containers/food/snacks/candy_corn,
+/obj/item/reagent_containers/food/snacks/candyheart,
+/obj/item/reagent_containers/food/snacks/chocolatebanana,
+/obj/item/reagent_containers/food/snacks/chocolatebanana,
+/obj/item/reagent_containers/food/snacks/sugarcookie/spookycoffin,
+/obj/item/reagent_containers/food/snacks/sugarcookie/spookyskull,
+/turf/open/floor/plasteel/vaporwave,
+/area/eventmap/inside)
+"atD" = (
+/obj/effect/turf_decal/weather/snow/corner{
+	dir = 8
+	},
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"atE" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"atF" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/effect/turf_decal/weather/snow/corner{
+	dir = 4
+	},
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"atG" = (
+/obj/structure/cable/white{
+	icon_state = "1-8"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"atH" = (
+/obj/item/storage/box/rxglasses,
+/obj/structure/table/glass,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"atI" = (
+/obj/structure/curtain{
+	color = "#B22222"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"atJ" = (
+/obj/structure/table/wood,
+/obj/machinery/computer/security/wooden_tv{
+	pixel_y = 8
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"atK" = (
+/obj/machinery/computer/secure_data,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"atL" = (
+/obj/machinery/door/airlock{
+	name = "Bar Staff Entrance";
+	req_access_txt = "25"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"atM" = (
+/obj/machinery/door/airlock{
+	name = "Kitchen";
+	req_access_txt = "28"
+	},
+/obj/machinery/door/firedoor,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"atN" = (
+/obj/structure/table/wood,
+/obj/machinery/smartfridge/disks,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"atO" = (
+/obj/effect/decal/cleanable/generic,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"atP" = (
+/obj/machinery/chem_master,
+/obj/effect/decal/cleanable/dirt,
+/obj/machinery/light/small,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"atQ" = (
+/obj/machinery/shower{
+	dir = 4
+	},
+/obj/structure/window/reinforced/spawner/north,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"atR" = (
+/obj/machinery/door/window/northleft{
+	name = "Cloning Shower";
+	req_access_txt = "24"
+	},
+/obj/structure/mirror{
+	pixel_y = -32
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"atS" = (
+/obj/machinery/door/window/northright{
+	name = "Cloning Shower"
+	},
+/obj/machinery/light/small,
+/obj/structure/window/reinforced/spawner/east,
+/turf/open/floor/plasteel/white/side{
+	dir = 1
+	},
+/area/eventmap/inside)
+"atT" = (
+/obj/item/toy/crayon/black,
+/turf/open/floor/wood{
+	icon_state = "wood-broken6"
+	},
+/area/eventmap/inside)
+"atU" = (
+/obj/item/paint/anycolor,
+/obj/item/toy/crayon/white,
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"atV" = (
+/obj/item/toy/crayon/spraycan/infinite{
+	icon_state = "deathcan2_cap"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"atW" = (
+/obj/item/paint/anycolor,
+/obj/item/stack/spacecash/c100,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"atX" = (
+/obj/item/paper/crumpled/ruins/originalcontent,
+/obj/item/toy/crayon/orange,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"atY" = (
+/mob/living/carbon/monkey{
+	color = "#009900";
+	icon_state = "monkey1";
+	name = "Painting Goblin"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"atZ" = (
+/obj/item/paint/anycolor,
+/obj/item/toy/crayon/yellow,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aua" = (
+/obj/item/paint/anycolor,
+/obj/item/stack/spacecash/c20,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aub" = (
+/obj/item/paper/crumpled/ruins/originalcontent,
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"auc" = (
+/obj/item/toy/crayon/blue,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aud" = (
+/obj/item/paint/anycolor,
+/obj/item/toy/crayon/purple,
+/turf/open/floor/wood{
+	icon_state = "wood-broken5"
+	},
+/area/eventmap/inside)
+"aue" = (
+/obj/item/stack/spacecash/c50,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"auf" = (
+/obj/structure/table/wood/fancy/blackred,
+/obj/item/reagent_containers/blood/random,
+/obj/item/reagent_containers/blood/random,
+/obj/item/reagent_containers/blood/random,
+/obj/item/candle/infinite,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aug" = (
+/obj/structure/table/reinforced,
+/obj/item/candle/infinite,
+/turf/open/floor/plasteel/vaporwave,
+/area/eventmap/inside)
+"auh" = (
+/obj/machinery/vending/dinnerware,
+/turf/open/floor/plasteel/vaporwave,
+/area/eventmap/inside)
+"aui" = (
+/obj/structure/closet/secure_closet/freezer/fridge,
+/obj/effect/turf_decal/weather/snow/corner{
+	dir = 8
+	},
+/obj/item/organ/liver,
+/obj/item/organ/liver,
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"auj" = (
+/obj/structure/closet/secure_closet/freezer/fridge,
+/obj/effect/turf_decal/weather/snow/corner,
+/obj/item/organ/heart,
+/obj/item/organ/heart,
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"auk" = (
+/obj/structure/closet/secure_closet/freezer/fridge,
+/obj/item/reagent_containers/food/snacks/snowcones/apple,
+/obj/item/reagent_containers/food/snacks/snowcones/blue,
+/obj/item/reagent_containers/food/snacks/snowcones/clown,
+/obj/item/reagent_containers/food/snacks/snowcones/fruitsalad,
+/obj/item/reagent_containers/food/snacks/snowcones/grape,
+/obj/item/reagent_containers/food/snacks/snowcones/honey,
+/obj/item/reagent_containers/food/snacks/snowcones/kiwi,
+/obj/item/reagent_containers/food/snacks/snowcones/lemon,
+/obj/item/reagent_containers/food/snacks/snowcones/lime,
+/obj/item/reagent_containers/food/snacks/snowcones/mime,
+/obj/item/reagent_containers/food/snacks/snowcones/orange,
+/obj/item/reagent_containers/food/snacks/snowcones/peach,
+/obj/item/reagent_containers/food/snacks/snowcones/pineapple,
+/obj/item/reagent_containers/food/snacks/snowcones/rainbow,
+/obj/item/reagent_containers/food/snacks/snowcones/red,
+/obj/item/reagent_containers/food/snacks/snowcones/soda,
+/obj/item/reagent_containers/food/snacks/snowcones/strawberry,
+/obj/effect/turf_decal/weather/snow/corner,
+/obj/effect/turf_decal/weather/snow/corner,
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"aul" = (
+/obj/structure/fluff/snowlegion,
+/obj/effect/turf_decal/weather/snow/corner,
+/obj/effect/turf_decal/weather/snow/corner,
+/turf/open/floor/spooktime/snow,
+/area/eventmap/inside)
+"aum" = (
+/obj/structure/closet/secure_closet/freezer/cream_pie,
+/obj/item/reagent_containers/food/snacks/pie/cream,
+/obj/item/reagent_containers/food/snacks/pie/cream,
+/obj/effect/turf_decal/weather/snow/corner,
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"aun" = (
+/obj/structure/closet/secure_closet/freezer/cream_pie,
+/obj/item/reagent_containers/food/snacks/pie/cream,
+/obj/item/reagent_containers/food/snacks/pie/cream,
+/obj/effect/turf_decal/weather/snow/corner,
+/obj/effect/turf_decal/weather/snow/corner{
+	dir = 6
+	},
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"auo" = (
+/turf/open/floor/plasteel/white/side{
+	dir = 1
+	},
+/area/eventmap/inside)
+"aup" = (
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"auq" = (
+/obj/item/gun/magic/staff/healing,
+/obj/structure/table/glass,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aur" = (
+/obj/machinery/light,
+/obj/structure/cable/yellow,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"aus" = (
+/obj/structure/chair/wood{
+	dir = 1
+	},
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"aut" = (
+/obj/effect/turf_decal/loading_area{
+	dir = 8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"auu" = (
+/obj/effect/decal/cleanable/cobweb,
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"auv" = (
+/obj/effect/decal/cleanable/dirt,
+/obj/structure/cable/yellow{
+	icon_state = "0-4"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"auw" = (
+/obj/structure/sign/directions/security{
+	dir = 8;
+	pixel_x = -32;
+	pixel_y = -24
+	},
+/obj/structure/sign/directions/supply{
+	dir = 8;
+	pixel_x = -32;
+	pixel_y = -32
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"aux" = (
+/obj/structure/chair/wood,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"auy" = (
+/obj/machinery/conveyor{
+	dir = 8;
+	id = "cargo_in"
+	},
+/obj/effect/turf_decal/stripes/line{
+	dir = 1
+	},
+/obj/effect/turf_decal/stripes/line,
+/turf/open/floor/plating,
+/area/eventmap/inside)
+"auz" = (
+/obj/structure/chair/wood,
+/obj/effect/landmark/start/assistant,
+/turf/open/floor/wood/damturf/broken1,
+/area/eventmap/inside)
+"auA" = (
+/obj/machinery/button/door/dorms/dorm06,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"auB" = (
+/obj/structure/barricade/wooden/snowed,
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"auC" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/machinery/vending/games,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"auD" = (
+/obj/structure/chair/stool/bar,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"auE" = (
+/obj/effect/turf_decal/tile/red{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/green{
+	dir = 8
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountain)
+"auF" = (
+/obj/structure/table/reinforced,
+/obj/machinery/door/firedoor,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"auG" = (
+/obj/machinery/camera/emp_proof,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"auH" = (
+/obj/structure/cable/white,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"auI" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"auJ" = (
+/obj/machinery/chem_master/condimaster,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"auK" = (
+/obj/structure/table,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"auL" = (
+/obj/structure/table,
+/obj/machinery/reagentgrinder,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"auM" = (
+/obj/structure/table,
+/obj/effect/meteor/meaty{
+	lifetime = 1e+009
+	},
+/obj/effect/decal/cleanable/cobweb,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"auN" = (
+/obj/machinery/dominator,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"auO" = (
+/obj/machinery/sleeper,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"auP" = (
+/obj/machinery/hydroponics,
+/obj/effect/decal/cleanable/glass,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"auQ" = (
+/obj/machinery/computer/operating,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"auR" = (
+/obj/structure/table/optable,
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "floor5"
+	},
+/obj/effect/decal/cleanable/glass,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"auS" = (
+/obj/item/storage/backpack/duffelbag/med/surgery,
+/obj/item/book/manual/wiki/surgery,
+/obj/structure/table,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"auT" = (
+/obj/machinery/computer/crew,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"auU" = (
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"auV" = (
+/obj/structure/spacevine,
+/turf/closed/indestructible/riveted,
+/area/eventmap/inside)
+"auW" = (
+/obj/structure/table,
+/obj/machinery/light/small{
+	dir = 1
+	},
+/obj/item/storage/box/ingredients/carnivore,
+/obj/item/reagent_containers/food/condiment/enzyme,
+/obj/item/reagent_containers/food/condiment/enzyme,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"auX" = (
+/obj/structure/alien/resin/membrane,
+/obj/structure/spacevine,
+/obj/structure/spacevine,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"auY" = (
+/obj/structure/alien/resin/membrane,
+/obj/structure/spacevine,
+/obj/structure/spacevine,
+/mob/living/simple_animal/hostile/venus_human_trap{
+	a_intent = "friendly";
+	harm_intent_damage = 0;
+	melee_damage_lower = 0;
+	melee_damage_type = "arousal";
+	melee_damage_upper = 0
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"auZ" = (
+/obj/structure/kitchenspike,
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "gib3"
+	},
+/obj/effect/decal/cleanable/cobweb,
+/obj/item/stack/sheet/animalhide/human,
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 9
+	},
+/turf/open/floor/plasteel/dark/corner,
+/area/eventmap/inside)
+"ava" = (
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 1
+	},
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 1
+	},
+/obj/machinery/iv_drip,
+/turf/open/floor/plasteel/dark/side,
+/area/eventmap/inside)
+"avb" = (
+/obj/structure/kitchenspike,
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "floor5"
+	},
+/obj/effect/decal/remains/xeno/larva,
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 1
+	},
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "xgiblarvahead"
+	},
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "xgibmid2"
+	},
+/turf/open/floor/plasteel/dark/side,
+/area/eventmap/inside)
+"avc" = (
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 1
+	},
+/obj/machinery/iv_drip,
+/turf/open/floor/plasteel/dark/side,
+/area/eventmap/inside)
+"avd" = (
+/obj/structure/kitchenspike,
+/obj/effect/decal/cleanable/blood/splatter,
+/obj/effect/decal/remains/human,
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 1
+	},
+/turf/open/floor/plasteel/dark/side,
+/area/eventmap/inside)
+"ave" = (
+/obj/structure/kitchenspike,
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "gibmid3"
+	},
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "remainsxeno"
+	},
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 1
+	},
+/turf/open/floor/plasteel/dark/side,
+/area/eventmap/inside)
+"avf" = (
+/obj/structure/kitchenspike,
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "floor5"
+	},
+/obj/item/stack/sheet/animalhide/human,
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 1
+	},
+/turf/open/floor/plasteel/dark/side,
+/area/eventmap/inside)
+"avg" = (
+/obj/structure/kitchenspike,
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "gibtorso"
+	},
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 5
+	},
+/turf/open/floor/plasteel/dark/corner{
+	dir = 8
+	},
+/area/eventmap/inside)
+"avh" = (
+/turf/closed/indestructible/necropolis,
+/area/eventmap/inside)
+"avi" = (
+/atom/movable/screen/alert/status_effect/blooddrunk{
+	desc = "You see your disfigured skull screaming on the wall.";
+	icon = 'icons/mob/screen_gen.dmi';
+	icon_state = "Devil-6";
+	name = "Foolish creature of meat and bone."
+	},
+/turf/closed/indestructible/necropolis,
+/area/eventmap/inside)
+"avj" = (
+/atom/movable/screen/alert/status_effect/blooddrunk{
+	desc = "You feel hollow and empy inside.";
+	icon = 'icons/effects/cult_effects.dmi';
+	icon_state = "cultshield";
+	name = "You should not have come here."
+	},
+/turf/closed/indestructible/necropolis,
+/area/eventmap/inside)
+"avk" = (
+/obj/structure/necropolis_gate,
+/obj/structure/mineral_door/iron,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"avl" = (
+/obj/structure/sink/kitchen{
+	pixel_y = 28
+	},
+/obj/structure/closet/crate/bin{
+	storage_capacity = 300
+	},
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"avm" = (
+/obj/structure/bed,
+/obj/item/bedsheet/captain,
+/turf/open/floor/carpet/royalblue,
+/area/eventmap/inside)
+"avn" = (
+/obj/machinery/camera/emp_proof{
+	c_tag = "Containment - Fore Starboard";
+	dir = 8;
+	network = list("singularity")
+	},
+/obj/structure/sign/poster/official/hydro_ad{
+	pixel_x = 32
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"avo" = (
+/obj/structure/table/wood,
+/obj/item/paper_bin,
+/obj/item/pen/fountain/captain,
+/obj/item/stamp/captain,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"avp" = (
+/obj/structure/life_candle,
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"avq" = (
+/turf/closed/wall/rust,
+/area/eventmap/outside)
+"avr" = (
+/obj/machinery/door/airlock{
+	name = "Hydroponics Backroom";
+	req_access_txt = "35"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"avs" = (
+/obj/effect/decal/cleanable/dirt,
+/obj/machinery/door/airlock/medical/glass{
+	name = "Old Chemistry Lab"
+	},
+/obj/machinery/door/firedoor,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"avt" = (
+/obj/machinery/door/airlock/medical/glass{
+	id_tag = "GeneticsDoor";
+	name = "Genetics";
+	req_access_txt = "5; 68"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"avu" = (
+/obj/effect/turf_decal/stripes/line,
+/obj/effect/turf_decal/stripes/line{
+	dir = 1
+	},
+/obj/machinery/conveyor{
+	dir = 8;
+	id = "cargo_in"
+	},
+/turf/open/floor/plating,
+/area/eventmap/inside)
+"avv" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/obj/effect/landmark/start/head_of_personnel,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"avw" = (
+/obj/structure/table/wood,
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"avx" = (
+/obj/item/reagent_containers/food/condiment/saltshaker,
+/obj/item/reagent_containers/food/condiment/peppermill,
+/obj/structure/table/reinforced,
+/obj/machinery/door/firedoor,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"avy" = (
+/obj/effect/landmark/start/cook,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"avz" = (
+/obj/effect/decal/cleanable/plasma,
+/turf/closed/wall/mineral/wood,
+/area/eventmap/inside)
+"avA" = (
+/obj/machinery/doppler_array,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"avB" = (
+/obj/effect/decal/cleanable/blood/tracks,
+/obj/effect/decal/cleanable/blood/splatter,
+/mob/living/simple_animal/pet/cat/custom_cat{
+	name = "Ghost cat"
+	},
+/turf/open/floor/sepia,
+/area/eventmap/inside)
+"avC" = (
+/obj/machinery/iv_drip,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"avD" = (
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 8;
+	name = "Blood"
+	},
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "floor2"
+	},
+/turf/open/floor/plasteel/dark/side{
+	dir = 4
+	},
+/area/eventmap/inside)
+"avE" = (
+/obj/item/storage/box/donkpockets,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"avF" = (
+/obj/item/storage/box/fakesyndiesuit,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"avG" = (
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111"
+	},
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "gib5"
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"avH" = (
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111"
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"avI" = (
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111"
+	},
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "floor5"
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"avJ" = (
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "gib4"
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"avK" = (
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 4
+	},
+/obj/effect/gibspawner/human,
+/turf/open/floor/plasteel/dark/side{
+	dir = 8
+	},
+/area/eventmap/inside)
+"avL" = (
+/atom/movable/screen/alert/status_effect/blooddrunk{
+	desc = "I'M WATCHING YOU, COWARD.";
+	name = "???"
+	},
+/turf/open/indestructible/spooknecropolis,
+/area/eventmap/inside)
+"avM" = (
+/turf/open/indestructible/spooknecropolis,
+/area/eventmap/inside)
+"avN" = (
+/atom/movable/screen/alert/status_effect/blooddrunk{
+	desc = "YOUR SOUL IS MINE, MORTAL.";
+	name = "???"
+	},
+/turf/open/indestructible/spooknecropolis,
+/area/eventmap/inside)
+"avO" = (
+/obj/item/reagent_containers/food/condiment/sugar,
+/obj/item/reagent_containers/food/condiment/sugar,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"avP" = (
+/obj/structure/bookcase/random/fiction,
+/turf/open/floor/wood{
+	icon_state = "wood-broken3"
+	},
+/area/eventmap/inside)
+"avQ" = (
+/obj/structure/bed,
+/obj/item/bedsheet/random,
+/obj/machinery/button/door/dorms/dorm15,
+/obj/effect/decal/cleanable/dirt,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"avR" = (
+/obj/effect/turf_decal/stripes/line,
+/obj/effect/turf_decal/stripes/line{
+	dir = 1
+	},
+/obj/structure/plasticflaps/opaque,
+/obj/machinery/conveyor{
+	dir = 8;
+	id = "cargo_in"
+	},
+/turf/open/floor/plating,
+/area/eventmap/inside)
+"avS" = (
+/obj/structure/fence,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"avT" = (
+/obj/structure/fluff/empty_cryostasis_sleeper,
+/obj/effect/decal/cleanable/glass,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"avU" = (
+/mob/living/simple_animal/astral{
+	desc = "...Is haunting Space Station Three.";
+	name = "Ghost"
+	},
+/turf/open/floor/sepia,
+/area/eventmap/inside)
+"avV" = (
+/obj/machinery/loot_locator,
+/turf/open/floor/sepia,
+/area/eventmap/inside)
+"avW" = (
+/obj/effect/decal/cleanable/blood/tracks,
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "gib3"
+	},
+/turf/open/floor/sepia,
+/area/eventmap/inside)
+"avX" = (
+/turf/closed/indestructible/riveted,
+/area/eventmap/inside)
+"avY" = (
+/obj/machinery/door/airlock/virology,
+/obj/structure/spacevine,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"avZ" = (
+/obj/structure/spacevine,
+/obj/effect/spawner/structure/window/reinforced,
+/turf/open/floor/clockwork/reebe,
+/area/eventmap/inside)
+"awa" = (
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 8;
+	name = "Blood"
+	},
+/obj/effect/gibspawner/human,
+/turf/open/floor/plasteel/dark/side{
+	dir = 4
+	},
+/area/eventmap/inside)
+"awb" = (
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "floor2"
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"awc" = (
+/obj/structure/reagent_dispensers/cooking_oil,
+/obj/structure/showcase/horrific_experiment{
+	icon_state = "cover-on";
+	layer = 4.5
+	},
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 6
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"awd" = (
+/turf/closed/wall/r_wall/rust,
+/area/eventmap/inside)
+"awe" = (
+/obj/structure/reagent_dispensers/cooking_oil,
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 10
+	},
+/obj/structure/showcase/horrific_experiment{
+	icon_state = "cover-on";
+	layer = 4.5
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"awf" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 4
+	},
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "gibmid1"
+	},
+/obj/item/organ/brain,
+/turf/open/floor/plasteel/dark/side{
+	dir = 8
+	},
+/area/eventmap/inside)
+"awg" = (
+/obj/structure/flora/junglebush{
+	icon_state = "grassa4"
+	},
+/obj/vehicle/ridden/atv,
+/obj/item/key,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"awh" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"awi" = (
+/obj/structure/fluff/bus/dense,
+/turf/open/floor/spooktime/cobble/sideW{
+	icon_state = "cobble_side_n"
+	},
+/area/shuttle/arrival)
+"awj" = (
+/obj/structure/fluff/bus/dense{
+	icon_state = "hoodtop"
+	},
+/obj/docking_port/mobile/arrivals,
+/turf/open/floor/spooktime/cobble/sideS,
+/area/eventmap/outside)
+"awk" = (
+/turf/open/floor/spooktime/cobble/sideE,
+/area/eventmap/outside)
+"awl" = (
+/turf/open/floor/spooktime/cobble/sideW,
+/area/eventmap/outside)
+"awm" = (
+/obj/effect/landmark/observer_start,
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"awn" = (
+/turf/open/floor/spooktime/cobble/cornerSE,
+/area/eventmap/outside)
+"awo" = (
+/turf/open/floor/spooktime/cobble/cornerSW,
+/area/eventmap/outside)
+"awp" = (
+/mob/living/carbon/true_devil,
+/turf/open/indestructible/spooknecropolis,
+/area/eventmap/inside)
+"awq" = (
+/obj/item/reagent_containers/food/condiment/mayonnaise,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"awr" = (
+/obj/structure/table/reinforced,
+/obj/machinery/door/firedoor,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"aws" = (
+/obj/structure/mineral_door/wood,
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
+	id = "C02"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"awt" = (
+/obj/machinery/light{
+	dir = 8
+	},
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"awu" = (
+/obj/machinery/vending/hydroseeds,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"awv" = (
+/obj/structure/sign/departments/medbay/alt{
+	pixel_y = 32
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aww" = (
+/obj/structure/sign/directions/medical{
+	dir = 4;
+	pixel_x = 32;
+	pixel_y = -24
+	},
+/obj/structure/sign/directions/evac{
+	dir = 4;
+	pixel_x = 32;
+	pixel_y = -32
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"awx" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"awy" = (
+/obj/structure/table/wood,
+/obj/item/paper_bin/bundlenatural,
+/obj/item/pen,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"awz" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/wood/damturf/broken4,
+/area/eventmap/inside)
+"awA" = (
+/obj/structure/chair/stool/bar,
+/obj/effect/landmark/start/assistant,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"awB" = (
+/obj/machinery/light/small{
+	dir = 4
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"awC" = (
+/obj/item/storage/box/drinkingglasses,
+/obj/structure/table/reinforced,
+/obj/machinery/door/firedoor,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"awD" = (
+/obj/machinery/droneDispenser,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"awE" = (
+/obj/effect/decal/cleanable/salt,
+/turf/open/floor/sepia,
+/area/eventmap/inside)
+"awF" = (
+/obj/effect/decal/cleanable/blood/tracks,
+/turf/open/floor/sepia,
+/area/eventmap/inside)
+"awG" = (
+/obj/structure/mineral_door/wood,
+/turf/open/floor/plasteel/dark/side,
+/area/eventmap/inside)
+"awH" = (
+/turf/open/floor/plasteel/dark/side{
+	dir = 6
+	},
+/area/eventmap/inside)
+"awI" = (
+/obj/effect/decal/cleanable/blood/tracks{
+	dir = 4
+	},
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 4
+	},
+/obj/effect/gibspawner/human,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"awJ" = (
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 8;
+	name = "Blood"
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"awK" = (
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "gibup1"
+	},
+/obj/item/organ/stomach,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"awL" = (
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 8;
+	name = "Blood"
+	},
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "coatblood"
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"awM" = (
+/obj/structure/table/wood/fancy/blackred,
+/obj/item/toy/toy_dagger,
+/turf/open/indestructible/spooknecropolis,
+/area/eventmap/inside)
+"awN" = (
+/obj/structure/table/wood/fancy/blackred,
+/obj/item/clothing/neck/devilwings,
+/turf/open/indestructible/spooknecropolis,
+/area/eventmap/inside)
+"awO" = (
+/obj/structure/table/wood/fancy/blackred,
+/obj/item/blood_beam,
+/turf/open/indestructible/spooknecropolis,
+/area/eventmap/inside)
+"awP" = (
+/obj/structure/fluff/drake_statue,
+/turf/open/indestructible/spooknecropolis,
+/area/eventmap/inside)
+"awQ" = (
+/obj/item/clothing/glasses/wraith_spectacles,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"awR" = (
+/obj/structure/mineral_door/wood,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"awS" = (
+/obj/effect/landmark/start/captain,
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/white,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"awT" = (
+/obj/structure/table,
+/obj/machinery/microwave,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"awU" = (
+/obj/structure/table,
+/obj/item/reagent_containers/food/condiment/enzyme,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"awV" = (
+/obj/structure/table,
+/obj/item/storage/box/ingredients/delights,
+/obj/item/storage/box/ingredients/exotic,
+/obj/item/storage/box/ingredients/italian,
+/obj/item/storage/box/ingredients/grains,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"awW" = (
+/obj/structure/bed/dogbed/ian,
+/obj/structure/cable/white{
+	icon_state = "0-2"
+	},
+/mob/living/simple_animal/pet/dog/corgi/Ian,
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"awX" = (
+/obj/structure/sink{
+	dir = 8;
+	pixel_x = -12
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"awY" = (
+/obj/machinery/vending/hydronutrients,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"awZ" = (
+/obj/structure/bodycontainer/morgue,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"axa" = (
+/obj/structure/showcase/horrific_experiment{
+	icon_state = "pod_1"
+	},
+/turf/open/floor/sepia,
+/area/eventmap/inside)
+"axb" = (
+/obj/structure/showcase/machinery/implanter,
+/turf/open/floor/sepia,
+/area/eventmap/inside)
+"axc" = (
+/obj/machinery/computer/cloning,
+/obj/effect/decal/cleanable/oil,
+/turf/open/floor/sepia,
+/area/eventmap/inside)
+"axd" = (
+/obj/structure/showcase/horrific_experiment,
+/obj/effect/decal/cleanable/glass,
+/turf/open/floor/sepia,
+/area/eventmap/inside)
+"axe" = (
+/obj/structure/showcase/machinery/oldpod,
+/obj/effect/decal/cleanable/oil,
+/turf/open/floor/sepia,
+/area/eventmap/inside)
+"axf" = (
+/obj/structure/mineral_door/wood,
+/turf/open/floor/plasteel/dark/side{
+	dir = 1
+	},
+/area/eventmap/inside)
+"axg" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/plasteel/dark/side{
+	dir = 5
+	},
+/area/eventmap/inside)
+"axh" = (
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 4
+	},
+/obj/effect/decal/cleanable/blood/innards,
+/obj/effect/decal/cleanable/blood/splatter,
+/obj/structure/closet/secure_closet/freezer/fridge,
+/obj/item/clothing/head/hooded/human_head,
+/obj/item/reagent_containers/food/snacks/burger/human,
+/obj/item/reagent_containers/food/snacks/burger/human,
+/obj/item/reagent_containers/food/snacks/kebab/human,
+/obj/item/reagent_containers/food/snacks/meat/cutlet/plain/human,
+/obj/item/reagent_containers/food/snacks/meat/rawcutlet/plain/human,
+/obj/item/reagent_containers/food/snacks/meat/slab/human,
+/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/avian,
+/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/fly,
+/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/golem,
+/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/insect,
+/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/lizard,
+/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/plant,
+/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/shadow,
+/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/skeleton,
+/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/slime,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"axi" = (
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 8;
+	name = "Blood"
+	},
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "gibbearcore"
+	},
+/obj/item/organ/tongue,
+/turf/open/floor/plasteel/dark/side{
+	dir = 4
+	},
+/area/eventmap/inside)
+"axj" = (
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 4
+	},
+/turf/open/floor/plasteel/dark/side{
+	dir = 8
+	},
+/area/eventmap/inside)
+"axk" = (
+/obj/structure/healingfountain,
+/turf/open/indestructible/spooknecropolis,
+/area/eventmap/inside)
+"axl" = (
+/obj/structure/table/wood/fancy/blackred,
+/obj/item/tome,
+/turf/open/indestructible/spooknecropolis,
+/area/eventmap/inside)
+"axm" = (
+/obj/structure/table/wood/fancy/blackred,
+/obj/item/toy/spinningtoy{
+	name = "Gate to hell"
+	},
+/turf/open/indestructible/spooknecropolis,
+/area/eventmap/inside)
+"axn" = (
+/obj/structure/table/wood/fancy/blackred,
+/obj/item/organ/heart/demon,
+/turf/open/indestructible/spooknecropolis,
+/area/eventmap/inside)
+"axo" = (
+/obj/structure/bed,
+/obj/item/bedsheet/cult,
+/turf/open/indestructible/spooknecropolis,
+/area/eventmap/inside)
+"axp" = (
+/obj/machinery/light/small{
+	dir = 8
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"axq" = (
+/obj/structure/toilet,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"axr" = (
+/obj/structure/closet/secure_closet/hydroponics,
+/obj/machinery/camera/emp_proof{
+	c_tag = "Containment - Fore Port";
+	dir = 4;
+	network = list("singularity")
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"axs" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-4"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-8"
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"axt" = (
+/obj/structure/cable/yellow{
+	icon_state = "2-8"
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"axu" = (
+/obj/machinery/camera/emp_proof{
+	c_tag = "Library Game Room";
+	dir = 1;
+	network = list("singularity")
+	},
+/turf/open/floor/wood/damturf/broken2,
+/area/eventmap/inside)
+"axv" = (
+/obj/structure/chair/wood{
+	dir = 1
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"axw" = (
+/obj/machinery/computer/communications{
+	dir = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"axx" = (
+/obj/structure/chair/wood{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"axy" = (
+/obj/item/storage/box/matches,
+/obj/structure/table/wood,
+/obj/item/storage/fancy/candle_box,
+/obj/item/storage/fancy/candle_box,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"axz" = (
+/obj/item/storage/box/ingredients/wildcard,
+/obj/item/storage/box/ingredients/wildcard,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"axA" = (
+/obj/machinery/deepfryer,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"axB" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"axC" = (
+/obj/structure/table/wood,
+/obj/machinery/recharger,
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"axD" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/sepia,
+/area/eventmap/inside)
+"axE" = (
+/obj/effect/decal/cleanable/glass,
+/mob/living/simple_animal/astral{
+	desc = "...Is haunting Space Station Three.";
+	name = "Ghost"
+	},
+/turf/open/floor/sepia,
+/area/eventmap/inside)
+"axF" = (
+/obj/effect/decal/cleanable/plasma,
+/turf/open/floor/sepia,
+/area/eventmap/inside)
+"axG" = (
+/obj/machinery/door/airlock/virology,
+/turf/open/floor/clockwork/reebe,
+/area/eventmap/inside)
+"axH" = (
+/obj/structure/bed{
+	desc = "A large structure used to break the femurs of traitors and treasonists.";
+	icon = 'icons/obj/femur_breaker.dmi';
+	icon_state = "breaker_raised";
+	name = "Femur breaker"
+	},
+/obj/effect/decal/cleanable/blood/gibs/limb{
+	icon_state = "gibleg"
+	},
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "gib3"
+	},
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "floor2"
+	},
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 4
+	},
+/obj/item/organ/appendix,
+/turf/open/floor/plasteel/dark/side{
+	dir = 8
+	},
+/area/eventmap/inside)
+"axI" = (
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "gib6"
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"axJ" = (
+/obj/structure/reagent_dispensers/cooking_oil,
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 5
+	},
+/obj/structure/showcase/horrific_experiment{
+	icon_state = "cover-on";
+	layer = 4.5
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"axK" = (
+/obj/structure/reagent_dispensers/cooking_oil,
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 9
+	},
+/obj/structure/showcase/horrific_experiment{
+	icon_state = "cover-on";
+	layer = 4.5
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"axL" = (
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 4
+	},
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 4
+	},
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "gibmid3"
+	},
+/obj/item/organ/eyes,
+/turf/open/floor/plasteel/dark/side{
+	dir = 8
+	},
+/area/eventmap/inside)
+"axM" = (
+/obj/structure/table,
+/obj/item/storage/box/ingredients/american,
+/obj/item/storage/box/ingredients/fiesta,
+/obj/item/storage/box/ingredients/grains,
+/obj/item/storage/box/ingredients/fruity,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"axN" = (
+/obj/structure/filingcabinet,
+/obj/structure/cable/white{
+	icon_state = "2-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"axO" = (
+/obj/machinery/smartfridge/food,
+/turf/closed/wall/mineral/wood,
+/area/eventmap/inside)
+"axP" = (
+/obj/structure/filingcabinet/chestdrawer,
+/obj/structure/cable/white{
+	icon_state = "2-4"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"axQ" = (
+/obj/machinery/light/small{
+	dir = 8
+	},
+/obj/structure/closet/secure_closet/hydroponics,
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"axR" = (
+/obj/machinery/computer/card{
+	dir = 4
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"axS" = (
+/obj/machinery/door/airlock{
+	name = "Hydroponics Backroom";
+	req_access_txt = "35"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"axT" = (
+/obj/machinery/light/small,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"axU" = (
+/obj/structure/sign/departments/restroom{
+	pixel_y = -32
+	},
+/obj/machinery/camera/emp_proof{
+	c_tag = "Containment - Particle Accelerator";
+	dir = 1;
+	network = list("singularity")
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"axV" = (
+/obj/structure/sign/directions/science{
+	pixel_x = 32;
+	pixel_y = -40
+	},
+/obj/structure/sign/directions/evac{
+	dir = 4;
+	pixel_x = 32;
+	pixel_y = -24
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"axW" = (
+/obj/structure/falsewall/wood,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"axX" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-4"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"axY" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"axZ" = (
+/obj/item/reagent_containers/food/condiment/soysauce,
+/obj/structure/cable/yellow{
+	icon_state = "2-8"
+	},
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"aya" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/structure/chair/wood,
+/obj/effect/landmark/start/head_of_personnel,
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"ayb" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"ayc" = (
+/obj/item/storage/box/ingredients/sweets,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"ayd" = (
+/obj/item/storage/box/ingredients/vegetarian,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"aye" = (
+/obj/effect/landmark/start/mime,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ayf" = (
+/obj/structure/table/wood/fancy/royalblack,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ayg" = (
+/obj/structure/table/wood/fancy/royalblack,
+/obj/item/toy/dummy,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ayh" = (
+/obj/effect/decal/cleanable/chem_pile,
+/turf/open/floor/sepia,
+/area/eventmap/inside)
+"ayi" = (
+/turf/open/floor/clockwork/reebe,
+/area/eventmap/inside)
+"ayj" = (
+/obj/item/ectoplasm,
+/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/zombie,
+/turf/open/floor/clockwork/reebe,
+/area/eventmap/inside)
+"ayk" = (
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 8;
+	name = "Blood"
+	},
+/obj/effect/decal/cleanable/plasma,
+/turf/open/floor/plasteel/dark/side{
+	dir = 4
+	},
+/area/eventmap/inside)
+"ayl" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/effect/decal/cleanable/blood/tracks,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"aym" = (
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 1
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"ayn" = (
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 1
+	},
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "splatter1"
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"ayo" = (
+/obj/structure/table/plasmaglass,
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"ayp" = (
+/obj/structure/fluff/divine/convertaltar,
+/turf/open/indestructible/spooknecropolis,
+/area/eventmap/inside)
+"ayq" = (
+/obj/machinery/dna_scannernew,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"ayr" = (
+/obj/machinery/computer/cloning,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"ays" = (
+/obj/machinery/clonepod/experimental,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"ayt" = (
+/obj/structure/fluff/empty_terrarium,
+/obj/effect/decal/cleanable/oil,
+/obj/effect/decal/cleanable/glass,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"ayu" = (
+/obj/machinery/nuclearbomb/beer,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"ayv" = (
+/obj/structure/table,
+/obj/item/hand_labeler,
+/obj/item/defibrillator/loaded,
+/obj/item/extendohand/acme,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"ayw" = (
+/obj/structure/table,
+/obj/item/inducer/sci,
+/obj/item/defibrillator/loaded,
+/obj/item/defibrillator/loaded,
+/obj/item/storage/box/beakers/bluespace,
+/obj/item/storage/belt/medolier/full,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"ayx" = (
+/obj/structure/table,
+/obj/item/implanter/sad_trombone,
+/obj/item/implanter/sad_trombone,
+/obj/item/implanter/tracking/gps,
+/obj/item/implanter/tracking/gps,
+/obj/item/healthanalyzer/advanced,
+/obj/item/pneumatic_cannon/pie,
+/obj/item/storage/box/hug,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"ayy" = (
+/obj/item/organ/appendix{
+	icon_state = "blacktumor";
+	name = "Festering ooze"
+	},
+/turf/open/floor/clockwork/reebe,
+/area/eventmap/inside)
+"ayz" = (
+/obj/structure/cloth_pile,
+/turf/open/floor/clockwork/reebe,
+/area/eventmap/inside)
+"ayA" = (
+/obj/machinery/light/floor{
+	alpha = 0;
+	light_range = 20;
+	mouse_opacity = 0
+	},
+/obj/machinery/light/floor{
+	alpha = 0;
+	light_range = 20;
+	max_integrity = 9999;
+	mouse_opacity = 0
+	},
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"ayB" = (
+/obj/machinery/recharge_station,
+/turf/open/floor/carpet/monochrome,
+/area/eventmap/inside)
+"ayC" = (
+/obj/item/clothing/suit/ghost_sheet,
+/turf/open/floor/carpet/monochrome,
+/area/eventmap/inside)
+"ayD" = (
+/obj/structure/kitchenspike,
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 10
+	},
+/obj/effect/decal/remains/plasma,
+/obj/effect/decal/cleanable/plasma,
+/turf/open/floor/plasteel/dark/corner{
+	dir = 4
+	},
+/area/eventmap/inside)
+"ayE" = (
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111"
+	},
+/obj/machinery/iv_drip,
+/obj/effect/decal/cleanable/plasma,
+/turf/open/floor/plasteel/dark/side{
+	dir = 1
+	},
+/area/eventmap/inside)
+"ayF" = (
+/obj/structure/kitchenspike,
+/obj/item/stack/sheet/animalhide/corgi,
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111"
+	},
+/obj/effect/decal/cleanable/blood/tracks,
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "itemblood"
+	},
+/obj/item/reagent_containers/food/snacks/meat/slab/corgi,
+/turf/open/floor/plasteel/dark/side{
+	dir = 1
+	},
+/area/eventmap/inside)
+"ayG" = (
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111"
+	},
+/obj/machinery/iv_drip,
+/turf/open/floor/plasteel/dark/side{
+	dir = 1
+	},
+/area/eventmap/inside)
+"ayH" = (
+/obj/structure/kitchenspike,
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111"
+	},
+/obj/structure/spider/stickyweb,
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "u_psycopath"
+	},
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "gibdown1"
+	},
+/turf/open/floor/plasteel/dark/side{
+	dir = 1
+	},
+/area/eventmap/inside)
+"ayI" = (
+/obj/structure/kitchenspike,
+/obj/item/stack/sheet/animalhide/lizard,
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111"
+	},
+/obj/effect/decal/cleanable/blood/tracks,
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "floor4-old"
+	},
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "splatter4"
+	},
+/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/lizard,
+/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/lizard,
+/turf/open/floor/plasteel/dark/side{
+	dir = 1
+	},
+/area/eventmap/inside)
+"ayJ" = (
+/obj/structure/kitchenspike,
+/obj/item/stack/sheet/animalhide/monkey,
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111"
+	},
+/obj/effect/decal/cleanable/blood/tracks,
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "gibmid3"
+	},
+/obj/item/reagent_containers/food/snacks/meat/slab/monkey,
+/obj/item/reagent_containers/food/snacks/meat/slab/monkey,
+/turf/open/floor/plasteel/dark/side{
+	dir = 1
+	},
+/area/eventmap/inside)
+"ayK" = (
+/obj/structure/kitchenspike,
+/obj/item/stack/sheet/animalhide/xeno,
+/obj/effect/turf_decal/weather/snow/corner{
+	color = "#991111";
+	dir = 6
+	},
+/obj/effect/decal/cleanable/blood/tracks,
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "xgib2"
+	},
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "xgiblarvahead"
+	},
+/obj/item/reagent_containers/food/snacks/meat/slab/xeno,
+/obj/item/reagent_containers/food/snacks/meat/slab/xeno,
+/turf/open/floor/plasteel/dark/corner{
+	dir = 1
+	},
+/area/eventmap/inside)
+"ayL" = (
+/atom/movable/screen/alert/status_effect/blooddrunk{
+	desc = "BEWARE, I LIVE.";
+	name = "???"
+	},
+/turf/open/indestructible/spooknecropolis,
+/area/eventmap/inside)
+"ayM" = (
+/atom/movable/screen/alert/status_effect/blooddrunk{
+	desc = "WELCOME TO HELL, CURSED ONE.";
+	name = "???"
+	},
+/turf/open/indestructible/spooknecropolis,
+/area/eventmap/inside)
+"ayN" = (
+/turf/closed/indestructible/spookytime/matrixblocker,
+/area/eventmap/mountain)
+"ayO" = (
+/turf/open/floor/spooktime/cobble/sideS,
+/area/eventmap/outside)
+"ayP" = (
+/obj/structure/fluff/bus/passable{
+	icon_state = "wheredahoodat"
+	},
+/turf/open/floor/spooktime/cobble/sideW{
+	icon_state = "cobble_side_n"
+	},
+/area/eventmap/outside)
+"ayQ" = (
+/turf/open/floor/spooktime/cobble/sideW{
+	icon_state = "cobble_corner_ne"
+	},
+/area/eventmap/outside)
+"ayR" = (
+/obj/effect/landmark/start/research_director,
+/turf/open/floor/spooktime/cobble/sideS,
+/area/eventmap/outside)
+"ayS" = (
+/obj/effect/landmark/start/head_of_personnel,
+/turf/open/floor/spooktime/cobble/sideS,
+/area/eventmap/outside)
+"ayT" = (
+/obj/effect/landmark/start/captain,
+/turf/open/floor/spooktime/cobble/sideS,
+/area/eventmap/outside)
+"ayU" = (
+/obj/machinery/door/airlock/command{
+	name = "Head of Personnel's Quarters";
+	req_access_txt = "57"
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ayV" = (
+/obj/structure/spacevine,
+/obj/structure/spacevine,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"ayW" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/plating,
+/area/eventmap/mountaininside)
+"ayX" = (
+/obj/structure/cable/white{
+	icon_state = "2-8"
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"ayY" = (
+/obj/structure/noticeboard{
+	dir = 8;
+	pixel_x = 32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"ayZ" = (
+/obj/effect/landmark/start/librarian,
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"aza" = (
+/obj/effect/landmark/start/scientist,
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"azb" = (
+/obj/effect/landmark/start/assistant,
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"azc" = (
+/obj/effect/landmark/start/assistant,
+/turf/open/floor/spooktime/cobble/sideW,
+/area/eventmap/outside)
+"azd" = (
+/obj/effect/landmark/start/assistant,
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"aze" = (
+/obj/item/reagent_containers/food/drinks/bottle/trappist,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"azf" = (
+/obj/effect/landmark/start/lawyer,
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"azg" = (
+/obj/effect/landmark/start/roboticist,
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"azh" = (
+/obj/structure/punching_bag,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"azi" = (
+/obj/effect/landmark/start,
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"azj" = (
+/obj/effect/landmark/start,
+/turf/open/floor/spooktime/cobble/cornerSW,
+/area/eventmap/outside)
+"azk" = (
+/obj/effect/landmark/start,
+/turf/open/floor/spooktime/cobble/sideS,
+/area/eventmap/outside)
+"azl" = (
+/obj/effect/landmark/start/assistant,
+/turf/open/floor/spooktime/cobble/sideS,
+/area/eventmap/outside)
+"azm" = (
+/obj/effect/landmark/start/mime,
+/turf/open/floor/spooktime/cobble/sideS,
+/area/eventmap/outside)
+"azn" = (
+/obj/effect/landmark/start/chief_engineer,
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"azo" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/obj/structure/table/wood/fancy/royalblack,
+/obj/item/camera/spooky,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"azp" = (
+/obj/item/reagent_containers/food/snacks/kebab/rat/double,
+/obj/structure/table/reinforced,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"azq" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/plasteel/stairs/medium,
+/area/eventmap/outside)
+"azr" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/spooktime/cobble/sideN,
+/area/eventmap/outside)
+"azs" = (
+/obj/effect/landmark/start/atmospheric_technician,
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"azt" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"azu" = (
+/obj/machinery/light/small{
+	dir = 8
+	},
+/turf/open/floor/spooktime/cobble/sideW,
+/area/eventmap/outside)
+"azv" = (
+/obj/structure/flora/tree/jungle,
+/obj/structure/flora/tree/jungle,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"azw" = (
+/obj/machinery/autolathe,
+/obj/effect/turf_decal/bot,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"azx" = (
+/obj/structure/chair/wood{
+	dir = 4
+	},
+/obj/effect/landmark/start/geneticist,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"azy" = (
+/obj/machinery/vending/coffee,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"azz" = (
+/obj/structure/dresser,
+/obj/structure/curtain{
+	color = "#B22222";
+	pixel_x = 32
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"azA" = (
+/obj/structure/sign/directions/evac{
+	dir = 4;
+	pixel_x = 32;
+	pixel_y = -24
+	},
+/turf/open/floor/spooktime/cobble/cornerSE,
+/area/eventmap/outside)
+"azB" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/indestructible/cobble,
+/area/eventmap/outside)
+"azC" = (
+/obj/effect/landmark/start/assistant,
+/turf/open/floor/spooktime/cobble/sideE,
+/area/eventmap/outside)
+"azD" = (
+/obj/effect/landmark/start/shaft_miner,
+/turf/open/floor/spooktime/cobble/sideE,
+/area/eventmap/outside)
+"azE" = (
+/obj/structure/flora/ausbushes/ywflowers,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"azF" = (
+/obj/effect/landmark/start/librarian,
+/turf/open/floor/spooktime/cobble/sideW,
+/area/eventmap/outside)
+"azG" = (
+/obj/structure/chair/wood/wings,
+/obj/effect/landmark/start/assistant,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"azH" = (
+/obj/machinery/computer/scan_consolenew{
+	dir = 8
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"azI" = (
+/obj/effect/landmark/start/scientist,
+/turf/open/floor/spooktime/cobble/sideW,
+/area/eventmap/outside)
+"azJ" = (
+/obj/structure/closet/secure_closet/captains,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"azK" = (
+/obj/structure/flora/grass/jungle/b,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"azL" = (
+/obj/machinery/vending/wardrobe/jani_wardrobe,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"azM" = (
+/obj/structure/closet/l3closet/janitor,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"azN" = (
+/obj/structure/closet/jcloset,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"azO" = (
+/obj/machinery/vending/medical{
+	req_access = null
+	},
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"azP" = (
+/turf/open/floor/spooktime/beach/coasts/coastW,
+/area/eventmap/outside)
+"azQ" = (
+/turf/closed/indestructible/spookytime/matrixblocker,
+/area/eventmap/mountaininside)
+"azR" = (
+/obj/structure/reagent_dispensers/watertank/high,
+/obj/structure/disposalpipe/segment{
+	dir = 4
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"azS" = (
+/obj/effect/wisp,
+/turf/open/floor/carpet/green,
+/area/eventmap/inside)
+"azT" = (
+/obj/structure/table/wood/fancy/green,
+/obj/item/gun/magic/staff/healing,
+/obj/item/gun/magic/staff/healing,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"azU" = (
+/turf/open/floor/spooktime/beach/coasts/coastNE,
+/area/eventmap/outside)
+"azV" = (
+/obj/structure/barricade/wooden/crude,
+/obj/structure/spacevine,
+/obj/effect/spawner/structure/window,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"azW" = (
+/obj/item/flashlight/glowstick/orange,
+/turf/open/floor/spooktime/beach,
+/area/eventmap/outside)
+"azX" = (
+/obj/structure/curtain{
+	color = "#B22222";
+	pixel_x = -32
+	},
+/obj/structure/bookcase/random/adult,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"azY" = (
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"azZ" = (
+/obj/item/storage/pill_bottle/happy,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aAa" = (
+/obj/structure/disposalpipe/segment{
+	dir = 4
+	},
+/turf/closed/wall/mineral/wood,
+/area/eventmap/inside)
+"aAb" = (
+/turf/closed/mineral/ash_rock,
+/area/eventmap/mountaininside)
+"aAc" = (
+/obj/machinery/door/airlock/glass_large,
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
+	id = "C05"
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aAd" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/disposalpipe/segment{
+	dir = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aAe" = (
+/obj/structure/reagent_dispensers/beerkeg,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aAf" = (
+/obj/structure/disposalpipe/segment{
+	dir = 10
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aAg" = (
+/obj/structure/chair/comfy/black{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aAh" = (
+/obj/item/storage/fancy/cigarettes/cigpack_shadyjims,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aAi" = (
+/obj/structure/cable/pink{
+	icon_state = "6-9"
+	},
+/turf/open/floor/plating,
+/area/eventmap/mountain)
+"aAj" = (
+/obj/structure/table/wood/fancy,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aAk" = (
+/obj/machinery/camera/emp_proof{
+	c_tag = "Containment - Particle Accelerator";
+	dir = 1;
+	network = list("singularity")
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aAl" = (
+/obj/machinery/chem_dispenser/drinks/beer/fullupgrade{
+	dir = 1
+	},
+/obj/structure/table,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"aAm" = (
+/obj/machinery/chem_dispenser/drinks/fullupgrade{
+	dir = 1
+	},
+/obj/structure/table,
+/obj/structure/cable/yellow,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"aAn" = (
+/obj/structure/closet/secure_closet/freezer/fridge,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/milk,
+/obj/item/reagent_containers/food/condiment/soymilk,
+/obj/item/reagent_containers/food/condiment/soymilk,
+/obj/item/reagent_containers/food/condiment/soymilk,
+/obj/item/reagent_containers/food/condiment/soymilk,
+/obj/item/reagent_containers/food/condiment/soymilk,
+/obj/item/reagent_containers/food/condiment/soymilk,
+/obj/item/reagent_containers/food/condiment/soymilk,
+/obj/item/reagent_containers/food/condiment/soymilk,
+/obj/item/reagent_containers/food/condiment/soymilk,
+/obj/item/reagent_containers/food/condiment/soymilk,
+/obj/item/reagent_containers/food/condiment/soymilk,
+/obj/item/reagent_containers/food/condiment/soymilk,
+/obj/item/reagent_containers/food/condiment/soymilk,
+/obj/item/reagent_containers/food/condiment/soymilk,
+/obj/item/storage/fancy/egg_box,
+/obj/item/storage/fancy/egg_box,
+/obj/item/storage/fancy/egg_box,
+/obj/item/storage/fancy/egg_box,
+/obj/item/storage/fancy/egg_box,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"aAo" = (
+/obj/item/chair,
+/turf/open/floor/plasteel/damturf/platdmg3,
+/area/eventmap/mountaininside)
+"aAp" = (
+/obj/item/stack/sheet/mineral/mythril,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aAq" = (
+/obj/machinery/processor,
+/obj/machinery/light/small,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"aAr" = (
+/obj/item/disk/tech_disk/debug,
+/obj/machinery/light/floor,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aAs" = (
+/obj/structure/noticeboard{
+	dir = 1;
+	pixel_y = -32
+	},
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/item/reagent_containers/food/condiment/flour,
+/obj/structure/closet/secure_closet/freezer/fridge,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"aAt" = (
+/obj/item/reagent_containers/food/drinks/bottle/bottleofnothing,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aAu" = (
+/obj/structure/chair/comfy/beige{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aAv" = (
+/obj/structure/reagent_dispensers/watertank/high,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aAw" = (
+/obj/item/storage/pill_bottle/happiness,
+/obj/effect/decal/cleanable/dirt,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aAx" = (
+/obj/machinery/light,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aAy" = (
+/obj/structure/fermenting_barrel,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aAz" = (
+/obj/structure/closet/crate/hydroponics,
+/obj/structure/cable/yellow,
+/obj/structure/sign/poster/contraband/kudzu{
+	pixel_y = -32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aAA" = (
+/obj/item/reagent_containers/food/snacks/chips,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aAB" = (
+/obj/structure/beebox/unwrenched,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aAC" = (
+/obj/structure/table,
+/obj/structure/cable/white{
+	icon_state = "0-4"
+	},
+/obj/item/storage/box/bodybags{
+	pixel_x = -3;
+	pixel_y = 5
+	},
+/obj/item/storage/box/rxglasses,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"aAD" = (
+/obj/structure/flora/ausbushes/leafybush,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aAE" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"aAF" = (
+/obj/machinery/light{
+	dir = 4
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aAG" = (
+/obj/item/lighter,
+/turf/open/floor/carpet/purple,
+/area/eventmap/mountaininside)
+"aAH" = (
+/obj/structure/cable/white{
+	icon_state = "1-8"
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"aAI" = (
+/obj/machinery/dna_scannernew,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"aAJ" = (
+/turf/open/floor/spooktime/beach/coasts/watercoastNE,
+/area/eventmap/outside)
+"aAK" = (
+/obj/structure/falsewall/wood,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"aAL" = (
+/obj/item/storage/pill_bottle/stimulant,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aAM" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/obj/structure/toilet{
+	dir = 4
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aAN" = (
+/obj/structure/bonfire,
+/turf/open/floor/engine,
+/area/eventmap/mountain)
+"aAO" = (
+/obj/machinery/door/airlock{
+	name = "Toilet Unit"
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aAP" = (
+/obj/structure/sign/departments/showers{
+	pixel_y = 32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aAQ" = (
+/obj/machinery/light/small{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aAR" = (
+/obj/structure/bed,
+/obj/item/bedsheet/centcom,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aAS" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/obj/structure/toilet{
+	dir = 8
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aAT" = (
+/obj/structure/table,
+/obj/item/storage/box/mousetraps,
+/obj/item/storage/box/lights/mixed{
+	pixel_x = 4;
+	pixel_y = 4
+	},
+/obj/machinery/light/small{
+	dir = 8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aAU" = (
+/obj/item/reagent_containers/food/snacks/fudgedice,
+/turf/open/floor/wood{
+	icon_state = "wood-broken4"
+	},
+/area/eventmap/inside)
+"aAV" = (
+/obj/effect/landmark/start/janitor,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aAW" = (
+/obj/machinery/door/airlock{
+	name = "Custodial Closet";
+	req_access_txt = "26"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aAX" = (
+/obj/machinery/door/airlock/maintenance,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aAY" = (
+/obj/machinery/light{
+	dir = 1
+	},
+/obj/structure/table/plasmaglass,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aAZ" = (
+/obj/machinery/vending/kink,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aBa" = (
+/obj/machinery/door/airlock/freezer,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"aBb" = (
+/obj/structure/cable/pink{
+	icon_state = "6-8"
+	},
+/turf/open/floor/plating,
+/area/eventmap/mountain)
+"aBc" = (
+/obj/machinery/door/airlock{
+	name = "Bar Backroom";
+	req_access_txt = "25"
+	},
+/obj/machinery/door/firedoor,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aBd" = (
+/obj/structure/table,
+/obj/item/folder/white,
+/obj/item/storage/pill_bottle/mannitol{
+	pixel_x = -5;
+	pixel_y = 12
+	},
+/obj/item/storage/pill_bottle/mutadone{
+	pixel_x = -8;
+	pixel_y = 10
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"aBe" = (
+/obj/effect/landmark/start/geneticist,
+/obj/structure/chair/wood,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"aBf" = (
+/obj/structure/fluff/bus/passable/seat/driver,
+/obj/structure/chair/comfy/shuttle{
+	dir = 4;
+	icon_state = ""
+	},
+/obj/machinery/light/floor{
+	alpha = 0;
+	light_range = 20;
+	max_integrity = 9999;
+	mouse_opacity = 0
+	},
+/turf/open/floor/plasteel/dark{
+	icon_state = "bus"
+	},
+/area/shuttle/arrival)
+"aBg" = (
+/obj/machinery/light/floor,
+/obj/machinery/telecomms/broadcaster,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aBh" = (
+/obj/structure/window/reinforced/spawner/north,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"aBi" = (
+/obj/machinery/light/small{
+	dir = 4;
+	light_color = "#d8b1b1"
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aBj" = (
+/obj/machinery/light/small{
+	dir = 8
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aBk" = (
+/obj/structure/closet/secure_closet/injection,
+/obj/effect/decal/cleanable/cobweb{
+	icon_state = "cobweb2"
+	},
+/obj/effect/decal/cleanable/generic,
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aBl" = (
+/obj/structure/closet/secure_closet/personal,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aBm" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aBn" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aBo" = (
+/obj/machinery/light{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aBp" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"aBq" = (
+/obj/structure/cable/white{
+	icon_state = "2-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "2-4"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"aBr" = (
+/obj/structure/cable/white{
+	icon_state = "1-8"
+	},
+/obj/structure/dresser,
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"aBs" = (
+/obj/machinery/vending/assist,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aBt" = (
+/obj/structure/closet/crate/bin,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aBu" = (
+/obj/effect/turf_decal/tile/red{
+	dir = 8
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountain)
+"aBv" = (
+/obj/structure/table,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aBw" = (
+/obj/structure/chair/comfy/brown{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aBx" = (
+/obj/machinery/shower{
+	dir = 8
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aBy" = (
+/obj/item/storage/fancy/cigarettes/cigpack_midori,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aBz" = (
+/turf/open/floor/carpet/purple,
+/area/eventmap/mountaininside)
+"aBA" = (
+/obj/item/reagent_containers/pill/zoom,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aBB" = (
+/obj/effect/turf_decal/tile/green{
+	dir = 1
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountain)
+"aBC" = (
+/obj/structure/chair,
+/obj/effect/landmark/start/assistant,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aBD" = (
+/obj/item/flashlight/lantern,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aBE" = (
+/obj/structure/bed,
+/obj/item/bedsheet/pirate,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aBF" = (
+/obj/machinery/telecomms/allinone/indestructable{
+	freq_listening = list(1347,1349,1351,1353,1355,1357,1359,1447)
+	},
+/obj/machinery/light/floor,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aBG" = (
+/obj/machinery/nanite_chamber,
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aBH" = (
+/obj/item/storage/pill_bottle/penis_enlargement,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aBI" = (
+/obj/structure/chair,
+/obj/effect/landmark/start/lawyer,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aBJ" = (
+/obj/structure/chair,
+/obj/effect/landmark/start/clown,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aBK" = (
+/obj/structure/curtain{
+	color = "#B22222";
+	pixel_y = -32
+	},
+/turf/open/floor/wood/damturf/broken3,
+/area/eventmap/inside)
+"aBL" = (
+/turf/open/floor/plasteel/damturf/damage1,
+/area/eventmap/mountain)
+"aBM" = (
+/obj/machinery/light{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aBN" = (
+/turf/open/floor/spooktime/beach/coasts/watercoastW,
+/area/eventmap/outside)
+"aBO" = (
+/obj/structure/table/wood,
+/obj/machinery/computer/security/wooden_tv{
+	pixel_y = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aBP" = (
+/obj/structure/table/wood,
+/obj/item/reagent_containers/food/snacks/donut/chaos,
+/obj/item/reagent_containers/food/snacks/donut/jelly{
+	pixel_x = 4;
+	pixel_y = 2
+	},
+/obj/item/reagent_containers/food/snacks/donut{
+	pixel_x = -3;
+	pixel_y = 5
+	},
+/obj/item/reagent_containers/food/snacks/donut{
+	pixel_x = -2;
+	pixel_y = -4
+	},
+/obj/item/reagent_containers/food/snacks/donut{
+	pixel_x = -4
+	},
+/obj/item/reagent_containers/food/snacks/donut{
+	pixel_x = 5;
+	pixel_y = -1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aBQ" = (
+/obj/structure/table,
+/obj/item/watertank/janitor,
+/obj/item/mop/advanced,
+/obj/item/grenade/chem_grenade/cleaner,
+/obj/item/grenade/chem_grenade/cleaner,
+/obj/item/grenade/chem_grenade/cleaner,
+/obj/item/grenade/chem_grenade/cleaner,
+/obj/item/grenade/chem_grenade/cleaner,
+/obj/item/grenade/chem_grenade/cleaner,
+/obj/item/grenade/chem_grenade/cleaner,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aBR" = (
+/obj/structure/cable/pink{
+	icon_state = "2-5"
+	},
+/obj/structure/cable/pink{
+	icon_state = "2-9"
+	},
+/turf/open/floor/plating,
+/area/eventmap/mountain)
+"aBS" = (
+/obj/vehicle/ridden/janicart/upgraded,
+/obj/item/key/janitor,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aBT" = (
+/obj/structure/bed,
+/obj/item/bedsheet/pirate,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aBU" = (
+/obj/machinery/door/airlock/wood/dorms/dorm07,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aBV" = (
+/obj/structure/janitorialcart,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aBW" = (
+/obj/item/lighter/greyscale,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aBX" = (
+/obj/structure/chair/comfy/black{
+	dir = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aBY" = (
+/obj/structure/falsewall/wood,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aBZ" = (
+/obj/structure/closet/secure_closet/freezer/meat,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aCa" = (
+/obj/structure/noticeboard{
+	pixel_y = 32
+	},
+/obj/structure/table/wood,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aCb" = (
+/obj/machinery/camera/emp_proof,
+/obj/machinery/light{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aCc" = (
+/obj/item/flashlight/lantern,
+/obj/structure/curtain{
+	color = "#B22222";
+	pixel_x = -32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aCd" = (
+/obj/structure/closet/secure_closet/security,
+/obj/item/clothing/head/beret/sec/navyofficer,
+/obj/item/clothing/under/rank/security/officer/formal,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aCe" = (
+/obj/machinery/shower{
+	desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well...";
+	pixel_y = 24
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aCf" = (
+/obj/structure/plasticflaps/opaque,
+/obj/effect/turf_decal/bot,
+/turf/open/floor/plating,
+/area/eventmap/inside)
+"aCg" = (
+/obj/item/flashlight/flare/torch,
+/obj/item/flashlight/flare/torch,
+/obj/item/umbrella,
+/obj/item/pickaxe/mini,
+/obj/item/shovel,
+/obj/item/hatchet,
+/obj/item/storage/box/matches,
+/obj/item/storage/fancy/candle_box,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aCh" = (
+/obj/structure/toilet,
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/mountaininside)
+"aCi" = (
+/obj/effect/turf_decal/delivery,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aCj" = (
+/obj/structure/closet/secure_closet/freezer/meat,
+/obj/item/reagent_containers/food/snacks/carpmeat,
+/obj/item/reagent_containers/food/snacks/carpmeat,
+/obj/item/reagent_containers/food/snacks/meat/slab/gorilla,
+/obj/item/reagent_containers/food/snacks/meat/slab/gorilla,
+/obj/item/reagent_containers/food/snacks/meat/slab/gondola,
+/obj/item/reagent_containers/food/snacks/meat/slab/gondola,
+/obj/item/reagent_containers/food/snacks/meat/slab/spider,
+/obj/item/reagent_containers/food/snacks/meat/slab/spider,
+/obj/item/reagent_containers/food/snacks/meat/slab/xeno,
+/obj/item/reagent_containers/food/snacks/meat/slab/xeno,
+/obj/item/reagent_containers/food/snacks/meat/slab/corgi,
+/obj/item/reagent_containers/food/snacks/meat/slab/corgi,
+/obj/item/reagent_containers/food/snacks/meat/slab/bear,
+/obj/item/reagent_containers/food/snacks/meat/slab/bear,
+/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/lizard,
+/obj/item/reagent_containers/food/snacks/meat/slab/monkey,
+/obj/item/reagent_containers/food/snacks/meat/slab/monkey,
+/obj/item/reagent_containers/food/snacks/meat/slab/pug,
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"aCk" = (
+/obj/item/storage/fancy/egg_box,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"aCl" = (
+/obj/item/scythe,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aCm" = (
+/obj/structure/chair/comfy/beige,
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aCn" = (
+/obj/structure/sink/kitchen{
+	pixel_y = 28
+	},
+/obj/machinery/light/small{
+	dir = 4
+	},
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"aCo" = (
+/obj/machinery/smartfridge/drinks,
+/turf/closed/wall/mineral/wood,
+/area/eventmap/inside)
+"aCp" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-8"
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"aCq" = (
+/obj/machinery/light{
+	dir = 4
+	},
+/obj/structure/closet/crate,
+/obj/item/clothing/neck/devilwings,
+/obj/item/clothing/gloves/bracer,
+/obj/item/clothing/accessory/skullcodpiece,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aCr" = (
+/obj/structure/closet/secure_closet/bar,
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aCs" = (
+/turf/open/floor/spooktime/beach/coasts/coastSE,
+/area/eventmap/outside)
+"aCt" = (
+/obj/effect/turf_decal/tile/green{
+	dir = 4
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountain)
+"aCu" = (
+/obj/structure/closet/crate,
+/obj/item/clothing/mask/horsehead,
+/obj/item/clothing/mask/horsehead,
+/obj/item/clothing/mask/bandana/red,
+/obj/item/clothing/mask/rat/bat,
+/obj/item/clothing/mask/rat/bear,
+/obj/item/clothing/mask/rat/bee,
+/obj/item/clothing/mask/rat/fox,
+/obj/item/clothing/mask/rat/jackal,
+/obj/item/clothing/mask/rat/raven,
+/obj/item/clothing/mask/rat/tribal,
+/obj/item/clothing/mask/frog,
+/obj/item/clothing/mask/scarecrow,
+/obj/item/clothing/mask/gondola,
+/obj/item/clothing/head/rice_hat,
+/obj/item/clothing/head/pharaoh,
+/obj/item/clothing/head/hunter,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aCv" = (
+/turf/open/floor/wood/damturf/broken3,
+/area/eventmap/inside)
+"aCw" = (
+/obj/structure/reagent_dispensers/beerkeg,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aCx" = (
+/obj/structure/toilet{
+	dir = 4
+	},
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/mountaininside)
+"aCy" = (
+/obj/structure/table,
+/obj/item/storage/box/drinkingglasses,
+/obj/item/storage/box/drinkingglasses,
+/obj/item/storage/box/beakers,
+/obj/item/storage/box/donkpockets,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aCz" = (
+/obj/structure/reagent_dispensers/keg/mead,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aCA" = (
+/obj/structure/table/wood,
+/obj/item/reagent_containers/food/drinks/bottle/wine,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aCB" = (
+/obj/structure/reagent_dispensers/keg/milk,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aCC" = (
+/obj/structure/table,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"aCD" = (
+/obj/machinery/computer/scan_consolenew{
+	dir = 1
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"aCE" = (
+/turf/open/floor/wood/damturf/broken2,
+/area/eventmap/mountaininside)
+"aCF" = (
+/obj/machinery/light{
+	dir = 1
+	},
+/obj/machinery/vending/kink,
+/turf/open/floor/wood/damturf/broken5,
+/area/eventmap/mountaininside)
+"aCG" = (
+/obj/structure/closet/toolcloset,
+/obj/item/storage/belt/durathread,
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aCH" = (
+/obj/structure/window/reinforced/spawner/west,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"aCI" = (
+/turf/open/indestructible/cobble,
+/area/eventmap/outside)
+"aCJ" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"aCK" = (
+/obj/structure/bed,
+/obj/effect/landmark/start/head_of_security,
+/obj/item/bedsheet/hos,
+/obj/structure/sign/poster/contraband/bountyhunters{
+	pixel_x = 32
+	},
+/turf/open/floor/carpet/red,
+/area/eventmap/inside)
+"aCL" = (
+/obj/structure/sink{
+	dir = 8;
+	pixel_x = -12
+	},
+/obj/structure/mirror{
+	pixel_x = -28
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aCM" = (
+/obj/structure/barricade/security,
+/turf/open/indestructible/airblock,
+/area/eventmap/mountaininside)
+"aCN" = (
+/obj/item/storage/fancy/cigarettes/cigpack_cannabis,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aCO" = (
+/obj/structure/healingfountain,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aCP" = (
+/obj/structure/table,
+/obj/structure/bedsheetbin/towel,
+/obj/machinery/light/small{
+	dir = 8
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aCQ" = (
+/obj/item/aiModule/reset/purge,
+/obj/machinery/light/floor,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aCR" = (
+/obj/effect/landmark/start/head_of_security,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aCS" = (
+/obj/machinery/shower{
+	dir = 8
+	},
+/obj/item/soap,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aCT" = (
+/obj/structure/chair{
+	dir = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aCU" = (
+/obj/structure/flora/ausbushes/leafybush,
+/obj/structure/flora/tree/spookytime,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aCV" = (
+/obj/structure/fluff/bus/dense{
+	icon_state = "hoodbottom"
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"aCW" = (
+/obj/structure/fluff/bus/dense{
+	icon_state = "frontwallbottomrear"
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"aCX" = (
+/obj/structure/fluff/bus/dense{
+	icon_state = "frontwallbottom"
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"aCY" = (
+/obj/structure/fluff/bus/dense{
+	icon_state = "reartire"
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"aCZ" = (
+/obj/structure/fluff/bus/passable{
+	icon_state = "bottomdoor";
+	layer = 3
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"aDa" = (
+/obj/structure/fluff/bus/dense{
+	icon_state = "fronttire"
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"aDb" = (
+/obj/effect/landmark/start/detective,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aDc" = (
+/obj/structure/table/wood/bar,
+/obj/machinery/recharger,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aDd" = (
+/obj/structure/chair/office/dark{
+	dir = 8
+	},
+/obj/effect/landmark/start/depsec/supply,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aDe" = (
+/obj/machinery/door/airlock/security/glass{
+	name = "Security Office";
+	req_access_txt = "63"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aDf" = (
+/obj/machinery/light/small{
+	dir = 8
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-4"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aDg" = (
+/obj/machinery/recharge_station,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aDh" = (
+/obj/item/pizzabox/margherita,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aDi" = (
+/obj/machinery/door/airlock/maintenance{
+	name = "Kitchen Maintenance";
+	req_access_txt = "28"
+	},
+/turf/open/floor/plating,
+/area/eventmap/inside)
+"aDj" = (
+/obj/item/storage/fancy/cigarettes/dromedaryco,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aDk" = (
+/turf/open/floor/spooktime/beach,
+/area/eventmap/mountain)
+"aDl" = (
+/obj/item/reagent_containers/food/snacks/meat/slab/spider,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"aDm" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/obj/structure/filingcabinet/filingcabinet,
+/obj/machinery/light/small{
+	dir = 4
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aDn" = (
+/obj/item/reagent_containers/food/snacks/meat/slab/pug,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"aDo" = (
+/obj/effect/landmark/start/cook,
+/obj/structure/cable/yellow{
+	icon_state = "1-4"
+	},
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"aDp" = (
+/obj/structure/trap/ctf/nomech,
+/turf/open/floor/spooktime/cobble/cornerSW,
+/area/eventmap/outside)
+"aDq" = (
+/obj/item/storage/fancy/egg_box,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"aDr" = (
+/obj/machinery/door/airlock/freezer,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"aDs" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood/damturf/broken1,
+/area/eventmap/inside)
+"aDt" = (
+/obj/machinery/light/small{
+	dir = 4
+	},
+/obj/effect/landmark/start/captain,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aDu" = (
+/obj/structure/fluff/bus/passable/seat,
+/obj/structure/window/reinforced{
+	dir = 8
+	},
+/obj/structure/chair/comfy/shuttle{
+	dir = 4;
+	icon_state = ""
+	},
+/obj/effect/landmark/start,
+/obj/machinery/light/floor{
+	alpha = 0;
+	light_range = 20;
+	max_integrity = 9999;
+	mouse_opacity = 0
+	},
+/turf/open/floor/plasteel/dark{
+	icon_state = "bus"
+	},
+/area/shuttle/arrival)
+"aDv" = (
+/obj/structure/fluff/bus/passable/seat,
+/obj/structure/chair/comfy/shuttle{
+	dir = 4;
+	icon_state = ""
+	},
+/obj/effect/landmark/start,
+/obj/machinery/light/floor{
+	alpha = 0;
+	light_range = 20;
+	max_integrity = 9999;
+	mouse_opacity = 0
+	},
+/turf/open/floor/plasteel/dark{
+	icon_state = "bus"
+	},
+/area/shuttle/arrival)
+"aDw" = (
+/obj/machinery/door/airlock{
+	name = "Bar Backroom";
+	req_access_txt = "25"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aDx" = (
+/obj/structure/fluff/bus/passable/seat{
+	pixel_y = 15
+	},
+/obj/structure/chair/comfy/shuttle{
+	dir = 4;
+	icon_state = ""
+	},
+/obj/effect/landmark/start,
+/obj/machinery/light/floor{
+	alpha = 0;
+	light_range = 20;
+	max_integrity = 9999;
+	mouse_opacity = 0
+	},
+/turf/open/floor/plasteel/dark{
+	icon_state = "bus"
+	},
+/area/shuttle/arrival)
+"aDy" = (
+/obj/structure/mineral_door/wood,
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
+	id = "C03"
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aDz" = (
+/obj/structure/sink/puddle,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aDA" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood/damturf/broken3,
+/area/eventmap/inside)
+"aDB" = (
+/obj/item/reagent_containers/food/drinks/bottle/tequila,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aDC" = (
+/obj/item/reagent_containers/food/snacks/spiderlollipop,
+/obj/effect/decal/cleanable/cobweb,
+/turf/open/floor/plasteel/damturf/scorched2,
+/area/eventmap/mountaininside)
+"aDD" = (
+/obj/item/storage/pill_bottle/stimulant,
+/turf/open/floor/plasteel/damturf/platdmg1,
+/area/eventmap/mountaininside)
+"aDE" = (
+/obj/item/reagent_containers/pill/breast_enlargement,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aDF" = (
+/obj/machinery/door/airlock{
+	name = "Bar Storage";
+	req_access_txt = "25"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aDG" = (
+/obj/structure/closet/cabinet,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aDH" = (
+/obj/structure/spacevine,
+/obj/structure/spacevine,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aDI" = (
+/turf/closed/wall/r_wall,
+/area/eventmap/inside)
+"aDJ" = (
+/obj/structure/chair/e_chair,
+/obj/effect/decal/cleanable/ash/large,
+/obj/effect/decal/cleanable/generic,
+/obj/effect/decal/cleanable/glass{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aDK" = (
+/obj/effect/landmark/start/head_of_security,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aDL" = (
+/obj/item/stamp/hos,
+/obj/structure/table/wood/fancy,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aDM" = (
+/obj/effect/spawner/structure/window/reinforced/tinted,
+/obj/structure/cable/white,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aDN" = (
+/obj/machinery/vending/donksofttoyvendor,
+/turf/open/floor/spooktime/cobble/cornerNE,
+/area/eventmap/outside)
+"aDO" = (
+/obj/machinery/light/small{
+	dir = 8
+	},
+/obj/structure/cable/white,
+/obj/effect/landmark/start/head_of_personnel,
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"aDP" = (
+/obj/structure/table,
+/obj/structure/window/reinforced/tinted,
+/obj/item/reagent_containers/rag/towel,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aDQ" = (
+/obj/machinery/shower{
+	dir = 8
+	},
+/obj/structure/window/reinforced/tinted,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aDR" = (
+/obj/structure/chair/wood,
+/obj/effect/landmark/start/security_officer,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aDS" = (
+/obj/structure/table/wood,
+/obj/machinery/light/small{
+	dir = 4
+	},
+/obj/machinery/recharger,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aDT" = (
+/obj/machinery/door/airlock/maintenance,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aDU" = (
+/obj/machinery/door/airlock/wood/dorms/dorm16,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aDV" = (
+/obj/machinery/icecream_vat,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"aDW" = (
+/obj/structure/closet/secure_closet/freezer/meat,
+/obj/item/reagent_containers/food/snacks/carpmeat,
+/obj/item/reagent_containers/food/snacks/carpmeat,
+/obj/item/reagent_containers/food/snacks/meat/slab/gorilla,
+/obj/item/reagent_containers/food/snacks/meat/slab/gorilla,
+/obj/item/reagent_containers/food/snacks/meat/slab/gondola,
+/obj/item/reagent_containers/food/snacks/meat/slab/gondola,
+/obj/item/reagent_containers/food/snacks/meat/slab/spider,
+/obj/item/reagent_containers/food/snacks/meat/slab/spider,
+/obj/item/reagent_containers/food/snacks/meat/slab/xeno,
+/obj/item/reagent_containers/food/snacks/meat/slab/xeno,
+/obj/item/reagent_containers/food/snacks/meat/slab/corgi,
+/obj/item/reagent_containers/food/snacks/meat/slab/corgi,
+/obj/item/reagent_containers/food/snacks/meat/slab/bear,
+/obj/item/reagent_containers/food/snacks/meat/slab/bear,
+/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/lizard,
+/obj/item/reagent_containers/food/snacks/meat/slab/monkey,
+/obj/item/reagent_containers/food/snacks/meat/slab/monkey,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"aDX" = (
+/obj/machinery/food_cart,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"aDY" = (
+/obj/machinery/door/airlock/wood/dorms/dorm19,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aDZ" = (
+/obj/item/coin/diamond,
+/obj/item/stack/sheet/mineral/silver,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aEa" = (
+/obj/machinery/vending/wardrobe/chef_wardrobe,
+/obj/machinery/camera/emp_proof{
+	c_tag = "Containment - Fore Starboard";
+	dir = 8;
+	network = list("singularity")
+	},
+/obj/structure/cable/yellow,
+/turf/open/floor/plasteel/cafeteria,
+/area/eventmap/inside)
+"aEb" = (
+/obj/item/lighter,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aEc" = (
+/obj/structure/cable/yellow,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aEd" = (
+/obj/structure/reagent_dispensers/keg/gargle,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aEe" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/mineral/titanium/white{
+	name = "padded floor"
+	},
+/area/eventmap/inside)
+"aEf" = (
+/turf/open/floor/mineral/titanium/white{
+	name = "padded floor"
+	},
+/area/eventmap/inside)
+"aEg" = (
+/obj/effect/landmark/start/janitor,
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"aEh" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/mineral/titanium/white{
+	name = "padded floor"
+	},
+/area/eventmap/inside)
+"aEi" = (
+/obj/item/bodypart/head,
+/obj/item/clothing/head/collectable/kitty,
+/obj/item/clothing/mask/scarecrow,
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "gibbearcore"
+	},
+/obj/item/stamp/ce,
+/turf/open/floor/mineral/titanium/white{
+	name = "padded floor"
+	},
+/area/eventmap/inside)
+"aEj" = (
+/obj/structure/closet/secure_closet/personal/cabinet,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aEk" = (
+/obj/structure/sign/plaques/deempisi{
+	pixel_y = 32
+	},
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aEl" = (
+/obj/structure/bed,
+/obj/item/bedsheet/random,
+/obj/machinery/button/door/dorms/patient1,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aEm" = (
+/obj/effect/decal/cleanable/shreds,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aEn" = (
+/obj/structure/closet/secure_closet/hos,
+/obj/item/clothing/under/rank/security/head_of_security/formal,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aEo" = (
+/obj/effect/decal/cleanable/cobweb/cobweb2,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aEp" = (
+/obj/structure/sign/poster/official/space_cops{
+	pixel_y = -32
+	},
+/turf/open/floor/wood/damturf/broken1,
+/area/eventmap/inside)
+"aEq" = (
+/obj/structure/curtain{
+	color = "#B22222"
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aEr" = (
+/obj/machinery/button/door/dorms/luxury3{
+	id = "C03";
+	pixel_y = -24
+	},
+/turf/open/floor/wood/damturf/broken1,
+/area/eventmap/mountaininside)
+"aEs" = (
+/obj/machinery/light,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aEt" = (
+/obj/structure/cable/yellow{
+	icon_state = "0-4"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aEu" = (
+/obj/structure/table/wood/bar,
+/obj/machinery/computer/security/wooden_tv{
+	pixel_y = 8
+	},
+/obj/structure/window/reinforced/spawner,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aEv" = (
+/obj/structure/table/wood/bar,
+/obj/machinery/computer/secure_data/laptop{
+	dir = 1;
+	pixel_y = 6
+	},
+/obj/structure/window/reinforced/spawner,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aEw" = (
+/obj/structure/cable/pink{
+	icon_state = "0-5"
+	},
+/obj/structure/cable/pink{
+	icon_state = "0-9"
+	},
+/turf/open/floor/plating,
+/area/eventmap/mountain)
+"aEx" = (
+/obj/structure/toilet{
+	dir = 4
+	},
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aEy" = (
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aEz" = (
+/obj/effect/decal/cleanable/cobweb/cobweb2,
+/turf/open/floor/spooktime/beach,
+/area/eventmap/outside)
+"aEA" = (
+/obj/effect/decal/cleanable/cobweb/cobweb2,
+/obj/structure/table/wood,
+/obj/structure/bedsheetbin/towel,
+/obj/structure/cable/yellow{
+	icon_state = "0-8"
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aEB" = (
+/obj/structure/sign/poster/official/ian{
+	pixel_y = 32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aEC" = (
+/obj/machinery/button/door/dorms/luxury3{
+	id = "C09";
+	pixel_x = -8
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aED" = (
+/turf/closed/wall/mineral/wood,
+/area/eventmap/mountaininside)
+"aEE" = (
+/obj/structure/closet/secure_closet/freezer/meat,
+/obj/structure/window/reinforced/spawner/north,
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"aEF" = (
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aEG" = (
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/mountain)
+"aEH" = (
+/obj/structure/closet/secure_closet/freezer/kitchen{
+	req_access = null
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aEI" = (
+/obj/structure/window/reinforced/spawner/north,
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"aEJ" = (
+/obj/item/flashlight/glowstick/cyan,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aEK" = (
+/obj/structure/noticeboard/hop{
+	pixel_x = 32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aEL" = (
+/obj/item/flashlight/glowstick/orange,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aEM" = (
+/obj/structure/kitchenspike,
+/obj/structure/window/reinforced/spawner/north,
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"aEN" = (
+/obj/item/reagent_containers/food/drinks/bottle/whiskey,
+/turf/open/floor/wood{
+	icon_state = "wood-broken5"
+	},
+/area/eventmap/inside)
+"aEO" = (
+/obj/machinery/light/floor,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aEP" = (
+/obj/structure/table/reinforced,
+/obj/machinery/door/firedoor,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aEQ" = (
+/obj/machinery/door/airlock{
+	name = "Bar Backroom";
+	req_access_txt = "25"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aER" = (
+/obj/structure/chair/sofa/right,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aES" = (
+/obj/structure/table/optable,
+/obj/item/reagent_containers/glass/bowl,
+/obj/item/toy/fluff/tennis_poly/red,
+/obj/item/clothing/neck/petcollar,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"aET" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/mineral/titanium/white{
+	name = "padded floor"
+	},
+/area/eventmap/inside)
+"aEU" = (
+/obj/structure/blob/normal{
+	color = "#777777";
+	name = "peculiar goo"
+	},
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aEV" = (
+/obj/structure/table/plasmaglass,
+/obj/item/stock_parts/cell/hyper,
+/obj/item/stock_parts/cell/hyper,
+/obj/item/stock_parts/cell/hyper,
+/obj/item/stock_parts/cell/hyper,
+/obj/item/stock_parts/cell/hyper,
+/obj/item/stock_parts/cell/hyper,
+/obj/machinery/light/floor{
+	alpha = 0;
+	light_range = 20;
+	mouse_opacity = 0
+	},
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aEW" = (
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "floor4-old"
+	},
+/turf/open/floor/mineral/titanium/white{
+	name = "padded floor"
+	},
+/area/eventmap/inside)
+"aEX" = (
+/obj/machinery/light{
+	dir = 1
+	},
+/turf/open/floor/plasteel/damturf/scorched1,
+/area/eventmap/mountaininside)
+"aEY" = (
+/obj/item/organ/heart,
+/obj/effect/decal/cleanable/blood/gibs/old,
+/turf/open/floor/mineral/titanium/white{
+	name = "padded floor"
+	},
+/area/eventmap/inside)
+"aEZ" = (
+/obj/item/storage/pill_bottle/breast_enlargement,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aFa" = (
+/obj/item/flashlight/glowstick/cyan,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aFb" = (
+/obj/effect/decal/cleanable/cobweb/cobweb2,
+/obj/structure/spacevine,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aFc" = (
+/obj/structure/flora/tree/spookytimexl,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aFd" = (
+/turf/closed/wall/r_wall/rust,
+/area/cargo/miningstorage)
+"aFe" = (
+/obj/machinery/door/airlock/wood/dorms/patient1,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aFf" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood/damturf/broken3,
+/area/eventmap/inside)
+"aFg" = (
+/obj/machinery/door/airlock/security/glass{
+	name = "Security Office";
+	req_access_txt = "63"
+	},
+/obj/machinery/door/firedoor,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aFh" = (
+/obj/structure/mineral_door/wood,
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
+	id = "C04"
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aFi" = (
+/turf/open/floor/spooktime/beach/coasts/innerW,
+/area/eventmap/outside)
+"aFj" = (
+/obj/machinery/door/airlock/security/glass{
+	name = "Security Desk";
+	req_access_txt = "63"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/machinery/door/firedoor,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aFk" = (
+/obj/structure/mirror{
+	icon_state = "mirror_broke";
+	pixel_x = 28
+	},
+/obj/structure/sink{
+	dir = 4;
+	pixel_x = 11
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aFl" = (
+/obj/structure/closet/secure_closet/freezer/cream_pie,
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"aFm" = (
+/obj/effect/decal/cleanable/dirt,
+/turf/open/floor/plating,
+/area/eventmap/mountaininside)
+"aFn" = (
+/obj/item/reagent_containers/food/snacks/sausage,
+/obj/structure/table/reinforced,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aFo" = (
+/obj/structure/kitchenspike,
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"aFp" = (
+/obj/structure/closet/chefcloset,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aFq" = (
+/obj/item/autosurgeon/penis,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aFr" = (
+/obj/machinery/rnd/production/circuit_imprinter,
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aFs" = (
+/obj/item/storage/fancy/cigarettes,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aFt" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aFu" = (
+/obj/machinery/vending/dinnerware,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aFv" = (
+/obj/machinery/chem_dispenser/drinks/beer/fullupgrade{
+	dir = 4
+	},
+/obj/structure/table/wood/bar,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aFw" = (
+/turf/closed/wall/rust,
+/area/eventmap/mountaininside)
+"aFx" = (
+/obj/machinery/camera/emp_proof,
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aFy" = (
+/obj/machinery/light/small{
+	brightness = 3;
+	dir = 8
+	},
+/obj/structure/fireplace{
+	dir = 4;
+	pixel_x = -8
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aFz" = (
+/obj/machinery/door/airlock{
+	name = "Bar Staff Entrance";
+	req_access_txt = "25"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aFA" = (
+/obj/item/restraints/handcuffs,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aFB" = (
+/obj/machinery/door/airlock/wood/glass,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aFC" = (
+/obj/structure/closet/secure_closet/hop,
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"aFD" = (
+/obj/machinery/door/airlock/wood/glass,
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aFE" = (
+/turf/open/floor/spooktime/beach/coasts/coastN,
+/area/eventmap/outside)
+"aFF" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aFG" = (
+/obj/machinery/door/airlock/wood/glass,
+/obj/effect/decal/cleanable/blood/old,
+/obj/effect/decal/cleanable/dirt,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aFH" = (
+/obj/structure/curtain{
+	color = "#B22222"
+	},
+/obj/effect/spawner/structure/window/reinforced,
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
+	id = "C01"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aFI" = (
+/obj/structure/closet/secure_closet/warden,
+/obj/item/gun/ballistic/shotgun/automatic/combat/compact,
+/obj/item/gun/energy/pumpaction/defender,
+/obj/item/clothing/under/rank/security/warden/formal,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aFJ" = (
+/obj/effect/decal/cleanable/cobweb/cobweb2,
+/obj/item/storage/fancy/cigarettes/cigpack_cannabis,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aFK" = (
+/obj/item/reagent_containers/food/snacks/pastatomato,
+/obj/structure/table/reinforced,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aFL" = (
+/obj/effect/decal/cleanable/cobweb,
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/machinery/light/small/broken{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aFM" = (
+/obj/item/reagent_containers/food/snacks/toastedsandwich,
+/obj/structure/table/reinforced,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aFN" = (
+/obj/structure/chair/wood/normal,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aFO" = (
+/obj/effect/decal/cleanable/ash/large,
+/obj/effect/decal/cleanable/generic,
+/obj/effect/decal/cleanable/glass{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aFP" = (
+/obj/machinery/light{
+	dir = 1
+	},
+/obj/machinery/button/door/dorms/luxury3{
+	id = "C04"
+	},
+/turf/open/floor/wood/damturf/broken5,
+/area/eventmap/mountaininside)
+"aFQ" = (
+/obj/machinery/computer/nanite_chamber_control{
+	dir = 1
+	},
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aFR" = (
+/obj/structure/sink/kitchen{
+	pixel_y = 30
+	},
+/turf/open/floor/sepia,
+/area/eventmap/mountaininside)
+"aFS" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/effect/decal/cleanable/ash/crematorium,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aFT" = (
+/obj/machinery/light/small{
+	dir = 4
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aFU" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/mountaininside)
+"aFV" = (
+/obj/item/reagent_containers/food/drinks/bottle/whiskey,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aFW" = (
+/obj/machinery/computer/rdconsole/robotics,
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aFX" = (
+/obj/effect/decal/cleanable/blood/splatter{
+	icon_state = "splatter1"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aFY" = (
+/obj/item/storage/pill_bottle/breast_enlargement,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aFZ" = (
+/obj/structure/mirror{
+	pixel_x = 28
+	},
+/obj/structure/sink{
+	dir = 4;
+	pixel_x = 11
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aGa" = (
+/obj/structure/reagent_dispensers/cooking_oil,
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"aGb" = (
+/obj/structure/sign/poster/official/love_ian{
+	pixel_y = -32
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"aGc" = (
+/obj/structure/bed,
+/obj/machinery/button/door/dorms/dorm16,
+/obj/item/bedsheet/hop,
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"aGd" = (
+/obj/item/reagent_containers/food/drinks/bottle/lizardwine,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aGe" = (
+/obj/structure/closet/cabinet,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aGf" = (
+/obj/machinery/button/door/dorms/dorm19,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aGg" = (
+/obj/structure/flora/rock/pile/icy,
+/obj/structure/flora/tree/spookytime,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aGh" = (
+/turf/closed/indestructible/riveted/boss,
+/area/eventmap/mountaininside)
+"aGi" = (
+/obj/item/storage/box/matches,
+/obj/item/shovel,
+/obj/item/flashlight/flare/torch,
+/obj/item/hatchet,
+/obj/item/pickaxe/mini,
+/obj/structure/rack,
+/obj/item/umbrella,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aGj" = (
+/obj/item/storage/box/matches,
+/obj/machinery/light/small{
+	dir = 8
+	},
+/obj/item/shovel,
+/obj/item/flashlight/flare/torch,
+/obj/item/hatchet,
+/obj/item/pickaxe/mini,
+/obj/structure/rack,
+/obj/item/umbrella,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aGk" = (
+/obj/machinery/door/airlock/survival_pod,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aGl" = (
+/obj/structure/closet/crate/freezer/blood,
+/obj/machinery/light/small,
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"aGm" = (
+/obj/machinery/gibber/autogibber,
+/turf/open/floor/plasteel/freezer,
+/area/eventmap/inside)
+"aGn" = (
+/obj/structure/closet/gimmick/tacticool,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aGo" = (
+/obj/structure/mineral_door/wood,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aGp" = (
+/obj/machinery/vending/wardrobe/bar_wardrobe,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aGq" = (
+/obj/structure/bed,
+/obj/item/bedsheet/pirate,
+/turf/open/floor/wood/damturf/broken6,
+/area/eventmap/mountaininside)
+"aGr" = (
+/obj/structure/flora/rock/pile/icy,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aGs" = (
+/obj/machinery/chem_dispenser/drinks/fullupgrade{
+	dir = 4
+	},
+/obj/machinery/light/small{
+	dir = 8
+	},
+/obj/structure/table/wood/bar,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aGt" = (
+/obj/effect/landmark/start/bartender,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aGu" = (
+/obj/machinery/computer/mech_bay_power_console,
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aGv" = (
+/obj/structure/table,
+/obj/item/storage/toolbox/mechanical,
+/obj/item/stack/cable_coil,
+/obj/item/storage/box/lights/mixed,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aGw" = (
+/obj/structure/noticeboard{
+	pixel_y = 32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aGx" = (
+/obj/structure/table,
+/obj/item/reagent_containers/food/drinks/bottle/whiskey,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aGy" = (
+/obj/item/stack/sheet/mineral/diamond,
+/obj/item/stack/sheet/mineral/plasma,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aGz" = (
+/turf/open/floor/plasteel/damturf/scorched2,
+/area/eventmap/mountaininside)
+"aGA" = (
+/obj/structure/noticeboard{
+	pixel_y = 32
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"aGB" = (
+/obj/structure/bed,
+/obj/item/bedsheet/hop,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aGC" = (
+/obj/item/aiModule/supplied/freeform,
+/obj/machinery/light/floor,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aGD" = (
+/obj/structure/flora/tree/spookytime,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"aGE" = (
+/obj/structure/destructible/cult/tome,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aGF" = (
+/obj/effect/decal/cleanable/blood/tracks,
+/obj/effect/decal/cleanable/dirt,
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"aGG" = (
+/turf/closed/wall/rust,
+/area/cargo/miningstorage)
+"aGH" = (
+/obj/structure/bed,
+/obj/item/bedsheet/random,
+/obj/machinery/button/door/dorms/patient2,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aGI" = (
+/obj/machinery/light{
+	dir = 8
+	},
+/obj/structure/table/wood/fancy,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aGJ" = (
+/obj/item/chair,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aGK" = (
+/obj/effect/turf_decal/stripes/line{
+	dir = 8
+	},
+/obj/effect/turf_decal/caution{
+	dir = 4
+	},
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/obj/structure/cable/white{
+	icon_state = "2-4"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aGL" = (
+/obj/item/chair/wood,
+/turf/open/floor/plasteel/damturf/scorched,
+/area/eventmap/mountaininside)
+"aGM" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/spooktime/cobble/sideS,
+/area/eventmap/outside)
+"aGN" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/white{
+	icon_state = "2-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aGO" = (
+/obj/machinery/door/airlock/security{
+	aiControlDisabled = 1;
+	name = "Prisoner Transfer Centre";
+	req_access_txt = "2"
+	},
+/obj/effect/decal/cleanable/vomit/old,
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aGP" = (
+/obj/machinery/door/airlock/survival_pod,
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
+	id = "C07"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aGQ" = (
+/obj/effect/decal/cleanable/ash/crematorium,
+/turf/open/floor/wood{
+	icon_state = "wood-broken2"
+	},
+/area/eventmap/inside)
+"aGR" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/effect/decal/cleanable/shreds,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aGS" = (
+/obj/effect/decal/cleanable/generic,
+/turf/open/floor/wood{
+	icon_state = "wood-broken7"
+	},
+/area/eventmap/inside)
+"aGT" = (
+/obj/item/clothing/mask/frog,
+/turf/open/floor/spooktime/beach/coasts/coastS,
+/area/eventmap/outside)
+"aGU" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-4"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aGV" = (
+/obj/machinery/light,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aGW" = (
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aGX" = (
+/obj/machinery/door/airlock{
+	name = "Bathroom"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aGY" = (
+/obj/structure/sign/barsign,
+/turf/closed/wall/mineral/wood,
+/area/eventmap/inside)
+"aGZ" = (
+/obj/structure/table/wood/bar,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aHa" = (
+/obj/item/reagent_containers/food/condiment/saltshaker,
+/obj/item/reagent_containers/food/condiment/peppermill,
+/obj/structure/table/wood/bar,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aHb" = (
+/obj/item/candle/infinite,
+/obj/structure/table/wood/bar,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aHc" = (
+/obj/item/storage/box/drinkingglasses,
+/obj/structure/table/wood/bar,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aHd" = (
+/obj/effect/decal/cleanable/dirt,
+/obj/structure/table/reinforced,
+/obj/item/flashlight,
+/turf/open/floor/plating,
+/area/eventmap/mountaininside)
+"aHe" = (
+/obj/effect/decal/cleanable/blood/old,
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"aHf" = (
+/obj/effect/spawner/structure/window/reinforced,
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
+	id = "C02"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHg" = (
+/obj/item/pizzabox/vegetable,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aHh" = (
+/obj/effect/decal/cleanable/blood/tracks{
+	dir = 4
+	},
+/obj/effect/decal/cleanable/dirt,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHi" = (
+/obj/structure/sign/directions/security{
+	dir = 8;
+	pixel_x = -32;
+	pixel_y = 40
+	},
+/obj/structure/sign/directions/supply{
+	dir = 8;
+	pixel_x = -32;
+	pixel_y = 32
+	},
+/obj/structure/sign/directions/engineering{
+	pixel_x = -32;
+	pixel_y = 24
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"aHj" = (
+/obj/structure/chair/comfy/beige,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aHk" = (
+/turf/open/floor/spooktime/beach/coasts/watercoastE,
+/area/eventmap/outside)
+"aHl" = (
+/obj/machinery/door/airlock/wood/dorms/patient2,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHm" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"aHn" = (
+/obj/machinery/computer/nanite_cloud_controller,
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aHo" = (
+/obj/effect/spawner/structure/window/reinforced,
+/obj/structure/cable/white,
+/obj/structure/cable/white{
+	icon_state = "0-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHp" = (
+/obj/item/storage/box/snappops,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aHq" = (
+/obj/machinery/computer/prisoner/management,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aHr" = (
+/obj/effect/decal/cleanable/blood/old,
+/obj/structure/barricade/wooden/crude,
+/obj/structure/mineral_door/wood,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHs" = (
+/obj/structure/sign/directions/medical{
+	dir = 4;
+	pixel_x = 32;
+	pixel_y = 32
+	},
+/obj/structure/sign/directions/evac{
+	dir = 4;
+	pixel_x = 32;
+	pixel_y = 40
+	},
+/obj/structure/sign/directions/science{
+	pixel_x = 32;
+	pixel_y = 24
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"aHt" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/machinery/door/firedoor,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHu" = (
+/obj/item/flashlight/lantern{
+	anchored = 1;
+	can_be_unanchored = 1;
+	light_color = "#EE9933";
+	light_range = 5;
+	on = 1
+	},
+/turf/open/floor/wood/damturf/broken1,
+/area/eventmap/inside)
+"aHv" = (
+/obj/item/reagent_containers/food/drinks/bottle/bottleofnothing,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aHw" = (
+/obj/structure/barricade/wooden/crude,
+/obj/machinery/door/firedoor,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHx" = (
+/obj/machinery/door/airlock/security{
+	name = "Armoury";
+	req_access_txt = "3"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHy" = (
+/obj/machinery/door/airlock/security/glass{
+	name = "Security Office";
+	req_access_txt = "63"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/machinery/door/firedoor,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHz" = (
+/obj/structure/chair/wood/wings{
+	dir = 4
+	},
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/wood/damturf/broken1,
+/area/eventmap/inside)
+"aHA" = (
+/obj/item/reagent_containers/food/condiment/saltshaker,
+/obj/item/reagent_containers/food/condiment/peppermill,
+/obj/structure/table/wood/fancy,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHB" = (
+/obj/structure/chair/wood/wings{
+	dir = 8
+	},
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHC" = (
+/obj/structure/sign/poster/official/high_class_martini{
+	pixel_y = 32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHD" = (
+/obj/structure/flora/ausbushes/lavendergrass,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aHE" = (
+/obj/structure/table/reinforced,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aHF" = (
+/obj/item/reagent_containers/food/snacks/khachapuri,
+/obj/structure/table/reinforced,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aHG" = (
+/obj/structure/chair/stool/bar,
+/turf/open/floor/wood/damturf/broken7,
+/area/eventmap/inside)
+"aHH" = (
+/obj/structure/closet/crate,
+/obj/item/flashlight/flare/torch,
+/obj/item/flashlight/flare/torch,
+/obj/item/flashlight/flare/torch,
+/obj/item/flashlight/flare/torch,
+/obj/item/flashlight/flare/torch,
+/obj/item/flashlight/flare/torch,
+/obj/item/flashlight/flare/torch,
+/obj/item/flashlight/flare/torch,
+/obj/item/flashlight/flare/torch,
+/obj/item/flashlight/flare/torch,
+/obj/item/flashlight/flare/torch,
+/obj/item/flashlight/flare/torch,
+/obj/item/flashlight/flare/torch,
+/obj/item/flashlight/flare/torch,
+/obj/item/flashlight/flare/torch,
+/obj/item/flashlight/flare/torch,
+/obj/item/flashlight/flare/torch,
+/obj/item/flashlight/flare/torch,
+/obj/item/flashlight/flare/torch,
+/obj/item/flashlight/flare/torch,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHI" = (
+/turf/open/floor/spooktime/cobble/cornerNW,
+/area/eventmap/outside)
+"aHJ" = (
+/obj/machinery/light/small{
+	dir = 4;
+	light_color = "#d8b1b1"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHK" = (
+/obj/structure/table/wood/fancy/orange,
+/obj/item/clothing/suit/straight_jacket{
+	pixel_x = -8;
+	pixel_y = 8
+	},
+/obj/item/clothing/suit/straight_jacket,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHL" = (
+/obj/structure/table/wood/fancy/orange,
+/obj/item/clothing/accessory/lawyers_badge,
+/obj/item/restraints/handcuffs/fake,
+/obj/item/stamp/law,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHM" = (
+/obj/item/pet_carrier,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"aHN" = (
+/obj/item/chair/wood,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHO" = (
+/obj/effect/decal/cleanable/dirt,
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"aHP" = (
+/obj/effect/decal/cleanable/dirt,
+/obj/machinery/light/small,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHQ" = (
+/obj/structure/table/wood/fancy/orange,
+/obj/effect/decal/cleanable/dirt,
+/obj/item/clothing/head/scarecrow_hat,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHR" = (
+/obj/structure/curtain{
+	color = "#B22222";
+	pixel_x = -32
+	},
+/obj/effect/landmark/start/librarian,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHS" = (
+/obj/structure/window/reinforced{
+	dir = 4
+	},
+/obj/structure/table/wood/bar,
+/obj/machinery/computer/security/wooden_tv{
+	pixel_y = 8
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aHT" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHU" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHV" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHW" = (
+/obj/structure/rack,
+/obj/item/gun/ballistic/shotgun/automatic/combat,
+/obj/item/gun/ballistic/shotgun/automatic/combat,
+/obj/item/gun/ballistic/shotgun/automatic/combat,
+/obj/item/gun/ballistic/shotgun/automatic/combat,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHX" = (
+/obj/machinery/light{
+	dir = 1
+	},
+/obj/item/storage/box/rubbershot,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aHY" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/closed/wall/mineral/wood,
+/area/eventmap/inside)
+"aHZ" = (
+/obj/structure/table/wood/bar,
+/obj/machinery/recharger,
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIa" = (
+/obj/structure/trap/ctf/nomech,
+/turf/closed/mineral/ash_rock,
+/area/eventmap/mountain)
+"aIb" = (
+/obj/item/clothing/head/helmet/justice,
+/obj/structure/closet/secure_closet/warden,
+/obj/item/clothing/suit/armor/hos/trenchcoat,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIc" = (
+/obj/item/stack/sheet/metal/fifty,
+/turf/open/floor/spooktime/beach/coasts/coastS,
+/area/eventmap/outside)
+"aId" = (
+/obj/structure/closet/secure_closet/security,
+/obj/machinery/light{
+	dir = 1
+	},
+/obj/item/clothing/head/beret/sec/navyofficer,
+/obj/item/clothing/under/rank/security/officer/formal,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIe" = (
+/obj/machinery/recharge_station,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIf" = (
+/obj/effect/landmark/start/lawyer,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIg" = (
+/obj/machinery/light{
+	dir = 1
+	},
+/obj/structure/chair/wood/wings{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIh" = (
+/turf/open/floor/wood/damturf/broken6,
+/area/eventmap/inside)
+"aIi" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-4"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"aIj" = (
+/obj/structure/mineral_door/wood,
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIk" = (
+/obj/structure/chair/office/dark{
+	dir = 4
+	},
+/obj/effect/landmark/start/warden,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aIl" = (
+/obj/item/chair/wood,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aIm" = (
+/obj/structure/rack,
+/obj/item/gun/ballistic/shotgun/automatic/dual_tube,
+/obj/item/gun/ballistic/shotgun/automatic/dual_tube,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIn" = (
+/obj/structure/flora/grass/jungle/b{
+	icon_state = "grassa5"
+	},
+/turf/open/floor/spooktime/cobble/cornerSE,
+/area/eventmap/outside)
+"aIo" = (
+/obj/item/storage/box/rubbershot,
+/obj/item/storage/box/rubbershot,
+/obj/item/storage/box/rubbershot,
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIp" = (
+/turf/open/floor/spooktime/beach/coasts/coastSW,
+/area/eventmap/outside)
+"aIq" = (
+/turf/open/floor/sepia,
+/area/eventmap/mountaininside)
+"aIr" = (
+/obj/item/storage/box/rubbershot,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIs" = (
+/obj/structure/cable/yellow{
+	icon_state = "2-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"aIt" = (
+/obj/item/storage/box/techsslug,
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIu" = (
+/obj/structure/toilet{
+	dir = 8
+	},
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/mountaininside)
+"aIv" = (
+/obj/structure/closet/cardboard,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aIw" = (
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-8"
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"aIx" = (
+/obj/structure/curtain{
+	color = "#B22222";
+	pixel_y = 32
+	},
+/turf/open/floor/wood{
+	icon_state = "wood-broken3"
+	},
+/area/eventmap/inside)
+"aIy" = (
+/obj/machinery/button/door{
+	id = "armory";
+	name = "Armory Shutters";
+	pixel_x = 26;
+	req_access_txt = "3"
+	},
+/obj/item/storage/box/rubbershot,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIz" = (
+/obj/machinery/door/airlock/wood,
+/turf/open/floor/carpet,
+/area/eventmap/mountaininside)
+"aIA" = (
+/obj/effect/landmark/start/security_officer,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIB" = (
+/obj/effect/landmark/start/security_officer,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aIC" = (
+/obj/effect/landmark/start/security_officer,
+/obj/structure/cable/white{
+	icon_state = "2-4"
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aID" = (
+/obj/machinery/vending/coffee,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aIE" = (
+/obj/effect/turf_decal/loading_area,
+/obj/machinery/light/small{
+	dir = 8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aIF" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aIG" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-4"
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIH" = (
+/obj/item/storage/fancy/donut_box,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aII" = (
+/obj/vehicle/ridden/secway,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIJ" = (
+/obj/item/reagent_containers/food/snacks/pancakes,
+/obj/structure/table/reinforced,
+/turf/open/floor/plasteel/damturf/damage4,
+/area/eventmap/mountaininside)
+"aIK" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-8"
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"aIL" = (
+/obj/structure/falsewall/wood,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIM" = (
+/obj/structure/chair/wood/wings{
+	dir = 4
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIN" = (
+/obj/structure/table/wood/fancy,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIO" = (
+/obj/machinery/computer/rdconsole{
+	dir = 1
+	},
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aIP" = (
+/obj/machinery/vending/kink,
+/turf/open/floor/plasteel/damturf/scorched2,
+/area/eventmap/mountaininside)
+"aIQ" = (
+/obj/structure/closet/secure_closet/freezer/fridge,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aIR" = (
+/obj/structure/chair/wood/wings{
+	dir = 8
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIS" = (
+/obj/item/candle/infinite,
+/obj/structure/table/wood/fancy,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIT" = (
+/obj/structure/table,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aIU" = (
+/obj/structure/curtain{
+	color = "#B22222";
+	pixel_y = 32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIV" = (
+/obj/structure/spacevine,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aIW" = (
+/obj/structure/chair/wood/wings,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIX" = (
+/obj/machinery/door/airlock/wood/dorms/dorm20,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIY" = (
+/obj/structure/chair/wood/wings,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/effect/landmark/start/assistant,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aIZ" = (
+/obj/effect/turf_decal/stripes/line{
+	dir = 8
+	},
+/obj/effect/turf_decal/caution{
+	dir = 4
+	},
+/obj/structure/cable/white{
+	icon_state = "2-4"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aJa" = (
+/obj/structure/window/reinforced,
+/obj/machinery/computer/crew{
+	dir = 1
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aJb" = (
+/obj/effect/decal/cleanable/cobweb,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aJc" = (
+/obj/structure/extinguisher_cabinet,
+/turf/closed/wall/mineral/wood,
+/area/eventmap/mountaininside)
+"aJd" = (
+/obj/structure/window/reinforced,
+/obj/structure/table/wood/bar,
+/obj/machinery/computer/secure_data/laptop{
+	dir = 1;
+	pixel_y = 6
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aJe" = (
+/obj/machinery/vending/tool,
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aJf" = (
+/obj/structure/table/wood/bar,
+/obj/structure/window/reinforced,
+/obj/structure/window/reinforced{
+	dir = 4
+	},
+/obj/machinery/recharger,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aJg" = (
+/obj/structure/cable/yellow,
+/obj/structure/bed,
+/obj/item/bedsheet/brown,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aJh" = (
+/obj/machinery/light/small,
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"aJi" = (
+/obj/machinery/camera/emp_proof{
+	c_tag = "Containment - Particle Accelerator";
+	dir = 1;
+	network = list("singularity")
+	},
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"aJj" = (
+/obj/structure/table/wood,
+/obj/item/paper/fluff/balls/spookyasylum/cell04,
+/obj/item/paper/fluff/balls/spookyasylum/cell03,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/inside)
+"aJk" = (
+/obj/item/reagent_containers/food/drinks/bottle/blazaam,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aJl" = (
+/turf/open/indestructible/airblock,
+/area/eventmap/mountaininside)
+"aJm" = (
+/obj/structure/mineral_door/woodrustic,
+/turf/open/floor/spooktime/cobble/cornerSW,
+/area/eventmap/outside)
+"aJn" = (
+/obj/structure/bonfire,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aJo" = (
+/obj/machinery/vending/kink,
+/turf/open/floor/carpet/blue,
+/area/eventmap/inside)
+"aJp" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/machinery/door/firedoor,
+/obj/machinery/door/airlock/medical/glass{
+	id_tag = "MedbayFoyer";
+	name = "Medbay";
+	req_access_txt = "5"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aJq" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/item/a_gift/anything,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aJr" = (
+/turf/closed/wall/rust,
+/area/eventmap/mountain)
+"aJs" = (
+/obj/structure/rack,
+/obj/item/gun/ballistic/automatic/shotgun/bulldog/unrestricted,
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aJt" = (
+/obj/structure/rack,
+/obj/item/storage/box/beanbag,
+/obj/item/storage/box/beanbag,
+/obj/item/storage/box/fireshot,
+/obj/item/storage/box/lethalshot,
+/obj/item/storage/box/lethalslugs,
+/obj/item/storage/box/lethalshot,
+/obj/item/storage/box/rubbershot,
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aJu" = (
+/obj/structure/rack,
+/obj/item/gun/energy/pulse{
+	pixel_x = 4;
+	pixel_y = -4
+	},
+/obj/item/gun/energy/pulse,
+/obj/item/gun/energy/pulse{
+	pixel_x = -4;
+	pixel_y = 4
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aJv" = (
+/obj/structure/rack,
+/obj/item/gun/ballistic/shotgun/riot{
+	pixel_x = 4;
+	pixel_y = -4
+	},
+/obj/item/gun/ballistic/shotgun/riot,
+/obj/item/gun/ballistic/shotgun/riot{
+	pixel_x = -4;
+	pixel_y = 4
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood/damturf/broken4,
+/area/eventmap/inside)
+"aJw" = (
+/turf/open/floor/wood/damturf/broken3,
+/area/eventmap/mountaininside)
+"aJx" = (
+/turf/closed/indestructible/rock,
+/area/eventmap/mountain)
+"aJy" = (
+/obj/machinery/light/small{
+	dir = 8
+	},
+/obj/machinery/vending/kink,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aJz" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aJA" = (
+/obj/machinery/door/airlock/security{
+	name = "Armoury";
+	req_access_txt = "3"
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aJB" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/white{
+	icon_state = "2-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-8"
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aJC" = (
+/obj/effect/turf_decal/bot,
+/obj/machinery/shower{
+	dir = 4
+	},
+/obj/structure/mirror{
+	pixel_x = -28
+	},
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/mountaininside)
+"aJD" = (
+/obj/structure/bonfire,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"aJE" = (
+/obj/machinery/button/door/dorms/dorm20,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aJF" = (
+/obj/machinery/vending/coffee,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aJG" = (
+/obj/item/pizzabox/infinite,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aJH" = (
+/obj/machinery/conveyor_switch/oneway{
+	dir = 8;
+	id = "cargo_out"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aJI" = (
+/obj/effect/turf_decal/caution{
+	dir = 8
+	},
+/obj/effect/turf_decal/stripes/line{
+	dir = 4
+	},
+/obj/machinery/door/airlock/mining/glass{
+	name = "Cargo Bay";
+	req_access_txt = "31"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aJJ" = (
+/obj/vehicle/ridden/secway,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aJK" = (
+/turf/open/floor/spooktime/beach/coasts/innerN,
+/area/eventmap/outside)
+"aJL" = (
+/obj/structure/closet,
+/obj/item/stack/sheet/glass/fifty,
+/obj/item/stack/sheet/glass/fifty,
+/obj/item/stack/sheet/metal/fifty,
+/obj/item/stack/sheet/metal/fifty,
+/obj/item/stack/sheet/metal/fifty,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aJM" = (
+/turf/open/floor/wood/damturf/broken1,
+/area/eventmap/inside)
+"aJN" = (
+/obj/machinery/computer/cargo{
+	dir = 4
+	},
+/obj/effect/turf_decal/delivery,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aJO" = (
+/obj/structure/falsewall/wood,
+/turf/closed/wall/mineral/wood,
+/area/eventmap/inside)
+"aJP" = (
+/obj/structure/table/wood/fancy/cyan,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aJQ" = (
+/obj/machinery/door/firedoor,
+/turf/open/floor/wood/damturf/broken2,
+/area/eventmap/inside)
+"aJR" = (
+/obj/structure/chair/office/dark,
+/obj/effect/landmark/start/cargo_technician,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aJS" = (
+/obj/machinery/button/door/dorms/luxury3{
+	id = "C07";
+	pixel_x = -8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aJT" = (
+/obj/machinery/computer/bounty{
+	dir = 8
+	},
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/obj/effect/turf_decal/delivery,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aJU" = (
+/turf/open/floor/spooktime/beach/coasts/innerE,
+/area/eventmap/outside)
+"aJV" = (
+/obj/item/chair/wood,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aJW" = (
+/obj/structure/closet,
+/obj/item/stack/sheet/glass/fifty,
+/obj/item/stack/sheet/glass/fifty,
+/obj/item/stack/sheet/metal/fifty,
+/obj/item/stack/sheet/metal/fifty,
+/turf/open/floor/wood/damturf/broken5,
+/area/eventmap/inside)
+"aJX" = (
+/obj/structure/closet/crate/wooden,
+/obj/item/storage/box/matches,
+/obj/item/storage/box/matches,
+/obj/item/storage/box/matches,
+/obj/item/storage/fancy/candle_box,
+/obj/item/storage/fancy/candle_box,
+/obj/item/storage/fancy/candle_box,
+/obj/item/storage/fancy/candle_box,
+/obj/item/storage/fancy/candle_box,
+/obj/item/storage/fancy/candle_box,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aJY" = (
+/obj/machinery/ore_silo,
+/obj/machinery/light/floor,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aJZ" = (
+/obj/item/reagent_containers/food/condiment/saltshaker,
+/obj/item/reagent_containers/food/condiment/peppermill,
+/obj/item/candle/infinite,
+/obj/structure/table/wood/fancy,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aKa" = (
+/turf/open/floor/plasteel/damturf/damage2,
+/area/eventmap/mountaininside)
+"aKb" = (
+/obj/item/candle/infinite,
+/obj/structure/table/wood/fancy,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aKc" = (
+/obj/item/soap/syndie,
+/obj/effect/decal/cleanable/blood/old,
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/mountaininside)
+"aKd" = (
+/obj/effect/spawner/structure/window/reinforced,
+/obj/structure/cable/white,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aKe" = (
+/obj/machinery/door/firedoor,
+/obj/machinery/door/airlock/security{
+	name = "Labor Shuttle";
+	req_access_txt = "2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aKf" = (
+/obj/machinery/light/small{
+	dir = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aKg" = (
+/obj/machinery/door/airlock/wood,
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/mountaininside)
+"aKh" = (
+/obj/structure/table,
+/obj/item/storage/pill_bottle/lsd,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aKi" = (
+/turf/open/floor/plasteel/damturf/damage1,
+/area/eventmap/mountaininside)
+"aKj" = (
+/obj/machinery/light{
+	dir = 8
+	},
+/obj/structure/table,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aKk" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/machinery/door/airlock/engineering{
+	name = "Telecommunications Chamber";
+	req_access_txt = "61"
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aKl" = (
+/obj/effect/landmark/start/ai,
+/obj/machinery/light/floor,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aKm" = (
+/obj/structure/chair/sofa/left,
+/obj/effect/landmark/start/assistant,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aKn" = (
+/obj/effect/decal/cleanable/dirt,
+/obj/structure/closet/secure_closet/RD,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aKo" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aKp" = (
+/obj/machinery/light/floor,
+/obj/item/stack/sheet/glass/fifty{
+	amount = 10000;
+	max_amount = 10000
+	},
+/obj/item/stack/sheet/bluespace_crystal{
+	amount = 10000;
+	max_amount = 10000
+	},
+/obj/item/stack/sheet/metal{
+	amount = 10000;
+	max_amount = 10000
+	},
+/obj/item/stack/sheet/mineral/diamond{
+	amount = 10000;
+	max_amount = 10000
+	},
+/obj/item/stack/sheet/mineral/gold{
+	amount = 10000;
+	max_amount = 10000
+	},
+/obj/item/stack/sheet/mineral/plasma{
+	amount = 10000;
+	max_amount = 10000
+	},
+/obj/item/stack/sheet/mineral/silver{
+	amount = 10000;
+	max_amount = 10000
+	},
+/obj/item/stack/sheet/mineral/titanium{
+	amount = 10000;
+	max_amount = 10000
+	},
+/obj/item/stack/sheet/mineral/uranium{
+	amount = 10000;
+	max_amount = 10000
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aKq" = (
+/turf/open/floor/spooktime/cobble/roadsideS,
+/area/eventmap/outside)
+"aKr" = (
+/obj/item/gun/energy/e_gun/stun,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aKs" = (
+/obj/effect/landmark/start/warden,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aKt" = (
+/obj/item/reagent_containers/pill/stimulant,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aKu" = (
+/obj/structure/closet/crate,
+/obj/item/clothing/head/pirate,
+/obj/item/clothing/head/santa,
+/obj/item/clothing/head/magus,
+/obj/item/clothing/head/mailman,
+/obj/item/clothing/head/griffin,
+/obj/item/clothing/head/bearpelt,
+/obj/item/clothing/head/beret,
+/obj/item/clothing/head/bowler,
+/obj/item/clothing/head/fedora,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aKv" = (
+/obj/item/storage/box/stunslug,
+/obj/item/storage/box/stunslug,
+/obj/item/storage/box/stunslug,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aKw" = (
+/obj/structure/table/wood/bar,
+/obj/machinery/door/poddoor/shutters{
+	id = "armory";
+	name = "Armoury Shutter"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aKx" = (
+/obj/machinery/door/airlock/silver{
+	name = "Bathroom"
+	},
+/turf/open/floor/sepia,
+/area/eventmap/mountaininside)
+"aKy" = (
+/obj/item/reagent_containers/food/drinks/bottle/lizardwine,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aKz" = (
+/obj/structure/urinal{
+	pixel_y = 32
+	},
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/mountaininside)
+"aKA" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aKB" = (
+/obj/machinery/light{
+	dir = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aKC" = (
+/obj/item/reagent_containers/food/drinks/bottle/lizardwine,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aKD" = (
+/obj/machinery/nanite_programmer,
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aKE" = (
+/obj/effect/landmark/start/depsec/engineering,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aKF" = (
+/obj/effect/landmark/start/depsec/medical,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aKG" = (
+/obj/machinery/vending/snack/random,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aKH" = (
+/obj/effect/landmark/start/depsec/science,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aKI" = (
+/obj/machinery/door/firedoor,
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/machinery/door/airlock/security{
+	name = "Labor Shuttle";
+	req_access_txt = "2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aKJ" = (
+/obj/structure/chair/comfy/beige{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aKK" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood{
+	icon_state = "wood-broken4"
+	},
+/area/eventmap/inside)
+"aKL" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/structure/cable/white{
+	icon_state = "2-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aKM" = (
+/obj/machinery/button/door/dorms/luxury3{
+	id = "C11";
+	pixel_y = -24
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aKN" = (
+/obj/machinery/door_timer{
+	id = "Cell 1";
+	name = "Cell 1";
+	pixel_y = -32
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aKO" = (
+/obj/machinery/door_timer{
+	id = "Cell 2";
+	name = "Cell 2";
+	pixel_y = -32
+	},
+/obj/effect/decal/cleanable/blood/tracks{
+	dir = 4
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aKP" = (
+/turf/open/floor/spooktime/cobble/sideN,
+/area/eventmap/outside)
+"aKQ" = (
+/turf/open/floor/spooktime/beach/coasts/coastE,
+/area/eventmap/outside)
+"aKR" = (
+/obj/structure/cable/white{
+	icon_state = "2-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aKS" = (
+/turf/open/floor/spooktime/cobble/cornerNE,
+/area/eventmap/outside)
+"aKT" = (
+/obj/structure/rack,
+/obj/item/gun/ballistic/shotgun/boltaction{
+	pixel_x = -4;
+	pixel_y = 4
+	},
+/obj/item/gun/ballistic/shotgun/boltaction{
+	pixel_x = 4;
+	pixel_y = -4
+	},
+/obj/item/gun/ballistic/shotgun/boltaction,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aKU" = (
+/obj/structure/rack,
+/obj/item/clothing/suit/armor/riot{
+	pixel_x = 4;
+	pixel_y = -4
+	},
+/obj/item/clothing/suit/armor/riot,
+/obj/item/clothing/suit/armor/riot{
+	pixel_x = -4;
+	pixel_y = 4
+	},
+/obj/item/clothing/head/helmet/riot{
+	pixel_x = 4;
+	pixel_y = -4
+	},
+/obj/item/clothing/head/helmet/riot,
+/obj/item/clothing/head/helmet/riot{
+	pixel_x = -4;
+	pixel_y = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aKV" = (
+/obj/structure/rack,
+/obj/item/clothing/suit/armor/bulletproof{
+	pixel_x = 4;
+	pixel_y = -4
+	},
+/obj/item/clothing/suit/armor/bulletproof,
+/obj/item/clothing/suit/armor/bulletproof{
+	pixel_x = -4;
+	pixel_y = 4
+	},
+/obj/item/clothing/head/helmet/alt{
+	pixel_x = 4;
+	pixel_y = -4
+	},
+/obj/item/clothing/head/helmet/alt,
+/obj/item/clothing/head/helmet/alt{
+	pixel_x = -4;
+	pixel_y = 4
+	},
+/turf/open/floor/wood/damturf/broken6,
+/area/eventmap/inside)
+"aKW" = (
+/obj/structure/closet/secure_closet/hos,
+/obj/item/clothing/head/helmet/justice/escape{
+	name = "justice helmet"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aKX" = (
+/obj/effect/turf_decal/stripes/line{
+	dir = 8
+	},
+/obj/effect/turf_decal/stripes/line{
+	dir = 4
+	},
+/obj/machinery/conveyor{
+	id = "cargo_front"
+	},
+/turf/open/floor/plating,
+/area/eventmap/inside)
+"aKY" = (
+/obj/machinery/light,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aKZ" = (
+/obj/machinery/light/small{
+	brightness = 3;
+	dir = 8
+	},
+/turf/open/floor/carpet,
+/area/eventmap/mountaininside)
+"aLa" = (
+/obj/structure/closet/secure_closet/armory3,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aLb" = (
+/obj/structure/closet/secure_closet/armory2,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aLc" = (
+/obj/structure/closet/secure_closet/armory1,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aLd" = (
+/obj/structure/closet/crate/wooden,
+/obj/item/storage/box/matches,
+/obj/item/storage/box/matches,
+/obj/item/storage/box/matches,
+/obj/item/storage/fancy/candle_box,
+/obj/item/storage/fancy/candle_box,
+/obj/item/storage/fancy/candle_box,
+/obj/item/storage/fancy/candle_box,
+/obj/item/storage/fancy/candle_box,
+/obj/item/storage/fancy/candle_box,
+/turf/open/floor/wood/damturf/broken7,
+/area/eventmap/inside)
+"aLe" = (
+/obj/structure/table/wood/bar,
+/obj/machinery/recharger,
+/obj/item/key/security,
+/obj/item/key/security,
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aLf" = (
+/obj/machinery/rnd/production/techfab/department/security,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aLg" = (
+/obj/item/autosurgeon/gloweyes,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aLh" = (
+/obj/effect/decal/cleanable/cobweb,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aLi" = (
+/obj/structure/chair/wood/wings{
+	dir = 4
+	},
+/obj/machinery/light/small,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aLj" = (
+/obj/structure/chair/wood/wings{
+	dir = 8
+	},
+/obj/machinery/light/small,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aLk" = (
+/obj/machinery/door/window/brigdoor/security/cell{
+	id = "Cell 1";
+	name = "Cell 1"
+	},
+/obj/effect/decal/cleanable/blood/tracks,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aLl" = (
+/obj/structure/sign/poster/official/no_erp,
+/turf/closed/wall/rust,
+/area/eventmap/mountaininside)
+"aLm" = (
+/obj/machinery/door/window/brigdoor/security/cell{
+	id = "Cell 2";
+	name = "Cell 2"
+	},
+/obj/effect/decal/cleanable/blood/old,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aLn" = (
+/turf/closed/wall/mineral/iron,
+/area/eventmap/inside)
+"aLo" = (
+/obj/machinery/biogenerator,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/inside)
+"aLp" = (
+/obj/machinery/seed_extractor,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/inside)
+"aLq" = (
+/obj/item/radio/intercom{
+	desc = "Talk through this. It looks like it has been modified to not broadcast.";
+	name = "Prison Intercom (General)";
+	pixel_x = -25;
+	pixel_y = -2;
+	prison_radio = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aLr" = (
+/obj/machinery/shower{
+	dir = 8;
+	pixel_y = -4
+	},
+/obj/effect/turf_decal/bot,
+/turf/open/floor/sepia,
+/area/eventmap/mountaininside)
+"aLs" = (
+/obj/machinery/light/small{
+	dir = 4;
+	light_color = "#d8b1b1"
+	},
+/turf/open/floor/wood{
+	icon_state = "wood-broken6"
+	},
+/area/eventmap/inside)
+"aLt" = (
+/obj/effect/decal/cleanable/cobweb/cobweb2,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aLu" = (
+/obj/effect/decal/cleanable/crayon,
+/obj/machinery/light/small{
+	dir = 4;
+	light_color = "#d8b1b1"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aLv" = (
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/inside)
+"aLw" = (
+/obj/machinery/light/small{
+	dir = 4;
+	light_color = "#d8b1b1"
+	},
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/inside)
+"aLx" = (
+/obj/item/coin/antagtoken,
+/obj/structure/closet/crate/trashcart/moneywish,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aLy" = (
+/obj/structure/bed,
+/obj/item/bedsheet/pirate,
+/obj/machinery/flasher{
+	id = "Cell 1";
+	pixel_x = -28
+	},
+/obj/effect/decal/cleanable/blood/old,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aLz" = (
+/obj/structure/closet/secure_closet/brig{
+	id = "Cell 1";
+	name = "Cell 1 Locker"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aLA" = (
+/obj/structure/table/optable,
+/obj/effect/decal/cleanable/blood/old,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aLB" = (
+/obj/structure/table/plasmaglass,
+/obj/item/storage/backpack/duffelbag/sec/surgery,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aLC" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aLD" = (
+/obj/structure/bed,
+/obj/item/bedsheet/cult,
+/obj/machinery/flasher{
+	id = "Cell 2";
+	pixel_x = -28
+	},
+/obj/effect/decal/cleanable/blood/gibs/old,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aLE" = (
+/obj/structure/closet/secure_closet/brig{
+	id = "Cell 2";
+	name = "Cell 2 Locker"
+	},
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/item/toy/toy_dagger,
+/obj/item/clothing/suit/cultrobes,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aLF" = (
+/obj/item/chair,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aLG" = (
+/obj/item/reagent_containers/food/drinks/bottle/whiskey,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aLH" = (
+/obj/structure/sink/puddle,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/inside)
+"aLI" = (
+/obj/machinery/hydroponics/soil,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/inside)
+"aLJ" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/inside)
+"aLK" = (
+/obj/structure/holohoop,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/inside)
+"aLL" = (
+/obj/structure/table/wood/fancy,
+/obj/item/candle/infinite{
+	pixel_x = -8
+	},
+/obj/item/reagent_containers/food/snacks/meat/steak{
+	pixel_y = 16
+	},
+/obj/item/candle/infinite{
+	pixel_x = 8
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/mountain)
+"aLM" = (
+/obj/structure/spacevine,
+/turf/open/floor/spooktime/beach/watersolid,
+/area/eventmap/mountain)
+"aLN" = (
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/inside)
+"aLO" = (
+/obj/structure/closet/crate/bin,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/inside)
+"aLP" = (
+/obj/structure/chair/wood,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/inside)
+"aLQ" = (
+/obj/structure/bed,
+/obj/item/bedsheet/blue,
+/turf/open/floor/carpet,
+/area/eventmap/mountaininside)
+"aLR" = (
+/obj/structure/curtain{
+	color = "#B22222";
+	pixel_x = 32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aLS" = (
+/obj/structure/table/wood,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/inside)
+"aLT" = (
+/obj/structure/toilet{
+	dir = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aLU" = (
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/outside)
+"aLV" = (
+/obj/item/stack/sheet/mineral/diamond,
+/obj/item/stack/sheet/mineral/adamantine,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aLW" = (
+/obj/structure/spacevine,
+/turf/open/floor/spooktime/beach/coasts/innerS,
+/area/eventmap/outside)
+"aLX" = (
+/obj/machinery/light/small,
+/turf/open/floor/wood{
+	icon_state = "wood-broken4"
+	},
+/area/eventmap/inside)
+"aLY" = (
+/obj/structure/barricade/wooden,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aLZ" = (
+/obj/item/storage/fancy/cigarettes/cigpack_mindbreaker,
+/obj/effect/decal/cleanable/dirt,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aMa" = (
+/obj/machinery/shower{
+	desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well...";
+	dir = 8
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aMb" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/sepia,
+/area/eventmap/mountaininside)
+"aMc" = (
+/obj/item/scythe,
+/turf/open/floor/wood{
+	icon_state = "wood-broken5"
+	},
+/area/eventmap/inside)
+"aMd" = (
+/obj/structure/table/wood,
+/obj/machinery/light/small{
+	brightness = 3;
+	dir = 8
+	},
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/inside)
+"aMe" = (
+/obj/item/chair/wood,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/inside)
+"aMf" = (
+/obj/machinery/cryopod{
+	dir = 8
+	},
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/inside)
+"aMg" = (
+/obj/structure/chair/wood{
+	dir = 1
+	},
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/inside)
+"aMh" = (
+/turf/open/floor/spooktime/beach/coasts/watercoastSE,
+/area/eventmap/outside)
+"aMi" = (
+/obj/machinery/conveyor_switch/oneway{
+	dir = 8;
+	id = "cargo_front"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aMj" = (
+/obj/structure/table/reinforced,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aMk" = (
+/obj/structure/table/reinforced,
+/obj/item/stamp{
+	pixel_x = -12;
+	pixel_y = 16
+	},
+/obj/item/stamp/denied{
+	pixel_x = 12;
+	pixel_y = 16
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aMl" = (
+/obj/structure/chair/sofa/right,
+/obj/item/storage/daki,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aMm" = (
+/obj/structure/table/reinforced,
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aMn" = (
+/obj/machinery/light/small{
+	dir = 8
+	},
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aMo" = (
+/obj/machinery/mecha_part_fabricator,
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aMp" = (
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aMq" = (
+/obj/machinery/light/floor{
+	alpha = 0;
+	light_range = 20;
+	mouse_opacity = 0
+	},
+/obj/machinery/light/floor{
+	alpha = 0;
+	light_range = 20;
+	mouse_opacity = 0
+	},
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aMr" = (
+/obj/effect/turf_decal/stripes/line{
+	dir = 4
+	},
+/obj/effect/turf_decal/stripes/line{
+	dir = 8
+	},
+/obj/structure/plasticflaps/opaque,
+/obj/machinery/conveyor{
+	id = "cargo_front"
+	},
+/turf/open/floor/plating,
+/area/eventmap/inside)
+"aMs" = (
+/obj/machinery/conveyor_switch/oneway{
+	id = "cargo_out"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aMt" = (
+/obj/machinery/computer/cargo/request{
+	dir = 4
+	},
+/obj/effect/turf_decal/delivery,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aMu" = (
+/obj/item/storage/fancy/rollingpapers,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aMv" = (
+/obj/effect/spawner/structure/window/reinforced,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aMx" = (
+/obj/effect/turf_decal/tile/brown{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/brown{
+	dir = 1
+	},
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aMy" = (
+/obj/structure/table/plasmaglass,
+/obj/item/integrated_electronics/analyzer,
+/obj/item/integrated_electronics/debugger,
+/obj/item/integrated_electronics/detailer,
+/obj/item/integrated_electronics/wirer,
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aMz" = (
+/obj/structure/bookcase/manuals/medical,
+/turf/closed/wall/mineral/wood,
+/area/eventmap/mountaininside)
+"aMA" = (
+/obj/effect/turf_decal/tile/brown{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/brown{
+	dir = 1
+	},
+/obj/structure/noticeboard/qm{
+	pixel_y = 32
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aMB" = (
+/obj/item/reagent_containers/food/urinalcake,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aMC" = (
+/obj/effect/turf_decal/stripes/corner,
+/obj/effect/turf_decal/stripes/line{
+	dir = 9
+	},
+/obj/machinery/conveyor{
+	dir = 5;
+	id = "conveyor_out"
+	},
+/turf/open/floor/plating,
+/area/eventmap/inside)
+"aMD" = (
+/obj/effect/turf_decal/stripes/line,
+/obj/effect/turf_decal/stripes/line{
+	dir = 1
+	},
+/obj/machinery/conveyor{
+	dir = 4;
+	id = "cargo_out"
+	},
+/turf/open/floor/plating,
+/area/eventmap/inside)
+"aME" = (
+/turf/open/floor/carpet/red,
+/area/eventmap/mountaininside)
+"aMF" = (
+/obj/effect/turf_decal/stripes/line,
+/obj/effect/turf_decal/stripes/line{
+	dir = 1
+	},
+/obj/structure/plasticflaps/opaque,
+/obj/machinery/conveyor{
+	dir = 4;
+	id = "cargo_out"
+	},
+/turf/open/floor/plating,
+/area/eventmap/inside)
+"aMG" = (
+/obj/structure/mineral_door/wood,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aMH" = (
+/obj/structure/chair{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/brown{
+	dir = 8
+	},
+/obj/effect/turf_decal/tile/brown{
+	dir = 1
+	},
+/obj/machinery/light/small{
+	dir = 8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aMI" = (
+/turf/open/floor/carpet/orange,
+/area/eventmap/mountaininside)
+"aMJ" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aMK" = (
+/obj/machinery/processor,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aML" = (
+/obj/machinery/door/airlock/mining/glass{
+	name = "Cargo Bay";
+	req_access_txt = "31"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aMM" = (
+/obj/structure/flora/tree/jungle,
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"aMN" = (
+/obj/effect/landmark/start/assistant,
+/turf/open/floor/spooktime/cobble/roadsideS,
+/area/eventmap/outside)
+"aMO" = (
+/obj/effect/turf_decal/stripes/line{
+	dir = 8
+	},
+/obj/effect/turf_decal/stripes/line{
+	dir = 4
+	},
+/obj/machinery/conveyor{
+	dir = 1;
+	id = "cargo_out"
+	},
+/turf/open/floor/plating,
+/area/eventmap/inside)
+"aMP" = (
+/obj/structure/chair{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/brown{
+	dir = 8
+	},
+/obj/effect/turf_decal/tile/brown{
+	dir = 1
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aMQ" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/obj/effect/landmark/start/assistant/override,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aMR" = (
+/obj/item/switchblade,
+/turf/open/floor/wood{
+	icon_state = "wood-broken2"
+	},
+/area/eventmap/inside)
+"aMS" = (
+/obj/structure/table,
+/obj/item/storage/pill_bottle/penis_enlargement,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aMT" = (
+/obj/machinery/camera/emp_proof{
+	c_tag = "Cargo Office";
+	dir = 8;
+	network = list("singularity")
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aMU" = (
+/obj/effect/turf_decal/loading_area,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aMV" = (
+/obj/effect/turf_decal/bot,
+/obj/machinery/autolathe/toy,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aMW" = (
+/obj/machinery/light/floor{
+	alpha = 0;
+	light_range = 20;
+	max_integrity = 9999;
+	mouse_opacity = 0
+	},
+/obj/machinery/vending/tool,
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aMX" = (
+/obj/item/storage/pill_bottle/breast_enlargement,
+/turf/open/floor/plasteel/damturf/scorched,
+/area/eventmap/mountaininside)
+"aMY" = (
+/obj/structure/closet/crate/bin,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aMZ" = (
+/obj/effect/turf_decal/stripes/line,
+/obj/effect/turf_decal/stripes/line{
+	dir = 1
+	},
+/obj/machinery/conveyor{
+	dir = 4;
+	id = "cargo_out"
+	},
+/obj/machinery/light/small,
+/turf/open/floor/plating,
+/area/eventmap/inside)
+"aNa" = (
+/obj/machinery/vending/coffee,
+/turf/open/floor/wood/damturf/broken6,
+/area/eventmap/mountaininside)
+"aNb" = (
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
+	id = "C05"
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aNc" = (
+/obj/item/gun/magic/staff/healing,
+/obj/structure/table/wood/fancy/green,
+/turf/open/floor/carpet/orange,
+/area/eventmap/mountaininside)
+"aNd" = (
+/obj/item/storage/firstaid/regular,
+/turf/open/floor/carpet/orange,
+/area/eventmap/mountaininside)
+"aNe" = (
+/obj/structure/table,
+/obj/machinery/chem_dispenser/drinks/beer,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aNf" = (
+/obj/item/chair/wood,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"aNg" = (
+/obj/structure/table/wood,
+/obj/item/reagent_containers/food/drinks/mug/coco,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aNh" = (
+/obj/effect/turf_decal/stripes/corner{
+	dir = 4
+	},
+/obj/effect/turf_decal/stripes/line{
+	dir = 6
+	},
+/obj/machinery/conveyor/inverted{
+	dir = 10;
+	id = "cargo_out"
+	},
+/turf/open/floor/plating,
+/area/eventmap/inside)
+"aNi" = (
+/obj/item/flashlight/lantern{
+	anchored = 1;
+	can_be_unanchored = 1;
+	light_color = "#EE9933";
+	light_range = 5;
+	on = 1
+	},
+/turf/open/floor/carpet/orange,
+/area/eventmap/mountaininside)
+"aNj" = (
+/obj/machinery/door/airlock/mining{
+	name = "Mining";
+	req_access_txt = "48"
+	},
+/obj/machinery/door/firedoor,
+/obj/effect/turf_decal/tile/brown{
+	dir = 1
+	},
+/obj/effect/turf_decal/tile/brown{
+	dir = 8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aNk" = (
+/obj/machinery/shower{
+	desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well...";
+	dir = 4
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aNl" = (
+/obj/structure/closet/athletic_mixed,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aNm" = (
+/obj/item/clothing/head/hardhat/pumpkinhead/jaqc,
+/obj/structure/table/wood/fancy/green,
+/obj/effect/spawner/lootdrop/welder_tools,
+/turf/open/floor/carpet/orange,
+/area/eventmap/mountaininside)
+"aNn" = (
+/obj/machinery/door/airlock/mining{
+	name = "Mining";
+	req_access_txt = "48"
+	},
+/obj/machinery/door/firedoor,
+/obj/effect/turf_decal/tile/brown{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/brown,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aNo" = (
+/obj/structure/mineral_door/wood,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aNp" = (
+/obj/effect/spawner/structure/window/reinforced,
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/plating,
+/area/eventmap/inside)
+"aNq" = (
+/obj/structure/chair/wood/wings{
+	dir = 4
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/mountain)
+"aNr" = (
+/obj/effect/turf_decal/tile/brown{
+	dir = 1
+	},
+/obj/effect/turf_decal/tile/brown{
+	dir = 8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aNs" = (
+/obj/effect/turf_decal/tile/brown{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/brown,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aNt" = (
+/obj/item/scythe,
+/obj/structure/curtain{
+	color = "#B22222";
+	pixel_y = 32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aNu" = (
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aNv" = (
+/obj/structure/spacevine,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/outside)
+"aNw" = (
+/obj/structure/closet/crate/trashcart,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"aNx" = (
+/obj/structure/table/wood,
+/obj/structure/bedsheetbin/towel,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aNy" = (
+/obj/structure/rack,
+/obj/effect/turf_decal/bot,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aNz" = (
+/obj/structure/barricade/sandbags,
+/turf/open/indestructible/airblock,
+/area/eventmap/mountaininside)
+"aNA" = (
+/obj/item/storage/fancy/heart_box,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aNB" = (
+/obj/effect/turf_decal/delivery,
+/obj/machinery/mineral/equipment_vendor,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aNC" = (
+/obj/structure/holohoop{
+	dir = 1
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"aND" = (
+/obj/effect/turf_decal/tile/brown{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/brown{
+	dir = 1
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aNE" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/machinery/door/firedoor,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aNF" = (
+/obj/effect/decal/cleanable/cobweb/cobweb2,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aNG" = (
+/obj/structure/chair/sofa,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aNH" = (
+/obj/structure/bed,
+/obj/item/bedsheet/black,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aNI" = (
+/obj/item/bedsheet/blue,
+/obj/structure/bed,
+/turf/open/floor/carpet/green,
+/area/eventmap/mountaininside)
+"aNJ" = (
+/obj/structure/mirror{
+	pixel_x = 28
+	},
+/obj/structure/sink{
+	dir = 4;
+	pixel_x = 11
+	},
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/mountaininside)
+"aNK" = (
+/obj/structure/mirror{
+	pixel_x = -28
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aNL" = (
+/obj/structure/table/wood,
+/obj/item/reagent_containers/rag/towel,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aNM" = (
+/obj/machinery/door/firedoor,
+/obj/effect/turf_decal/tile/brown{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/brown{
+	dir = 1
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aNN" = (
+/obj/machinery/door/airlock/mining{
+	name = "Mining";
+	req_access_txt = "48"
+	},
+/obj/effect/turf_decal/tile/brown{
+	dir = 4
+	},
+/obj/effect/turf_decal/tile/brown{
+	dir = 1
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aNO" = (
+/obj/machinery/light/floor,
+/obj/machinery/telecomms/bus{
+	appearance_flags = "bus mainframe (NULL)";
+	freq_listening = list(1347,1349,1351,1353,1355,1357,1359,1447)
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aNP" = (
+/obj/effect/turf_decal/tile/brown,
+/obj/effect/turf_decal/tile/brown{
+	dir = 1
+	},
+/obj/effect/turf_decal/tile/brown{
+	dir = 8
+	},
+/obj/effect/landmark/start/shaft_miner,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aNQ" = (
+/obj/effect/turf_decal/tile/brown,
+/obj/effect/turf_decal/tile/brown{
+	dir = 8
+	},
+/obj/effect/landmark/start/shaft_miner,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aNR" = (
+/obj/machinery/door/airlock/wood/glass,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aNS" = (
+/obj/structure/spacevine,
+/obj/structure/spacevine,
+/obj/structure/spacevine,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aNT" = (
+/obj/structure/table/plasmaglass,
+/obj/item/stock_parts/cell/hyper,
+/obj/item/stock_parts/cell/hyper,
+/obj/item/stock_parts/cell/hyper,
+/obj/item/stock_parts/cell/hyper,
+/obj/item/stock_parts/cell/hyper,
+/obj/item/stock_parts/cell/hyper,
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aNU" = (
+/obj/structure/cable/white{
+	icon_state = "2-4"
+	},
+/obj/effect/turf_decal/tile/brown{
+	dir = 8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aNV" = (
+/obj/structure/table/wood/fancy/green,
+/obj/item/gun/magic/staff/healing,
+/turf/open/floor/carpet/orange,
+/area/eventmap/mountaininside)
+"aNW" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/effect/turf_decal/tile/brown,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aNX" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/machinery/door/firedoor,
+/obj/effect/turf_decal/tile/brown,
+/obj/effect/turf_decal/tile/brown{
+	dir = 8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aNY" = (
+/obj/item/flashlight/lantern{
+	anchored = 1;
+	can_be_unanchored = 1;
+	light_color = "#EE9933";
+	light_range = 5;
+	on = 1
+	},
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aNZ" = (
+/obj/vehicle/sealed/vectorcraft,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aOa" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/machinery/door/airlock/mining{
+	name = "Mining";
+	req_access_txt = "48"
+	},
+/obj/effect/turf_decal/tile/brown,
+/obj/effect/turf_decal/tile/brown{
+	dir = 8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aOb" = (
+/obj/machinery/light{
+	dir = 1
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aOc" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/obj/structure/closet/secure_closet/quartermaster,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aOd" = (
+/obj/structure/bed,
+/obj/item/bedsheet/qm,
+/obj/effect/landmark/start/quartermaster,
+/obj/structure/sign/poster/contraband/masked_men,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aOe" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/obj/structure/sink{
+	dir = 8;
+	pixel_x = -12
+	},
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/inside)
+"aOf" = (
+/obj/vehicle/sealed/vectorcraft/ambulance,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aOg" = (
+/obj/structure/toilet{
+	dir = 8
+	},
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/inside)
+"aOh" = (
+/obj/effect/turf_decal/bot,
+/obj/structure/closet/secure_closet/miner,
+/obj/machinery/camera/emp_proof{
+	c_tag = "Mining Entrance";
+	dir = 1;
+	network = list("singularity")
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aOi" = (
+/obj/effect/turf_decal/bot,
+/obj/structure/closet/secure_closet/miner,
+/obj/machinery/light/small,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aOj" = (
+/obj/structure/toilet{
+	dir = 4
+	},
+/turf/open/floor/sepia,
+/area/eventmap/mountaininside)
+"aOk" = (
+/obj/machinery/light,
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/mountaininside)
+"aOl" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood/damturf/broken5,
+/area/eventmap/inside)
+"aOm" = (
+/obj/effect/turf_decal/bot,
+/obj/structure/closet/secure_closet/miner,
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aOn" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/obj/effect/turf_decal/tile/brown{
+	dir = 1
+	},
+/obj/effect/turf_decal/tile/brown{
+	dir = 8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aOo" = (
+/obj/structure/cable/white{
+	icon_state = "2-4"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aOp" = (
+/obj/structure/cable/white{
+	icon_state = "0-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aOq" = (
+/obj/effect/turf_decal/bot,
+/obj/machinery/shower{
+	dir = 4
+	},
+/obj/structure/mirror{
+	pixel_x = -28
+	},
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/inside)
+"aOr" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/obj/machinery/autolathe/toy,
+/turf/open/floor/spooktime/cobble/sideN,
+/area/eventmap/outside)
+"aOs" = (
+/obj/effect/landmark/start/quartermaster,
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/inside)
+"aOt" = (
+/obj/machinery/door/airlock/mining{
+	name = "Mining";
+	req_access_txt = "48"
+	},
+/obj/machinery/door/firedoor,
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/obj/effect/turf_decal/tile/brown{
+	dir = 1
+	},
+/obj/effect/turf_decal/tile/brown{
+	dir = 8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aOu" = (
+/obj/machinery/door/airlock/wood,
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aOv" = (
+/obj/machinery/door/airlock/wood,
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/inside)
+"aOw" = (
+/obj/structure/bed,
+/obj/item/bedsheet/random,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aOx" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/white{
+	icon_state = "0-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aOy" = (
+/turf/open/floor/spooktime/beach/coasts/watercoastNW,
+/area/eventmap/outside)
+"aOz" = (
+/obj/machinery/light/floor,
+/obj/machinery/telecomms/processor{
+	appearance_flags = "processor unit";
+	freq_listening = list(1347,1349,1351,1353,1355,1357,1359,1447);
+	name = "processor unit (NULL)"
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aOA" = (
+/obj/structure/cable/white{
+	icon_state = "2-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/indestructible/cobble,
+/area/eventmap/outside)
+"aOB" = (
+/obj/structure/filingcabinet,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aOC" = (
+/turf/open/floor/plasteel/damturf/platdmg3,
+/area/eventmap/mountaininside)
+"aOD" = (
+/obj/structure/fluff/broken_flooring,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aOE" = (
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aOF" = (
+/obj/machinery/grandfatherclock,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aOG" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/obj/structure/table/wood,
+/obj/item/paper_bin,
+/obj/item/pen/fountain,
+/obj/item/stamp/qm,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aOH" = (
+/obj/structure/chair/comfy/black{
+	dir = 4
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aOI" = (
+/obj/machinery/light/small{
+	dir = 4
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aOJ" = (
+/obj/structure/sign/poster/official/no_erp,
+/turf/closed/wall/mineral/wood,
+/area/eventmap/inside)
+"aOK" = (
+/obj/machinery/light/small{
+	brightness = 3;
+	dir = 8
+	},
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aOL" = (
+/obj/effect/spawner/structure/window/reinforced,
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
+	id = "C01"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aOM" = (
+/obj/structure/chair/office/dark,
+/obj/effect/landmark/start/quartermaster,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aON" = (
+/obj/machinery/button/door/dorms/luxury3{
+	id = "C10";
+	pixel_x = 24;
+	pixel_y = -12
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aOO" = (
+/obj/structure/table,
+/obj/machinery/reagentgrinder,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aOP" = (
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/obj/machinery/computer/card/minor/qm{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aOQ" = (
+/obj/vehicle/sealed/vectorcraft/cyber,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aOR" = (
+/obj/structure/table,
+/obj/machinery/light{
+	dir = 1
+	},
+/obj/machinery/chem_dispenser/drinks,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aOS" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/machinery/computer/cargo{
+	dir = 1
+	},
+/turf/open/floor/wood/damturf/broken3,
+/area/eventmap/inside)
+"aOT" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/machinery/computer/bounty{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aOU" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/machinery/computer/security/qm{
+	dir = 1
+	},
+/obj/structure/sign/poster/official/twelve_gauge{
+	pixel_y = -32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aOV" = (
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
+	id = "C10";
+	name = "Quartermaster's Shutters"
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/machinery/door/airlock/mining{
+	name = "Quartermaster's Quarters";
+	req_access_txt = "41"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aOW" = (
+/obj/structure/table/wood,
+/obj/item/storage/firstaid/brute,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aOX" = (
+/obj/structure/closet/secure_closet/personal,
+/obj/machinery/light/small{
+	brightness = 3;
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aOY" = (
+/obj/structure/closet/crate/bin,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aOZ" = (
+/obj/machinery/shower{
+	desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well...";
+	dir = 8
+	},
+/obj/item/soap,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aPa" = (
+/obj/structure/table,
+/obj/structure/bedsheetbin/towel,
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aPb" = (
+/obj/structure/bed,
+/obj/item/bedsheet/black,
+/turf/open/floor/carpet/purple,
+/area/eventmap/mountaininside)
+"aPc" = (
+/obj/structure/bookcase/random,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aPd" = (
+/obj/machinery/computer/rdconsole,
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aPe" = (
+/obj/vehicle/sealed/vectorcraft/CAPT,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aPf" = (
+/obj/vehicle/sealed/vectorcraft/CE,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aPg" = (
+/obj/vehicle/sealed/vectorcraft/CMO,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aPh" = (
+/obj/vehicle/sealed/vectorcraft/QM,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aPi" = (
+/turf/closed/indestructible/riveted/hierophant,
+/area/eventmap/mountaininside)
+"aPj" = (
+/obj/structure/filingcabinet/chestdrawer,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aPk" = (
+/obj/vehicle/sealed/vectorcraft/RD,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aPl" = (
+/obj/structure/rack,
+/obj/item/stack/sheet/mineral/wood/fifty,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aPm" = (
+/obj/item/candle/infinite,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aPn" = (
+/obj/vehicle/sealed/vectorcraft/hop,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aPo" = (
+/obj/structure/table/reinforced,
+/obj/item/storage/toolbox/syndicate,
+/obj/item/storage/toolbox/gold_real,
+/obj/item/storage/toolbox/syndicate,
+/obj/item/storage/toolbox/gold_real,
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aPp" = (
+/obj/vehicle/sealed/vectorcraft/hos,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aPq" = (
+/mob/living/simple_animal/jacq{
+	active = 0
+	},
+/turf/open/floor/carpet/orange,
+/area/eventmap/mountaininside)
+"aPr" = (
+/obj/structure/flora/grass/jungle/b,
+/turf/open/floor/spooktime/cobble/sideS,
+/area/eventmap/outside)
+"aPs" = (
+/obj/machinery/light/small{
+	dir = 8
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"aPt" = (
+/obj/structure/chair/wood/wings,
+/turf/open/floor/carpet/orange,
+/area/eventmap/mountaininside)
+"aPu" = (
+/obj/structure/table/wood/fancy/green,
+/obj/item/reagent_containers/food/snacks/pizza/pineapple,
+/turf/open/floor/carpet/orange,
+/area/eventmap/mountaininside)
+"aPv" = (
+/obj/machinery/door/airlock/vault{
+	name = "Mecha Battleground"
+	},
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aPw" = (
+/obj/structure/table/wood/fancy/green,
+/obj/item/reagent_containers/food/snacks/pizza/margherita,
+/turf/open/floor/carpet/orange,
+/area/eventmap/mountaininside)
+"aPx" = (
+/obj/machinery/light{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aPy" = (
+/obj/structure/table/wood/fancy/green,
+/obj/item/reagent_containers/food/snacks/pizza/meat,
+/turf/open/floor/carpet/orange,
+/area/eventmap/mountaininside)
+"aPz" = (
+/obj/structure/table/wood/fancy/green,
+/obj/item/reagent_containers/food/snacks/pizza/mushroom,
+/turf/open/floor/carpet/orange,
+/area/eventmap/mountaininside)
+"aPA" = (
+/obj/item/skub,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aPB" = (
+/obj/structure/table/wood/fancy/green,
+/obj/item/reagent_containers/food/snacks/pizza/sassysage,
+/turf/open/floor/carpet/orange,
+/area/eventmap/mountaininside)
+"aPC" = (
+/obj/structure/table,
+/obj/machinery/microwave,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aPD" = (
+/obj/machinery/rnd/production/protolathe/department/science{
+	acted_explosions = "Dumbasses";
+	allowed_department_flags = 126;
+	name = "department protolathe (Dumb powergamers)"
+	},
+/obj/machinery/light/floor,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aPE" = (
+/obj/structure/table/wood/fancy/green,
+/obj/item/reagent_containers/food/snacks/pizza/vegetable,
+/turf/open/floor/carpet/orange,
+/area/eventmap/mountaininside)
+"aPF" = (
+/obj/vehicle/sealed/vectorcraft/auto,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aPG" = (
+/obj/structure/table/wood/fancy/green,
+/obj/effect/spawner/lootdrop/welder_tools,
+/obj/item/clothing/head/welding,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aPH" = (
+/obj/effect/spawner/structure/window/reinforced,
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/mountaininside)
+"aPI" = (
+/obj/structure/spacevine,
+/turf/open/floor/spooktime/beach,
+/area/eventmap/outside)
+"aPJ" = (
+/obj/item/soap/homemade,
+/turf/open/floor/sepia,
+/area/eventmap/mountaininside)
+"aPK" = (
+/obj/item/clothing/neck/petcollar,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aPL" = (
+/obj/structure/fluff/broken_flooring,
+/turf/open/floor/plating,
+/area/eventmap/mountaininside)
+"aPM" = (
+/obj/machinery/recycler/lumbermill,
+/turf/open/floor/plating,
+/area/eventmap/mountaininside)
+"aPN" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/plating,
+/area/cargo/miningstorage)
+"aPO" = (
+/turf/open/floor/plasteel/damturf/platdmg2,
+/area/eventmap/mountaininside)
+"aPP" = (
+/obj/machinery/door/airlock/abandoned{
+	name = "Filthy Powergame Shack"
+	},
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aPQ" = (
+/turf/open/floor/plasteel,
+/area/cargo/miningstorage)
+"aPR" = (
+/obj/machinery/light/small{
+	dir = 4;
+	light_color = "#d8b1b1"
+	},
+/turf/open/floor/plasteel,
+/area/cargo/miningstorage)
+"aPS" = (
+/obj/machinery/door/airlock/security,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aPT" = (
+/turf/closed/wall,
+/area/eventmap/mountaininside)
+"aPU" = (
+/obj/item/clothing/head/hardhat/pumpkinhead/jaqc,
+/obj/structure/table/wood/fancy/green,
+/obj/effect/spawner/lootdrop/welder_tools,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aPV" = (
+/obj/machinery/light/small/broken{
+	dir = 1
+	},
+/obj/effect/decal/cleanable/cobweb,
+/obj/effect/decal/cleanable/glass,
+/turf/open/floor/mineral/titanium/white{
+	name = "padded floor"
+	},
+/area/eventmap/inside)
+"aPW" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/obj/item/reagent_containers/glass/bowl,
+/obj/item/clothing/neck/petcollar,
+/turf/open/floor/mineral/titanium/white{
+	name = "padded floor"
+	},
+/area/eventmap/inside)
+"aPX" = (
+/obj/item/pet_carrier,
+/obj/effect/decal/cleanable/semen,
+/turf/open/floor/mineral/titanium/white,
+/area/eventmap/inside)
+"aPY" = (
+/obj/item/reagent_containers/food/drinks/bottle/grappa,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aPZ" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/indestructible/cobble,
+/area/eventmap/outside)
+"aQa" = (
+/obj/structure/cable/pink{
+	icon_state = "2-5"
+	},
+/turf/open/floor/plating,
+/area/eventmap/mountain)
+"aQb" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aQc" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aQd" = (
+/obj/item/lighter/gold,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aQe" = (
+/turf/open/floor/carpet/green,
+/area/eventmap/mountaininside)
+"aQf" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood/damturf/broken2,
+/area/eventmap/inside)
+"aQg" = (
+/obj/structure/bookcase/manuals/research_and_development,
+/turf/closed/wall/mineral/wood,
+/area/eventmap/mountaininside)
+"aQh" = (
+/obj/item/toy/fluff/tennis_poly/red,
+/turf/open/floor/mineral/titanium/white,
+/area/eventmap/inside)
+"aQi" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/structure/noticeboard{
+	pixel_y = 32
+	},
+/obj/item/paper/fluff/balls/spookyasylum/cell03,
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/inside)
+"aQj" = (
+/obj/effect/decal/cleanable/cobweb{
+	icon_state = "cobweb2"
+	},
+/obj/structure/noticeboard{
+	pixel_y = 32
+	},
+/obj/item/paper/fluff/balls/spookyasylum/cell04,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aQk" = (
+/obj/structure/cable/pink{
+	icon_state = "1-10"
+	},
+/turf/open/floor/plating,
+/area/eventmap/mountain)
+"aQl" = (
+/obj/item/flashlight/lantern{
+	anchored = 1;
+	can_be_unanchored = 1;
+	light_color = "#EE9933";
+	light_range = 5;
+	on = 1
+	},
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aQm" = (
+/obj/structure/table/wood/fancy/orange,
+/obj/item/reagent_containers/rag/towel,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aQn" = (
+/obj/structure/table/wood/fancy,
+/obj/item/reagent_containers/food/snacks/donut/bungo,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aQo" = (
+/obj/structure/table/wood/fancy,
+/obj/item/reagent_containers/food/snacks/donut/glaze,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aQp" = (
+/obj/structure/table/wood/fancy,
+/obj/item/reagent_containers/food/snacks/donut/matcha,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aQq" = (
+/obj/effect/decal/cleanable/dirt,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aQr" = (
+/obj/structure/table/wood/fancy,
+/obj/item/reagent_containers/food/snacks/donut/apple,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aQs" = (
+/obj/structure/bed,
+/obj/item/bedsheet/purple,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aQt" = (
+/obj/structure/table/wood/fancy,
+/obj/item/reagent_containers/food/snacks/donut/laugh,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aQu" = (
+/obj/structure/chair{
+	dir = 8
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aQv" = (
+/obj/structure/cable/pink{
+	icon_state = "2-9"
+	},
+/turf/open/floor/plating,
+/area/eventmap/mountain)
+"aQw" = (
+/obj/structure/table/wood/fancy,
+/obj/item/reagent_containers/food/snacks/donut/jelly/berry,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aQx" = (
+/obj/structure/table/wood,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aQy" = (
+/obj/structure/table/wood/fancy,
+/obj/item/reagent_containers/food/snacks/donut/caramel,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aQz" = (
+/obj/item/reagent_containers/food/snacks/roastparsnip,
+/obj/structure/table/reinforced,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aQA" = (
+/obj/structure/table/wood/fancy,
+/obj/item/reagent_containers/food/snacks/donut/laugh,
+/obj/item/reagent_containers/food/snacks/donut/laugh,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aQB" = (
+/obj/structure/table/wood/fancy,
+/obj/item/reagent_containers/food/snacks/donut/laugh,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aQC" = (
+/obj/machinery/light/small{
+	dir = 4
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/inside)
+"aQD" = (
+/obj/item/barthpot{
+	BallTutorial = 1;
+	active = 0;
+	light_range = 5
+	},
+/turf/open/floor/spooktime/cobble/roadsideS,
+/area/eventmap/outside)
+"aQF" = (
+/obj/machinery/washing_machine,
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/mountaininside)
+"aQG" = (
+/obj/structure/sink{
+	dir = 8;
+	pixel_x = -12
+	},
+/obj/structure/mirror{
+	pixel_x = -28
+	},
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/mountaininside)
+"aQI" = (
+/obj/structure/bookcase/random/adult,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aQK" = (
+/turf/open/floor/spooktime/beach,
+/area/eventmap/outside)
+"aQL" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/carpet/purple,
+/area/eventmap/inside)
+"aQM" = (
+/obj/effect/landmark/start/clown,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aQN" = (
+/obj/machinery/door/firedoor,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aQO" = (
+/obj/structure/table/wood/bar,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aQP" = (
+/obj/structure/table/plasmaglass,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aQQ" = (
+/obj/effect/spawner/structure/window/reinforced,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aQR" = (
+/obj/structure/table/wood/bar,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aQS" = (
+/obj/structure/table,
+/obj/item/reagent_containers/food/drinks/bottle/tequila,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aQT" = (
+/obj/effect/landmark/start/clown,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"aQU" = (
+/obj/structure/table,
+/obj/machinery/light{
+	dir = 1
+	},
+/obj/item/book/manual/wiki/barman_recipes,
+/obj/item/book/granter/action/drink_fling,
+/obj/item/reagent_containers/food/drinks/shaker,
+/obj/item/reagent_containers/rag,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aQV" = (
+/obj/structure/dresser,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aQW" = (
+/obj/item/reagent_containers/food/snacks/khinkali,
+/obj/structure/table/reinforced,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aQX" = (
+/obj/structure/table,
+/obj/item/reagent_containers/food/drinks/bottle/champagne,
+/obj/machinery/button/door/dorms/luxury3{
+	id = "C08";
+	pixel_y = -24
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aQY" = (
+/obj/machinery/washing_machine,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aQZ" = (
+/obj/structure/chair/wood/normal,
+/turf/open/floor/carpet/purple,
+/area/eventmap/inside)
+"aRa" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aRb" = (
+/obj/structure/cable/yellow{
+	icon_state = "0-4"
+	},
+/obj/structure/chair/wood/normal{
+	dir = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aRc" = (
+/obj/item/reagent_containers/food/drinks/bottle/absinthe,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aRd" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"aRe" = (
+/obj/item/restraints/handcuffs,
+/turf/open/floor/carpet/red,
+/area/eventmap/mountaininside)
+"aRf" = (
+/obj/structure/chair/wood/normal{
+	dir = 4
+	},
+/turf/open/floor/carpet/purple,
+/area/eventmap/inside)
+"aRg" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/spooktime/cobble/sideE,
+/area/eventmap/outside)
+"aRh" = (
+/obj/structure/table/wood/poker,
+/obj/item/toy/cards/deck/cas/black{
+	pixel_x = 4
+	},
+/obj/item/toy/cards/deck/cas{
+	pixel_x = -4
+	},
+/obj/item/toy/cards/deck{
+	pixel_y = 4
+	},
+/obj/machinery/light/small,
+/turf/open/floor/carpet/purple,
+/area/eventmap/inside)
+"aRi" = (
+/obj/structure/fluff/broken_flooring,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aRj" = (
+/obj/structure/chair/wood/normal{
+	dir = 8
+	},
+/turf/open/floor/carpet/purple,
+/area/eventmap/inside)
+"aRk" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/spooktime/cobble/sideW,
+/area/eventmap/outside)
+"aRl" = (
+/obj/structure/chair/wood/normal{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aRm" = (
+/turf/open/floor/plasteel/damturf/damage5,
+/area/eventmap/mountaininside)
+"aRn" = (
+/obj/effect/spawner/structure/window/reinforced,
+/turf/open/floor/plating,
+/area/eventmap/inside)
+"aRo" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"aRp" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/structure/curtain{
+	color = "#B22222";
+	pixel_x = 32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aRq" = (
+/obj/machinery/light/small{
+	dir = 4
+	},
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/mountaininside)
+"aRr" = (
+/obj/structure/flora/grass/jungle/b,
+/turf/open/floor/spooktime/cobble/sideN,
+/area/eventmap/outside)
+"aRs" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"aRt" = (
+/obj/effect/landmark/start/janitor,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"aRu" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/effect/landmark/start/scientist,
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"aRv" = (
+/obj/structure/flora/junglebush,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aRw" = (
+/obj/machinery/door/airlock/wood,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aRy" = (
+/obj/item/stack/sheet/metal/fifty,
+/turf/open/floor/spooktime/beach,
+/area/eventmap/outside)
+"aRz" = (
+/obj/machinery/door/airlock/survival_pod,
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
+	id = "C08"
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aRB" = (
+/turf/open/floor/plating,
+/area/eventmap/mountaininside)
+"aRC" = (
+/obj/effect/decal/remains/human,
+/obj/effect/rune/apocalypse,
+/obj/effect/decal/cleanable/blood/splatter,
+/obj/item/toy/plush/catgirl/fermis,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aRD" = (
+/obj/effect/landmark/start/janitor,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-8"
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"aRE" = (
+/obj/item/reagent_containers/food/drinks/trophy/gold_cup,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aRF" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/spooktime/cobble/sideE,
+/area/eventmap/outside)
+"aRG" = (
+/turf/closed/wall/mineral/iron,
+/area/eventmap/mountain)
+"aRJ" = (
+/obj/effect/decal/cleanable/cobweb,
+/turf/open/floor/spooktime/cobble/sideW{
+	icon_state = "cobble_side_n"
+	},
+/area/eventmap/outside)
+"aRL" = (
+/obj/item/stack/sheet/metal/fifty,
+/turf/open/floor/spooktime/beach/coasts/coastNE,
+/area/eventmap/outside)
+"aRM" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/spooktime/cobble/sideW{
+	icon_state = "cobble_side_n"
+	},
+/area/eventmap/outside)
+"aRN" = (
+/obj/item/flashlight/flare/torch,
+/obj/item/flashlight/flare/torch,
+/obj/machinery/light/floor{
+	CanAtmosPass = 0;
+	alpha = 0
+	},
+/obj/item/umbrella,
+/obj/item/pickaxe/mini,
+/obj/item/shovel,
+/obj/item/hatchet,
+/obj/item/storage/box/matches,
+/obj/item/storage/fancy/candle_box,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aRO" = (
+/obj/structure/cable/pink{
+	icon_state = "4-10"
+	},
+/turf/open/floor/plating,
+/area/eventmap/mountain)
+"aRP" = (
+/turf/open/floor/wood/damturf/broken2,
+/area/eventmap/inside)
+"aRQ" = (
+/obj/machinery/computer/rdconsole/core,
+/obj/machinery/light/floor,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aRS" = (
+/turf/open/floor/plasteel/damturf/damage4,
+/area/eventmap/mountaininside)
+"aRT" = (
+/obj/item/flashlight/lantern{
+	anchored = 1;
+	can_be_unanchored = 1;
+	light_color = "#EE9933";
+	light_range = 5;
+	on = 1
+	},
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aRU" = (
+/obj/item/flashlight/lantern{
+	anchored = 1;
+	can_be_unanchored = 1;
+	light_color = "#EE9933";
+	light_range = 5;
+	on = 1
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/mountain)
+"aRV" = (
+/turf/open/floor/spooktime/beach/coasts/watercoastS,
+/area/eventmap/outside)
+"aRW" = (
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/mountain)
+"aRX" = (
+/obj/structure/closet/cabinet,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aSb" = (
+/obj/item/scythe,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aSe" = (
+/obj/effect/decal/cleanable/dirt,
+/obj/machinery/vending/clothing,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aSg" = (
+/obj/effect/decal/cleanable/dirt,
+/obj/item/chair/stool,
+/turf/open/floor/plating,
+/area/eventmap/mountaininside)
+"aSi" = (
+/obj/structure/closet{
+	name = "Official Clothing"
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aSj" = (
+/obj/item/chair/stool,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aSk" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"aSl" = (
+/obj/structure/bonfire,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aSn" = (
+/obj/machinery/nanite_program_hub,
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aSo" = (
+/turf/open/floor/plating,
+/area/eventmap/outside)
+"aSq" = (
+/obj/machinery/autolathe/hacked,
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aSt" = (
+/obj/item/storage/pill_bottle/zoom,
+/turf/open/floor/plasteel/damturf/scorched1,
+/area/eventmap/mountaininside)
+"aSF" = (
+/obj/structure/curtain{
+	color = "#B22222";
+	pixel_x = -32
+	},
+/turf/open/floor/wood/damturf/broken5,
+/area/eventmap/inside)
+"aSH" = (
+/obj/machinery/button/door/dorms/luxury3{
+	id = "C01";
+	pixel_x = -8
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aSK" = (
+/obj/item/storage/daki,
+/turf/open/floor/plasteel/damturf/scorched2,
+/area/eventmap/mountaininside)
+"aSL" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/disposalpipe/segment{
+	dir = 4
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"aSM" = (
+/obj/effect/landmark/start/janitor,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/disposalpipe/segment{
+	dir = 4
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"aSN" = (
+/obj/structure/bonfire,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aSO" = (
+/obj/effect/landmark/start/station_engineer,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/disposalpipe/segment{
+	dir = 4
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"aSP" = (
+/obj/machinery/light{
+	dir = 8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aSQ" = (
+/obj/effect/landmark/start/assistant,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/disposalpipe/segment{
+	dir = 4
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"aSR" = (
+/obj/item/flashlight/flare,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aSS" = (
+/obj/effect/landmark/start,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/disposalpipe/segment{
+	dir = 4
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"aST" = (
+/obj/effect/landmark/start/cyborg,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/disposalpipe/segment{
+	dir = 4
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"aSU" = (
+/obj/machinery/rnd/production/protolathe/department/science{
+	acted_explosions = "Dumbasses";
+	allowed_department_flags = 126;
+	name = "department protolathe (Dumb powergamers)"
+	},
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aSV" = (
+/obj/structure/table/reinforced,
+/turf/open/floor/plating,
+/area/eventmap/mountaininside)
+"aSW" = (
+/obj/item/a_gift/anything,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aTc" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-4"
+	},
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"aTe" = (
+/obj/structure/mirror{
+	pixel_x = 28
+	},
+/turf/open/floor/sepia,
+/area/eventmap/mountaininside)
+"aTi" = (
+/obj/structure/chair/sofa/left,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aTj" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aTm" = (
+/obj/structure/sink/puddle,
+/turf/open/floor/spooktime/beach,
+/area/eventmap/outside)
+"aTn" = (
+/obj/item/integrated_circuit_printer,
+/obj/structure/table/plasmaglass,
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aTp" = (
+/obj/effect/decal/cleanable/cobweb,
+/obj/machinery/vending/kink,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aTu" = (
+/obj/item/reagent_containers/food/drinks/bottle/champagne,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aTv" = (
+/obj/structure/trap/ctf/nomech,
+/turf/open/floor/spooktime/cobble/cornerSE,
+/area/eventmap/outside)
+"aTw" = (
+/turf/open/floor/spooktime/beach/water,
+/area/eventmap/outside)
+"aTx" = (
+/obj/item/fugu_gland,
+/turf/open/floor/spooktime/beach/coasts/coastN,
+/area/eventmap/outside)
+"aTA" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-8"
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aTC" = (
+/turf/closed/wall/r_wall/rust,
+/area/eventmap/mountain)
+"aTD" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-4"
+	},
+/obj/structure/sign/directions/security{
+	dir = 8;
+	pixel_x = -32;
+	pixel_y = 24
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aTE" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/sign/directions/medical{
+	dir = 4;
+	pixel_x = 32;
+	pixel_y = 24
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aTG" = (
+/obj/structure/flora/grass/jungle/b,
+/obj/structure/flora/tree/jungle,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"aTH" = (
+/obj/machinery/light/small,
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/mountaininside)
+"aTJ" = (
+/obj/structure/closet,
+/obj/item/clothing/suit/hooded/wintercoat/miner,
+/obj/item/clothing/shoes/sneakers/brown,
+/obj/item/clothing/under/pants/classicjeans,
+/obj/item/clothing/neck/scarf,
+/obj/item/clothing/neck/stripedgreenscarf,
+/obj/item/toy/fluff/tennis_poly/tri/squeak/rainbow,
+/obj/item/toy/fluff/tennis_poly,
+/obj/item/clothing/suit/hooded/wintercoat/miner,
+/obj/item/clothing/shoes/sneakers/brown,
+/obj/item/clothing/under/pants/classicjeans,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aTL" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/disposalpipe/segment,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aTM" = (
+/obj/item/soap/syndie,
+/turf/open/floor/sepia,
+/area/eventmap/mountaininside)
+"aTN" = (
+/obj/item/storage/firstaid/tactical,
+/turf/open/floor/plasteel/damturf/platdmg1,
+/area/eventmap/mountaininside)
+"aTO" = (
+/obj/item/stack/sheet/metal/fifty,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aTP" = (
+/obj/structure/mineral_door/wood,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/disposalpipe/segment,
+/turf/open/floor/plasteel/stairs,
+/area/eventmap/mountaininside)
+"aTQ" = (
+/obj/structure/flora/junglebush{
+	icon_state = "busha1"
+	},
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aTR" = (
+/obj/machinery/light/floor,
+/obj/machinery/telecomms/message_server,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aTS" = (
+/obj/structure/sign/departments/restroom{
+	pixel_y = 32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aTT" = (
+/obj/structure/sign/barsign,
+/turf/closed/wall/mineral/wood,
+/area/eventmap/mountaininside)
+"aTU" = (
+/obj/machinery/power/port_gen/pacman/mrs,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aTV" = (
+/obj/machinery/computer/mech_bay_power_console{
+	dir = 1
+	},
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aTX" = (
+/turf/open/floor/plasteel/damturf/scorched1,
+/area/eventmap/mountaininside)
+"aTY" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/turf/open/indestructible/cobble,
+/area/eventmap/outside)
+"aUe" = (
+/obj/item/flashlight/seclite,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aUf" = (
+/obj/structure/flora/ausbushes/lavendergrass,
+/obj/structure/flora/tree/spookytimexl,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aUi" = (
+/obj/item/storage/pill_bottle/zoom,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aUj" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aUl" = (
+/obj/structure/table,
+/obj/item/clothing/mask/gas,
+/obj/machinery/light/small{
+	dir = 1
+	},
+/obj/item/clothing/glasses/sunglasses/big,
+/obj/item/clothing/glasses/sunglasses/big,
+/obj/item/clothing/glasses/sunglasses/big,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aUn" = (
+/obj/structure/cable/pink{
+	icon_state = "5-10"
+	},
+/turf/open/floor/plating,
+/area/eventmap/mountain)
+"aUo" = (
+/obj/machinery/light/floor,
+/obj/machinery/telecomms/processor{
+	freq_listening = list(1359,1441)
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aUr" = (
+/turf/open/floor/plasteel/damturf/platdmg1,
+/area/eventmap/mountaininside)
+"aUt" = (
+/obj/item/stack/sheet/mineral/bananium,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aUu" = (
+/obj/item/storage/firstaid/ancient,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aUx" = (
+/obj/structure/chair/wood/wings{
+	dir = 8
+	},
+/turf/open/floor/carpet/royalblack,
+/area/eventmap/mountain)
+"aUy" = (
+/turf/open/floor/spooktime/beach/watersolid,
+/area/eventmap/outside)
+"aUz" = (
+/obj/structure/flora/grass/jungle/b{
+	icon_state = "grassa1"
+	},
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/outside)
+"aUD" = (
+/obj/structure/table,
+/obj/item/reagent_containers/food/drinks/bottle/kahlua,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aUE" = (
+/obj/item/reagent_containers/food/drinks/bottle/rum,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aUK" = (
+/turf/open/floor/plasteel/damturf/scorched,
+/area/eventmap/mountaininside)
+"aUL" = (
+/obj/structure/spacevine,
+/obj/structure/spacevine,
+/turf/open/floor/spooktime/beach/watersolid,
+/area/eventmap/mountain)
+"aUM" = (
+/obj/item/storage/pill_bottle/lsd,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aUP" = (
+/obj/structure/cable/white{
+	icon_state = "2-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"aUQ" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-4"
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"aUW" = (
+/obj/machinery/light/floor{
+	alpha = 0;
+	light_range = 20;
+	max_integrity = 9999;
+	mouse_opacity = 0
+	},
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aUX" = (
+/obj/machinery/button/door/dorms/luxury3{
+	id = "C05";
+	pixel_y = -24
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aUY" = (
+/obj/structure/trap/ctf/nomech,
+/turf/closed/mineral/ash_rock,
+/area/eventmap/outside)
+"aVd" = (
+/obj/structure/fluff/bus/passable{
+	icon_state = "topdoor"
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"aVe" = (
+/obj/structure/sign/departments/botany{
+	pixel_x = -32
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"aVf" = (
+/obj/machinery/vending/kink,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aVh" = (
+/turf/open/floor/wood/damturf/broken4,
+/area/eventmap/inside)
+"aVi" = (
+/obj/effect/spawner/structure/window/reinforced,
+/turf/open/floor/clockwork/reebe,
+/area/eventmap/inside)
+"aVj" = (
+/obj/item/coin/diamond,
+/obj/item/stack/sheet/mineral/adamantine,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aVk" = (
+/obj/structure/chair/stool,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aVm" = (
+/obj/item/reagent_containers/food/drinks/bottle/fernet,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aVn" = (
+/obj/machinery/light/small,
+/obj/structure/closet/crate/bin,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aVo" = (
+/obj/structure/dresser,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aVq" = (
+/obj/item/gun/ballistic/shotgun/lethal,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aVr" = (
+/obj/structure/table/wood,
+/obj/item/reagent_containers/food/snacks/beans,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aVt" = (
+/obj/structure/flora/ausbushes/sparsegrass,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aVu" = (
+/obj/item/ammo_box/magazine/wt550m9/wtrubber,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aVv" = (
+/obj/structure/table,
+/obj/structure/table,
+/obj/item/reagent_containers/food/drinks/bottle/cognac,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aVy" = (
+/obj/item/lighter/greyscale,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aVz" = (
+/obj/item/gun/ballistic/automatic/wt550,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aVC" = (
+/obj/item/storage/box/handcuffs,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aVD" = (
+/turf/open/floor/wood/damturf/broken1,
+/area/eventmap/mountaininside)
+"aVE" = (
+/obj/item/pizzabox/meat,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aVG" = (
+/turf/open/floor/spooktime/beach/watersolid,
+/area/eventmap/mountain)
+"aVJ" = (
+/turf/open/floor/wood/damturf/broken5,
+/area/eventmap/inside)
+"aVR" = (
+/obj/machinery/light{
+	dir = 1
+	},
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/mountaininside)
+"aVS" = (
+/obj/item/stack/sheet/bluespace_crystal,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aVW" = (
+/obj/machinery/light/small,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aVY" = (
+/obj/structure/spacevine,
+/turf/open/floor/spooktime/beach/coasts/coastE,
+/area/eventmap/outside)
+"aVZ" = (
+/obj/structure/bookcase/manuals/engineering,
+/turf/closed/wall/mineral/wood,
+/area/eventmap/mountaininside)
+"aWd" = (
+/turf/open/floor/spooktime/beach/coasts/coastNW,
+/area/eventmap/outside)
+"aWf" = (
+/obj/structure/spacevine,
+/turf/open/floor/spooktime/beach/water,
+/area/eventmap/outside)
+"aWi" = (
+/obj/item/reagent_containers/food/snacks/nachos,
+/obj/structure/table/reinforced,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aWj" = (
+/obj/structure/bed,
+/obj/item/bedsheet/black,
+/turf/open/floor/carpet/green,
+/area/eventmap/mountaininside)
+"aWk" = (
+/obj/item/clothing/head/squatter_hat,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aWl" = (
+/obj/structure/rack,
+/obj/item/gun/magic/staff/healing,
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aWo" = (
+/obj/structure/bed,
+/obj/item/bedsheet/syndie,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aWq" = (
+/obj/structure/curtain{
+	color = "#B22222";
+	pixel_y = -32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aWs" = (
+/obj/structure/flora/tree/jungle,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aWt" = (
+/obj/structure/spacevine,
+/turf/open/floor/spooktime/beach/coasts/coastN,
+/area/eventmap/outside)
+"aWv" = (
+/obj/effect/turf_decal/stripes/line,
+/turf/open/floor/plasteel,
+/area/eventmap/mountain)
+"aWy" = (
+/obj/machinery/light/small{
+	dir = 8
+	},
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aWz" = (
+/obj/item/reagent_containers/pill/lsd,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aWA" = (
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"aWJ" = (
+/obj/structure/bed,
+/obj/item/bedsheet/hos,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aWK" = (
+/obj/machinery/light/floor,
+/obj/machinery/telecomms/bus{
+	freq_listening = list(1459,1441)
+	},
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aWL" = (
+/obj/structure/closet/gimmick/russian,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aWN" = (
+/obj/structure/table/plasmaglass,
+/obj/item/multitool,
+/obj/item/multitool,
+/obj/item/multitool,
+/obj/item/multitool,
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aWO" = (
+/obj/machinery/shower{
+	dir = 8;
+	pixel_y = -4
+	},
+/obj/effect/turf_decal/bot_red,
+/obj/effect/turf_decal/bot,
+/turf/open/floor/sepia,
+/area/eventmap/mountaininside)
+"aWQ" = (
+/obj/item/stack/sheet/metal/fifty,
+/turf/open/floor/spooktime/beach/coasts/coastE,
+/area/eventmap/outside)
+"aWR" = (
+/obj/item/flashlight/seclite,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aWS" = (
+/turf/open/floor/carpet,
+/area/eventmap/mountaininside)
+"aWU" = (
+/obj/item/flashlight/glowstick/pink,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aWX" = (
+/obj/structure/closet/crate,
+/obj/item/clothing/head/pirate,
+/obj/item/clothing/head/santa,
+/obj/item/clothing/head/magus,
+/obj/item/clothing/head/mailman,
+/obj/item/clothing/head/griffin,
+/obj/item/clothing/head/bearpelt,
+/obj/item/clothing/head/beret,
+/obj/item/clothing/head/fedora,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aWY" = (
+/obj/item/stack/sheet/mineral/bananium,
+/obj/item/stack/sheet/mineral/bananium,
+/obj/item/stack/sheet/mineral/bananium,
+/obj/item/stack/sheet/mineral/bananium,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aWZ" = (
+/turf/open/floor/spooktime/beach/coasts/innerS,
+/area/eventmap/outside)
+"aXa" = (
+/obj/machinery/light/floor,
+/obj/machinery/telecomms/receiver,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aXh" = (
+/obj/machinery/computer/upload/ai,
+/obj/machinery/light/floor,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aXj" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "2-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aXn" = (
+/obj/effect/turf_decal/stripes/line{
+	dir = 4
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/mountain)
+"aXo" = (
+/obj/item/toy/plush/borgplushie{
+	pixel_w = -6;
+	pixel_x = -3;
+	pixel_y = -4
+	},
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aXq" = (
+/obj/machinery/light/floor{
+	alpha = 0;
+	light_range = 20;
+	mouse_opacity = 0
+	},
+/turf/closed/indestructible/riveted/boss,
+/area/eventmap/mountaininside)
+"aXs" = (
+/obj/effect/spawner/structure/window/plasma/reinforced,
+/turf/open/indestructible/airblock,
+/area/eventmap/mountaininside)
+"aXv" = (
+/obj/structure/bookcase/random/adult,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aXw" = (
+/obj/machinery/door/airlock/vault,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aXy" = (
+/obj/item/flashlight/lantern{
+	anchored = 1;
+	can_be_unanchored = 1;
+	light_color = "#EE9933";
+	light_range = 5;
+	on = 1
+	},
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/outside)
+"aXz" = (
+/obj/machinery/vending/assist,
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aXE" = (
+/obj/item/reagent_containers/food/drinks/bottle/tequila,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aXF" = (
+/obj/machinery/light{
+	dir = 1
+	},
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aXI" = (
+/obj/item/storage/pill_bottle/penis_enlargement,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aXJ" = (
+/obj/item/stack/sheet/mineral/sandstone,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aXK" = (
+/obj/item/reagent_containers/food/drinks/bottle/champagne,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aXM" = (
+/obj/structure/curtain{
+	color = "#B22222";
+	pixel_x = -32
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aXO" = (
+/obj/structure/table/plasmaglass,
+/obj/machinery/chem_dispenser/drinks/beer/fullupgrade{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aXP" = (
+/obj/structure/girder,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aXQ" = (
+/obj/item/flashlight/lantern,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aXR" = (
+/obj/machinery/vending/coffee,
+/obj/machinery/light/small{
+	brightness = 3;
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aXS" = (
+/turf/open/floor/spooktime/beach/coasts/coastS,
+/area/eventmap/outside)
+"aXU" = (
+/obj/structure/mirror{
+	pixel_x = 28
+	},
+/obj/effect/turf_decal/bot,
+/obj/machinery/shower{
+	dir = 8;
+	pixel_y = -4
+	},
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/mountaininside)
+"aXX" = (
+/obj/structure/mineral_door/wood,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/inside)
+"aXZ" = (
+/obj/item/paicard,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aYa" = (
+/turf/open/floor/spooktime/beach/coasts/watercoastN,
+/area/eventmap/outside)
+"aYb" = (
+/obj/item/chair,
+/turf/open/floor/plasteel/damturf/scorched2,
+/area/eventmap/mountaininside)
+"aYd" = (
+/obj/machinery/light/small{
+	dir = 8
+	},
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/mountaininside)
+"aYf" = (
+/obj/item/reagent_containers/food/drinks/bottle/cream,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aYh" = (
+/obj/item/reagent_containers/food/snacks/sashimi,
+/obj/structure/table/reinforced,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aYi" = (
+/obj/structure/table/wood,
+/obj/item/flashlight/lamp,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aYp" = (
+/obj/structure/chair/sofa/left,
+/obj/item/flashlight/seclite,
+/turf/open/floor/carpet/red,
+/area/eventmap/mountaininside)
+"aYr" = (
+/obj/structure/chair/sofa,
+/turf/open/floor/carpet/red,
+/area/eventmap/mountaininside)
+"aYs" = (
+/obj/structure/table,
+/obj/item/reagent_containers/food/drinks/bottle/trappist,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aYw" = (
+/obj/item/restraints/handcuffs,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aYy" = (
+/turf/open/floor/plasteel/showroomfloor,
+/area/eventmap/mountaininside)
+"aYz" = (
+/obj/item/restraints/handcuffs,
+/turf/open/floor/plasteel/damturf/scorched2,
+/area/eventmap/mountaininside)
+"aYA" = (
+/obj/structure/table,
+/obj/item/lighter/greyscale,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aYG" = (
+/obj/structure/spacevine,
+/obj/structure/spacevine,
+/obj/structure/spacevine,
+/obj/structure/spacevine,
+/obj/structure/spacevine,
+/obj/structure/spacevine,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aYH" = (
+/obj/item/reagent_containers/food/drinks/bottle/sake,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aYI" = (
+/obj/structure/flora/tree/spookytime,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aYJ" = (
+/obj/item/coin/diamond,
+/obj/item/stack/sheet/mineral/mythril,
+/turf/open/floor/plasteel/dark,
+/area/eventmap/mountaininside)
+"aYM" = (
+/obj/effect/decal/cleanable/dirt,
+/turf/open/floor/plasteel/damturf/scorched1,
+/area/eventmap/mountaininside)
+"aYO" = (
+/obj/item/stack/sheet/mineral/sandstone/thirty,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aYQ" = (
+/turf/open/floor/spooktime/beach/coasts/watercoastSW,
+/area/eventmap/outside)
+"aYT" = (
+/obj/structure/mineral_door/wood,
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
+	id = "C11"
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aYU" = (
+/obj/item/storage/fancy/cigarettes/cigpack_mindbreaker,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aYV" = (
+/obj/structure/table/wood,
+/obj/item/reagent_containers/food/drinks/bottle/tequila,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aYW" = (
+/obj/machinery/door/airlock/wood/glass,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aYY" = (
+/obj/item/reagent_containers/food/drinks/bottle/trappist,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aZa" = (
+/obj/structure/chair/comfy{
+	dir = 1
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aZb" = (
+/obj/item/reagent_containers/food/snacks/powercrepe,
+/obj/structure/table/reinforced,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aZg" = (
+/obj/machinery/light/small{
+	dir = 4
+	},
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aZi" = (
+/obj/machinery/light{
+	dir = 4
+	},
+/obj/structure/table/plasmaglass,
+/obj/machinery/chem_dispenser/drinks/fullupgrade{
+	dir = 8
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aZj" = (
+/obj/structure/chair/comfy/brown{
+	dir = 4
+	},
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aZk" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountaininside)
+"aZm" = (
+/obj/item/reagent_containers/food/snacks/scotchegg,
+/obj/structure/table/reinforced,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aZo" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/spooktime/cobble/sideN,
+/area/eventmap/outside)
+"aZr" = (
+/obj/machinery/light/floor{
+	alpha = 0;
+	light_range = 20;
+	max_integrity = 9999;
+	mouse_opacity = 0
+	},
+/turf/open/indestructible/airblock,
+/area/eventmap/mountaininside)
+"aZt" = (
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aZv" = (
+/obj/structure/bed,
+/obj/item/bedsheet/blue,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aZx" = (
+/obj/machinery/light/floor{
+	alpha = 0;
+	light_range = 20;
+	mouse_opacity = 0
+	},
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"aZz" = (
+/obj/item/reagent_containers/food/drinks/bottle/wine,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aZA" = (
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aZB" = (
+/obj/structure/bonfire,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aZC" = (
+/obj/item/flashlight,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aZE" = (
+/obj/structure/bed/dogbed,
+/turf/open/floor/wood,
+/area/eventmap/mountaininside)
+"aZH" = (
+/obj/structure/sign/directions/security{
+	dir = 1
+	},
+/obj/structure/sign/directions/command{
+	dir = 1;
+	pixel_y = 8
+	},
+/obj/structure/sign/directions/supply{
+	dir = 1;
+	pixel_y = -8
+	},
+/turf/closed/wall/mineral/wood,
+/area/eventmap/inside)
+"aZI" = (
+/obj/item/lighter,
+/turf/open/floor/carpet/green,
+/area/eventmap/mountaininside)
+"aZJ" = (
+/obj/item/lipstick/random,
+/turf/open/floor/plasteel,
+/area/eventmap/mountaininside)
+"aZK" = (
+/obj/structure/sign/directions/science{
+	dir = 4
+	},
+/obj/structure/sign/directions/engineering{
+	pixel_y = -8
+	},
+/obj/structure/sign/directions/medical{
+	dir = 1;
+	pixel_y = 8
+	},
+/turf/closed/wall/mineral/wood,
+/area/eventmap/inside)
+"aZL" = (
+/obj/structure/cable/pink{
+	icon_state = "1-6"
+	},
+/turf/open/floor/plating,
+/area/eventmap/mountain)
+"aZM" = (
+/obj/structure/flora/bush,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"aZN" = (
+/obj/structure/fluff/broken_flooring,
+/obj/effect/decal/cleanable/dirt,
+/turf/open/floor/plating,
+/area/eventmap/mountaininside)
+"aZP" = (
+/obj/structure/trap/ctf/nomech,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/outside)
+"aZQ" = (
+/obj/structure/mineral_door/wood,
+/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
+	id = "C01"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"aZS" = (
+/obj/structure/spacevine,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"aZU" = (
+/obj/machinery/vending/coffee,
+/turf/open/floor/wood{
+	icon_state = "wood-broken3"
+	},
+/area/eventmap/inside)
+"aZW" = (
+/obj/machinery/mech_bay_recharge_port,
+/obj/machinery/light/floor{
+	alpha = 0;
+	light_range = 20;
+	max_integrity = 9999;
+	mouse_opacity = 0
+	},
+/turf/open/floor/circuit/off,
+/area/eventmap/mountaininside)
+"baa" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"baX" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"bbi" = (
+/obj/effect/turf_decal/caution/stand_clear{
+	dir = 8;
+	pixel_x = -8
+	},
+/obj/docking_port/stationary{
+	dir = 4;
+	dwidth = 8;
+	height = 7;
+	id = "supply_home";
+	name = "Cargo Bay";
+	width = 20
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/outside)
+"bbt" = (
+/obj/structure/fence/corner{
+	dir = 4
+	},
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"bbv" = (
+/obj/structure/fence{
+	dir = 8
+	},
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"bbx" = (
+/turf/open/floor/plasteel,
+/area/eventmap/outside)
+"bby" = (
+/obj/effect/turf_decal/caution/stand_clear{
+	dir = 1;
+	pixel_y = 8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/outside)
+"bbD" = (
+/obj/effect/turf_decal/caution/stand_clear{
+	dir = 8;
+	pixel_x = -8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/outside)
+"bbE" = (
+/obj/effect/turf_decal/caution/stand_clear{
+	dir = 4;
+	pixel_x = 8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/outside)
+"bbG" = (
+/obj/structure/sign/mining{
+	pixel_x = 32
+	},
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/outside)
+"bbI" = (
+/obj/effect/turf_decal/caution/stand_clear{
+	pixel_y = -8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/outside)
+"bbJ" = (
+/obj/structure/fence/corner{
+	dir = 1
+	},
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"bbK" = (
+/obj/structure/fence/corner,
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"bbL" = (
+/obj/structure/fence{
+	dir = 8
+	},
+/turf/open/floor/spooktime/cobble/sideS,
+/area/eventmap/outside)
+"bbM" = (
+/obj/structure/fence/corner{
+	dir = 4
+	},
+/turf/open/floor/spooktime/cobble/sideS,
+/area/eventmap/outside)
+"bbP" = (
+/obj/structure/fence/corner{
+	dir = 9
+	},
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"bbZ" = (
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"bcb" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/spooktime/cobble/sideS,
+/area/eventmap/outside)
+"bcd" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"bce" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/disposalpipe/segment{
+	dir = 4
+	},
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"bci" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/indestructible/cobble,
+/area/eventmap/outside)
+"bck" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/indestructible/cobble,
+/area/eventmap/outside)
+"bcn" = (
+/turf/open/floor/plating,
+/area/eventmap/mountain)
+"bco" = (
+/obj/effect/turf_decal/stripes/line{
+	dir = 8
+	},
+/obj/effect/turf_decal/caution{
+	dir = 4
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/mountain)
+"bcp" = (
+/obj/effect/turf_decal/stripes/line{
+	dir = 8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/mountain)
+"bcq" = (
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/indestructible/cobble,
+/area/eventmap/outside)
+"bcx" = (
+/obj/effect/turf_decal/stripes/line{
+	dir = 1
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/mountain)
+"bcJ" = (
+/obj/structure/sign/directions/security{
+	pixel_x = -32;
+	pixel_y = -36
+	},
+/obj/structure/sign/directions/supply{
+	dir = 8;
+	pixel_x = -32;
+	pixel_y = -28
+	},
+/turf/open/floor/spooktime/cobble/sideW,
+/area/eventmap/outside)
+"bdh" = (
+/obj/structure/cable/white{
+	icon_state = "1-2"
+	},
+/turf/open/floor/plating,
+/area/eventmap/mountain)
+"bdm" = (
+/obj/effect/turf_decal/stripes/line{
+	dir = 4
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/outside)
+"bds" = (
+/obj/effect/turf_decal/stripes/line{
+	dir = 4
+	},
+/obj/effect/turf_decal/caution{
+	dir = 8
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/outside)
+"bdy" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/turf/open/floor/plating,
+/area/eventmap/mountain)
+"bdz" = (
+/obj/structure/cable/white{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/white{
+	icon_state = "2-4"
+	},
+/turf/open/floor/plating,
+/area/eventmap/mountain)
+"bdA" = (
+/obj/structure/cable/white{
+	icon_state = "1-8"
+	},
+/turf/open/floor/plating,
+/area/eventmap/mountain)
+"bdC" = (
+/obj/structure/cable/white{
+	icon_state = "1-4"
+	},
+/turf/open/floor/plating,
+/area/eventmap/mountain)
+"bdI" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/obj/structure/reagent_dispensers/fueltank,
+/turf/open/floor/plating,
+/area/eventmap/mountain)
+"bdL" = (
+/obj/structure/fence/door,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"bdN" = (
+/obj/structure/closet/crate/bin,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"bdO" = (
+/obj/structure/chair/sofa/right,
+/obj/item/toy/cards/deck/cas,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"bdP" = (
+/obj/structure/chair/sofa,
+/obj/item/toy/cards/deck/syndicate,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"bdQ" = (
+/obj/structure/chair/sofa/left,
+/obj/item/toy/cards/deck/cas/black,
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"bdR" = (
+/obj/effect/turf_decal/stripes/line{
+	dir = 4
+	},
+/obj/machinery/computer/shuttle/mining,
+/turf/open/floor/plasteel,
+/area/eventmap/outside)
+"bea" = (
+/obj/machinery/light/small{
+	dir = 4;
+	light_color = "#d8b1b1"
+	},
+/turf/open/floor/spooktime/dirtpatch,
+/area/eventmap/mountain)
+"bef" = (
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-8"
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"bey" = (
+/obj/machinery/light/small{
+	dir = 8
+	},
+/obj/structure/table/wood,
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"beA" = (
+/obj/structure/chair/sofa/left{
+	dir = 4
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"beB" = (
+/obj/structure/chair/sofa{
+	dir = 4
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"beE" = (
+/obj/structure/chair/sofa/right{
+	dir = 4
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"beF" = (
+/obj/structure/table/wood,
+/obj/machinery/light/small{
+	dir = 8
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-2"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"beG" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "1-4"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"beH" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/wood/damturf/broken4,
+/area/eventmap/inside)
+"beI" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"beJ" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"beK" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-4"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/cable/yellow{
+	icon_state = "2-8"
+	},
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"bfd" = (
+/obj/machinery/door/airlock{
+	name = "Unisex Showers"
+	},
+/turf/open/floor/plasteel{
+	icon_state = "sepia"
+	},
+/area/eventmap/inside)
+"bfA" = (
+/obj/structure/disposalpipe/segment,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"bfB" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/disposalpipe/segment,
+/turf/open/floor/carpet,
+/area/eventmap/inside)
+"bfC" = (
+/obj/structure/disposalpipe/segment,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"bfD" = (
+/obj/structure/chair/sofa/right,
+/obj/structure/disposalpipe/segment,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"bfE" = (
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/disposalpipe/segment,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"bfF" = (
+/obj/effect/decal/cleanable/dirt{
+	desc = "A thin layer of dust coating the floor.";
+	name = "dust"
+	},
+/obj/structure/disposalpipe/segment,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"bfG" = (
+/obj/effect/spawner/structure/window/reinforced,
+/obj/structure/disposalpipe/segment,
+/turf/open/floor/wood,
+/area/eventmap/inside)
+"bfH" = (
+/obj/structure/disposalpipe/segment,
+/turf/open/floor/spooktime/nonspooktimegrass,
+/area/eventmap/outside)
+"bfI" = (
+/obj/structure/disposalpipe/segment,
+/turf/open/floor/spooktime/cobble/sideW{
+	icon_state = "cobble_side_n"
+	},
+/area/eventmap/outside)
+"bfJ" = (
+/obj/structure/disposalpipe/segment,
+/turf/open/floor/spooktime/cobble,
+/area/eventmap/outside)
+"bfK" = (
+/obj/structure/disposalpipe/segment,
+/turf/open/floor/spooktime/cobble/sideS,
+/area/eventmap/outside)
+"bfL" = (
+/obj/structure/disposalpipe/segment,
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"bfM" = (
+/obj/effect/landmark/start/janitor,
+/obj/structure/cable/yellow{
+	icon_state = "4-8"
+	},
+/obj/structure/disposalpipe/segment{
+	dir = 9
+	},
+/turf/open/floor/spooktime/cobble/roadmid,
+/area/eventmap/outside)
+"bgc" = (
+/obj/item/banner/cargo,
+/turf/open/floor/spooktime/cobble/sideN,
+/area/eventmap/outside)
+"bgu" = (
+/obj/machinery/light/small{
+	brightness = 3;
+	dir = 8
+	},
+/turf/open/floor/spooktime/spooktimegrass,
+/area/eventmap/outside)
+"bgw" = (
+/obj/structure/sign/mining{
+	pixel_x = -32
+	},
+/obj/machinery/light/small{
+	brightness = 3;
+	dir = 8
+	},
+/turf/open/floor/spooktime/cobble/sideN,
+/area/eventmap/outside)
+"bgx" = (
+/obj/machinery/light/small{
+	dir = 1
+	},
+/turf/open/floor/spooktime/cobble/sideN,
+/area/eventmap/outside)
+"bgA" = (
+/obj/effect/turf_decal/caution/stand_clear{
+	dir = 8;
+	pixel_x = -8
+	},
+/obj/docking_port/stationary{
+	dir = 4;
+	dwidth = 3;
+	height = 5;
+	id = "mining_home";
+	name = "mining shuttle bay";
+	roundstart_template = /datum/map_template/shuttle/mining/delta;
+	width = 7
+	},
+/turf/open/floor/plasteel,
+/area/eventmap/outside)
 
 (1,1,1) = {"
-aJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxayNayNayNayNaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaVGaVGaVGaVGaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaVGaVGaVGaVGaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaVGaVGaVGaVGaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacagsaNFaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaVGaVGaVGaVGaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaXEaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaVGaVGaVGaVGaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaFwaFwaFwaFwaFwaFwaFwaFwaFwaFwagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaEDaEDaEDaEDaEDaEDaEDaacaacaVGaVGaVGaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaZSaacaEDaEDabeaAYaEDaEDaEDaJcaEDaEDaEDaEDaEDaEDaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaFwaDCaPOaGJaRmaEXaYbaUraXKaFwagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaQdaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaEDaERaNGaTiaCFazyaEDaacaacaVGaVGaVGaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaEUaEUagsagsagsagsagsagsaacaZSaZSaZSaacaacaEDaBsaKGaMpaECaMpaBoaMpaMpaQPaMpaAYaQPaEDaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaREagsaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaFwaOCaTXaFnaHFaIJaWiaGdaKaaEFagsaLFaKyaacaacaacaacaacaacaacaacaacaacaacaZSayVaZSaZSaacaacayVaacaacagsagsagsaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaLhagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaEDaJwaMpaXQaMpaMpaEDaacaacaVGaVGaVGaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaEUaEUaEUaEUagsagsagsagsagsagsagsagsagsagsaacaacaEDaHjaHjaHjaMpaMpaMpaMpaMpaQPaMpaMpaXOaEDaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacagsagsagsagsagsagsagsaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaFwazeaKiaZbaZmaFKaQWaEFaGzaEFaBLagsagsaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsaZSaZSaNSaacaacagsagsagsaacaacaacaacaacaacaacaacaacagsagsaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaEDaMpaMpaCEaMpaCAaEDaacaacaVGaVGaVGaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaEUaEUaXoaEUaEUagsagsagsagsagsagsagsagsagsagsaacaacaEDaAjaAjaAjaAuaMpaMpaMpaMpaQPaMpaMpaZiaEDaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaFwaYMaGzazpaYhaQzaFMaKiaOCaFwagsaacagsaacaacaacaacaacaacaacaacaacaacagsagsagsaTOagsaZSayVagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaDyaEraYwaMpaMpaGqaEDaacaacaVGaVGaVGaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaEUaEUaEUaEUaEUagsagsagsagsagsagsagsagsagsagsagsaacaacaEDaGIaAjaAjaAuaMpaMpaMpaMpaQPaMpaMpaQPaEDaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsaacagsagsagsaacagsaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaFwaGzaAoaTXaAtaUKaTXaOCaEFaEFagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsaacaacaacaacaacaZSayVaZSaacaGnaacaacaacagsagsagsaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaZgabeaEDaEDaEDaEDaEDaEDaacaVGaVGaVGaVGaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaEUaEUaEUaEUagsagsaSlagsagsagsagsagsagsagsaacaacaacaEDaKJaKJaKJaMpaVWaMpaTJaMpaMpaVWaMpaMpaEDaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsagsaacagsaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaFwaFwaFwaFwaFwaFwaFwaFwaEFaEFagsagsagsagsagsagsayVaZSaZSagsaacaacagsaacagsagsagsagsagsagsagsaTOagsagsagsaacaacaacaacaacaacaacaacaacaacagsagsagsaCOagsagsagsaacaacaacaZSagsaZSagsagsagsagsagsagsagsagsagsaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaLhagsaacaacaacaacaacaacaacaacaacaVGaVGaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaEUagsagsagsagsagsagsagsagsagsagsagsagsagsaacaacaacaEDazyaMpaMpaMpaEDaGoaEDaEDaEDaEDaEDaEDaEDaEDaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacagsagsaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZkaEFaGJagsagsagsagsagsayVaacaacaacaacaacaacaacaacaacagsaTOagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsaacaacaZSagsagsagsagsaacagsagsagsagsagsagsaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaVGaVGaLMaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsagsagsagsagsagsaacaacaacaEDaEDaEDaGoaGoaEDaYyaYyaYyaFUaKgaYyaYyaIuaEDaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaZSagsagsagsagsaacaacaacaacaZSaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsaacaacagsagsaacaacaacaacaacaacaacaacaacaBDagsagsagsagsagsagsagsagsagsagsaacagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaDkagsaZSaacaacaacaacaacaVGaTwaLMaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaEDaMpaMpaEDaQGaYyaYyaNJaEDaYyaTHaYyaEDaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaacagsagsagsagsagsagsayVagsagsagsagsagsaacaacaacaacaacaacaacaacaacaZSaacayVaZSagsaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacagsaTOagsagsagsaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsagsagsagsaacaacagsagsaacagsaacaacaacaacaacaacaacaacaacaacagsagsaZSaZSagsagsagsaZSagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaQKagsaZSaPIaPIaVYaTwaTwaTwaTwazPaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsaZSaZSaZSaacaacaacaacaacaacaEDaMpaMpaEDaEDaEDaEDaEDaEDaEDaEDaEDaEDaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsaacagsagsagsagsagsaacagsagsagsagsaacaacaacaacaacaacagsaZSagsaZSaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacagsagsaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacagsayVagsagsagsaZSagsaZSagsagsagsagsagsaZSahJaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaQKaQKaQKaLWaXSaCsaTwaTwaTwaWdaJUaEzaacaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsaacaacaZSaZSaZSaacaacaacaacaEDaMpaMpaMpaMpaMpaMpaAZaEDaQxaQxaSiaEDaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacagsagsaZSagsagsagsagsaacagsagsagsagsagsaacaacaacagsayVaZSaZSaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacagsagsaacaacaacaacaacagsagsagsagsagsagsaacagsaDjagsagsagsagsagsagsagsagsagsagsaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaZSagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaQKaQKaKQaTwaTwaTwaTwaWdaJUaeYaQKaQKagsaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaZSaZSaacaacaacaEDaAQaMpaMpaMpaMpaMpaKfaEDaMpaMpaWoaEDaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsagsagsagsagsaacaacaacagsagsagsagsagsagsaZSagsaacaacaacaacaacaacaacaacaacaacagsagsaNFaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacagsaZSaZSaacaacagsagsagsaacaacaacagsagsagsagsagsaacaacaacaacagsagsagsagsaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaZSagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaPIaQKaQKaKQaTwaTwaTwaTwazPaQKaQKaQKagsaDkagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaZSaZSaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaZSaacaacaacaacaEDaIQaIQaQYaMpaMpaMpaMpaRwaMpaVWaARaEDaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsaacaacagsagsagsagsagsaNSagsagsagsaNFaacaacaacaacaacaacaFVagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaZSaZSagsagsaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacagsaZSaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaPIaQKaQKaKQaTwaTwaTwaTwazPaQKaTmagsaDkagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSagsaacaacaacaacaacaacaacaacaacaacaacaacagsagsaNFaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaEDaEDaEDaEDaEDaEDaEDaEDaEDaEDaEDaEDaEDaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacagsaacaacagsagsagsaZSayVaZSagsagsagsagsagsaacaacaacagsagsagsaZSaacagsaacaacaacaacaacagsagsagsagsagsagsagsavEagsaWLagsagsaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacagsaZSaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaPIaQKaKQaTwaTwaTwaWdaJUaQKaQKaacaacaacagsagsagsagsagsagsaNFaacaacaacaacaacagsaZSaZSaacaacaacaacaacaacaacagsagsaNFaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsaacagsagsaacaacaacaacagsaZSaZSagsagsagsagsaacaacagsagsagsaZSaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsalvaacaacaacaacaacaacaacaacaacaacaacaZSaZSaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaQKaQKaKQaTwaTwaTwazPaQKaQKagsaacaacaacaacagsagsagsagsagsagsaacaacaacaacaacagsagsagsaacaacaacaacaacaacagsaREaSWagsaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacagsagsagsaacaacaacaacaacaZSayVagsagsagsaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacavFagsagsagsagsaEbagsagsaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaEDaEDaEDaEDaEDaFhabeaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacagsaacaacagsaQKaQKaKQaTwaTwaTwazPaQKaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacagsagsaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacagsaacagsagsagsagsagsaacaacaacaacayVagsagsaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaSlagsagsagsaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaEDaERaNGaTiaFPaMpaEDaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsaacaacaacaacaacaacaZSayVagsagsagsaDkagsaQKaKQaTwaTwaTwaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacagsagsagsaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsaacaacaacaacaacagsagsagsagsagsaacagsagsaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaEDalwalQarlaMpaMpaEDaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsaacaacaacagsayVagsagsagsagsagsagsaacaacaacaLMaTwaTwaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacagsagsagsagsaacaacaacaacaacaacagsagsaacagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaZSagsagsagsaBDagsagsaZSaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaEDaEDaEDaEDaEDaMpaMpaCEaMpaCAaEDaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsaacagsagsagsagsaacaacaacaacaacaacaacaLMaLMaVGaLMaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsaacagsaacagsagsagsaacaacaacaacaacaacagsaacagsagsaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaZSaacaacaacaacagsayVaZSaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaEDaMpaMpaMpaGoaVDaMpaMpaIQaNaaEDaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsaZSaacaacaacaacaacaacaacaacaacaLMaVGaVGaLMaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsaacaacaacaacaacaacaacagsagsagsaacaacaacagsaVSagsaacaacaacagsagsagsaacaacaacaacaacagsagsagsagsagsaacagsaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaacaacaacaacaacaacaZSaZSaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaEDaMpaMpaMpaEDaEDaGoaEDaEDaEDaEDaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaSlagsagsagsagsaacaacaacaacaacaacaacaacaacaVGaVGaVGaULaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaacagsaacaacaacaacagsaZSayVayVagsaZSagsagsagsagsagsagsaacaacaacaacaacagsagsaacaacaacagsagsagsaacaacaacaacaacagsagsaacaacaacaacaacaacagsaacaacaacaacagsagsagsaacaacaacaacaacagsagsagsagsaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaEDaPxaMpaQsaEDaQFaYyaVRaYyaYyaEDaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaVGaVGaVGaLMaacaacagsagsaPAagsaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacabHabHabHabHabHabHabHaacaacagsaGnagsaJGagsagsagsaacaacagsagsagsaZSayVagsagsagsagsagsagsagsagsagsagsaacaacagsagsaacaacaacagsagsagsagsaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacagsaVSagsaacaacaacaacaacagsagsagsagsaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaEDaAZaMpaWoaEDaYyaKcaYyaYyaXUaEDaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaVGaVGaVGaVGaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacabHabRacFacVadzaerabHaacagsagsagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsaacaacaacaacagsagsaZSaZSaZSaZSagsaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacagsagsagsagsaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSagsaacaacaacaacaacaacaacaacaacaEDaEDaEDaEDaEDaCxaYyaOkaYyaYyaEDaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSayVagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaVGaVGaVGaVGaacaacagsagsagsaDzagsagsaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacabHaesabRaetaeraeuabHaacagsagsagsagsagsaSlagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacagsaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaEDaEDaEDaEDaEDaEDaEDaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacayVaZSagsagsagsagsagsaZSaZSaacaacaacaacaacaacaacaacaacaacaVGaVGaVGaVGaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacabHacVaevaexaeyacVaeHagsagsagsaFVagsaEbagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSagsaWUagsagsaEJagsaZSaZSaacaacaacaacaacaacaacaacaacaacaVGaVGaVGaVGaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacabHaiSapLapXauEaBuabHaacaacaREagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaZSagsagsagsagsagsagsaZSaacaacaacaacaacaacaacaacaacaacaacaVGaVGaVGaVGaVGaacaacaacaacagsagsagsagsagsaacaacaacaacaacaacaZSaZSaZSagsagsaacaacaacaacaacaacaacaacagsaZSaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacabHapLaBBacVaCtauEabHaacaacaacaacagsaUuagsaCNagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaAbaFwaFwaFwaFwaAbaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaSRagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaNvaLUaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaHpaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaLUaLUaLUaLUagsagsagsagsaZSaacaacaacaacaacaacaacaacaacaacaacaacaVGaVGaVGaVGaVGaacaacaacaacaacaacagsagsagsaacaacaacagsagsagsaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacabHabHabHabHabHabHabHaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaFwaAbaUKaOwaAbaAbaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaNvaZSaNvaLUaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaaNaaNaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaLUagsagsagsagsaZSayVaacaacaacaacaacaacaacaacaacaacaVGaVGaVGaVGaVGaVGaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSagsaacaacaacaacaacaacaacagsaNFaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaPTaPLaQqaRBaFwaAbaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaNvaNvaNvaLUaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaLUaLUaLUaLUagsagsagsaZSaacaacaacaacaacaacaacaacaacaVGaVGaVGaVGaVGaVGaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaAbaRmaAwaRBaAbaAbaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaLUaLUaLUaLUanvaPIaVYaHkaTwaTwaTwaTwaUyaUyaUyaUyaUyaVGaVGaVGaVGaacaacaacaacaacaacagsagsaSlagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacagsaAbaAbaAbaFwaPTaFwaFwaFwaFwaAbaUKaQqaFwaAbaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaVYaHkaTwaTwaTwaUyaUyaUyaUyaUyaUyaUyaVGaVGaVGaacaacaacaacaacaacagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacagsagsaacaacaacaacaacaacaacaacagsaFwaAbaFwaXvaRBaFwaAbaAbaAbaEFaRBaQqaAbaAbaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaKQaYQaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaVGaVGaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaZSagsaFwaJbaUKaUraKiaEoaFwaAbaAbaVCaFmaPLaAbaAbaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaJKaRLaHkaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaVGaVGaVGaacaacaacaacaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaZkaEFaEFaEFaRSaRBaAbaAbaFwaFwaRBaFwaFwaFwaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaRyaQKaWZaCsaHkaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaVGaVGaacaacaacaacaacaacaacagsagsagsagsaNFaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacagsaacaacaacaacaacaacaacaacaacaacaacaZSaZSagsaRiaEFaPOaEFaZNaQqaEFaEFaFmaRBaFmaRBayWaUraPTaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaQKaWZaCsaOyaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaacaacaacaacaacaacaacagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacagsagsaacaacagsagsagsagsaacaacaacaacaacagsagsaacaKiaUraQqaEFaRSaUKaLGaRBaAbaFwaKaaLZaFmawQaFwaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaWZaXSaIcaGTaCsaOyaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaDzagsagsagsagsaacaacaacaacagsaDzagsagsagsaNFaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaZSagsaacaacaacaacagsagsaacagsagsagsaacagsagsagsaacaacagsagsagsaacaFwaFwaFwaAbaEFaRBaGzaAbaAbaFwaTXaQqaEFaPLaAbaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaWQaOyaRVaRVaRVaTwaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaacaacaacaacaacaacaacaacaacaacaacagsagsagsaNFaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaZSagsagsaacaacaacaacagsagsagsaacaacaacaacagsagsagsagsagsagsaacaacaacaAbaAbaAbaFwaPTaFwaFwaFwaFwaAbaFwaFwaFwaAbaFwaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaWZaCsaHkaTwaTwaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaMBagsagsagsagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacagsagsagsaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaWZaCsaOyaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacagsaMBagsaMBagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsaacaacagsagsaacaacaacaacaacaacagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaWZaCsaOyaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsaNFaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsaDzaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacagsagsaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaWZaCsaOyaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaTwaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaZSagsaacaacaacaacaacaacaacaacagsaMBaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaKQaOyaTwaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaTwaTwaBNazPaQKaacaacaacaacaacaacaacaacaacaacagsagsagsaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaKQaHkaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaTwaBNazPaQKaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSayVaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacagsaNFaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaWZaCsaHkaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaTwaBNazPaQKaacaacaacaacaacaacaacaacaacaacaacaacagsaZSayVayVaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaWZaCsaOyaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaTwaBNazPaQKaQKaQKaacaacaacaacaacaacaacaacaacaacaacagsaZSaZSayVaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacagsagsagsaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaacaacaacaacaacaacaacaacaacaacagsaHgagsagsagsaNFaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaWZaCsaOyaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaBNazPaQKaQKaQKaacaacaacaacaacaacaacaacaacaacaacaacaacaZSayVayVaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaacaacaacaacaacaacaacaacaacagsagsagsaEbagsagsagsaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaWZaCsaOyaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaBNazPaQKaQKaQKaQKaaNaqraqraqraqraqraqraqraqraqraacaacaacaZSayVaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacagsaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaacaacaacaacaacaacaacagsagsagsaFAagsagsagsagsaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaKQaOyaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaBNazPaQKaQKaQKaaNaaNaqraJyaOEaRXacuaOEaheaayaqraacaacaacaZSayVaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaZSaFbaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacagsagsagsaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaacaacaacaacaacaacagsagsagsagsaSlagsagsaWkaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaKQaHkaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaBNazPaQKaQKaQKaaNaaNaHfaCcaIhabJabJabJaOEaJMaqraacaacaacayVaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacagsaLgagsagsaZSagsaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaacaacaacaacaacaNAagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaKQaHkaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaBNazPaQKaQKaaNaaNaaNaHfaXMaRPabJaBTabJaSbaOEaqraacaacaacaacayVayVaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacagsagsaacaacagsagsagsagsaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaZSaacaacagsagsaSRagsaByagsaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaKQaYQaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaBNazPaQKaQKaaNaSNaaNaHfaSFaVyabJabJabJaOEaTuaqraacaacaacaacaZSayVayVaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSagsaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaZSagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaZSaZSagsagsagsagsaSRagsagsaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaJKazUaYQaTwaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaBNazPaQKaQKaaNaaNaaNaqraWqaOEapHaBKaWqaVhagdaqraacaacaacaacaacagsagsaZSagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSagsaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaZSagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaJKazUaYQaTwaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaBNazPaQKaaNaaNaaNaaNaOJaHfawsaqraHfaHfaqraqraqraacaacaaNaacaZSayVagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaZSagsaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaJKazUaYQaTwaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaBNazPaQKaQKaaNaaNaaNaaNaaNaabaaNaaNaaNaacaacaacaacaaNaaNagsagsagsaZSayVagsagsaNSagsaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaJKazUaHkaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaTwaBNazPaQKaQKaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaLUagsaZSagsagsagsaZSayVaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaQKaKQaYQaYaaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaTwaBNazPaQKaQKaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNagsagsagsagsagsagsaZSayVagsaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaJKaFEazUaHkaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaBNazPaQKaQKaQKaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNagsagsagsagsayVagsayVagsaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaQKaKQaYQaYaaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaBNaIpaXSaFiaQKaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaaNagsagsagsagsagsaZSagsaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacagsagsagsagsagsaacaacaacaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaQKaJKaFEazUaYQaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaRVaAJazPaQKaQKaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaZSaZSagsaZSagsagsaZSaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacagsagsagsaacaacaacaacaacaacayVaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaQKaJKazUaHkaTwaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaBNaIpaFiaQKaQKaaNaaNaaNaaNaSNaaNaaNaaNaacaacaacaacagsayVagsagsaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaZSaacaacaacaacaacaacaacaacaacaacaacaaNaaNaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraqraafaafaafaqraqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaKQaYQaTwaTwaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaAJaIpaFiaQKaQKaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaaNaaNaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraqraqraqraqraqraagaOEaOEaaiaajaqraqraqraqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaJKazUaYQaTwaTwaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaAJazPaQKaQKaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaaNaaNaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNabLaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraakaCzaOEaalaqraamaOEaOEaOEaOEaqraOqaanaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaaNaQKaQKaQKaQKaJKazUaYQaTwaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaBNaIpaFiaQKaQKaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaraOEaOEaVJaHJaqraayaRPaOEaOEaOEaaoaanaOgaqraqraaqaaqaaqaqraqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaJKazUaHkaTwaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaAJazPaQKaQKaQKaQKaaNaaNaDBaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacagsaacaacaacaacaacaacaacaacaacaIVaaNaaNaIVaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraqraqraqraqraqraqraqraqraqraqraqraqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraCwaazaOEaOEaqraaAaOEaglaglaaHaqraqraqraqraaIaaiaOEaOEaaJaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaaNaaNaQKaQKaQKaQKaKQaYQaYaaTwaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaBNaIpaXSaXSaFiaQKaQKaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacagsaacaacaacaacaacaacaacaacaacaIVaIVaaNaIVaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraaKakWakWaOEaaLakWaaPaOEaaQabCaaRaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraqraqraqraqraaSaqraqraaTaglaaUaaVaqraanaaWaqraOEaOEaOEaOEaaXaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaQKaJKaFEazUaYQaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaRVaRVaAJazPaQKaQKaQKaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaDzagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaIVaIVaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraaYaaZabaaOEaOEaOEaOEaOEaOEaOEaOEaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraqrabbabcabfabgaOEabhaqraqrabiabjaOJaqrablaanabmaOEaJMaOEaOEaayaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaJKazUaYQaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaBNazPaQKaQKaQKaQKaQKaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaaNaaNaIVaIVaIVaaNaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNabnaOEaOEaOEaOEaOEabpaOEaOEaOEaOEaOEabnaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraFuaOEaOEaJMaOEaOEabqaOEaOEaCvaOEaOEaqraqraqraqraFNaFNaOEaOEaboaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaaNaQKaQKaQKaQKaJKazUaHkaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaBNaIpaXSaXSaQKaQKaQKaQKaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaIVaIVaaNaaNaaNaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraOEaOEaOEaOEaOEaOEaOEaOEaOEaOEaOEaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraqraaSaqrabuabhabhabhaOEaOEaOEaOEaOEaOEagNacPaqrabvabwaOEabxaqraqraaraaraqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaQKaKQaHkaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaRVaRVaAJazPaQKaQKaQKaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaIVaaNaaNaaNaaNaaNaaNaaNaaNaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqramkamkaqraqraqracyaqraqraqramkamkaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraOEaOEaOEauDauDauDaOEabyabzabzabzabzabyaOEaOEaqraOJabAabBaqraqraaQabCaaRaqraqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaKQaYQaTwaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaBNazPaQKaQKaQKaQKaQKaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaZSagsaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNabnabDaOEaqraCeaqrabJabJabEaqraOEabDabnaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaraOEaRPabyabyabyaRPaOEabyabMabNabOabPabyaOEaOEaVhaOEaOEaOEaOEaOEabyabyabyaJMaaraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaaNaQKaQKaQKaQKaJKazUaHkaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaBNaIpaXSaXSaXSaXSaXSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaZSagsaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqrabDaOEaqrabQabSabJabTabUaqraOEabDaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaraOEaOEabyabyabyaOEaOEabyabNabVabNabNabyaIhaOEaOEaOEaCvaOEaOEaOEabyabyabyaOEaaraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaQKaKQaHkaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaRVaRVaRVaRVaRVaRVaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaZSagsaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraOEaOEaqracaaqraoDacbaccaqraOEaOEaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqrasKaOEabyabyabyaOEaVhabyacdacdacdacdabyaOEaOEaqraOJaceacfaqraqracgabWachaqraqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaaNaQKaQKaQKaQKaQKaQKaKQaHkaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaTwaTwaTwaTwaTwaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaZSagsaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraOEaOEaqraqraqraciaqraqraqraOEaOEaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraOEaOEabyabyabyaOEaOEaOEaOEaOEaOEaVJaOEabZacPaqrackaclaOEacmaqraqraaraaraqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaKQaHkaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaTwaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaZSagsaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqrabJabJabJabJacnacoacpabJabJabJabJaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraqraOEabyabyabyaOEaCvaOEaOEaOEaOEaOEaqraqraqraqracqacqaOEaOEaboaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaQKaKQaHkaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaTwaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNacractacvabJacwacxaczacxacwabJactacvacraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaqragaaOEaLCaOEacCacjaqracEacHaOJaqraqrablaanabmaOEaCvaOEaOEaayaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaaNaQKaQKaQKaQKaQKaKQaHkaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaZSagsagsaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqracLacMabJabJabJaFtabJabJabJacLacMaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabaqraqraaracWaaraqraqraqracYadfadhadiaqraanaaWaqraaiaOEaOEaVJaaXaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaQKaKQaYQaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaTwaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaNFaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaZSaZSaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqractacvactacvabJadnabJactacvactacvaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabaabaHIazraKPaKSaqraaAaOEaiiadAaiiaqraqraqraqracuaOEaOEaOEaaJaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaQKaQKaJKazUaHkaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaTwaTwaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacagsaZSagsaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaaNacracLadBadCadEabJaFtabJadGadQadUacMacraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabaabaabawlazBaCIawkaqraayaOEaOEaOEaOEaaoaanaOgaqraqraegaegaegaqraqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaaNaQKaQKaQKaQKazWaQKaQKaKQaHkaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaZSagsaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaaNaqractacvactacvabJaFtabJactacvactacvaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabaabaabaabaatawlazBaCIawkaqraamaOEaIhaOEaaiaqraOqaanaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaQKaQKaQKaKQaHkaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaaNaqracLadBadCadEabJaFtabJadGadQadUacMaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaiTanoanoanoanoaoZaqDayOawnaqraagaOEaOEaOEacuaqraqraqraqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaQKaQKaQKaWZaCsaHkaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaTwaTwaacaacaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaaNacractacvactacvabJaFtabJactacvactacvacraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabazBaabaabaabaabaabaabaabaabaqraqraelaelaelaqraqraabaabaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaaNaQKaQKaQKaQKaWZaXSaCsaOyaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaTwaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaaNaqracLadBadCadEabJaFtabJadGadQadUacMaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabazBaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaWZaCsaOyaRVaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqractacvactacvabJaFtabJactacvactacvaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabazBaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaWZaCsaOyaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaTwaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabaabaaNaaNaabaabaabaaNaaNaaNaaNaaNaaNaaNaaNaaNacracLadBadCadEabJaFtabJadGadQadUacMacraJVaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabazBaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaKQaOyaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaTwaTwaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabaabaabaabaabaabaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaqractacvactacvabJaFtabJactacvactacvaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabazBaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaaNaQKaQKaKQaHkaTwaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabaabaaNaaNaabaabaabaabaabaabaabaabaabaabaabaaNaqracLacMacLacMabJaFtabJacLaemacLacMaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabazBaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaKQaYQaYaaYaaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabaabaabaabaabaabaabaabaabaabaaNaqraqraqraqraqraqraLCaqraqraqraqraqraqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaataRdaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaJKaFEaFEazUaHkaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaacaacaacaacaacaacaacaacaacaacaacaacagsaNFaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaqrabJaFtabJaqraabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaRdaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaQKaKQaYQaYaaTwaTwaTwaTwaUyaTwaUyaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaTwaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaahaahaahaahaabaqraenaFtabJaqraabaJDaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaRdaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaJKaFEazUaYQaYaaYaaYaaTwaTwaTwaTwaUyaTwaUyaUyaUyaUyaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaTwaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaqracyaeoacyaqraabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaRdaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaJKaFEaFEaFEazUaYQaYaaYaaTwaTwaTwaTwaTwaTwaTwaTwaTwaUyaUyaUyaTwaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaTwaTwaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaawaawaawaawaawaawaawaawaawaawaawaawbbvbbvbbvbbvbbvbbvbbvbbvbbvbbtaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaataabaabaabaaxaabaabaabaataabaabaabaabaabaabaabaabaabaabaahaahaahaahaabafiafjazqafCafiaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaRdaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaQKaQKaQKaJKaFEaFEazUaYQaYaaYaaYaaYaaYaaYaaYaaTwaTwaTwaTwaTwaTwaTwaTwaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaUyaTwaTwaTwaTwaWfaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaawaaOabkabtabIaawaCiaCiacsaCiacAaawaaNaaNaaNaaNaaNaaNaaNaaNaaNavSaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabaabaWAaWAaWAaWAaWAaWAaWAaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaataHIazraKSaataabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaRdaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaQKaQKaQKaQKaJKaFEaFEaFEaFEaFEaFEaFEazUaYQaYaaYaaYaaYaaYaaTwaTwaTwaUyaUyaUyaUyaUyaUyaTwaTwaTwaTwaUyaUyaUyaTwaTwaYaaYaaYaaYaaYaaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacagsagsaacaacaacagsaLUaLUacGauUauUauUacRaRnauUauUaddauUauUaRnaaNbbxbbybbxbbxbbxbbybbxaaNavSaaNaaNaaNaqraqraqraqraqraqraqraaNaaNaaNaaNaaNaaNaaNaabaabaabaabaWAaWAaWAaWAaWAaWAaWAaabaabaabaabaabaabaabaabaabaabaabaahaahaahaahaabaNfawlazBawkaabaabaaBaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaRdaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaQKaQKaQKaQKaQKaJKaFEaFEaFEaFEaTxazUaYQaTwaTwaTwaTwaUyaUyaUyaTwaTwaTwaTwaTwaTwaTwaTwaTwaMhaWdaFEaFEaFEaWtaacaacaacaacaacaacaacaacaacayVaZSagsaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaLYaLYaTCagsagsagsaLUbbGaawadtauUauUadxaawauUaeiadtadtauUaawaaNbbxaSoaSoaSoaSoaSobbxaaNaqraqraaraqraqraepaeqaeLaeMaePaqraqraqraqraaraqraqraqraabaabaabaabaWAaWAaWAaWAaWAaWAaWAaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabawlazBawkaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaRdaataabaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabaabaaCaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaQKaQKaQKaQKaQKaQKaQKaQKaQKaQKaJKazUaYQaTwaTwaTwaTwaTwaTwaTwaTwaTwaTwaYaaYaaYaaYaaMhaWdaJUaaaaQKaQKaPIaacaacaacaacaacaacaacaacaacaZSayVaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaZSaKAagsagsaacaacaLUaawaewahpaoOaRnaawarCauUauUauUauUaawaRnbbxaSoaSoaSoaSoaSobbxaaNaqraeQaCvaeRaqrasKaOEaJMaOEaOEacPafUafaafbafeaffacXaqraabaabaabaabaWAaWAaWAaWAaWAaWAaWAaabahXahYahYahYahYahYahYahYahYahYahYahYahYahYahYahYahZajGajJahYahYahYahYahYahYahYahYahYahYahYahYahYahYahYahYahYahYahYahYakdapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaaNaQKaQKaQKaQKaQKaQKaJKazUaYQaYaaYaaYaaYaaYaaYaaYaaYaaMhaWdaFEaFEaFEaFEaJUaQKaQKaQKaQKaQKaPIaacaacaacaacaacaacaacaZSaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaZSagsagsaacaacaacaLUaawarDarOascasEasFatGauUauUautauyavuavRbbxaSoaSoaSoaSoaSobbxaaNaarafgaOEaOEaOEaOEabyabyabyaOEaRPaOEaOEaIhafBafDaOEaaraabaabaabaabaWAaWAaWAaWAaWAaWAaWAaabanqaataabaabaabaabaaDaabaabaaEaabaabaaFaabaabaaGawoayOazAaaEaabaabaaDaabaabaaEaabaabaabaauaabaabaabaabaabaabaabaabaabaRdaabaabaabaabaabaabaabaabaabaabaHIaKSaabaabaabaabaaDaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabapRaaNaaNaaNaaNaaNaYIaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaJKaFEaFEaFEaFEaFEaFEaFEaFEaFEaFEaJUaQKaQKaQKaQKaQKaQKaQKaQKaaNaQKaIVaacaacaacaacaacaacaacaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaZSagsaacaacaacaacaLUaawazwauUauUaDmaawaIEauUauUauUaJHauUaJIbbiaSoaSoaSoaSoaSobbEaaNaarafgaOEagaaOEaOEabyabyabyaOEaOEaOEabyabyabyabyaOEaaraabaabaabaabaWAaWAaWAaWAaWAaWAaWAaabanqaabaqraqraqraqraqragcagcaqragcagcaqragcagcaqraIjagcacyaqragcagcaqragcagcaqragcagcaqraqraqraqraqraabaabaabaabaabaabaRdaabaabaabaabaabaabaabaabaabaabawlawkaaFaabaabaabaqraqraqraqraaeaaeaqraqraqraaeaqraqraaeaqraqraqraaNaaNaabapRaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaQKaQKaQKaQKaQKaQKaQKaQKaQKaQKaQKaQKaQKaQKaQKaQKaQKaaNaQKaQKaaNaaNaaNaacaacaacaZSaZSaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaZSagsaacaacaacaacaLUaawaawaJNaJRaJTaawaKXaMiauUauUaddaQCaRnbbxaSoaSoaSoaSoaSobbxaaNaqragwaOEadeaqrasKaCvaOEaOEaOEagPagPabyagRabyabyagTaqraabaabaabaataWAaWAaWAadWaWAaWAaWAaatanqaabaqragUahnaDIaOEadjaJzaBmaJzaJzahqahBahBadRaQNaHtaQNahCaJzaJzahqahBahBaBmahBahDaOEaDIahFahGaqraabaabaabaabaabaabaRdaabaabaabaabaabaabaabaabaabaabawlapRaKPaKPaKPaaMaqracOadgaqradjadkadladmadoadpadqadsaduadvadwaqraaNaaNaabapRaaNaaNaYIaFcaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaQKaQKaQKaaNaQKaaNaQKaQKaQKaQKaQKaQKaQKaQKaQKaQKaQKaaNaaNaaNaaNaaNaaNaacaacaZSayVaZSayVaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaTCaWvaWvaWvaTCaacaacasMbdLaacaacaacaacaLUaLUaawaMjaMkaMmaawaMraawauUauUaMsauUaJIbbDaSoaSoaSoaSoaSobbEaaNaqraqraaraqraqrahHaeOahIahKahMaqrahNabyabyabyabyahOaqraabaabaabaabaWAaWAaWAaWAaWAaWAaWAaabanqaabahCaiaaibaDIaDIaaeaaeaDIaaeaaeaicaaeaaeaDIaaeaidaaeaDIaaeaaeaicaaeaaeaDIaaeaaeaDIaDIaieaizadRaabaabaabaabaabaabaRdaabaabaabaabaabaabaabaabaabaabawlapRapRapRaCIabdaqradyadFaqraOEadHadIaFFadJadKadLaFFadMadOadPadRaaNaaNaabapRaaNaaNaaNaaNaaNaYIaaNaFcaaNaWsaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQKaQKaaNaaNaaNaaNaaNaaNaaNaaNaacaZSaZSaZSaZSaNSayVaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaXnbcnbcnbcnbcoagsagsagsagsaacaacaacaacaacaLUaawaMtaMwaMxaMAaCiaawauUauUaMCaMDaMFbbxaSoaSoaSoaSoaSobbxaaNavSaaNaaNaaNaqraqraqraqraqraqraqraiBabyabyagRabyahOaaraabaabaabaabaWAaWAaWAaWAaWAaWAaWAaabanqaabaqraglaiIaBmaiJaiKaiXaiYaiXaiXaiXaiXaiXaiZaiXajaajHaiZajHajHajHajHajHaiYajHajIajKaBmajLakbaqraabaabaNwaNwaabaabaRdaabaabaabaabaabaabaabaabaabaabawoayOabrabrayOawnaqradSadTadIaFFadVadladXadYadZaeaaebaecaedaeeaqraaNaaNaabapRaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaZSaZSaZSaNSayVaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaXnbcnbcnbcnbcpagsagsagsagsaacaacaacaacaacaLUaawaMHauUaMJauUauUaMLauUauUaMOaawaRnbbxaSoaSoaSoaSoaSobbxaaNavSaaNaaNaaNaaNabFabGaOrabGaDNaqrakcabyabyabyabyahOaaraabaabaabaabaWAaWAaWAaWAaWAaWAaWAaabanqaaDaqraqraqrakeakfakoakzakzakzakpakzakzakzakzakzakoakzakzakzakzakzakzakqakzakzakoakrakeaqraqraqrabKabKabKabKabKabKaRdabKabKabKabKabKabKaqraqraaraqraqraqraqraqraaraqraqraqraqraqraefaehaqraqraqraqraqraqraqraqraqraqraaNaaNaabapRaaNaaNaaNaYIaYIaaNaaNaaNaaNaaNaaNaaNaFcaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaZSaYGaNSayVaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaXnbcnbcnbcnbcoagsagsagsagsaacaacaacaacaacaLUaawaMPauUaMQauUaMTaawaMUaMUaMOaawaaNbbxaSoaSoaSoaSoaSobbxaaNavSaaNaaNaaNaaNawlaCIaCIaCIawkaqrakTabyabyabyabyahOaqraabaabaabaabaWAaWAaWAaWAaWAaWAaWAaabanqaabaqraRXakUaDIahCakVadRaDIakZaOEaOEalaalbalcaldalealfaonaOEalgalkalxalyaDIahCakVadRaDIaccalAaqraabaabaabaabaabaabaRdaabaabaabaabaabaabaqraejaekaezaeAaqraeBaeCaeFaeGaeIaeIaeJaqraeKaLCaqraeOaqvaeSaeTaeUaeVafcafdaqraaNaaNaabapRaaNaaNaaNaaNaYIaaNaYIaaNaaNaaNaaNaaNaaNaaNaaNaWsaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaZSayVaZSagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaTCbcxbcxbcxaTCaacalvbcnbcnaacaacaacaacaacaLUaawaMVauUaMJauUaMYaawaMDaMZaNhaawbgubbxaSoaSoaSoaSoaSobbxaaNavSaaNaaNaaNaaNawlaCIapRapRawkaqraqraqralPaQQalPaqraqraabaabaabaabaWAaWAaWAaWAaWAaWAaWAaabanqaabalRaXMalSalUaQNaHtaQNaDIalValWaOEaOEalXaOoamaamJanianraOEanSaOEaOEaOEaDIaQNaHtaQNanTabJanVaaraabaabaabaabaabaabaRdaabaabaabaabaabaabaaraOEaOEaOEaOEaOEaOEaVJaOEaOEaOEafhafkaqraeKaflaqrafmaOEaOEaOEafnaOEaOEafoaqraaNaaNaabapRaaNaaNaWsaaNaYIaaNaaNaaNaaNaaNaaNaaNaYIaaNaaNaaNaaNaaNaaNavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacawdaNjaNnafwafwawdaacaRvaLUaawaawaNoaNpaNoaawaawaawaawaawaawaaNbbxbbIbbxbbxbbxbbIbbxaaNavSaWsaaNaaNaaNawlaCIapRapRawkaabawhaauawlaRdawkaabaabaabaabaabaabaWAaWAaWAaNCaWAaWAaWAaabanqajlaqraoUaoVaDIahCaoWadRaDIapcapealOaOEabZaHTapqaEcaOEaHTaOEanSaOEaprapFaDIahCaoWadRaDIapGabEaqraabaabaabaabaabaabaRdaabaabaabaabaabaabaqrafpafzaOEaOEafAaOEaOEafEagaaOEaeOagbaqraOEageaqragfanJaggaghaOEadNagpagqaqraaNaaNaabapRaaNaaNaaNaaNaaNaaNaaNaaNaaNaWsaaNaaNaaNaaNaaNaaNaaNaaNaaNavqacIacJacKaqraqraqraqraqraqrafuaqraqraqrafvafvafvafwafwafwafvaqrafvafwafvafwafvafxafyaqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacafwaNraNsaNyaNBafwafwafwbgwbgcaqkaCIaZoaCIaqkbgcaKPbgxayQbbJbbvbbvbbvbbvbbvbbvbbvbbvbbvbbKaaNaaNaaNaTQawlaCIapRapRawkaabaabaatawlaRdawkaauaabaabaabaabaataabaabaabaabaabaabaabaatanqacQaqraqrapWaqraQNaHtapZaDIaDIaDIaDIaDIaDIaqaaDIaDIaOEaHTabZanSaOEaqbaqeaDIaqfaHtaQNaqraqraqraqracTaabaabaabaabaataRdaataabaabaabaabacUaqraqraguagvaqraqraqraqraqragxaqraqraqraqraOEaLCaqraqraqraqraqraqraqragyaqraqraqraqraabapRaaNaaNaaNaaNaaNaFcaaNaYIaaNaaNaaNaaNaaNaaNaYIaaNaaNaaNaaNavqacZaabadaaqrafFafGaiiafHaiiaiiafIafJaqrafMafNaglafOafPafQafRaqrafSafRafOafPafvaglaglaqrafTafUacSacPafVafWafVafUacSacPafTaqrafXaOEampaOEafXaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaJxaacaacaacaacaacaacaacaacafwaNrarOaNDaNDaNDaNMaNNaCIaCIaCIaCIbciaCIaCIaCIaCIaCIaCIaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaCIapRapRapRapRaKPaKPaKPapRazBaCIaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaZoaKSacyaOEaOEaQNaqtaqEaqIaDIalGarbareaqrakzarfakzaDIaDIarAaDIaDIaDIaDIaDIaDIaqIaqEarBaQNaOEaOEaIjaHIaKPaKPaKPaKPaKPazraKPaKPaKPaKPaKPaKSacyahgahgahgaOEaOEagBagOaOEaOEaqvaOEaOEahjaeKahkaOEahgahgahgagdaqrakgaOEahlahmahoaqraabapRaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaYIaYIaaNaaNaaNaaNaabavqaauaaFadDaqraiiaiiaiiagiaiiagjaiiaOEaqraqraqragkaglaglaglaglaqraglaglaglaglafvaglagkaqrafWafVagmafVafWagnafWafVafWafVagoaqraOEaglaglaglaOEaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaJx
-aJxaJxaqraqraqraqraqraqraqraacafwaNPaNQaNQaNUaNWaNXaOabckbckbckbckbcqbckbckbckbckaOAbckbckbckbckbckbckbckbckbckbckbckbckbckbckbckbckbckaTYaPZaPZaPZanoanoanoanoanoaPZanoanoanoanoanoanoanoanoanoanoanoanoanoanobaaaRgahraFFaFFaNEarFarGaqIarKakzasaasdashasuasvaswaszasGaHTasHaonaDIasKasIasJaqIauparFaNEaFFaFFahraRkanoanoanoanoanoaTcanoanoanoanoanoaRgahrahsahxahsaFFaFFaFFaFFahPahPaFFahQahRbeIaFFahVaFFahsahsahWaifaqraOEaigaihahgaiqaqraabapRaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaFcaYIaYIaaNaaNaaNaaNaabavqadaaabacZaqragjagCagDagEagFagGaiiaOEaqragHafNaglaglagIaglagJagKagLagkagIaglaglaglaglaqraqraqraqraqraqragMaqraqraqraqraqraqraOEaglaglaglaOEaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaJx
-aJxaJxaqraOcaOdaqraOeaOgaqraacafwaOhaOiaOmaOnaNsafwafwaacaacbbLbbLbbLbbLbbLbbMaCIbciapRayOayOayOayOayOayOayOayOayOayOayOayOayOayOayOaCIaRdapRayOayOayOayOayOayOayOayOayOayOayOayOayOayOayOayOayOapRaCIaCIayOayOayOawnacyaOEaOEaQNauwaqEaqIaDIauAauHavmaqraHTaonavoaDIalIavvaOEaonaDIavPavQaDIaqIaqEawwaQNaOEaOEacyawoayOayOayOayOayOayOayOayOayOayOayOawnacyahgaiAahgaOEaiCabZaOEaqvaOEaOEabZaOEaLCaOEaOEaqvahgahgaiAaiDaqraOEahgahgahgaOEaqraauapRaaNaaNaaNaWsaaNaaNaaNaaNazvaaNaaNaaNaaNaaNaaNaWsaaNaaNaabavqaaFaauaaFalBaiiagCagWagXagYagZaiiaOEaqraqraqraglagkaglaglahaahbagLaglaglagkaglaqraqrahcahdaOEaOEaheahfahgahfaOEaOEaOEahhaqraOEahiaglaglaOEaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaJx
-aJxaJxaqraOoaOpaqraOqaOsaqraacawdafwafwafwaOtaNnawdaacaacaacaaNaaNaaNaaNaaNavSawlanqawkaQlaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQlawlaRdawkaataabaabaabaabaabaabaabaabaabaabaabaabaabaabaabaabbcJapRawkaabaabaabacQaqraqraqraqraqIaqEawBakeawRaqraqraqrawSalXaOEaDIaOEaHTaqIawWaDIaDIaDIakeaxpaqEaqIaqraqraqraqraeDapRaataabaabaabaCIaabaaFaabaatapRaeEaqraqraiEaiFaiGaqraqraiHaiLaqraqraqraqraiMaqraqraqraOEaOEaLCaqraqraOEahgahgaiUaiVaqraabapRaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaeNadDaabaaFahtaiiagCahuahvahwagGaiiarpaqragHafNaglaglagkaglaglaqraglaglaglaglaglafNahyaqrahzaOEaglaglaglaglaglaglaglaOEahAaqrafXaOEaOEaOEafXaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaJx
-aJxaJxaqraOuaqraqraqraOvaqraacaacaacaacbdIbdhbcnaacaacaacaacbbxbbxbbybbxbbxavSawlanqawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlaRdawkaaNaaNaaNaaNaaNaaNaaNaaNaqraqraaraaraqraaraaraqraqrawlapRawkaabaabaabaabaqramzaOEaaraqIaqEaqIaDIaNuaxqaqraxwaxBaxCaxNaDIaxPaxRayaaybayUayXazzalRaqIaqEaqIaqraccalAaqraeWapRaabaeXaLUaLUaCIaLUaLUaeXaabapRaeZaqraiWajbajcajdaiWaqrajkajmajnajoaqrajpajrajCajDaqrajEaeKaLCaqrajFaOEaOEaOEajMajUaaraabapRaaNaaNaRvaZMaRvaRvaaNaaNaVtaADaHDaaNaWsaaNaaNaabaabaabaabacNaabaeWaauahtaiiaiiahSahSahSaiiaiiaOEaqraqraqraqraqraqraqracyaqracyaqraqraqraqraqraqraqrahTaglabyabyaglaglaglahUabyaglahTaqraqraBYaBYaBYaqraqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaJx
-aJxaJxaqraOxaOBaOGalOaOEaOJbdNaacbdObdPbdQbdhagsagsaacaacbdRbbxaSoaSoaSobbxavSawlanqawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlaRdawkaaNaaNaaNaaNaaNaaNaaNaaNaqrazOafUacSafUacSacPaezaarawlapRawkaabaabaabaabaarazXazYaBUarFaCpaqIaDIaCLaDtaqraDIaDMaDIaDMaDIaKdaDIaQOaDIaDIaDOaqIaDUaqIaqEaqIaDYabJanVaaraabapRaabaeXaLUaeXaCIaeXaLUaeXaabapRaabaarajVaLCajWaOEajVaqrajkajmaNuajoaqrajXajYaNuajZaqraeKaeKaLCaqrakaaOEahgahgahgaknaqraeWapRaaNaaNaaNaGraaNaADazEaaNaaNaaNaaNaVtaaNaaNaaNafraabaabaabaeNaauacZaabagVaiiaijaiiaiiaiiaiiaiiaqvaikailaimainaioaipaqrajOairajOaqraisaitaiuaivaiwaqrahTaglaglaglaglaglaglaglaglaglahTaqraixaiyaiyaiyaixaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaJx
-aJxaJxaqraOKaOEaOMaOEaONaqraMnagsagsagsagsbdhagsagsagsagsbdsbbxaSoaSoaSobbxavSawlanqawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlaRdawkaqraaraaraaraqraqraqraqraqraglaglaglaglaglaglaglaqrazuapRawkaabaabaabaabaqrakSaEcaqraqIaqEaqIaDIaNuaNuaEqaDIaOEaOEaOEaOEaOEaEBaEKaDIaFCaGbaGcaDIaqIaqEaqIaqraGfabEaqraabapRaaFaeXaLUaeXaCIaeXaLUaeXaabapRaabaqraksaLCaOEaktakuaqrajkajmaNuajoaqrakvaNuakXalhaqraeKaOEaTjadIaliaOEahgahgahgaljaqraabapRaaNaaNazKaaNaaNazKaYIazKaaNaaNaGraaNaaNaaNaGraabaabaabafsavqaabaabaeWahtadNaiNaOEaOEaOEaOEaiOaOEaOEaOEaOEanJaOEaOEacyajOajOajOacyaOEaivaivaivaiPaqrajhaglahUaglaglaiQaglaglahUaglahTaqragSaiRaOEaiRaOEaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaJx
-aJxaJxaqraOPaOSaOTaOUaBmaOVbdybdybdybdybdzbdAagsaZSagsagsbdmbgAaSoaSoaSobbEavSawlanqawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlaRdawkaqraGiaOEaGiaGiaGiaGiaGiaGiaglaglaglaglaglaglaglacyawlapRawkaabaabaabaabaqraqraqraqraxpaqEaqIakeaDIaDIaDIaDIaOEaqraaraaraaraqraOEaDIaDIaDIaDIakeaqIaqEawBaOJaqraqraqragzapRapRapRapRapRapRapRapRapRapRapRagAaqralzalTalYaqraqraqrajkalZaNuajoaqrambamcamdamxaqraeKaOEaLCaqramyaeKahgahgamBamCaqraabapRaaNaaNaaNaaNaHDaVtaYIazKaYIaaNaaNaaNaaNaVtaaNaaNaaNaGraaNacNaauaaFadDaqraOEaOEaqvagtaOEaOEajeaOEaqvaOEaOEaOEafZaqvacyajOajOajOaqrajfajgaivaivajjaqrahTaglaglabyabyaglabyabyaglaglahTaqraOEajiaRCaOEaOEaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaJx
-aJxaJxaqraqraqraqraqraqraqraacaacaTCaMnbdhagsaZSaZSaacaacaacbbxaSoaSoaSobbxavSawlanqawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlaRdawkaaraGjaOEaOEaOEaOEaOEaOEaOEaglaglaglaglaglaglaglacyawlapRawkaabaabaabaabaqraePaGEaqraqIaqEaqIaqIaqIaqIaqIaqIaHiaHmaqIaqIaqIaHmaHsaqIaqIaqIaqIaqIaqIaqEaqIaqraccalAaqraabapRaabaeXaLUaeXaCIaeXaLUaeXaaDapRaaFaqrajVaLCaOEamEaNuaNuajkajmaNuajoaqraqraqraqraqraqraOEaOEaLCaqramGaeKaqvaOEamHamIaaraabapRaaNaaNaaNazKazKaaNaaNaaNaaNaHDaaNaaNaaNaaNaaNaaNaaNaADaaNacNadaaabacZaqrajqabWabXaqvajsajuajvajwafZaOEaOEaOEaOEajxajyajOajOajOaqraqraqrajzaqraqraqrajAaOEaglaglaglaglaglaglaglaOEajBaqraqvahfaOEahfabYaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaJx
-aJxaJxaacaacaacaacaacaacaacaacaacaacagsbdhagsaacaacaacaacaacbbxaSoaSoaSobbxavSawlanqawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlaRdawkaaraGiaOEaGiaGiaGiaGiaGiaGiaHuaOEaOEaHHaOEaIhaOEacyawlapRawkaabaaBaabaabaaraHRazYaHYarFaIiarFarFaIsarFarFarFarFarFarFarFarFarFarFarFarFarFaIwarFarFaIKaqIaIXabJanVaaraabapRaauaeXaLUaeXaCIaeXaLUaeXaabapRaabaaramKaLCamOaqramQaNuajkajmaNuangaqranhanhanjankaqraOEaOEageaqraqraeKahgahgamBanlaqraabapRaaNaaNazKaaNaaNaaNazKaaNazKaaNaaNaaNaaNaWsaaNaaNaaNaaNaaNacNaaFaauaaFaqraqraqraqraqrajyajyaqraqraqrajyajyajyaqraqraqrajNajOajOaqrajPajQabyabyajRaqraOEaOEaOEajSagSaOEaOEajTaOEaOEaOEaqraixaOEaOEaOEaixaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacagsbdhagsaacaacaacaacaacbbxbbxbbIbbxbbxavSawlanqawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlaRdawkaaraGiaOEaOEaOEaOEaOEaOEaVhaOEaOEaOEaOEaOEaOEaOEaqrazuapRawkaabaabaabaabaqraOEaJgaqraqIaqIaqIaqIaqEaJhaqIaqIaqIaqIaqIaqIaqIaqIaqIaqIaJiaJhaqEaqIaqIaqIaJoaqraJEabEaqraaFapRaabaeXahEaLUaCIaLUahEaeXaabapRaabaqraiWanmannaqranpaNuajkajmansantaqranuanCanDanEaqraOEaOEageafUaqraOEahgahgahgaOEaqraabapRaaNaaNaaNaWsaVtaVtaaNaaNaaNaFcaYIaaNaaNaaNaaNaaNaaNaaNaaNacNadDaabaaFajyakgakhaOEakiaOEaOEakjajeakjaOEakkaOEaqvaOEaqrajOajOajOacyaOEabyabyabyaklaqraqraqraqraqracyacyacyaqraqraqraqraqraqrajyakmajyaqraqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacagsbdhaacaacaacaacaacaacaacaacaacbbvbbvbbKawlanqawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlaRdawkaqraGiaOEaGiaGiaGiaGiaGiaGiaOEaJLaJWaJXaJXaLdaJXaarawlapRawkaabaqraqraqraqraOEaqraqraqraqraqracyanFaqraqraqraqraqraqraqraqraqraqraqraqraqranGacyaqraqraqraqraqraqraqraqracyaqranPanPanPanQanPanPanPaqranRaqraqraqranUaiFaqranWaNuajkanXaqraqraqranZaNuanuanEaqrajEaOEaLCacSaqraoaahgamBaobagpaqraauapRaaNaaNaaNaaNaGraaNaaNaYIaaNaHDaaNaaNaGraaNaaNaaNaGraaNaaNavqaabaeWaauajyakwakxakyakzakzakBakCakDakDakDakEakDakzaOEacyajOajOajOaqrakFakGakHabyakIaqrakJakKacXaqraOEaOEagSakLakMakNakOakPakQaOEaOEaOEakRaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacagsaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacagsagsbdhbeaaFdaGGaGGaGGaGGaGGaFdaacaaNaaNaaNawlanqawkaQlaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlaRdawkaqraaraaraaraqraqraqraqraqraaraaraqraqraaraaraqraqrawlapRawkaaFaqraocaOEabJabJaodaoeaOEaqrakgaOEaLCagNaOEaCvaOEagNaOEaOEaOEaOEaVhagNaOEaOEaLCaOEaOEagNaOEagBakwaofakYaOEaOEaqraNuaomaNuaNuaNuaomaNuaqraooaopaopaopaoraopaopaopaopaosaotaopaouaovaopaopaopaopaowahgahgaiAaoxaqraoyaOEaozaoAaoBaqraabapRaaNaaNaADaaNaHDaaNaaNaaNaYIaaNaaNaaNaaNaaNaHDaaNaaNaADaaNavqaauacZaabaqraOEallakDakzalmakDakDakDalnakDaloakDakzaOEacyajOalpajOaqraqraqralqaqraqraqralradralsaqrakwabyaeeabyabyaltabyabyaluabyabyabyakYaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacagsaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacagsalvbdCbdyaPNaPQaPQaPQaPQaPQaGGaacaaNaaNaaNawlanqapRaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPapRaRdapRaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPapRapRawkaabaaraoCaOEaoDaoEaoPaFFaFFadIaFFaFFaoQaOEaOEaoRaoRaoRaoRaoRaoRaoRaoRaoRaoRaoRaLCaOEaOEaOEazGaOEaOEaOEaOEaOEaOEaaraNuaoSaNuaNuaNuaoSaNuaaraoTauUauUauUapaapbapbapbapbapbapdapbapbapbapbapsapbapbaptahsahsapvaqraqraqraqraqraqraqraqraqracyaqraabaabaabaADaaNaaNaaNaaNaGraaNaYIaaNaHDaaNaGraaNaaNaaNavqaabaabaeWaskaqvakzakzakzalCakzalDakzalDalEalDakzakzaOEaqrajOajOajOacyaOEalFakzalGalHaqralIalJalKaqrakwabyabyabyabyabyabyabyabyabyaeeabyalMaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacagsagsaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacagsaTCaacaacaGGaPQaPQaPQaPQaPQaGGaacaaNaaNaaNawlbbZahYahYaUPahYahYahYahYahYahYahYahYahYahYahYahYahYahYaUQanoadbadcapRapRajtapRajtapRajtapRajtapRajtapRajtapRapRapRapRawkaabaqraOEaOEapwapxapxaOEaOEaqrabJabJaLCaOEaOEaoRapzapzapzapzapzapzapzapzapzaoRaLCaOEaOEaOEakWaOEaOEakjaOEaOEakjaqrapAaoSaNuapBaNuaoSapEaqrapIapJapKapJapJapMapJapJapJapJapVapJapMapJapJapVapJapJapYahgahgaiAaqraqdaqgaqsaqFaqrakgaOEaJMaOEaqraabaabaabaaNaaNaaNaFcaHDaaNaADaaNaYIaaNaaNaaNaaNaHDaaNavqadaaabacZaskaOEakzameamfakzamgamhakzamiamjakzameameaqvaqracBamkacDaqragSakzamoakzaapaqralOafZamqaqramrabyamsabyamtabyabyamuabyabyamvabyamwaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacagsaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacagsagsaacaacaacaGGaPQaPQaPQaPQaPRaGGaacaacaaNaaNawoayOayOapRanqayOayOayOayOayOayOayOayOayOayOayOayOayOayOayOayOapRaRdapRayOayOayOayOayOayOayOayOayOayOayOayOayOayOapRapRawkacQaqraqGaOEaLCaOEaOEaOEamAaqraqHabJaLCaOEaOEaoRapzapzapzapzapzapzapzapzapzaoRaLCaOEaOEaOEamFaOEakwaqJakYaOEaqKaqrakvaoSaNuaqLaNuaoSaqMaqraqraqraqPaqraqraqraqraqraqraqraqQaqraqraqraaraqTaaraqraqraOEaOEaLCaqraOEaLCaOEaOEaqraRPaOEaOEaOEaaraabaabaabaYIaYIaaNaaNaYIaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaeNaaFaauaaFaskadNakzameamfakzamPamhakzamiamRamSameameaOEaqracBamkacDaqramTamUamVakzamWaqramXaOEamYaqramZabyabyabyaeeabyabyabyabyabyabyabyakYaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacagsagsaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacagsagsaacaacaacaGGaPQaPQaPQaPQaPQaGGaacaacaaNaaNaaNaaNaaNawlaRFaQlaaNaaNaaNapRapRaaNaaNaaNaaNaaNaaNaaNaaNaaNaatawlaRdawkakAakAakAakAakAakAakAakAakAakAakAakAakAakAawlapRawkaabaqralOaOEaqUaqVamzaOEamAaqrarcabJaLCaOEaOEaoRapzapzapzapzapzapzapzapzapzaoRaLCaOEaOEaOEaOEaOEaOEamFaOEaOEamFaqraNuaNuaNuardaNuaNuaNuaqrargarkarmauUarwaqrarxarxaryarzarEarHaqramHaOEaLCaonarLaaraOEaOEaTjarMaFFbaXaOEarNaqraOEaOEaOEaOEaqraabaVtaaNaYIaaNaVtaaNaaNaYIaaNaHDaVtaaNaaNaaNaYIaaNaaNavqadDaabaaFaskanJaqvacjamAanJanKakSaOEamzalNaOEacjanLajeaqracBamkacDaqraqraqraqraqraqraqraqracyaqraqrakwabyabyanMabyabyanNabyabyanOabyabyakYaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacagsagsaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacagsagsaacaacaacaGGaPQaPQaPQaPQaPQaGGaacaacaacaaNaaNaaNaaNawlaRFaaNaqraqranPacyacyanPaqraqraqraqraqraqraqraqraabawlaRdawkakAakAakAakAakAakAakAakAakAakAakAakAakAakAawlapRawkaabaaraOEaOEaLCaOEaOEaOEaOEaqrasbabJaLCaOEaOEaoRapzapzapzapzapzapzapzapzapzaoRaLCaOEakjaOEaOEaOEaOEaOEaOEaseaOEaaraNuaoSaNuaNuaNuaoSaNuarmarmasfasfasfasgaqrauUasiasjasjasxasyaqramHaOEasAaOEaOEaaraOEaOEaLCaqrasBaOEaOEasCaqrasKaVJaOEasLaqraabaaNaaNaWsaaNaaNaaNaHDaVtaaNaaNaWsaaNaCUaaNaaNaaNaaNavqaabaeWaauajyaogaqraqraqraqraqraqraqraqraqraqraqraqraqraqracBamkacDaqraqraqraolaonaonaOEaqraqjaoqaqrakwabyabyabyabyabyabyaeeabyabyabyabyalMaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacagsagsaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaLYaacaacaacaacaFdaGGaGGaGGaGGaGGaFdaacaacaacaacaaNaaNaaNawlaRFaaNaqraQnaOEaOEaOEabJabJabJaqraBlaOEaOEaBlanPaabawlaRdawkakAakAakAakAakAakAakAakAakAakAakAakAakAakAawlapRawkaabaqrakSakSaLCaOEasNasOasPaqratlabJaLCaOEaOEaoRapzapzapzapzatmapzapzapzapzaoRatnaFFatoatpatqaOEakwatrakYaOEaOEaqraNuaoSaNuatsardaoSaNuaiFauUasfasfasfattaqratuatvatxasjatyatHaqraonaOEatJatKaiiaaraOEaOEaLCaqrasBaOEaOEasCaqraOEaOEaOEaOEaaraabaVtaaNazKaGraaNaaNaGgaaNaaNaaNaADalLaaNaaNaaNaaNaaNacNaauacZaabaqraoFaqraoGaOEaOEaOEaOEaOEaOEaOEaoHaoHaoHaoHaoIajOajOajOaoIajxaqraoJaOEaoKagSaqraqjaqjaqrakwabyabyaoLabyabyabyabyaoMabyaoNabyakYaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacagsagsaZSaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNawlaRFaaNaqraQoaOEaOEaOEaQpabJabJaqraOXaOEaOEaBlanPaaFawlaRdawkakAakAakAakAakAakAakAakAakAakAakAakAakAakAawlapRawkacQaqraqraqraLCaqvaqraqraqraqraqHabJaLCaOEaOEaoRapzapzapzapzapzapzapzapzapzaoRaLCaOEaqraqratLaqraaraaraaraqratMaqrakvaoSaNuatNaNuaoSaqMaqratOauUatParmauUaqratQatRatSauoauUauqaqraonaOEaurausaiiaqrasKaOEaLCaqrasBaOEaOEasCaqraOEaOEaCvaOEaqraabaaNaADazEaaNamlazKaWsaaNaPmafsafKaabaabafraabaabaabavqaabaabamnaqrapfaqraoIaoIapiapgapiapiapjaoIapkaOEaqvabYaOEajOajOajOadraOEaqraplapmaOEaOEacyaqjaqjaqrapnaeeabyabyabyabyapoabyabyabyabyaeeappaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacagsaZSaZSaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNawlaRFaaNaqraQraOEaOEaOEaQtaQuabJaqraBlaOEaOEaBlanPaabawlaRdawkakAakAakAakAakAakAakAakAakAakAakAakAakAakAawlapRawkaaDaqrauuauvauxauzaVhaOEauCaqrarcabJaLCaOEaOEaoRapzapzapzapzapzapzapzapzapzaoRaLCauDauFauGauIauJauKauLauWavlapyaqraNuaNuardaNuaNuaNuavnaqraqravraqravsaqraqraqraqraqravtaaraqraqraqraqraqraqraqraqracyanPanFaqraqraqraqraqraqraOEaOEaOEaOEaqramLaRvamMaaNaRvaaNaaNazKaaNazKaabaabaGDaftaabaabaabammavqamNamNammajyaqraqraqvaOEaOEaOEaOEaOEaOEaOEaOEaOEaOEaOEaOEajOajOajOaOEaoIaqraqraqraqraqraqraqjaqjaqrakwabyabyapCabyabyabyabyabyabyapDabyakYaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaZSaZSaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNawlaRFaaNaqraQwaOEaOEaOEaQyabJabJaqraOEaOEaEtaFFadIanoaRkasDawkakAakAakAakAakAakAakAakAakAakAakAakAakAakAawlapRawkaabaaraOEamHavwaonaiqaOEacjaqrasbabJaLCaOEaOEaoRapzapzapzapzapzapzapzapzapzaoRaLCauDavxapyauIapyapyapyavyavOawqawraNuaoSaNuawuaNuaoSaNuavraOEaOEaqraFtabJabJaBtaaragNaOEaOEaOEaOEaOEaOEagNaOEaOEaarabJabJaFtawvabJabJawxabJacyabJabJabJabJacyaHIaKPaKPaRraKPaKPaRraRranbancaTGaabaabaabafsaabaabaabandaRraneanfapNahgapOapPavpahgahgahgahgahgahgahgapQahgahgahgahgahgahgaqjaqjaqjaqjaqjaqjaqjaqjapSaqjacyaOEapTabyabyabyabyapUabyabyabyabyabyaOEaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaZSagsaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNawlaRFaaNaqraqraqraPSaPSaqraqraqraqraOEaqraqraqraqrawtawlapRawkakAakAakAakAakAakAakAakAakAakAakAakAakAakAawlapRawkaabaqrasKamHawyaonaiqaOEawzaqratlabJaLCaOEaOEaoRapzapzapzapzapzapzapzapzapzaoRaLCawAawCapyauIapyawTauKawUawVapyaqrawXaoSaNuawYaNuaoSapEaqraxraOEaqraVebeJbeJbeJaJpaFFaXjaFFaFFaFFaFFaFFaFFaFFaFFaJpbeJbeJaxsbeJbeJbeJbeJbeJahrbeJaxtabJabJanPawlanaapRapRapRanaanaanwanxanbanaaaNagraftaabaabaabaabanyanzanAanBapNahgapOahgazSahgahgahgahgahgahgahgahgahgahgahgahgaqcahgaqjaqjaqjaqjapSaqjapSaqjaqjaqjacyaOEaOEaOEaOEaOEaOEaOEaOEaOEaOEaOEaOEaOEaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaZSagsagsaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNawlaRFaaNaqraOEaOEaOEaOEaOEaOEaqraOYaNuaNuaNuaMaaqraabawlapRapRaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPaKPapRapRawkaabaqraOEaxuaxvaxxagaaOEaxyaqraqHabJaLCaOEaOEaoRaoRaoRaoRaoRaoRaoRaoRaoRaoRaoRaLCauDauFavyauIaxzawTauKaxAaxMapyaxOaNuaoSaNuaNuaNuaoSaNuaqraxQaFFaxSbefabJabJabJaaragQaHTagQagQaaraOEaOEaOEaOEaOEaaraxTabJabJabJaxUabJabJabJacyabJaFtabJaxVacyawoayOayOaPrayOayOaPrayOaPraPranaanaaMManaanHaabaabaabaJmanIanIaInaqhahgapOahgavpahgahgahgahgahgahgahgahgaqiahgahgahgahgahgaqjaqjaqjaqjaqjaqjaqjaqjapSaqjaqraqraOEaqlaqraqmaqnaqoaqpaqqaqraqracyacyaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacagsagsagsaacaacaacaacaacaJx
-aJxaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsaaNaaNawlaRFaaNaqraOEaOEakjaOEaOEaOEaqraNuaNuaNuaNuaOZaqraabawlapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRapRawkacQaqraqraqraxWaqraqraqraqraqraqraqralTaFFaFFaFFaFFaFFaFFaFFaFFaFFaFFaFFaFFaFFbaXauDauFapyaxXaxYaxYaxZaycapyaydatMaNuaNuaNuaNuaNuaNuaNuavraLCayYaqraFtabJabJaqraqraqNaztazxazHaqraqraqraquaqraqraqraqraqraNuaqraqraqraNuaqraqraqraLCaOEaOEaqraWyaaDafqaaDaaDammaabafrafsaftaabaabaabaabammaabaabammavqanYammamNaqraqraqraOEabYaOEaOEaOEaOEaOEaOEaOEafZaOEaOEaqvaOEaqwaqxaqraqraqraqraqraqyaqyaqyaqraqraqraqraqraqraqzaqAaqAaqAaqAaqBaqzaqCaqAaqAaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacagsagsaacaacaacaacaacaJx
-aJxaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaaNawlaRFaaNaqraOEakwaqJakYaOEaPUaqraNuaqraPaaNuaMaaqraeWawoayOayOaohayOayOayOayOaohayOayOaohaoiayOayOayOaojayOayOawnaokaBYazJaqvaLCaqrazLazMazNauUazRaAaaAdaAfaOEaOEaOEabZaOEaAkaOEabZaOEaOEaOEaOEaOEabZaqraAlaAmaAnapyauIaAqaAsapyaqraAvaAxaNuaNuaNuaAxaAyaqraAzaABaqraFtabJabJaqraACaAEaAHaqNaAIaAKaqRaqNaqOaqNaqSaqraAMaAOaNuaNuaqraNuaNuaAOaASaqraLCaOEaVhaqraaNaabafKaabafsafLaabaabaabaabafraabaabaabafraabaabaabaeNadDaaFaabajyaoFaqraoIaoIapiapiaqWapiazTaoIaoIaOEaOEaOEaOEaOEaqwaqwaqraqXaqYaqvaOEaiiagjaiiaOEajeaOEagSaOEaqZapyapyaraapyapyapyapyapyapyaqAaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacagsagsagsaacaacaacaacaJx
-aJxaacaacaacagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaRGawlaRFabKaqraOEaOEamFaOEaOEaOEaqraNuaqraqraqraqraqraqracyaaeacyaqraaeaaeaaeaqraqraqraqraqraqraaraaraaraqracyaaracyaqraqraqraqraxWaqraATaAVauUaAVauUaAWaTAbfAabJaqraqraqraqraqraqraqraqraAXaqraqraqraqraqraqraqraqraxOaBaaqraqratMaqraqraqraxOaBcauFaqraqraqraqraqraqraFtabJabJaqraBdaBeaqNaqNaBhaAKarhariariariarjaqraqraqraPsapEagKawXaBiaqraqraqraBjaOEaOEaaraaNazKaaNaaNazKaaNazKaaNaaNaGraaNaWsaaNaoYaaNaaNaaNafsavqacZaabaUzajyarnaqraOEaOEaOEaOEaOEarpaOEaOEaroaroaroaroaoIarpaqwarqaqrarragjarsartarsartarsaruarsartaiiaOEarvapyapyapyapyapyaraapyapyapyaqAaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacagsagsaacaacaacaacaJx
-aJxaacaacaacagsagsagsagsaacaacaacagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaaNawlaRFaaNaqraOEaOEaOEaOEaOEaqraqraqraqraOEagNaBkaqraBlaOEadjaBmaBnaBpaBqaBraqraBvaNuaBxaqraOEaBCaBIaBJaBMaRPaOEaOEaqraBOaBPaqraLCaqraBQauUauUaBSaBVaqraFtbfAabJaOEaOFaaraCaaCbaOEaCdaqraNuaCeaCeaCeaCeaCfaCiaCjapyaCkauIaCnaqraOEagNaCoaOEaOEaOEaOEaCraqraCwaCzaCBaqraFtabJabJaqraCCaCDaAIaCHaqNaAKaqNaqNaESaHMaJjaqraAMaAOaNuapEagKawXaNuaAOaASaqraLCaOEaOEaqraaNaaNaaNaHDaVtaaNazKaaNaFcaaNaaNaaNaVtaaNaYIaaNaGraabacNaauaaFadDaqrarPaqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqwaqwaqraqvaiiarQarQarQarQarQarQarQarQaiiaOEarRapyarSarTarUarVarWarXarYarZaqAaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacagsagsaacaacaacaacaJx
-aJxaacaacagsagsaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNawlaRFaaNaqraOEaOEaOEaOEaOEaPSaFFatqaqraOEaOEaOEaqraBlakWakWaOEaOEaiiaCJaCKaqraCPaCRaCSaqraCTaiiaiiaiiaiiaiiaiiaDbaDcaDdaOEaqraLCaqraqraqraqraqraqraqraDfbfBbeJaFFaFFaDeaFFaFFaOEaOEaqraNuaDgansaNuaNuaDiaDlaDnaCkaDnaDoaDqaDraFFaDsaDwaFFaDAaFFaFFaFFaDFaFFbeHaFFaDFaFtabJabJaqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraLCaJMaOEaqraaNaaNazKazKaaNaWsaaNaaNaHDaaNaaNaaNaaNaaNaaNaaNaADaabavqadaaabacZazVaslasmasmasmasmasmasmasmasmasmasmasmasmasmaOEaqraqwaqwaqraOEasnarQasoaspasoaspasoaspasqagjaOEasrapyassaqraqraqraqraqraqraqrastaqravqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacagsagsaacaacaacaacaJx
-aJxaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNawlaRFbbPaqraqraPSaPSaqraqraqraOEaLCaOEaOEaDJaOEaqraOEaDKaDLaOEaOEaiiaCJaiiaqraDPaNuaDQaqraCTaiiaiiaiiaiiaiiaiiaOEaQOaOEafkaqraLCaqraNKatIaOEaOEafUaqraOHbfAabJaOEaOEaaraOEaDRaOEaDSaqraqraqraqraDTaqraqraDVaDWapyapyaDXaEaaqraLCaOEauFabZaOEaOEaVJaEcaqraEdabZaOEaqraFtabJabJaBYaEeaEfaqraEhaETaqraPVaEiaqraPWaEfaqraNkaNuaqraNxaNLaqraEjaEkaElaqraLCaOEaOEaaraaNazKaaNaaNaaNazKaaNazKaaNaaNaYIaaNaaNaaNaaNaaNaaNaabaeNaaFaauaaFaskasQasRasSasTasUasVasWasXasYasTasZataatbatcataacyaqwaqwaqradNaiiarQarQarQarQarQarQarQarQagjaOEatdapyassaqrateatfatgatfathatiatjatkavqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaJx
-aJxaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNawlaRFavSaaNaaNaaNaaNaaNaaNaqraOEaLCaqraOEaEmaOEaqraEnaOEaOEaOEabZaOEaHTaOEacyaNuaNuaNuaqraCTaEpaOEaOEaEsaOEaOEaVJaqraEtatqaqraLCaqraqraqraWXaOEaSeaqraFtbfAabJaOEaOEaaraEuaQOaEvaaraqraExaAOaNuaEyaEAaqraEEaEIarJaEIaEMaqraqraLCaqraqraqraEPaEQaCoaqraqraqraqraqraqraFtabJabJaqraEfaEfaqraETaETaqraEWaEYaqraPXaQhaqraNkaOIaqraPsaNuaqraOEaOEaOEaFeaFfaOEaOEaqraaNaaNaaNaVtaVtaaNaaNaaNaYIaaNaaNaaNaFcaaNaaNaaNaaNaGDavqadDaabaaFaskasmasmasmasmasmasmasmasmasmasmasmasmasmasmaOEacyaqwarqaqratzaiiahSatAahSatBahSatBahSatBaiiaOEatCapyassaqratDarJatEarJarJarJatFatkavqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaJx
-aJxaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNawlaRFavSbbxbbybbxbbybbxaaNaqraOEaLCaqraqraqraqraqraqraqraqraqraqraqraLCaqraqraqraqraqraqraqraqraqraqraqraFgaaeaFgaqraqraFjaqraLCaqraNKatIayeaPKaCqaqraLCbfCaOEaOEaOEabJabJabJabJaAFaqraqraqraPsajraFkaqraFlarJarJarJaFoaqraFpaFsaFuaqraFvaNuaNuaNuaNuaFxaNuaNuaNuaFzaFtabJabJaqraFBaqraqraFDaqraqraFGaqraqraFDaqraqraNkaNubfdaNuaNuaqraqraqraqraFHaBjaOEaVJaqraaNaaNaaNaGraaNaaNaaNaYIaUfaaNaWsaGraaNaaNaaNaGraaNaabacNadDaaFaabazVatTatUatVatWatXatYatZasQauaaubaucaudaueasRalsaqraqwaqwaqraufatzarpaOEaOEaOEaOEaOEaOEaOEaqvanJaugaqAauhaqrauiaujaukaulaumaumaunatkavqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaJx
-aJxaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNawlaRFavSbbxaSoaSoaSobbxaaeaqraOEaLCaOEaOEaqraFIaNuaNuaqraFLaFOaFSaqraLCaOEaOEaOEaOEaFXaOEaOEaBMaOEaOEaOEaOEaHTaOEaOEaOEaLCaqraLCaqraqraqraOEaOEaOEacyaLCbfCaOEaOEaOEabJabJabJabJabJaqraExaAOaNuajraFZaqraGaarJaGlarJaGmaqraFpaEcaGpaqraGsaNuaNuaGtaNuaNuaNuaNuaNuaqraFtabJabJaqraOEaGwaOEabyaGAabyaGFaQiaOEaOEaQjaqraNkaNuaqraNuaNuaqraEjagNaGHaqraLCaVJaOEaaraaNaRvaZMaRvaRvaaNaaNaVtaADaHDaaNaaNaaNaaNaaNaaNaaNaabacNacZaabadaaqraqraqraqraqraqraqraqrajyajyajyajyajyajyajyajyajyarqaqwaqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqratkauBatkatkatkatkatkatkatkavqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaJx
-aJxaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNawlaRFavSbbDaSoaSoaSobbEaGKaBmaBmaGNaOEaQAaqraNuaNuaNuaGOaGQaGRaGSaqraGUaFFaFFaFFaFFaFFaFFaFFaFFaFFaFFaFFaFFaFFaGVaFFaGWbaXaqraLCaqraNKatIaOEaCuacPaqrbeybfDabCaKmaOEaOEaOEaOEaOEaboaqraqraqraqraGXaqraqraqraqraqraGYaqraqraqraqraqraqraGZaGZaHaaGZaGZaHbaHcaGZaGZaqraFtabJabJaqraOEaCvaOEabyabyabyabyaHeaHhaeKaOEaqraNkaNuaqraNuaNuaqraOEaOEaOEaHlaLCaOEaOEaqraaNaaNaGraFcaADazEaaNaaNaaNaaNaVtaaNaYIaWsaVtaaNaaNaabavqadDaaFaabaqrauMauNauOauPauQauRauSauTauUauVauXauXauXauYauVaqraqwaqwaqrauZavaavbavcavdavcaveavcavfavcavgaqravhaviavjavhavkavhaviavjaviavjaviavhavqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaJx
-aJxaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNawlaRFavSbbxaSoaSoaSobbxaHoaOEaOEaLCaOEaQAaqraNuaNuaHqaqraqraHraqraqraHtaHwaqraqraaeaqraHxaHxaqraaeaqraqraqraqraqraqraHyaqraqraLCaqraqraqraqraqraqraqrbeAbfAabJabJaOEaOEaOEaOEaOEaOEakwakWaIgaTSaLCanPaOEaHzaHAakYaOEaOEakwakWaHBaHCaOEauDawAauDauDaHGauDauDauDaHJaqraFtabJabJaqraHKaHLabZabyaeeaeeabyaHOaHPaHQaQmaqraqraqraqraNuaqraqraqraqraqraqraLCaOEaOEaqraaNazKaaNaaNazKaaNazKaaNaaNaGraaNaaNaaNaGraaNaaNaaNafsavqacZaabadaavzavAahLahLahLahLavBahLahLavCauVauXauXauXauXauVaqraqwaqwaqravDaqNaqNaqOavGavHavIaqNavJaqNavKaqraviavLavMavMavMavMavMavMavMavMavNaviavqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaJx
-aJxaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNawlaRFavSbbxaSoaSoaSobbxaHoaOEaOEaLCaOEaQBaqraNuaNuaNuaHSaOEaqvaHUaOEaHVaOEaqraHWaHTaBMaOEaJMaHXaHZaIbaqraCdaCdaIdaVhaLCaIeaqraxWaqraNKatIaqvaOEacSaqrbeBbfAabJabJaAgaOEaOEaOEaOEaOEaOEaOEaOEaOEaOlanPaOEaIfaOEaOEaOEaOEaOEaOEaOEaJMaOEaOEaOEaOEaOEaOEaOEaOEaOEaOEaqraFtabJabJaqraqraqraqraqraIjanPacyaqraqraqraqraqrayfaygazoaOEaAPaCvaFNaOEaOEacyaLCagaaOEaaraaNaaNaWsaHDaVtaaNazKaYIaFcaaNaaNaaNaVtaaNaaNaaNaGraabaeNaauaaFadDaqravTahLavUavVahLavWahLahLavCavXavYavZavZavZavXaqraqwaqwaqrawaawbaqNawcawdawdawdaweaqNaqNawfaqravjavMawpavMavMavMavMawpavMavMavMavjavqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaJx
-aJxaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNawlaRFavSbbxaSoaSoaSobbxaHoaOEaOEaLCaOEaOEaqrajraNuaIkaGZaOEabJabJabJaFtaOEaqraImaIoaCvaOEaIraOEaItaIyaqraIAaIBaICaIFaIGaIIaILbaXaqraqraqraKuaOEafUaqrbeEbfAabJabJaOEarIabJabJabJabJaRPaOEaOEaOEaTjaNEaFFaIMaINaIRaFFaDAaIMaISaIRaFFaFFaFFaIWaFFaFFaFFaIYaFFaFFaFFaNEaTDbeJaTEaNEaFFaQbaQcaFFaFFbeHaFFaFFaQcaFFaFFaQfaFFaQLaQLaQLaQLaQLaFFaFFaFFahrbaXaOEaOEaqraaNaaNazKazKaaNaaNaFcaaNaHDaaNaFcaaNaaNaaNaaNaaNaADaabavqadaaabacZazVawDahLahLahLawEawFahLahLauUauUauUauUauUauUauUacyaqwaqwawGawHaqNawIawdawdawdawdawdawJawKavKaqraviavMavMawMawNawOavMavMawPavMavMaviavqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaJx
-aJxaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNawlaRFavSbbDaSoaSoaSobbEaIZaBmaBmaGNaqraqraqrajraJaaJdaJfaOEarIaJqabJaFtaqvaqraqradjaJsaJtaJuaJvaJzaBmaJAaBmaIFaJBabJagaaJJaJOaJPaqraNKatIaQMaPKaCqaqrbeFbfCaZaaOEaZHabJabJabJabJabJaZKaOEaOEaOEaLCaJQaOEakwakWakYaOEaOEakwaJZakYaOEaOEakwaJZakYaOEakwaKbakYaOEaOEaQNabJabJabJaQNaJMaLCaOEaOEaOEaOEaOEajOajOajOajOajOaOEajOajOajOajOajOaOEaVJaOEacyaOEabZaOEaqraaNazKaaNaaNaaNazKaaNazKaYIaaNaaNaaNaaNaaNaYIaaNaaNaabavqaaFaauaaFaskawZahLaxaaxbaxcaxdaxeavUauUaoXauUauUauUauUauUacyaqwaqwaxfaxgaqNaxhawdawdawdawdawdawLaqNaxjaqravjaxkavMaxlaxmaxnavMaxoavMaxoavMavjavqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaJx
-aJxaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNawlaRFavSbbxaSoaSoaSobbxaKdaqraOEaHTaKeaOEaOEaLCaOEaOEaOEaOEabJaKkaKnaKoaOEaOEaqraOEaKraOEaKsaOEaKvaIraKwaKEaKFaKoabJaKHaqraqraqraqraqraqraOEaOEaOEacybeGbfEbeHaFFbeIbeJbeJbeJbeJbeJbeKaFFaFFaFFbaXanPaOEaOEaOEaOEaVJaOEaOEaOEaOEaOEaOEaOEamFaIhaOEaOEamFaOEaCvaOEaqraqraqraqraqraQOaQRaQOaOEaOEaOEaOEajOajOaQZajOajOaOEajOajOajOajOajOaOEaOEaOEaqraqraqraqraqraaNaaNaaNaVtaVtaaNaaNaaNaaNaaNaaNaWsaaNaaNaYIaYIaaNaaNavqadDaabaaFazVawZaxDahLahLaxEaxFahLahLavCawdaxGaViaViaViawdaqraqwarqaqraxiaxIaqNaxJawdawdawdaxKaqNaqNaxHaqraviavMavMavMavMavMavMavMavMawpavMaviavqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaJx
-aJxaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNawlaRFavSbbxbbIbbxbbIbbxaaNaqraOEadjaKIaBmaBmaBmaBmaBmaKKaKLaKNaBmaBmaKOaKRaqvaqraKTaKUaKVaKWaLaaLbaLcaqraCdaCdaLeaLfaCdaqraaNaaNaqraNKatIaOEaCuacPaqraOEbfCaOEaOEaLCabJabJabJabJabJaLCaOEaOEazGaOEanPaOEaLiaHAakYaOEaOEakwakWaLjaVJaOEaOEaOEaOEaOEabZaOEaOEaOEaOEaqraaNaaNaqraOEaRbbaXaQOabZaOEaOEaOEajOaRfaRhaRjajOaOEaVhaOEaOEaOEabZaOEaOEaOEaRlaQOaqraaNaaNaaNaaNaaNaGraaNaaNaaNaaNaHDaYIaaNaGraaNaaNaaNaGraaNaaNavqaabaeWaauaskawZahLayhahLahLahLahLaxDavCawdayiayiayiayjawdaqraqwaqwaqraykaqNaylaqNaymaynaymaqOaqOaqNaxLaqravjavMawpavMaypavMavMaxoavMaxoavMavjavqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaJx
-aJxaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNawlaRFbbJbbvbbvbbvbbvbbvbbvaqraqraqraqraqraOEaKdaqraqraLkaKdaqraOEaVJaqraKdaLmaqraqraqraqraqraqraqraqraqraqraqraKdaqraqraqraaNaaNaqraqraqraqraqraqraqraBXbfFaRPaOEaLCabJabJabJabJabJaLCaOEakwakWakYaqraqraqraaraqraqraqraqraaraqraqraqraqraaraqraqraqraqraaraqraqraqraaNaaNaqraqraqraaraqraqraqraqraaraqraqraqraqraqraqraqraqraRnaqraqraqraqraaraqraqraqraaNaaNaaNaADaaNaHDaaNaaNaWsaaNaYIaYIaaNaaNaaNaHDaaNaaNaADaaNaeNaauacZaabajyauUayqayraysaytayuayvaywayxawdayyayzayiatwawdaqrayBayCaqrayDayEayFayGayHayGayIayGayJayGayKaqraviayLavMavMavMavMavMavMavMavMayMaviavqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaJx
-aJxaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNawlaRFaaNaaNaaNaaNaaNaaNaaNaLnaLoaLpaqraOEaOEaOEaqraLqaqvaLsaqraRPaOEaqraLqaiyaLuaqraaNaVqaVzaVuaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraBXbfCabZaqvaLCaOEaOEaVnaOEaOEaLCaVJabZamFaOEaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabaabaabaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaADaaNaaNaaNaaNaGraaNaaNaaNaHDaaNaGraaNaaNaaNavqacKacKawgaqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqraqravhaviavjaviavjaviavjaviavjaviavjavhavqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaJx
-aJxaacaacagsagsaacaacaacaacaacaacaacaacaFwaFwaFwaFwaFwaFwaFwaFwaFwaacaacaaNaaNaaNaaNaaNawlaRFaaNaaNaaNaaNaaNaaNaaNaLnaLvaLwaqraOEaOEaOEaqraLyaOEaLzaqraLAaLBaqraLDadNaLEaqrabKabKabKabKabKabKabKabKabKabKabKabKabKabKabKabKabKabKabKabKabKaqraqrbfGaqracyaQQacyaqraqraqracyaQQacyaqraaraqraqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabaabaabaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaHDaaNaADaaNaaNaaNaaNaaNaaNaHDaaNavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqavqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaJx
-aJxaacaacagsagsaacaacaacaacaacaacaacaacaFwaadaObaTUaZAaHdamDaSVaFwaacaacaacaaNaaNaaNaaNawlaRFaaNaaNaaNaaNaaNaaNaaNaLnaLHaLvaqraqracyaqraqraqracyaqraqraqraqraqraqracyaqraqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabbfHawhawlaRuawkaabawhaabazcaQTawkawhaabaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabaabaabaabaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaZSagsaacaacaacaacaacaacaacaFwaZAaZAaZAaZAaZAaSgaSVaFwaacaacaacaaNaaNaaNaaNawlaRFaaNaaNaaNaaNaaNaaNaaNaLnaLIaLvaLvaLvaLvaLvaLJaLvaLvaLvaLJaLvaLKaLvaLJaLvaLnaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaWsaaNaaNaabaabbfHaabawlaRdawkaabaabaabawlaRdawkaabaabaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaZSaZSaacaacaacaacaacaacaacaFwaOCaZAaQqaRmaZAaRBaHEaFwaacaacaacaaNaaNaaNaaNawlaRFaaNaaNaaNaaNaaNaaNaaNaLnaLIaLvaLvaLvaLvaLvaLvaLvaLvaLvaLvaLNaLNaLNaLvaLvaLnaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabbfHaabawlaRdazCaabaabaabawlaRdawkaabaabaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaYIaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaZSaacaacaacaacaacaacaacaFwaZAaZAaZAaZJaZAaZAaUKaFwaacaaNaaNaaNaaNaaNaaNawlaRFaaNaaNaaNaaNaaNaaNaaNaLnaLIaLvaLOaqraqracyaqraqraLPaLvaLvaLNaLNaLNaLvaLvaLnaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabbfHaabawlaRdawkaabaabaabawlaRdazDaabaabaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaYIaYIaYIaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaZSaZSaacaacaacaacaacaacaFwaFmaFmaPMaZAaZAaRBaZAaFwaacaaNaaNaaNaaNaaNaaNawlaRFaaNaaNaaNaaNaaNaaNaaNaLnaLIaLvaLSaqraLTaLXaMaaqraMdaMeaLvaLNaLNaLNaLvaMfaLnaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaabbfHaatazFaRdawkaataabaatazIaRdawkaataabaabaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaYIaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaJx
-aJxaacaacaacaacayVayVaZSaacaacaacaacaacaFwaFwaFwaFwaFwaFwaTLaFwaFwaacaaNaWsaaNaaNaaNaaNawlaRFaaNaaNaaNaaNaaNaaNaaNaLnaLIaLvaLSaqraqraqraqraqraMgaLvaLvaLNaLNaLNaLvaLvaLnafYaphaphaphaphaphawiawiawiawiawiawiawiawiawiayPaphaphaphaphaphaphaphaphbfIaphapRaRdapRaphaphaphapRaRdapRaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphayQaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaJx
-aJxaacaacaacaacayVaZSaZSaacaacaacaacaacaacaacaacaacaacaFwaTPaFwaacaacaaNaaNaaNaaNaaNaaNawlaRFaaNaaNaaNaaNaaNaaNaaNaLnaLnaLnaLnaLnaLnaLnaLnaLnaLnaLnaLnaLnaLnaLnaLnaLnaLnawlapRayOayOayOayOaDuaDvaDvaasaDxaDvaDvaDvaBfawjayOayRaySayTapRapRapRayZbfJapRapRaRdapRapRapRapRapRaRdapRapRapRapRapRapRapRayOayOayOayOayOayOayOayOayOayOayOayOayOayOayOayOayOayOapRapRawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacagsaZSagsaacaacaacaacaJx
-aJxaacaacaacaZSaZSagsayVaZSaacaacaacaacaacaacaacaacaacaRJaRdaRMaphaphaphaphaphaphaphaphapRanqaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphaphapRawkaWAaWAaWAaWAaavabsabsabsabsabsabsabsaVdaCVaWAazaazbazbazcazdazdazfbfJapRapRaRdapRapRawmapRapRaRdapRapRapRapRapRapRawkaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAawlapRawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaacaacaacaacaJx
-aJxaacaacaZSaZSagsagsagsaZSagsaacaacaacaacaacaacaacawoayOaGMayOayOayOayOayOayOayOayOayOayObcbayOayOayOayOayOayOayOayOayOayOayOayOayOayOayOayOayOayOayOayOayOayOayOayOayOayOawnaWAaWAaWAaWAaCWaCXaCYaCXaCXaCXaCXaCXaCZaDaaWAazgazbaziazjazkazlazmbfKayOayOaGMayOayOayOayOayOaGMayOayOayOayOayOayOawnaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAawoayOawnaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaJx
-ayNaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaRoaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAbcdaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaEgaEgaEgaEgaEgaEgaEgaEgaEgaEgaEgaEgaEgaznazbaziaWAaziazbaWAbfLaWAaWAaRoaWAaWAaWAaWAaWAaRoaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaJx
-ayNaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaSLaSLaSLaSLaSLaSLaSLaSLaSLaSLbceaSLaSLaSLaSLaSLaSLaSLaSLaSLaSLaSLaSLaSLaSLaSLaSLaSLaSLaSLaSLaSLaSLaSLaSLaSLaSLaSLaSLaSLaSMaSMaSMaSMaSMaSMaSMaSMaSMaSMaSMaSMaSMaSOaSQaSSaSSaSSaSQaSTbfMaRtaRtaRDaRtaRtaRtaRtaRtaSkaRsaRsaRsaRsaRsaRsaRsaRsaRsaRsaRsaRsaRsaRsaRsaRsaRsaRsaRsaRsaRsaRsaRsaRsaRsaRsaRsaRsaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaJx
-ayNaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaEgaEgaEgaEgaEgaEgaEgaEgaEgaEgaEgaEgaEgazsazbazbazbazbazbazbazbazbazbaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaWAaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaJx
-aJxaacagsagsagsagsagsagsagsagsagsagsagsagsaaNagsaaNaaNaacaacaacaacaacaacaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaHIaKSaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaQDaMNaMNaMNaMNaMNaMNaMNaMNaMNaMNaMNaMNaMNaMNaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaKqaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaacaacaJx
-aJxaacaacaacagsagsagsagsagsagsagsagsagsagsagsaaNagsagsaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQlawlawkaQlaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraCgaCgaCgaCgaCgaCgaCgaCgaCgaCgaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaacaacaJx
-aJxaacaacaacagsagsagsagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraCgaCgaCgaCgaCgaCgaCgaCgaCgaCgaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaJx
-aJxaacaacaacagsaFqagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaraCgaCgaCgaCgaCgaCgaCgaCgaCgaCgaaraaNaaNaaNaaNaaNaaNaYIaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaJx
-aJxaacaacaacagsagsagsagsagsagsaELagsaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaraCgaRNaCgaCgaRNaRNaCgaCgaRNaCgaaraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaJx
-aJxaacaacaacaacaacaacaacagsaZSaZSaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraCgaCgaCgaCgaCgaCgaCgaCgaCgaCgaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqradeadeadeadeadeadeadeadeadeadeaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaWsaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraqraqraqraqraqraqraqraqraqraqraqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaYIaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSagsaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaYIaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaNvaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaFwaFwaPTaFwaFwaacaacaacaacaacaacaacaacagsagsaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaIVaLUaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaYIaaNaaNaWsaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaFwaFRaMbaWOaFwaFwaPTaFwaPTaPTaFwaacaacagsaZSaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaZSaZSaacaacagsagsaacaacaacaAAagsaNFaacaacaacaacaZSaZSaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQlawlawkaQlaaNaaNaaNaaNaaNaaNaaNaaNaaNaYIaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaFwaIqaIqaTeaFwaVfaQVaGeaYsaKhaFwaacaacagsaZSaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacagsaacagsagsagsazZaUMagsagsagsagsagsagsaZSayVaZSaZSaZSaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaYIaYIaYIaaNaaNaaNaaNaaNaYIaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaPTaIqaPJaIqaKxaZAaZAaZAaZAaFTaPTaacaacaZSaZSaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacagsaacagsaJkagsagsagsaSlagsagsagsagsagsaacaacaacaacaZSaZSaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaYIaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaWsaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaFwaOjaIqaIqaFwaGxaZAaAGaBzaBzaPTaacaacaZSaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsaEbagsagsagsagsagsagsagsaacaacaacaacaZSaZSaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaFwaPTaPTaFwaFwaITaZAaBzaBzaPbaFwaacaacaZSaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsaClagsagsagsaacaacaacaacaacaacayVaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaWsaaNaaNaaNaaNaaNaaNaYIaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaPTaPTaFwaFwaGkaFwaFwaFwaFwaacaacagsaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaUeagsagsagsaVEaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaPTaQIaQIaZAaZAaJFaFwaacaacaacaacagsaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaaNaaNaaNaaNaaNaaNaacaaNaaNaaNaaNaDHaIVaIVaIVaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaPTaZAaMEaMEaMEaPjaPTaacaacaacaacagsaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaaNaacaacaacaacaacaacagsaZSaZSaacaacaacaaNaaNaacaacaZSayVaDHaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaFwaMlaYraYpaMEaYfaFwaacaacaacaacagsaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacayVaZSaacaacaacaacaacaacaacagsayVaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaPTaPTaPTaFwaFwaFwaPTaFwaFwaacaacaacaacaacaacaacaacaacaacaacaacaacaFwaSPaMEaMEaMEaUDaPTaacaacaacagsagsaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSagsaVEaXIaWzaFJaacaacaFYagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaPTaYJaVjaLVaXwaZkaKiaAbaFwaXPaNlaNFaacaacaacaacaacaacaacaacaacaacaPTaZAaReaMEaMEaMSaFwaacaacaacagsaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaBAaacaDEagsaBDaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaPTaDZaLxaUtaFwaAbaOCaDDaGzagsagsaYOagsaacaacaacaacaacaacaacaacaacaFwaZAaZAaZAaQXaVvaFwaacaacaacagsaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaALagsaSlagsaWzaXZagsaDEaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaFwaGyaApaWYaFwaTNaKiaKiaEFagsagsagsagsaacaacaacaacaacaacaacaacaacaFwaFwaLlaRzaFwaFwaFwaacaacagsagsaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacagsaacagsaacaacaacaacaacagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQlawlawkaQlaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaKtaKtagsaEbaWzagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaFwaFwaFwaAbaAbaPOaEFaEFaFwagsaXJagsaacaacaacaacaacaacaacaacaacaacaacaacaEFaEFaZkaLtaacaacagsagsaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaUiaYYaWzagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaFwaODaIvaStaEFaYOagsagsagsagsaacaacaacaacaacaacaacaacagsagsagsagsagsagsaIlagsagsaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacagsaacaEDaEDaEDaEDaEDaEDaEDaEDaVZaQgaEDaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaAbaFwaAbaFwaFwaJraacagsagsagsagsaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacagsagsaacaEDaMpaUjaMpaKgaYyaIuaEDaERaTiaMzaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacagsaZzagsagsagsagsaacagsagsagsagsagsaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacagsaacaacaEDaPlaMpaGBaEDaJCaRqaEDaMpaMpaMzaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaLUaNvaIVaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaEZaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacagsagsagsagsaacaacaacagsagsagsagsagsagsaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaZSaacaacaEDaFyaMpaWJaEDaEDaEDaEDaAQaMpaEDaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacagsaZSaZSaNvaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaqraqraaNaqraXXaWRaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaYHaacaacagsagsagsagsaacaacaacaacagsagsagsagsagsaNFaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacagsagsaacaacaEDaMpaMpaMpaRwaMpaMpaMpaMpaMpaEDagsagsagsaacaacaacaacaacaacaacagsagsagsaacaacaZSaZSaZSaZSaNvaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaqraENaaNabYaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaEDaEDaEDaEDaEDaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaAhagsagsagsagsagsagsagsagsaacaacaacaacaacaacagsagsagsagsaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacagsagsaacaacaEDaVoaVWaDGaEDaXRaAZaMpaKMaMpaEDagsagsagsagsaacaacaacaacaacaacaacaacagsagsagsaZSaZSaZSaZSaZSaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaacaaNaaNaLUaLUaLUaaNaaNaaNaYAaZBafZaqraacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaEDaCxaYyaYyaEDaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaLFagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacagsagsaacaacaacaEDaEDaEDaEDaEDaEDaEDaEDaEDaYTabeagsagsagsagsagsaacaacaacaacaacaacaacaacagsagsagsaZSaZSaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaacaacaacaZSagsaZSaacaqraMRaOEaSjabYaqraacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaEDaYyaYyaXUaEDaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaRcagsaDzagsaEbagsaDhagsaZzaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacagsagsaKAagsagsagsagsagsagsaacaacaacaacaacaacaacaacagsagsaZSaZSaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQlaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaZSaacaacaBEaAUaMcaBHaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaEDaYyaTHaYyaEDaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaHvagsagsagsagsaIHagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaSlagsagsagsagsaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaacaacaqraqraacaqraqraacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaEDaKgaEDaEDaEDaEDaEDaEDaEDaEDaacaacaacaacaacagsagsagsaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacagsagsaDhagsaUEagsaYUaLFagsagsagsaacaacaacaacaacaacaacaacaacaacaZSagsaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacagsaacaacagsagsagsaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaaNaaNaaNaaNaLUaLUawlawkaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQlaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaEDaKZaLQaEDaPcaQxaVraPcazyaEDaacaacaacaacaacaacagsagsaacaacaacaacaacagsaZSagsagsagsagsaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacagsaLFagsaSlagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaZSagsaacaacaacaacaJx
-aJxaacaacaacaacaacaacagsagsaacagsagsagsagsagsaZSaZSaZSaacaacaacaacagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaaNaaNaLUaLUaLUaLUawlawkaLUaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaQlaaNagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaEDaWSaLQaEDaPxaZjaQxaMpaKBaEDaacaacaacaacaacaacaacagsagsagsagsagsaZSaZSagsagsaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacagsagsaCNagsagsaBWagsagsaPYaacaacaacagsagsaacaacaacaacaacaacaacaacaZSagsaacaacaacaacaJx
-aJxaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacagsaZSaZSaZSaZSagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaLUawlawkaLUaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacagsagsaacaacaacaacaEDaEDaEDaEDaEDaEDaEDaEDaEDaEDaEDaEDaacaacaacaacaacaacaacaacaacagsagsaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaEDaIzaEDaJcaMpaZjaNgaBwaMpaEDaacaacaacaacaacaacaacagsaZSaZSaZSaZSagsagsaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacagsaSRagsagsaSRaDzagsaMuaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacagsaacaacaacaacaJx
-aJxaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaXyawlawkaXyaLUaLUaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacagsagsagsagsaacaacaEDaChaEDaKzaKzaEDaGvaUlaMpaMpaNHaEDaacaacaacaacaacaacaacaacaacaacaZSaZSagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaEDaMpaMpaMpaMpaMpaMpaMpaMpaEDaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaLFagsagsaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacagsagsaacaacaacaacaJx
-aJxaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaLUawlawkaLUaLUaLUaLUaLUaLUaLUaaNaaNaaNaaNaQlaacaacaacaRTagsagsaacaacaEDaYdaKgaYyaRqaEDaCyaMpaMpaMpaZvaEDaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaEDaMpaKYaUXaMpaMpaMpaKYaZEaEDaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaRaaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaVmagsaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacagsagsaacaacaacaacaJx
-aJxaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaIaaIaaZPaDpaTvaZPaUYaUYaUYaUYaUYaUYaUYaUYaUYaUYaUYaIaaIaaacaacagsagsaacaacaEDaEDaEDaEDaYWaEDaEDaEDaNRaEDaJcaEDaEDaEDaEDaEDaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaEDaEDaEDaEDaAcaNbabeaEDaEDaEDaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaRaaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacagsaZSaacaacaacaacaJx
-aJxaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaIaaGhaGhaPPaPPaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaIaaacaacagsagsaacaacaAbaEFaEFaZkaEFaZkaEFaEDaMpaORaNeaMpaOOaQUaPCaEDaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaXFagsagsaXFagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacagsaZSaacaacaacaacaJx
-aJxaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaIaaGhaCGaZtaZtaCGaCGaCGaCGaCGaCGaCGaCGaCGaCGaCGaCGaGhaIaaacaacagsaRTaacaacaAbaAbaAbaEFaEFaEFaEFaEDaMpaMpaMpaMpaMpaMpaAeaEDaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacagsagsaacaacaacaacaacaJx
-aJxaacaacaacagsaacagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaIaaGhaCGaZtaZtaUWaZtaZtaUWaZtaZtaZtaZtaZtaZtaUWaZtaGhaIaaacaacagsagsaacaacaAbaAbaAbaAbaAbaEFaEFaEDaOWaYiaQxaYVaEDaMpaMKaEDaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaRaaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacagsagsaacaacaacaacaacaJx
-aJxaacaacaacagsagsagsagsagsaacaacaacaacagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaIaaGhaCGaUWaZtaZtaPoaXzaJeaXzaMWaXzaJeaUWaZtaZtaZtaGhaIaaacaacagsagsaacaacaAbaAbaAbaAbaAbaEFaEFaZkaVkaVkaVkaVkaEDaMpaBZaEDaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaZSagsaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaRaaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaLUaacaacaacaZSaZSagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacagsagsaacaacaacaacaacaJx
-aJxaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaIaaGhaCGaZtaZtaZtaPoaXzaJeaXzaJeaXzaJeaZtaZtaZtaZtaGhaIaaacaacagsagsaacaacaAbaAbaAbaAbaAbaEFaEFaEFaEFaEFaEFaEFaNRaMpaEHaEDaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaZSaZSagsaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaRaaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaLUaNvaNvaZSaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaacaacaacaacaacaacaacagsagsaacaacaacaacaacaJx
-aJxaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaIaaGhaCGaUWaZtaZtaUWaZtaZtaZtaZtaUWaZtaZtaZtaZtaZtaGhaIaaacaacagsagsaacaacaAbaAbaAbaAbaEFaEFaEFaJnaEFaEFaEFaEFaEDaTTaEDaEDaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSagsagsaacaacaacaacaacaacaacaacaacaacaacaacaLUaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaLUaNvayVaZSaZSayVaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaacaacaacaacaacaacaacagsagsaacaacaacaacaacaJx
-aJxaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaGhaCGaCGaCGaCGaCGaCGaCGaCGaCGaCGaCGaCGaZtaZtaZxaGhaIaaacaacagsagsaacaacaacaacaacaEFaEFaEFaEFaEFaEFaEFaEFagsagsagsaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaLUaNvaLUaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaLUaLUaNvaLUaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaacaacaacaacaacaacagsagsagsaacaacaacaacaacaJx
-aJxaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaIaaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaZtaZtaXqaGhaIaaacaacagsaRTaacaacaacaacaacagsagsagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaZSaZSaZSaacaacaacaacaacaacaacaacagsagsagsagsagsagsaZSagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaZSaLUaNvaaNaaNaaNaaNaaNaaNaaNaaNaaNaabaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaLUaLUaNvaLUaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaZSaZSaacaacaacaacagsaZSaacaacaacaacaacaacaJx
-aJxaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaIaaGhaZraJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaZraZraGhaZWaZtaGuaFraFWaMoaFraFWaMoaZtaZtaZtaZtaZtaZxaGhaIaaacaacagsagsaacaacaacaacagsagsagsagsagsagsagsagsagsagsagsagsagsaacaacaacaZSaZSaZSaZSaZSaacaacaacaacaacaacaacagsagsagsagsagsaZSaZSagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaZSaNvaNvaLUaaNaOJaqraOLaOLaOJaqraqraZQaOLaOJaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaLUaLUaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaZSaZSaacaacaacaacaacaacaJx
-aJxaacagsagsaZSaacaacaacaacaacaacaacaacaacaacaacaIaaGhaJlaZraJlaCMaCMaCMaJlapuaJlaJlaZraPiaPiaPiaPiaJlaJlaZraJlaJlaJlaZraJlaPiaPiaPiaJlapuaJlaZraPiaJlaJlaJlaJlaJlaGhaZtaZtaZtaZtaZtaZtaZtaZtaZtaZtaZtaZtaZtaZtaZtaGhaIaaacaacagsagsaacaacaacaacagsagsagsagsagsagsaacagsagsagsagsagsagsaacaacaacaZSaZSaZSaZSaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacagsaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaZSaZSaacaacaaNaqraTpaNtaIxaayaheaSHafZaIUaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaLUaLUaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaNFaacaacaZSaZSaacaacaacaacaacaacaJx
-aJxaacaacaZSaZSaacaacaacaacaacaacaacaacaacaacaacaIaaGhapuaJlaZraJlaJlaJlaJlaJlaJlaZraJlaJlaJlaJlaJlaZraJlaJlaJlaPiaJlaZraJlaJlaJlaJlaJlaJlaJlaZraPiaJlapuaJlaCMaCMaGhaZtaZtaZtaZtaZtaUWaUWaZtaUWaUWaZtaUWaUWaZtaZtaGhaIaaacaacagsagsaacaacaacaacaacaacagsagsagsaacaacagsagsagsagsagsagsagsagsagsagsagsagsaZSaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaZSaZSaacaacaacaqraKCaqvaOEaOEaSjaOEaOEaHNaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaJx
-aJxaacaacaZSaacaacaacaacaacaacaacaacaacaacaacaacaIaaGhaJlaJlaPiaPiaPiaPiaJlaJlaPiaJlaJlaJlaPiaPiaJlaJlaJlapuaJlaPiaJlaXsaXsaJlaPiaPiaPiaPiaJlaJlaJlaJlaJlaJlaJlaJlaGhaZtaZtaZtaZtaZtaZtaZtaZtaZtaZtaZtaZtaZtaZtaZtaGhaIaaacaacagsagsaacaacaacaacaacaacaacagsaacaacaacagsagsagsagsagsagsagsagsagsagsagsagsagsaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaZSaacaacaacaacaqraOEaFaabYaOEaOEaOEaZBaLRaOLaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsaacaacaacaacaacaacaJx
-aJxaacaacaZSaacaacaacaacaacaacaacaacaacaacaacaacaIaaGhaJlaJlaZraJlaXsaJlaJlaJlaPiaJlaJlapuaJlaJlaJlaJlaJlaJlaJlaJlaZraJlaJlaZraJlaJlaJlaJlaZraJlaJlaJlaPiaJlaJlaJlaGhaZtaZtaGhaGhaSqaSUaPdaFraZtaZtaZtaFraPdaSUaSqaGhaIaaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacagsaacaacagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaZSaacaacaacaacaqraqvagSaSjaOEadNaVyaOEaRpaOLaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsaacaacaacaacaacaacaJx
-aJxaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaIaaGhaJlaZraJlaJlaXsaZraZraJlaPiaJlaJlaJlaJlaJlaPiaZraJlaPiaJlaJlaJlaCMaJlaJlaJlaCMaJlaJlaJlaJlaXsaZraPiaJlaZraJlaGhaZxaZxaWlaGhaZtaZtaZtaZtaUWaUWaUWaZtaZtaZtaZtaGhaIaaacaacagsaRTaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsaacaacagsaZSaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacagsaacaacaacaacaqraOEaagaOEaqvaOEaOEaOEaZUaqraaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaFwaPTaFwaFwaPTaFwaacaacaacaacaacagsagsaSlagsagsagsaacaacaacaacaacaJx
-aJxaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaIaaGhaJlaJlaJlaPiaPiaJlaJlaJlaJlaJlaCMaJlaJlaJlaPiaJlaJlaPiaJlapuaJlaCMaJlapuaJlaCMaJlaJlapuaJlaXsaJlaPiaJlaZraJlaPvaZxaMqaWlaGhaUWaZtaZtaZtaUWaUWaUWaZtaZtaZtayAaGhaIaaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaSlagsagsagsaacagsaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaZSagsaacaacaacaacaacagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacagsaacaacaacaacaqraqraqraqraqraqraqraqraqraOJaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaFwaOjaMbaFRaLraFwaFwaPTaPTaFwaLlaMnagsagsagsagsagsaacaacaacaacaacaJx
-aJxaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaIaaGhaJlapuaJlaPiaPiaJlaJlaJlaJlaJlaCMaJlaZraJlaPiaJlaJlaPiaJlaJlaJlaCMaJlaJlaJlaCMaJlaJlaJlaJlaXsaJlaPiaJlaZraJlaPvaZxaMqaWlaGhaUWaZtaZtaZtaUWaUWaUWaZtaZtaZtayAaGhaIaaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSagsaZSagsaacaacagsagsagsaROaBbagsaROaBbagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaPTaIqaIqaTMaTeaFwaQIaZAaObaJSaGPagsagsagsagsagsagsaacaacaacaacaacaJx
-aJxaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaIaaGhaZraJlaJlaJlaJlaJlapuaJlaJlaZraCMaJlaJlaJlaXsaJlaJlaJlaZraJlaJlaJlaJlaJlaJlaJlaJlaZraZraJlaJlaJlaPiaJlaJlaJlaGhaZxaZxaWlaGhaZtaZtaZtaZtaZtaZtaZtaZtaZtaZtaZtaGhaIaaacaacagsagsaacaacaacaacaacaacaacaacaacagsaRTagsaacaRTagsagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaZSaZSagsagsagsagsagsaQaaEGaEGaBRaEGaEGaQvagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaFwaPTaPTaKxaFwaFwaFwaZAaMEaMEaZAaFwaacagsagsagsagsaacaacaacaacaacaacaJx
-aJxaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaIaaGhaJlaJlaJlaJlaZraJlaJlaJlaJlaJlaJlaJlaJlaJlaPiaJlaJlaJlapuaJlaPiaJlaJlaJlaPiaPiaPiaPiaJlaJlaPiaXsaJlaJlaJlaJlaGhaZtaZtaGhaGhaSqaSUaIOaFraZtaZtaZtaFraIOaSUaSqaGhaIaaacaacagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaZSaZSagsagsagsaacagsaZLaEGaNqaLLaUxaEGaQkaacagsagsaacaacaacaacaacaacaacaacaacaacaacagsagsaZSagsagsaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaFwaQVaGeaZAaZAazhaFwaZCaMEaMEaQSaFwaacaacaacaacaZSaacaacaacaacaacaacaJx
-aJxaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaIaaGhaJlaJlaPiaPiaPiaPiaJlaJlaPiaJlaJlaPiaJlaJlaJlaJlaJlaJlaJlaJlaJlaJlaZraJlaJlaJlaJlaJlaJlaJlaPiaJlaJlaJlaCMaCMaGhaZtaZtaZtaZtaZtaZtaZtaZtaZtaZtaZtaZtaZtaZtaZtaGhaIaaacaacaRTagsagsagsagsagsaRTagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsaRTaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaacagsagsaacaacagsagsaAiaEGaANaEGaUnagsagsagsagsaacaacaacaacaacaacaacaacaacaacagsagsaZSagsaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaFwaZAaZAaZAaZAaZAaGkaZAaZAaRBaMSaFwaacaacaacaacaZSaacaacaacaacaacaacaJx
-aJxaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaIaaGhaJlaJlaJlaJlaJlaJlaJlaJlaPiaJlaJlaPiaJlaZraJlaNzaNzaNzaNzaNzaJlaJlaJlaZraJlaJlapuaZraJlaJlaJlaZraJlaJlaJlaJlaGhaZtaZtaZtaZtaUWaUWaZtaZtaUWaUWaZtaUWaUWaUWaZtaGhaIaaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsaacaRTagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacagsagsagsaAiaEGaUnagsagsaacaacaZSaacaacaacaacaacaacaacagsagsagsagsaZSagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaPTaKjaZAaZIaQeaNIaFwaFwaFwaTXaFwaFwaacaacaacaacagsaNFaacaacaacaacaacaJx
-aJxaacaacaacaacagsagsaZSaacaacaacaacaacaacaacaacaIaaGhaJlapuaJlaCMaCMaCMaJlaJlaZraJlaJlaXsaJlaJlaJlaJlapuaJlaJlaJlaJlaJlaPiaJlaJlaJlaJlaJlaJlaPiaJlaJlapuaJlaJlaJlaGhaZtaZtaZtaZtaZtaZtaZtaZtaZtaZtayoaCmaTnaCmaTnaGhaIaaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsaacaacaacaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsaEwagsagsagsaacaacaZSaacaacaacaacaacagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaFwaGxaZAaQeaQeaWjaFwaPOaIDaTXaAbaFwaacaacaacaacaacagsaacaacaacaacaacaJx
-aJxaacaacaacaacaacaZSaZSaacaacaacaacaacaacaacaacaIaaGhaZraJlaZraJlaJlaJlaJlaJlaZraJlaJlaPiaJlaJlaJlaJlaZraZraJlaJlapuaJlaPiaJlaJlaZraJlaJlaJlaPiaJlaZraJlaJlaJlaZraGhaZWaZtaTVaZtaKDaHnaFQaBGaSnaZtaNTaMyaWNaMyaEVaGhaIaaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaZSagsagsaacaacaacaacaacaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsagsaZSagsagsaZSagsagsagsagsagsaacaacaacaacaacaRWaRUaRWaRWaRWaRWaRWaRWaRWaRWaRWaRUaacaacaacaacaacaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaFwaFwaPTaPTaFwaFwaFwaSKaRSaTXaAbaFwaacaacaacaacaacagsaacaacaacaacaacaJx
-aJxaacaacaacaacaacaZSaZSaacaacaacaacaacaacaacaacaIaaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaGhaIaaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacagsaRTagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacagsagsaZSagsaZSaZSaacaacaRUaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaacaacaacaacaacaacaacaacaZSaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaAbaAbaUraGLaIPaAbaacaacaacaacaacagsaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaZSaacaacaacaacaacaacaacaacaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaIaaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSagsaacaacaacaacaacaacaacaacaacaacaacaRUaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRUaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSagsaacaacaacaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaacaacaacaacaacaacaacaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaaNaaNaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaPOaYzaEFaGzaMXaFwaacaacaacaacaacagsaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaacaacaacaacaacaacaacaacaacaacaacaacaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaFwaEFaAbaTXaAbaFwaacaacaacaacagsagsaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSagsagsaacaacaacaacaacaacaacaacaacaacaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaRWaRWaRWaMvaMvaMvaMvaMGaMGaMvaMvaMvaMvaMvaMvaMvaRWaRWaRWaRWaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaAbaAbaFwaEFaFwaFwaacaacaacaacagsaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsaacaacaacaacaacaRWaRWaRWaMvaMvaMvaMvaMvaMGaMGaMvaMvaMvaMvaMvaMvaMvaMvaMvaMvaMvaMvaRWaRWaRWaMvaMIaNcaNcaNcaNcaNdaNiaMIaNmaNmaNmaNmaNmaMIaNiaMIaNdaNcaNcaNcaNVaMIaMvaRWaRWaRWaMvaNYaEFaEFaEFaEFaNZaNZaNZaNZaNZaNYaMvaRWaRWaRWaRWaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsaacaacaacaacaRWaRWaRWaMvaNYaOfaOfaOQaEFaEFaNYaPeaPfaPgaPhaPkaPnaPpaEFaEFaNYaMGaRWaRWaRWaMGaMIaMIaMIaMIaMIaMIaMIaMIaMIaPqaMIaMIaMIaMIaMIaMIaMIaMIaMIaMIaMIaMIaMGaRWaRWaRWaMGaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaMvaRWaRWaRWaRWaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaRWaRWaRWaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaMGaRWaRWaRWaMGaMIaMIaMIaMIaMIaMIaMIaMIaMIaMIaMIaMIaMIaMIaMIaMIaMIaMIaMIaMIaMIaMIaMGaRWaRWaRWaMGaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaNYaRWaRWaRWaRWaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaRWaRWaRWaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaNZaMvaRWaRWaRWaMvaNiaPtaPuaPwaPyaPtaMIaNiaPtaPtaPtaPtaPtaNiaMIaMIaPtaPzaPBaPEaPtaNiaMvaRWaRWaRWaMvaPFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaRWaRWaRWaRWaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaRWaRWaRWaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaNZaMvaRWaRWaRWaMvaMvaMvaMvaMvaMvaMvaMvaMvaMvaMvaMvaMvaMvaMvaMvaMvaMvaMvaMvaMvaMvaMvaMvaRWaRWaRWaMvaPFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaRWaRWaRWaRWaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaRUaRWaRWaRWaEFaEFaEFaEFaEFaPGaPGaPGaPGaPGaPGaPGaPGaPGaEFaEFaEFaNZaMvaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaMvaNYaEFaEFaEFaPGaPGaPGaPGaEFaEFaEFaEFaRWaRWaRWaRWaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaZSaZSaZSagsagsagsagsagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaRWaRWaRWaRWaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaNZaMvaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaMvaEFaEFaEFaEFaPGaPGaPGaPGaEFaEFaEFaEFaRWaRWaRWaRWaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaacaacaacaacaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsaZSaacaacaacaacaacaacaacaacaacaacagsagsagsagsaZSaZSaZSaZSagsagsagsaacaacaacaacaacaZSaZSaZSaacaacaacaRWaRWaRWaRWaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaNZaMvaRWaRWaRUaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaMvaPFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaRWaRWaRWaRWaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSaZSagsagsagsagsagsagsagsagsagsaZSaacaacaacaacaacaRWaRWaRWaRWaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaMvaRWaRWaRWaRWaRWaRWaRWaRUaacaacaacaacaacaRWaRUaRWaacaacaacaacaacaRUaRWaRWaRWaRWaRUaRWaRWaRWaMvaPFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaNYaRWaRWaRWaRWaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacaacaacaacagsaZSaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsaZSagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsaNFaacaacagsaZSaZSaZSaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaZSaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaRWaRWaRWaRWaMvaNYaPFaPFaPFaEFaEFaNYaPFaPFaPFaPFaPFaPFaPFaEFaEFaNYaMvaRWaRWaRWaRWaRWaRWaRWaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaRWaRWaRWaRWaRWaRWaRWaRWaMvaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaEFaMvaRWaRWaRWaRWaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsaacaacaacaacaacaacaacaacagsagsaZSaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsaZSaZSaZSagsagsaacaacaacaacaacaacaacaacaacagsagsagsagsagsaacaacagsagsagsagsaZSaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSagsagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaRWaRWaRWaRWaMvaMvaMvaMvaMvaMGaMGaMvaMvaMvaMvaMvaMvaMvaMvaMvaMvaMvaPHaRWaRWaRWaRWaRWaRWaacaacaacaacaacaJxaJxaJxaJxaJxaJxaJxaJxaJxaacaacaacaRWaRWaRWaRWaRWaRWaRWaMvaNYaEFaEFaEFaEFaPFaPFaPFaPFaPFaNYaMvaRWaRWaRWaRWaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsaacaacaacaacagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsaZSaZSagsagsaacaacaacaacaacaacagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsagsaZSaZSaZSagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaacaacaacaacaacaJxaJxazQazQazQazQazQazQazQaJxaJxaacaacaacaRUaRWaRWaRWaRWaRWaMvaMvaMvaMvaMGaMGaMvaMvaMvaMvaMvaMvaMvaRWaRWaRWaRWaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSagsagsagsagsaacaacagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaZSaZSagsagsagsagsagsagsagsagsaZSaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaacaacaacaacaacaJxazQazQazQaEOaBFaEOaRQaPDazQaJxaJxaJxaacaacaacaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacagsagsagsagsagsagsagsagsaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRUaacaacaacaacaacaJxazQaOzaNOaTRaEOaEOaEOaAraEOazQaJxaJxaJxaacaacaacaacaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaRUaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRUaRWaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJxazQaEOaEOaEOaGCaEOaEOaEOaEOazQaJxaJxaJxaJxaacaacaacaacaRUaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaRWaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJxaJxaJxazQaEOaEOaEOaCQaXhaKlaKpaJYazQaJxaJxaJxaJxaJxaJxaacaacaacaacaacaacaacaacaacaacaRWaRUaRWaRWaRWaRWaRWaRWaRWaRWaRWaRUaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJxaJxaJxaJxazQaUoaXaaBgaWKazQazQazQazQazQaJxaJxaJxaJxaJxaJxaJxaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaacaJx
-aJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxazQazQazQazQazQazQaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJxaJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+ayN
+ayN
+ayN
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+"}
+(2,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aWA
+aWA
+aWA
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(3,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aWA
+aWA
+aWA
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(4,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aLg
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aZS
+aZS
+aZS
+aZS
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aqr
+aOc
+aOo
+aOu
+aOx
+aOK
+aOP
+aqr
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aWA
+aWA
+aWA
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aZS
+aZS
+aZS
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(5,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+abH
+abH
+abH
+abH
+abH
+abH
+abH
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aTC
+aXn
+aXn
+aXn
+aTC
+aac
+aac
+aac
+aqr
+aOd
+aOp
+aqr
+aOB
+aOE
+aOS
+aqr
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aZS
+aZS
+aac
+aac
+aac
+aac
+aZS
+aZS
+aWA
+aWA
+aWA
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aZS
+aZS
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(6,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+abH
+abR
+aes
+acV
+aiS
+apL
+abH
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aWv
+bcn
+bcn
+bcn
+bcx
+aac
+aac
+aac
+aqr
+aqr
+aqr
+aqr
+aOG
+aOM
+aOT
+aqr
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aZS
+aZS
+ayV
+ayV
+aZS
+ags
+aWA
+aWA
+aWA
+ags
+ags
+ags
+aFq
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(7,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+abH
+acF
+abR
+aev
+apL
+aBB
+abH
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aWv
+bcn
+bcn
+bcn
+bcx
+aac
+aac
+aac
+aqr
+aOe
+aOq
+aqr
+alO
+aOE
+aOU
+aqr
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ayV
+aZS
+ags
+ags
+aWA
+aWA
+aWA
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(8,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+abH
+acV
+aet
+aex
+apX
+acV
+abH
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aWv
+bcn
+bcn
+bcn
+bcx
+aac
+aac
+aac
+aqr
+aOg
+aOs
+aOv
+aOE
+aON
+aBm
+aqr
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+ayV
+ags
+aWA
+aWA
+aWA
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aZS
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(9,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+abH
+adz
+aer
+aey
+auE
+aCt
+abH
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aTC
+bco
+bcp
+bco
+aTC
+aac
+aac
+aac
+aqr
+aqr
+aqr
+aqr
+aOJ
+aqr
+aOV
+aqr
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aWA
+aWA
+aWA
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(10,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+abH
+aer
+aeu
+acV
+aBu
+auE
+abH
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+bdN
+aMn
+bdy
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aWA
+aWA
+aWA
+ags
+ags
+ags
+ags
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(11,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+abH
+abH
+abH
+aeH
+abH
+abH
+abH
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aLY
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+alv
+awd
+afw
+afw
+afw
+afw
+awd
+aac
+aac
+ags
+bdy
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aLY
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aWA
+aWA
+aWA
+ags
+ags
+ags
+ags
+aEL
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(12,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aZS
+aZS
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aLY
+aZS
+aZS
+aZS
+aZS
+asM
+ags
+ags
+ags
+bcn
+aNj
+aNr
+aNr
+aNP
+aOh
+afw
+aac
+bdO
+ags
+bdy
+aTC
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aWA
+aWA
+aWA
+ags
+ags
+ags
+ags
+ags
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aZS
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(13,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+ags
+aZS
+ags
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aTC
+aKA
+ags
+ags
+ags
+bdL
+ags
+ags
+ags
+bcn
+aNn
+aNs
+arO
+aNQ
+aOi
+afw
+aac
+bdP
+ags
+bdy
+aMn
+ags
+ags
+ags
+ags
+alv
+aTC
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aWA
+aWA
+aWA
+ags
+ags
+ags
+ags
+aZS
+aZS
+aZS
+ags
+ags
+ags
+ags
+ags
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(14,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aEU
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aRE
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+afw
+aNy
+aND
+aNQ
+aOm
+afw
+bdI
+bdQ
+ags
+bdz
+bdh
+bdh
+bdh
+bdh
+bdh
+bdC
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aFw
+aFw
+aFw
+aFw
+aFw
+aFw
+aac
+aac
+aac
+aWA
+aWA
+aWA
+ags
+ags
+ags
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aZS
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(15,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aEU
+aEU
+aEU
+aEU
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aGn
+ags
+ags
+aFV
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+afw
+aNB
+aND
+aNU
+aOn
+aOt
+bdh
+bdh
+bdh
+bdA
+ags
+ags
+ags
+aac
+bea
+bdy
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aad
+aZA
+aOC
+aZA
+aFm
+aFw
+aac
+aac
+aac
+aWA
+aWA
+aWA
+aaN
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aZS
+aac
+aac
+ags
+ags
+aac
+aED
+aED
+aED
+aED
+aED
+aED
+aED
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(16,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aEU
+aEU
+aEU
+aEU
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ayV
+aac
+aac
+aac
+aac
+aIV
+aIV
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+awd
+afw
+aND
+aNW
+aNs
+aNn
+bcn
+ags
+ags
+ags
+aZS
+aac
+aac
+aac
+aFd
+aPN
+aGG
+aGG
+aGG
+aGG
+aFd
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aOb
+aZA
+aZA
+aZA
+aFm
+aFw
+aac
+aac
+aac
+aWA
+aWA
+aWA
+ags
+aaN
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aED
+aMp
+aPl
+aFy
+aMp
+aVo
+aED
+aac
+aac
+aac
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(17,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aEU
+aXo
+aEU
+aEU
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJG
+ags
+ags
+aEb
+ags
+aUu
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aaN
+aaN
+aaN
+aaN
+aIV
+aaN
+aaN
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aLU
+aLU
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+afw
+aNM
+aNX
+afw
+awd
+aac
+ags
+ags
+aZS
+aZS
+aac
+aac
+aac
+aGG
+aPQ
+aPQ
+aPQ
+aPQ
+aPQ
+aGG
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aTU
+aZA
+aQq
+aZA
+aPM
+aFw
+aac
+aac
+aac
+aWA
+aWA
+aWA
+aaN
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aJk
+ags
+ags
+aUe
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aED
+aUj
+aMp
+aMp
+aMp
+aVW
+aED
+aac
+aac
+aac
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(18,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aEU
+aEU
+aEU
+aEU
+aEU
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aSl
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aIV
+aIV
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aLU
+bbG
+aLU
+aLU
+aLU
+aLU
+aLU
+aac
+aac
+aac
+aac
+aRv
+afw
+aNN
+aOa
+afw
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aGG
+aPQ
+aPQ
+aPQ
+aPQ
+aPQ
+aGG
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aZA
+aZA
+aRm
+aZJ
+aZA
+aFw
+aac
+aac
+awo
+aWA
+aWA
+aWA
+aaN
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aED
+aMp
+aGB
+aWJ
+aMp
+aDG
+aED
+aac
+aac
+aac
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aIa
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(19,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aEU
+aEU
+aEU
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aCN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aIV
+aIV
+aaN
+aIV
+aIV
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aac
+aaN
+aaN
+aaw
+aaw
+acG
+aaw
+aaw
+aaw
+aaw
+aaw
+aLU
+aLU
+aLU
+aLU
+aLU
+aLU
+bgw
+aCI
+bck
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aGG
+aPQ
+aPQ
+aPQ
+aPQ
+aPQ
+aGG
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aHd
+aZA
+aZA
+aZA
+aZA
+aFw
+aFw
+aRJ
+ayO
+aWA
+aWA
+aWA
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+azZ
+ags
+aEb
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aED
+aKg
+aED
+aED
+aRw
+aED
+aED
+aac
+aac
+aac
+aac
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aIa
+aGh
+aZr
+aJl
+apu
+aJl
+aJl
+aJl
+aJl
+aJl
+aZr
+aJl
+aJl
+aJl
+aJl
+aZr
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(20,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aIV
+aIV
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaw
+aaO
+auU
+adt
+aew
+arD
+azw
+aaw
+aaw
+aaw
+aaw
+aaw
+aaw
+aaw
+bgc
+aCI
+bck
+aac
+aac
+aac
+bdR
+bds
+bdm
+aac
+aac
+aac
+aac
+aGG
+aPQ
+aPQ
+aPQ
+aPQ
+aPQ
+aGG
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+amD
+aSg
+aRB
+aZA
+aRB
+aTL
+aTP
+aRd
+aGM
+aRo
+aWA
+aWA
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aUM
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aED
+aYy
+aJC
+aED
+aMp
+aXR
+aED
+aac
+aac
+aac
+aac
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aIa
+aGh
+aJl
+aZr
+aJl
+aJl
+aJl
+aZr
+aJl
+apu
+aJl
+aJl
+aJl
+aJl
+apu
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(21,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aSl
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aIV
+aIV
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaw
+abk
+auU
+auU
+ahp
+arO
+auU
+aJN
+aMj
+aMt
+aMH
+aMP
+aMV
+aaw
+aqk
+aCI
+bck
+bbL
+aaN
+bbx
+bbx
+bbx
+bgA
+bbx
+bbx
+bbx
+aac
+aGG
+aPQ
+aPQ
+aPR
+aPQ
+aPQ
+aGG
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aSV
+aSV
+aHE
+aUK
+aZA
+aFw
+aFw
+aRM
+ayO
+aWA
+aSL
+aWA
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aSl
+ags
+ags
+aVE
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aED
+aIu
+aRq
+aED
+aMp
+aAZ
+aED
+aac
+aac
+aac
+aac
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aIa
+aGh
+aJl
+aJl
+aZr
+aPi
+aZr
+aJl
+aJl
+aJl
+aJl
+aJl
+aPi
+aJl
+aJl
+aZr
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(22,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaw
+abt
+auU
+auU
+aoO
+asc
+auU
+aJR
+aMk
+aND
+auU
+auU
+auU
+aNo
+aCI
+aCI
+bck
+bbL
+aaN
+bbx
+aSo
+aSo
+aSo
+aSo
+aSo
+bbx
+aac
+aFd
+aGG
+aGG
+aGG
+aGG
+aGG
+aFd
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aFw
+aFw
+aFw
+aFw
+aFw
+aFw
+aac
+aph
+ayO
+aWA
+aSL
+aWA
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aAA
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aED
+aED
+aED
+aED
+aMp
+aMp
+aED
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aIa
+aGh
+aJl
+aCM
+aJl
+aPi
+aJl
+aJl
+aPi
+aPi
+aJl
+aJl
+aPi
+aJl
+aCM
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(23,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaw
+abI
+acR
+adx
+aRn
+asE
+aDm
+aJT
+aMm
+aMx
+aMJ
+aMQ
+aMJ
+aNp
+aZo
+bci
+bcq
+bbL
+aaN
+bby
+aSo
+aSo
+aSo
+aSo
+aSo
+bbI
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aph
+ayO
+aWA
+aSL
+aWA
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aCl
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aVZ
+aER
+aMp
+aAQ
+aMp
+aKM
+aED
+ags
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aIa
+aGh
+aJl
+aCM
+aJl
+aPi
+aXs
+aXs
+aPi
+aPi
+aJl
+aZr
+aPi
+aJl
+aCM
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(24,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaw
+aaw
+aRn
+aaw
+aaw
+asF
+aaw
+aaw
+aaw
+aMA
+auU
+auU
+auU
+aNo
+aCI
+aCI
+bck
+bbL
+aaN
+bbx
+aSo
+aSo
+aSo
+aSo
+aSo
+bbx
+bbv
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aSL
+aWA
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aNF
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aQg
+aTi
+aMp
+aMp
+aMp
+aMp
+aYT
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aIa
+aGh
+aJl
+aCM
+aJl
+aPi
+aJl
+aZr
+aJl
+aJl
+aJl
+aJl
+aPi
+aJl
+aCM
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(25,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ayV
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaw
+aCi
+auU
+auU
+arC
+atG
+aIE
+aKX
+aMr
+aCi
+auU
+aMT
+aMY
+aaw
+aqk
+aCI
+bck
+bbL
+aaN
+bbx
+bbx
+bbx
+bbE
+bbx
+bbx
+bbx
+bbv
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aaN
+aaN
+aWs
+aaN
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aED
+aMz
+aMz
+aED
+aED
+aED
+abe
+aKA
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aIa
+aGh
+aJl
+aJl
+aJl
+aJl
+aJl
+aZr
+aJl
+aJl
+apu
+aJl
+aJl
+aJl
+aJl
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(26,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ayV
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaw
+aCi
+auU
+aei
+auU
+auU
+auU
+aMi
+aaw
+aaw
+aML
+aaw
+aaw
+aaw
+bgc
+aCI
+bck
+bbM
+avS
+avS
+avS
+avS
+avS
+avS
+avS
+avS
+bbK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aIa
+aGh
+aJl
+apu
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(27,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ayV
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaw
+acs
+add
+adt
+auU
+auU
+auU
+auU
+auU
+auU
+auU
+aMU
+aMD
+aaw
+aKP
+aCI
+bck
+aCI
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awo
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aIa
+aGh
+aJl
+aJl
+aJl
+aPi
+aPi
+aPi
+aJl
+aJl
+aJl
+aJl
+aPi
+aPi
+aZr
+aZr
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(28,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aZS
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaw
+aCi
+auU
+adt
+auU
+aut
+auU
+auU
+auU
+auU
+auU
+aMU
+aMZ
+aaw
+bgx
+aCI
+aOA
+bci
+anq
+anq
+anq
+anq
+anq
+anq
+anq
+anq
+anq
+anq
+anq
+bbZ
+ayO
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aaN
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ayV
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aSl
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aIa
+aGh
+aJl
+aJl
+aZr
+aJl
+aJl
+aJl
+aJl
+aJl
+aZr
+aJl
+aJl
+aJl
+aJl
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(29,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aZS
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aZS
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaw
+acA
+auU
+auU
+auU
+auy
+aJH
+add
+aMs
+aMC
+aMO
+aMO
+aNh
+aaw
+ayQ
+aCI
+bck
+apR
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+apR
+ahY
+ayO
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aRG
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aIa
+aGh
+aJl
+aZr
+aJl
+aJl
+aJl
+aJl
+aCM
+aCM
+aCM
+aJl
+aJl
+aJl
+aJl
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(30,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+ags
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaw
+aaw
+aRn
+aaw
+aaw
+avu
+auU
+aQC
+auU
+aMD
+aaw
+aaw
+aaw
+aaw
+bbJ
+aKP
+bck
+ayO
+aQl
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQl
+aKP
+ahY
+apR
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+apR
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aaN
+aNv
+aIV
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aIa
+aGh
+aJl
+aPi
+aJl
+aJl
+apu
+aJl
+aJl
+aJl
+aJl
+aJl
+aPi
+aPi
+aXs
+aPi
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(31,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+ags
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+bbv
+aaN
+aaN
+aaN
+aRn
+avR
+aJI
+aRn
+aJI
+aMF
+aRn
+aaN
+bgu
+aaN
+bbv
+aKP
+bck
+ayO
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aKP
+aUP
+anq
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+aRF
+anq
+bcb
+bcd
+bce
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aLU
+aaN
+aZS
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aIa
+aGh
+aJl
+aPi
+aJl
+aPi
+aJl
+aJl
+aJl
+aZr
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(32,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+ags
+ags
+aED
+aED
+aED
+aED
+aED
+aED
+aED
+aED
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+bbv
+aaN
+bbx
+bbx
+bbx
+bbx
+bbi
+bbx
+bbD
+bbx
+bbx
+bbx
+bbx
+bbx
+bbv
+aKP
+bck
+ayO
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aKP
+ahY
+ayO
+aQl
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+abK
+aaN
+aaN
+bbP
+avS
+avS
+avS
+avS
+avS
+avS
+avS
+avS
+avS
+avS
+bbJ
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aIa
+aGh
+aJl
+aPi
+aJl
+aPi
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aZr
+aJl
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(33,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+ags
+ags
+aED
+aBs
+aHj
+aAj
+aGI
+aKJ
+azy
+aED
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+bbv
+aaN
+bby
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+bbI
+bbv
+aKP
+bck
+ayO
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aKP
+ahY
+ayO
+aaN
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aaN
+bbx
+bbx
+bbD
+bbx
+bbx
+bbx
+bbD
+bbx
+bbx
+bbv
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+ayV
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aIa
+aGh
+aJl
+aPi
+aJl
+aJl
+aJl
+aPi
+aPi
+aPi
+aXs
+aPi
+aJl
+aJl
+aJl
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(34,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+ags
+ags
+abe
+aKG
+aHj
+aAj
+aAj
+aKJ
+aMp
+aED
+aED
+aED
+aED
+aED
+aED
+aED
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+bbv
+aaN
+bbx
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+bbx
+bbv
+aKP
+bck
+ayO
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aKP
+ahY
+ayO
+aaN
+aqr
+aQn
+aQo
+aQr
+aQw
+aqr
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+aqr
+aaN
+bby
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+bbI
+bbv
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aIa
+aGh
+aJl
+aJl
+aZr
+aJl
+aJl
+aZr
+aJl
+aJl
+aJl
+aJl
+aJl
+aNz
+aJl
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aac
+aac
+aac
+aac
+aJx
+"}
+(35,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+ags
+ags
+aAY
+aMp
+aHj
+aAj
+aAj
+aKJ
+aMp
+aGo
+aMp
+aMp
+aMp
+aAQ
+aIQ
+aED
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+bbv
+aaN
+bbx
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+bbx
+bbv
+aKP
+bck
+ayO
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aKP
+ahY
+ayO
+aaN
+anP
+aOE
+aOE
+aOE
+aOE
+aqr
+aOE
+aOE
+akw
+aOE
+aOE
+aOE
+aPS
+aaN
+bbx
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+bbx
+bbv
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aIa
+aGh
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aNz
+apu
+aZr
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aac
+aac
+aac
+aac
+aJx
+"}
+(36,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+ags
+ags
+aED
+aEC
+aMp
+aAu
+aAu
+aMp
+aMp
+aGo
+aMp
+aMp
+aMp
+aMp
+aIQ
+aED
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+bbv
+aaN
+bbx
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+bbx
+bbv
+aKP
+bck
+ayO
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aKP
+ahY
+ayO
+apR
+acy
+aOE
+aOE
+aOE
+aOE
+aPS
+aOE
+akj
+aqJ
+amF
+aOE
+aOE
+aPS
+aaN
+bby
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+bbI
+bbv
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aIa
+aGh
+aJl
+aZr
+aJl
+apu
+aJl
+aPi
+aPi
+aPi
+aJl
+aJl
+aJl
+aNz
+aJl
+aZr
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aJx
+"}
+(37,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aMp
+aMp
+aMp
+aMp
+aVW
+aED
+aED
+aED
+aED
+aMp
+aMp
+aQY
+aED
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+bbv
+aaN
+bby
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+aSo
+bbI
+bbv
+aKP
+bck
+ayO
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aKP
+ahY
+ayO
+apR
+acy
+aOE
+aOE
+aOE
+aOE
+aPS
+aOE
+aOE
+akY
+aOE
+aOE
+aOE
+aqr
+aaN
+bbx
+bbx
+bbE
+bbx
+bbx
+bbx
+bbE
+bbx
+bbx
+bbv
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aIa
+aGh
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aZr
+apu
+aJl
+aNz
+aJl
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aJx
+"}
+(38,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aBo
+aMp
+aMp
+aMp
+aMp
+aGo
+aYy
+aQG
+aED
+aMp
+aMp
+aMp
+aED
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+bbv
+aaN
+bbx
+bbx
+bbx
+bbx
+bbE
+bbx
+bbE
+bbx
+bbx
+bbx
+bbx
+bbx
+bbv
+aKP
+bck
+ayO
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aKP
+ahY
+ayO
+aaN
+anP
+abJ
+aQp
+aQt
+aQy
+aqr
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+aqr
+aaN
+aaN
+aae
+aGK
+aHo
+aHo
+aHo
+aIZ
+aKd
+aaN
+bbv
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aIa
+aGh
+aJl
+aJl
+aPi
+aPi
+aJl
+aJl
+apu
+aJl
+aJl
+aJl
+aJl
+aNz
+aJl
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aJx
+"}
+(39,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aJc
+aMp
+aMp
+aMp
+aMp
+aTJ
+aED
+aYy
+aYy
+aED
+aMp
+aMp
+aMp
+aED
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+bbv
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+bbv
+aKP
+bck
+ayO
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aKP
+ahY
+ayO
+aaN
+aqr
+abJ
+abJ
+aQu
+abJ
+aqr
+aOE
+aOE
+aPU
+aOE
+aqr
+aPS
+aqr
+aqr
+aqr
+aqr
+aBm
+aOE
+aOE
+aOE
+aBm
+aqr
+aqr
+aqr
+aLn
+aLn
+aLn
+aLn
+aLn
+aLn
+aLn
+aLn
+aLn
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aIa
+aGh
+aJl
+aJl
+aJl
+aJl
+aZr
+aJl
+aJl
+aJl
+aJl
+aPi
+aJl
+aJl
+aJl
+apu
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aJx
+"}
+(40,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aMp
+aMp
+aMp
+aMp
+aMp
+aED
+aYy
+aYy
+aED
+aMp
+aMp
+aMp
+aED
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aZS
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+bbt
+avS
+avS
+aqr
+aqr
+aar
+aar
+aqr
+aqr
+avS
+avS
+avS
+avS
+avS
+bbK
+aKP
+bck
+ayO
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aKP
+ahY
+ayO
+aaN
+aqr
+abJ
+abJ
+abJ
+abJ
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aFF
+aOE
+aOE
+aOE
+aOE
+aBm
+aOE
+aOE
+aOE
+aBm
+aOE
+aOE
+aqr
+aLo
+aLv
+aLH
+aLI
+aLI
+aLI
+aLI
+aLI
+aLn
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aIa
+aGh
+aJl
+aZr
+aZr
+aXs
+aJl
+aCM
+aCM
+aCM
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aJx
+"}
+(41,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aQP
+aQP
+aQP
+aQP
+aMp
+aED
+aFU
+aNJ
+aED
+aAZ
+aKf
+aMp
+aED
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aRi
+aKi
+aFw
+aAb
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aeQ
+afg
+afg
+agw
+aqr
+aaN
+aaN
+aaN
+aaN
+aWs
+aaN
+aKP
+bck
+ayO
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aKP
+ahY
+ayO
+aaN
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aOY
+aNu
+aNu
+aNu
+aqr
+atq
+aLC
+aLC
+aLC
+aLC
+aGN
+aLC
+aLC
+aLC
+aGN
+aHT
+adj
+aqr
+aLp
+aLw
+aLv
+aLv
+aLv
+aLv
+aLv
+aLv
+aLn
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+ags
+ags
+ags
+ags
+ags
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aIa
+aGh
+aJl
+aJl
+aJl
+aXs
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aZr
+aJl
+aPi
+aPi
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aJx
+"}
+(42,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aMp
+aMp
+aMp
+aMp
+aVW
+aED
+aKg
+aED
+aED
+aED
+aED
+aRw
+aED
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aAb
+aFw
+aFw
+aZk
+aEF
+aUr
+aFw
+aAb
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aar
+aCv
+aOE
+aOE
+aOE
+aar
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aKP
+bck
+ayO
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aKP
+ahY
+ayO
+aaN
+aqr
+aBl
+aOX
+aBl
+aOE
+aOE
+aNu
+aNu
+aqr
+aqr
+aqr
+aqr
+aOE
+aqr
+aqr
+aOE
+aOE
+aOE
+aOE
+aOE
+aqr
+aKe
+aKI
+aqr
+aqr
+aqr
+aqr
+aLv
+aLv
+aLO
+aLS
+aLS
+aLn
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aaN
+aac
+aac
+ags
+aZS
+aZS
+aZS
+aZS
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aIa
+aGh
+aJl
+aPi
+aJl
+aJl
+aZr
+aJl
+apu
+aJl
+aJl
+aJl
+aJl
+aZr
+aJl
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aJx
+"}
+(43,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aAY
+aMp
+aMp
+aMp
+aMp
+aED
+aYy
+aYy
+aED
+aQx
+aMp
+aMp
+aED
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aAb
+aAb
+aJb
+aEF
+aPO
+aQq
+aFw
+aAb
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aeR
+aOE
+aga
+ade
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aKP
+bck
+ayO
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aKP
+ahY
+ayO
+aaN
+aqr
+aOE
+aOE
+aOE
+aOE
+aqr
+aNu
+aNu
+aPa
+aqr
+aOE
+aOE
+aOE
+aOE
+aqr
+aOE
+aQA
+aQA
+aQB
+aOE
+aqr
+aOE
+aBm
+aqr
+aOE
+aOE
+aqr
+aLv
+aLv
+aqr
+aqr
+aqr
+aLn
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aLU
+aZS
+aZS
+aZS
+aZS
+aZS
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aIa
+aGh
+aJl
+aPi
+aJl
+aPi
+aJl
+aJl
+aJl
+aJl
+aJl
+aPi
+aJl
+aJl
+aJl
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aJx
+"}
+(44,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aQP
+aXO
+aZi
+aQP
+aMp
+aED
+aYy
+aTH
+aED
+aQx
+aMp
+aVW
+aED
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aAb
+aFw
+aUK
+aEF
+aEF
+aEF
+aAb
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aqr
+aqr
+aOE
+aOE
+aqr
+aqr
+aqr
+aaN
+aaN
+aaN
+aaN
+aTQ
+aKP
+bck
+ayO
+aQl
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aKP
+ahY
+ayO
+aaN
+aqr
+aOE
+aOE
+aOE
+aEt
+aqr
+aNu
+aNu
+aNu
+aqr
+agN
+aOE
+aDJ
+aEm
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aOE
+aBm
+aOE
+aOE
+aOE
+acy
+aLv
+aLv
+aqr
+aLT
+aqr
+aLn
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aNv
+aZS
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aIa
+aGh
+aJl
+aPi
+aJl
+aPi
+aJl
+aCM
+aCM
+aCM
+aJl
+aPi
+aJl
+aJl
+aJl
+aZr
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aac
+aac
+aac
+aac
+aJx
+"}
+(45,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aED
+aED
+aED
+aED
+aED
+aED
+aIu
+aYy
+aED
+aSi
+aWo
+aAR
+aED
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aXv
+aUr
+aEF
+aZN
+aRS
+aEF
+aPT
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aep
+asK
+aOE
+aOE
+asK
+ahH
+aqr
+abF
+awl
+awl
+awl
+awl
+aCI
+bck
+aCI
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+apR
+ahY
+ayO
+aaN
+aqr
+aBl
+aBl
+aBl
+aFF
+aqr
+aMa
+aOZ
+aMa
+aqr
+aBk
+aOE
+aOE
+aOE
+aqr
+aFI
+aNu
+aNu
+aNu
+ajr
+ajr
+aLC
+aBm
+aKd
+aOE
+aOE
+aqr
+aLv
+aLv
+acy
+aLX
+aqr
+aLn
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aIV
+aNv
+aNv
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aIa
+aGh
+aJl
+aJl
+aJl
+aPi
+aJl
+aJl
+aJl
+aJl
+aJl
+aPi
+aJl
+apu
+aJl
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(46,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aED
+aED
+aED
+aED
+aED
+aED
+aED
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aPT
+aRB
+aKi
+aRS
+aQq
+aUK
+aRB
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aNA
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aeq
+aOE
+aby
+aby
+aCv
+aeO
+aqr
+abG
+aCI
+aCI
+aCI
+aCI
+apR
+aTY
+aRd
+aRd
+aRd
+aRd
+aRd
+aRd
+aRd
+aRd
+aRd
+aRd
+aRd
+aRd
+aUQ
+ayO
+aaN
+aqr
+anP
+anP
+anP
+adI
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aNu
+aNu
+aNu
+aNu
+aNu
+aJa
+aOE
+aBm
+aqr
+aqr
+aqr
+aqr
+aLJ
+aLv
+aqr
+aMa
+aqr
+aLn
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aIa
+aGh
+aJl
+apu
+aJl
+aPi
+aJl
+aJl
+aJl
+aJl
+aZr
+aPi
+aJl
+aZr
+aJl
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(47,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aFw
+aEo
+aRB
+aEF
+aLG
+aGz
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aeL
+aJM
+aby
+aby
+aOE
+ahI
+aqr
+aOr
+aCI
+apR
+apR
+apR
+apR
+aPZ
+apR
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+apR
+ano
+ayO
+aat
+aab
+aab
+aaF
+aab
+ano
+awt
+aab
+aab
+aeW
+aqr
+aBl
+aBl
+aOE
+aEn
+aqr
+aNu
+aNu
+aHq
+aNu
+aIk
+aJd
+aOE
+aBm
+aqr
+aLq
+aLy
+aqr
+aLv
+aLv
+aqr
+aqr
+aqr
+aLn
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aIa
+aGh
+aJl
+aJl
+aJl
+aJl
+aZr
+aJl
+apu
+aJl
+aZr
+aJl
+aJl
+aJl
+aJl
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(48,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aAb
+aFw
+aAb
+aEF
+aRB
+aAb
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aHg
+ags
+aFA
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aeM
+aOE
+aby
+aby
+aOE
+ahK
+aqr
+abG
+aCI
+apR
+apR
+apR
+apR
+aPZ
+ayO
+aat
+aaN
+aaN
+aqr
+aqr
+aar
+aar
+aar
+aqr
+aqr
+aKP
+adb
+apR
+awl
+awl
+awl
+awl
+awl
+aRk
+awl
+awl
+awl
+awo
+acy
+aOE
+akW
+aDK
+aOE
+aqr
+aqr
+aGO
+aqr
+aHS
+aGZ
+aJf
+aOE
+aKK
+aLk
+aqv
+aOE
+acy
+aLv
+aLv
+aLP
+aMd
+aMg
+aLn
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aIa
+aGh
+aJl
+aZr
+aZr
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aPi
+aPi
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(49,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aAb
+aAb
+aAb
+aFm
+aAb
+aAb
+aFw
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aSl
+ags
+aSR
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aeP
+aOE
+aOE
+aOE
+aOE
+ahM
+aqr
+aDN
+awk
+awk
+awk
+awk
+apR
+aPZ
+ayO
+aab
+aaN
+aaN
+aar
+aGi
+aGj
+aGi
+aGi
+aGi
+aar
+aKP
+adc
+aRd
+aRd
+aRd
+aRd
+aRd
+aRd
+asD
+apR
+apR
+apR
+ayO
+aae
+adj
+akW
+aDL
+aOE
+aqr
+aFL
+aGQ
+aqr
+aOE
+aOE
+aOE
+aOE
+aKL
+aKd
+aLs
+aLz
+aqr
+aLv
+aLv
+aLv
+aMe
+aLv
+aLn
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aIa
+aGh
+aJl
+aPi
+aPi
+aJl
+aJl
+aXs
+aXs
+aXs
+aJl
+aPi
+aPi
+aJl
+aJl
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(50,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aac
+aac
+aac
+aAb
+aFw
+aPT
+aAb
+aFw
+aAb
+aAb
+aFw
+aRB
+aFw
+aFw
+aAb
+aac
+aac
+aac
+aac
+aac
+aNF
+ags
+ags
+aEb
+ags
+ags
+ags
+ags
+aSR
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aqr
+acP
+aRP
+aOE
+agP
+aqr
+aqr
+aqr
+aqr
+aqr
+aab
+aab
+aKP
+ano
+ayO
+aab
+aaN
+aaN
+aar
+aOE
+aOE
+aOE
+aOE
+aOE
+aar
+aKP
+apR
+apR
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+apR
+apR
+ayO
+acy
+aBm
+aOE
+aOE
+aOE
+aqr
+aFO
+aGR
+aHr
+aqv
+abJ
+arI
+abJ
+aKN
+aqr
+aqr
+aqr
+aqr
+aLJ
+aLv
+aLv
+aLv
+aLv
+aLn
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aIa
+aGh
+aJl
+aJl
+aJl
+aJl
+aJl
+aZr
+aJl
+aJl
+aJl
+aXs
+aJl
+aZr
+aJl
+aZr
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(51,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aac
+aac
+aac
+aFw
+aAb
+aPL
+aRm
+aAb
+aEF
+aVC
+aFw
+aFm
+aKa
+aTX
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aBy
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+afU
+aOE
+aOE
+agP
+ahN
+aiB
+akc
+akT
+aqr
+awh
+aab
+aKP
+ano
+ayO
+aab
+aaN
+aaN
+aar
+aGi
+aOE
+aGi
+aOE
+aGi
+aar
+aKP
+apR
+ayO
+akA
+akA
+akA
+akA
+akA
+akA
+akA
+aKP
+apR
+aoh
+aqr
+aBn
+aOE
+aOE
+abZ
+aqr
+aFS
+aGS
+aqr
+aHU
+abJ
+aJq
+aKk
+aBm
+aOE
+aRP
+aLA
+aqr
+aLv
+aLN
+aLN
+aLN
+aLN
+aLn
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aIa
+aGh
+aJl
+aJl
+apu
+aJl
+aPi
+aPi
+aPi
+aPi
+aPi
+aJl
+aJl
+aJl
+apu
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(52,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aFw
+aUK
+aQq
+aAw
+aUK
+aRB
+aFm
+aRB
+aRB
+aLZ
+aQq
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aNF
+ags
+ags
+aWk
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+afa
+aOE
+aby
+aby
+aby
+aby
+aby
+aby
+aqr
+aau
+aat
+aKP
+ano
+ayO
+aab
+aaN
+aaN
+aqr
+aGi
+aOE
+aGi
+aOE
+aGi
+aqr
+aKP
+ajt
+ayO
+akA
+akA
+akA
+akA
+akA
+akA
+akA
+aKP
+apR
+ayO
+aae
+aBp
+aii
+aii
+aOE
+aqr
+aqr
+aqr
+aqr
+aOE
+abJ
+abJ
+aKn
+aBm
+aVJ
+aOE
+aLB
+aqr
+aLK
+aLN
+aLN
+aLN
+aLN
+aLn
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aIa
+aGh
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(53,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aFw
+aOw
+aRB
+aRB
+aQq
+aQq
+aPL
+aFw
+ayW
+aFm
+aEF
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+afb
+aIh
+aby
+agR
+aby
+aby
+aby
+aby
+alP
+awl
+awl
+apR
+ano
+ayO
+aab
+aaN
+aaN
+aqr
+aGi
+aOE
+aGi
+aOE
+aGi
+aqr
+aKP
+apR
+ayO
+akA
+akA
+akA
+akA
+akA
+akA
+akA
+aKP
+apR
+ayO
+aae
+aBq
+aCJ
+aCJ
+aHT
+aLC
+aLC
+aGU
+aHt
+aHV
+aFt
+aFt
+aKo
+aKO
+aqr
+aqr
+aqr
+aqr
+aLv
+aLN
+aLN
+aLN
+aLN
+aLn
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aLU
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aIa
+aGh
+aZr
+aJl
+aCM
+aJl
+aJl
+aZr
+aZr
+aZr
+aJl
+aJl
+aCM
+aJl
+aJl
+aJl
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(54,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aFw
+aAb
+aFw
+aAb
+aFw
+aAb
+aAb
+aFw
+aUr
+awQ
+aPL
+aAb
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aar
+afe
+afB
+aby
+aby
+aby
+agR
+aby
+aby
+aQQ
+aRd
+aRd
+azB
+ano
+ayO
+aab
+aaN
+aaN
+aqr
+aGi
+aOE
+aGi
+aOE
+aGi
+aqr
+aKP
+ajt
+ayO
+akA
+akA
+akA
+akA
+akA
+akA
+akA
+aKP
+apR
+ayO
+aae
+aBr
+aCK
+aii
+aOE
+aqr
+aOE
+aFF
+aHw
+aOE
+aOE
+aqv
+aOE
+aKR
+aKd
+aLq
+aLD
+aqr
+aLJ
+aLv
+aLv
+aLv
+aLv
+aLn
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aLU
+aac
+aac
+aac
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aGh
+aZr
+aJl
+aCM
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aJl
+aCM
+aJl
+aJl
+aZr
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(55,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aAb
+aAb
+aAb
+aAb
+aAb
+aAb
+aAb
+aFw
+aPT
+aFw
+aAb
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aff
+afD
+aby
+aby
+aby
+aby
+aby
+aby
+alP
+awk
+awk
+aCI
+aPZ
+ayO
+aab
+aaN
+aaN
+aqr
+aGi
+aOE
+aGi
+aOE
+aGi
+aqr
+aKP
+apR
+ayO
+akA
+akA
+akA
+akA
+akA
+akA
+akA
+aKP
+apR
+ayO
+aqr
+aqr
+aqr
+aqr
+acy
+aqr
+aOE
+aFF
+aqr
+aqr
+aqr
+aqr
+aOE
+aqv
+aLm
+aiy
+adN
+acy
+aLv
+aLv
+aLv
+aMf
+aLv
+aLn
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aLU
+aLU
+aac
+aac
+aac
+aIa
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aPv
+aPv
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(56,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+acX
+aOE
+aOE
+agT
+ahO
+ahO
+ahO
+ahO
+aqr
+aab
+aau
+aKP
+ano
+ayO
+aab
+aqr
+aqr
+aqr
+aGi
+aOE
+aGi
+aVh
+aGi
+aqr
+aKP
+ajt
+ayO
+akA
+akA
+akA
+akA
+akA
+akA
+akA
+aKP
+apR
+aoh
+aqr
+aBv
+aCP
+aDP
+aNu
+aqr
+aOE
+aFF
+aqr
+aHW
+aIm
+aqr
+aqr
+aqr
+aqr
+aLu
+aLE
+aqr
+aLn
+aLn
+aLn
+aLn
+aLn
+aLn
+aph
+ayO
+aWA
+aSL
+aWA
+aKq
+aQl
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQl
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQl
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aLU
+aLU
+aLU
+aXy
+aLU
+aZP
+aGh
+aCG
+aCG
+aCG
+aCG
+aCG
+aCG
+aGh
+aZW
+aZt
+aZt
+aZt
+aZt
+aZx
+aZx
+aZx
+aZx
+aZt
+aZt
+aZt
+aZt
+aZW
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(57,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aqr
+aar
+aar
+aqr
+aqr
+aar
+aar
+aqr
+aqr
+aab
+aab
+aKP
+ano
+ayO
+aab
+aqr
+azO
+agl
+agl
+agl
+aHu
+aOE
+aOE
+aar
+aKP
+apR
+ayO
+akA
+akA
+akA
+akA
+akA
+akA
+akA
+aKP
+apR
+ayO
+aqr
+aNu
+aCR
+aNu
+aNu
+aqr
+aOE
+aFF
+aae
+aHT
+aIo
+adj
+aOE
+aKT
+aqr
+aqr
+aqr
+aqr
+aaN
+aaN
+aaN
+aaN
+afY
+awl
+apR
+ayO
+aWA
+aSL
+aWA
+aHI
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+aDp
+aPP
+aZt
+aZt
+aUW
+aZt
+aUW
+aCG
+aGh
+aZt
+aZt
+aZt
+aZt
+aZt
+aZx
+aMq
+aMq
+aZx
+aZt
+aZt
+aZt
+aZt
+aZt
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(58,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aKP
+ano
+ayO
+aab
+aar
+afU
+agl
+agl
+agl
+aOE
+aOE
+aJL
+aar
+aKP
+ajt
+ayO
+akA
+akA
+akA
+akA
+akA
+akA
+akA
+aKP
+apR
+ayO
+aqr
+aBx
+aCS
+aDQ
+aNu
+aqr
+aFX
+aFF
+aqr
+aBM
+aCv
+aJs
+aKr
+aKU
+aqr
+aaN
+abK
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+apR
+awk
+awn
+aWA
+aSL
+aWA
+aKS
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+aTv
+aPP
+aZt
+aZt
+aZt
+aZt
+aZt
+aCG
+aGh
+aGu
+aZt
+aZt
+aZt
+aGh
+aWl
+aWl
+aWl
+aWl
+aGh
+aZt
+aZt
+aZt
+aTV
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(59,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aKP
+ano
+ayO
+aab
+aar
+acS
+agl
+agl
+agl
+aOE
+aOE
+aJW
+aqr
+aKP
+apR
+ayO
+akA
+akA
+akA
+akA
+akA
+akA
+akA
+aKP
+apR
+aoh
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aOE
+aFF
+aHx
+aOE
+aOE
+aJt
+aOE
+aKV
+aqr
+aVq
+abK
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aWA
+aSL
+aWA
+aKq
+aQl
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQl
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQl
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aLU
+aLU
+aXy
+aLU
+aZP
+aGh
+aCG
+aUW
+aZt
+aZt
+aZt
+aCG
+aGh
+aFr
+aZt
+aZt
+aZt
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aZt
+aZt
+aZt
+aZt
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(60,1,1) = {"
+aJx
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aKP
+ano
+ayO
+aab
+aqr
+afU
+agl
+agl
+agl
+aHH
+aOE
+aJX
+aqr
+aKP
+ajt
+ayO
+akA
+akA
+akA
+akA
+akA
+akA
+akA
+aKP
+apR
+aoi
+aqr
+aOE
+aCT
+aCT
+aCT
+aqr
+aOE
+aFF
+aHx
+aJM
+aIr
+aJu
+aKs
+aKW
+aqr
+aVz
+abK
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aWA
+aSL
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aLU
+aLU
+aUY
+aGh
+aCG
+aZt
+aPo
+aPo
+aUW
+aCG
+aGh
+aFW
+aZt
+aZt
+aZt
+aSq
+aZt
+aUW
+aUW
+aZt
+aSq
+aZt
+aUW
+aZt
+aKD
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(61,1,1) = {"
+aJx
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aVS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aat
+aab
+aab
+aab
+aab
+aab
+aab
+aat
+aab
+aab
+aab
+aab
+aab
+aab
+aat
+aKP
+ano
+ayO
+aab
+aar
+acS
+agl
+agl
+agl
+aOE
+aOE
+aJX
+aar
+aKP
+apR
+ayO
+akA
+akA
+akA
+akA
+akA
+akA
+akA
+aKP
+apR
+ayO
+aar
+aBC
+aii
+aii
+aEp
+aqr
+aBM
+aFF
+aqr
+aHX
+aOE
+aJv
+aOE
+aLa
+aqr
+aVu
+abK
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aEg
+aSM
+aEg
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aLU
+aLU
+aUY
+aGh
+aCG
+aZt
+aXz
+aXz
+aZt
+aCG
+aGh
+aMo
+aZt
+aUW
+aZt
+aSU
+aZt
+aZt
+aZt
+aZt
+aSU
+aZt
+aUW
+aZt
+aHn
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(62,1,1) = {"
+aJx
+aac
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aab
+aKP
+ano
+ayO
+aab
+aar
+acP
+agl
+agl
+agl
+aIh
+aOE
+aLd
+aar
+aKP
+ajt
+ayO
+akA
+akA
+akA
+akA
+akA
+akA
+akA
+aKP
+apR
+ayO
+aar
+aBI
+aii
+aii
+aOE
+aqr
+aOE
+aFF
+aae
+aHZ
+aIt
+aJz
+aKv
+aLb
+aqr
+aaN
+abK
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aEg
+aSM
+aEg
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aLU
+aUY
+aGh
+aCG
+aUW
+aJe
+aJe
+aZt
+aCG
+aGh
+aFr
+aZt
+aUW
+aZt
+aPd
+aZt
+aZt
+aZt
+aZt
+aIO
+aZt
+aZt
+aZt
+aFQ
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(63,1,1) = {"
+aJx
+aac
+ags
+ags
+ags
+aac
+ags
+ags
+aRE
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aab
+aKP
+ano
+ayO
+aab
+aqr
+aez
+agl
+agl
+agl
+aOE
+aOE
+aJX
+aqr
+aKP
+apR
+ayO
+akA
+akA
+akA
+akA
+akA
+akA
+akA
+aKP
+apR
+ayO
+aar
+aBJ
+aii
+aii
+aOE
+aqr
+aOE
+aFF
+aqr
+aIb
+aIy
+aBm
+aIr
+aLc
+aqr
+aaN
+abK
+aaN
+aaN
+aaN
+aaN
+aaN
+awi
+aDu
+aav
+aCW
+aEg
+aSM
+aEg
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aLU
+aUY
+aGh
+aCG
+aZt
+aXz
+aXz
+aZt
+aCG
+aGh
+aFW
+aZt
+aZt
+aZt
+aFr
+aZt
+aZt
+aZt
+aZt
+aFr
+aZt
+aZt
+aZt
+aBG
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(64,1,1) = {"
+aJx
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aaN
+aab
+aab
+aab
+aaN
+aab
+aab
+aab
+aab
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aab
+aKP
+ano
+ayO
+aab
+aqr
+aar
+aqr
+acy
+acy
+acy
+aqr
+aar
+aqr
+aKP
+apR
+ayO
+akA
+akA
+akA
+akA
+akA
+akA
+akA
+aKP
+apR
+aoj
+aqr
+aBM
+aii
+aii
+aEs
+aqr
+aOE
+aFF
+aqr
+aqr
+aqr
+aJA
+aKw
+aqr
+aqr
+aaN
+abK
+aaN
+aaN
+aaN
+aaN
+aaN
+awi
+aDv
+abs
+aCX
+aEg
+aSM
+aEg
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aLU
+aUY
+aGh
+aCG
+aZt
+aMW
+aJe
+aZt
+aCG
+aGh
+aMo
+aZt
+aUW
+aZt
+aZt
+aUW
+aUW
+aUW
+aZt
+aZt
+aZt
+aUW
+aZt
+aSn
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(65,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aaN
+aab
+aab
+aab
+aaN
+aab
+aab
+aab
+aax
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+adW
+aWA
+aWA
+aWA
+aWA
+aWA
+aNC
+aab
+aKP
+ano
+apR
+bcJ
+awl
+awl
+azu
+awl
+awl
+awl
+azu
+awl
+awl
+apR
+apR
+apR
+awl
+awl
+awl
+awl
+awl
+awl
+awl
+apR
+apR
+ayO
+acy
+aRP
+aii
+aii
+aOE
+aFg
+aOE
+aFF
+aqr
+aCd
+aIA
+aBm
+aKE
+aCd
+aqr
+aaN
+abK
+aaN
+aaN
+aaN
+aaN
+aaN
+awi
+aDv
+abs
+aCY
+aEg
+aSM
+aEg
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aLU
+aUY
+aGh
+aCG
+aZt
+aXz
+aXz
+aUW
+aCG
+aGh
+aZt
+aZt
+aUW
+aZt
+aZt
+aUW
+aUW
+aUW
+aZt
+aZt
+aZt
+aUW
+aZt
+aZt
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(66,1,1) = {"
+aJx
+ags
+aac
+aac
+aac
+ags
+ags
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+ags
+ags
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aaN
+aab
+aab
+aab
+aaN
+aab
+aab
+aab
+aab
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aab
+aKP
+ano
+aCI
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+ayO
+aar
+aOE
+aii
+aii
+aOE
+aae
+aHT
+aFF
+aqr
+aCd
+aIB
+aIF
+aKF
+aCd
+aqr
+aaN
+abK
+aaN
+aaN
+aaN
+aaN
+aaN
+awi
+aas
+abs
+aCX
+aEg
+aSM
+aEg
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aUY
+aGh
+aCG
+aZt
+aJe
+aJe
+aZt
+aCG
+aGh
+aZt
+aZt
+aZt
+aZt
+aZt
+aUW
+aUW
+aUW
+aZt
+aZt
+aZt
+aZt
+ayo
+aNT
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(67,1,1) = {"
+aJx
+ags
+ags
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aVS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aaN
+aaN
+aab
+aaN
+aaN
+aab
+aab
+aab
+aab
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aab
+aKP
+ano
+aCI
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awk
+awn
+acy
+aOE
+aDb
+aOE
+aVJ
+aFg
+aOE
+aGV
+aqr
+aId
+aIC
+aJB
+aKo
+aLe
+aKd
+aaN
+abK
+aaN
+aaN
+aaN
+aaN
+aaN
+awi
+aDx
+abs
+aCX
+aEg
+aSM
+aEg
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aUY
+aGh
+aCG
+aZt
+aUW
+aZt
+aZt
+aCG
+aGh
+aZt
+aZt
+aUW
+aZt
+aFr
+aZt
+aZt
+aZt
+aZt
+aFr
+aZt
+aUW
+aCm
+aMy
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(68,1,1) = {"
+aJx
+ags
+ags
+ags
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aaN
+aaN
+aab
+aaN
+aaN
+aab
+aab
+aab
+aab
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aWA
+aab
+aKP
+ano
+ayO
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aaF
+aab
+aab
+acQ
+aab
+aab
+aab
+acQ
+aaD
+aab
+aab
+aab
+acQ
+aok
+aqr
+aqr
+aDc
+aQO
+aqr
+aqr
+aOE
+aFF
+aqr
+aVh
+aIF
+abJ
+abJ
+aLf
+aqr
+aaN
+abK
+aaN
+aaN
+aaN
+aaN
+aaN
+awi
+aDv
+abs
+aCX
+aEg
+aSM
+aEg
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aYI
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aUY
+aGh
+aCG
+aZt
+aZt
+aZt
+aZt
+aZt
+aZt
+aZt
+aZt
+aUW
+aZt
+aPd
+aZt
+aZt
+aZt
+aZt
+aIO
+aZt
+aUW
+aTn
+aWN
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(69,1,1) = {"
+aJx
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+ags
+ags
+ags
+ags
+aac
+ags
+ags
+aac
+ags
+ags
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aat
+aab
+aab
+aab
+aab
+aab
+aab
+aat
+aab
+aab
+aab
+aab
+aab
+aab
+aat
+aKP
+ano
+ayO
+aab
+aab
+aab
+aab
+aab
+aab
+aaB
+aab
+aqr
+aqr
+aar
+aqr
+aqr
+aqr
+aar
+aqr
+aqr
+aqr
+aar
+aqr
+aqr
+aqr
+aBY
+aqr
+aBO
+aDd
+aOE
+aEt
+aqr
+aOE
+aGW
+aHy
+aLC
+aIG
+aga
+aKH
+aCd
+aqr
+aaN
+abK
+aaN
+aaN
+aaN
+aaN
+aaN
+awi
+aDv
+abs
+aCX
+aEg
+aSM
+aEg
+aQD
+aqr
+aqr
+aar
+aar
+aqr
+aqr
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aYI
+aYI
+aYI
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aUY
+aGh
+aCG
+aUW
+aZt
+aZt
+aZt
+aZt
+aZt
+aZt
+aZt
+aZt
+aZt
+aSU
+aZt
+aZt
+aZt
+aZt
+aSU
+aZt
+aUW
+aCm
+aMy
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(70,1,1) = {"
+aJx
+aac
+aac
+aac
+aNF
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+ags
+ags
+ags
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahX
+anq
+anq
+anq
+anq
+anq
+anq
+anq
+anq
+anq
+anq
+aZo
+baa
+ayO
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aqr
+aoc
+aoC
+aOE
+aqG
+alO
+aOE
+akS
+aqr
+auu
+aOE
+asK
+aOE
+aqr
+azJ
+aqr
+aBP
+aOE
+afk
+atq
+aFj
+aLC
+baX
+aqr
+aIe
+aII
+aJJ
+aqr
+aqr
+aqr
+aaN
+abK
+aaN
+aaN
+aaN
+aaN
+aaN
+awi
+aDv
+abs
+aCX
+aEg
+aSM
+aEg
+aMN
+aCg
+aCg
+aCg
+aCg
+aCg
+ade
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aYI
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQl
+aUY
+aGh
+aCG
+aZt
+aZt
+aZt
+aZt
+aZx
+aXq
+aZx
+aZt
+aZt
+aZt
+aSq
+aZt
+ayA
+ayA
+aZt
+aSq
+aZt
+aZt
+aTn
+aEV
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(71,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aat
+aab
+aab
+aab
+aab
+aaD
+aab
+aab
+ajl
+acQ
+aKS
+aRg
+awn
+acQ
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aqr
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+akS
+aqr
+auv
+amH
+amH
+axu
+aqr
+aqv
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aIL
+aJO
+aqr
+aaN
+aaN
+aaN
+abK
+aaN
+aaN
+aaN
+aaN
+aaN
+awi
+aBf
+aVd
+aCZ
+aEg
+aSM
+aEg
+aMN
+aCg
+aCg
+aCg
+aRN
+aCg
+ade
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aIa
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aGh
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(72,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+ags
+ags
+aZS
+ags
+ags
+ags
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aab
+aqr
+aqr
+ahC
+aqr
+aqr
+aqr
+alR
+aqr
+aqr
+acy
+ahr
+acy
+aqr
+aqr
+aar
+aqr
+aqr
+aqr
+aar
+aqr
+aqr
+abJ
+aoD
+apw
+aLC
+aqU
+aLC
+aLC
+aLC
+aux
+avw
+awy
+axv
+axW
+aLC
+axW
+aLC
+aLC
+aLC
+aLC
+aLC
+aLC
+aLC
+aLC
+axW
+baX
+aJP
+aqr
+aaN
+aaN
+aaN
+abK
+aaN
+aaN
+aaN
+aaN
+aaN
+ayP
+awj
+aCV
+aDa
+aEg
+aSM
+aEg
+aMN
+aCg
+aCg
+aCg
+aCg
+aCg
+ade
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQl
+aac
+aac
+aac
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aIa
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(73,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ayV
+ags
+ags
+ags
+ags
+aZS
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aab
+aqr
+agU
+aia
+agl
+aqr
+aRX
+aXM
+aoU
+aqr
+aOE
+aFF
+aOE
+aqr
+amz
+azX
+akS
+aqr
+aeP
+aHR
+aOE
+aOE
+abJ
+aoE
+apx
+aOE
+aqV
+aOE
+aOE
+aqv
+auz
+aon
+aon
+axx
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aaN
+abK
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aEg
+aSM
+aEg
+aMN
+aCg
+aCg
+aCg
+aCg
+aCg
+ade
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(74,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ayV
+aac
+aac
+ags
+ags
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aab
+aqr
+ahn
+aib
+aiI
+aqr
+akU
+alS
+aoV
+apW
+aOE
+aFF
+aOE
+aqr
+aOE
+azY
+aEc
+aqr
+aGE
+azY
+aJg
+aqr
+aod
+aoP
+apx
+aOE
+amz
+aOE
+asN
+aqr
+aVh
+aiq
+aiq
+aga
+aqr
+azL
+aAT
+aBQ
+aqr
+aNK
+aqr
+aNK
+aqr
+aNK
+aqr
+aNK
+aqr
+aNK
+aqr
+aNK
+aqr
+aaN
+abK
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayR
+aza
+azg
+azn
+aSO
+azs
+aMN
+aCg
+aCg
+aCg
+aRN
+aCg
+ade
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+ags
+ags
+ags
+aRT
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(75,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aZS
+ags
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aab
+aqr
+aDI
+aDI
+aBm
+ake
+aDI
+alU
+aDI
+aqr
+aQN
+aNE
+aQN
+aqr
+aar
+aBU
+aqr
+aqr
+aqr
+aHY
+aqr
+aqr
+aoe
+aFF
+aOE
+aOE
+aOE
+aOE
+asO
+aqr
+aOE
+aOE
+aOE
+aOE
+aqr
+azM
+aAV
+auU
+aqr
+atI
+aqr
+atI
+aqr
+atI
+aqr
+atI
+aqr
+atI
+aqr
+atI
+aqr
+aaN
+abK
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayS
+azb
+azb
+azb
+aSQ
+azb
+aMN
+aCg
+aCg
+aCg
+aRN
+aCg
+ade
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQl
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aRT
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(76,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+ags
+ags
+ags
+ags
+aZS
+aac
+aac
+ags
+ags
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aaD
+aqr
+aOE
+aDI
+aiJ
+akf
+ahC
+aQN
+ahC
+aQN
+aqt
+arF
+auw
+aqI
+aqI
+arF
+aqI
+axp
+aqI
+arF
+aqI
+aqr
+aOE
+aFF
+aOE
+amA
+amA
+aOE
+asP
+aqr
+auC
+acj
+awz
+axy
+aqr
+azN
+auU
+auU
+aqr
+aOE
+aWX
+aye
+aOE
+aOE
+aqr
+aqv
+aKu
+aQM
+aOE
+aOE
+aqr
+aaN
+abK
+aaN
+aWs
+aaN
+aaN
+aaN
+aph
+ayT
+azb
+azi
+azi
+aSS
+azb
+aMN
+aCg
+aCg
+aCg
+aCg
+aCg
+ade
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aYI
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQl
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aRT
+ags
+ags
+ags
+ags
+ags
+aRT
+ags
+ags
+ags
+ags
+ags
+aRT
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(77,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+ags
+ags
+ags
+aZS
+aZS
+aac
+ags
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aab
+agc
+adj
+aae
+aiK
+ako
+akV
+aHt
+aoW
+aHt
+aqE
+arG
+aqE
+aqE
+aqE
+aCp
+aqE
+aqE
+aqE
+aIi
+aqI
+aqr
+aqr
+adI
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+auU
+aAV
+aBS
+aqr
+aOE
+aOE
+aPK
+aOE
+aCu
+aqr
+aOE
+aOE
+aPK
+aOE
+aCu
+aqr
+aaN
+abK
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+apR
+azc
+azj
+aWA
+aSS
+azb
+aMN
+aCg
+aCg
+aCg
+aCg
+aCg
+ade
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(78,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+ags
+ags
+ags
+ayV
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aab
+agc
+aJz
+aae
+aiX
+akz
+adR
+aQN
+adR
+apZ
+aqI
+aqI
+aqI
+awB
+aqI
+aqI
+aqI
+aqI
+aqI
+arF
+aqI
+aqr
+akg
+aFF
+abJ
+aqH
+arc
+asb
+atl
+aqH
+arc
+asb
+atl
+aqH
+aqr
+azR
+auU
+aBV
+aqr
+afU
+aSe
+aCq
+aOE
+acP
+aqr
+acS
+afU
+aCq
+aOE
+acP
+aqr
+aaN
+abK
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+apR
+azd
+azk
+azi
+aSS
+azb
+aMN
+aCg
+aCg
+aCg
+aRN
+aCg
+ade
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(79,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+ags
+ags
+ags
+ags
+ayV
+aac
+ags
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aaE
+aqr
+aBm
+aDI
+aiY
+akz
+aDI
+aDI
+aDI
+aDI
+aDI
+arK
+aDI
+ake
+aDI
+aDI
+aDI
+ake
+aqI
+arF
+aqI
+acy
+aOE
+aFF
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+aqr
+aAa
+aAW
+aqr
+aqr
+aqr
+aqr
+aqr
+acy
+aqr
+aqr
+aqr
+aqr
+aqr
+acy
+aqr
+aqr
+aqr
+aqr
+aab
+aab
+aab
+aab
+aab
+aph
+apR
+azd
+azl
+azb
+aSQ
+azb
+aMN
+aCg
+aCg
+aCg
+aCg
+aCg
+ade
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aED
+aED
+aED
+aED
+aAb
+aAb
+aAb
+aAb
+aAb
+aAb
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(80,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aSR
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aah
+aab
+aah
+aab
+aah
+aab
+ahY
+aab
+agc
+aJz
+aae
+aiX
+akz
+akZ
+alV
+apc
+aDI
+alG
+akz
+auA
+awR
+aNu
+aCL
+aNu
+aDI
+aqI
+aIs
+aqE
+anF
+aLC
+aoQ
+aLC
+aLC
+aLC
+aLC
+aLC
+aLC
+aLC
+aLC
+aLC
+aLC
+alT
+aAd
+aTA
+aFt
+aDf
+aOH
+aFt
+aLC
+aLC
+bey
+beA
+beB
+beE
+beF
+beG
+aOE
+aBX
+aBX
+aqr
+aab
+aab
+aab
+aab
+aab
+aph
+ayZ
+azf
+azm
+aWA
+aST
+azb
+aMN
+aqr
+aqr
+aar
+aar
+aqr
+aqr
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aCh
+aYd
+aED
+aEF
+aAb
+aAb
+aAb
+aAb
+aAb
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(81,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+ags
+ags
+ags
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aqr
+aqr
+abn
+aqr
+aqr
+abn
+aqr
+aqr
+aqr
+aqr
+acr
+aqr
+aqr
+acr
+aqr
+aqr
+acr
+aqr
+aqr
+acr
+aqr
+aqr
+aqr
+aab
+aah
+aab
+aah
+aab
+aah
+aab
+ahY
+aab
+agc
+aJz
+aae
+aiX
+akp
+aOE
+alW
+ape
+aDI
+arb
+asa
+auH
+aqr
+axq
+aDt
+aNu
+aDI
+aqI
+arF
+aJh
+aqr
+agN
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+aFF
+aAf
+bfA
+bfA
+bfB
+bfA
+bfA
+bfC
+bfC
+bfD
+bfA
+bfA
+bfA
+bfC
+bfE
+bfC
+bfF
+bfC
+bfG
+bfH
+bfH
+bfH
+bfH
+bfH
+bfI
+bfJ
+bfJ
+bfK
+bfL
+bfM
+azb
+aMN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aED
+aKg
+aED
+aEF
+aAb
+aAb
+aAb
+aAb
+aAb
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aRT
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(82,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aaK
+aaY
+aOE
+aOE
+amk
+abD
+abD
+aOE
+aOE
+abJ
+act
+acL
+act
+acL
+act
+acL
+act
+acL
+act
+acL
+act
+acL
+aqr
+aab
+aah
+aab
+aah
+aab
+aah
+aab
+ahY
+aaF
+aqr
+ahq
+aic
+aiX
+akz
+aOE
+aOE
+alO
+aDI
+are
+asd
+avm
+aqr
+aqr
+aqr
+aEq
+aDI
+aqI
+arF
+aqI
+aqr
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+aFF
+aOE
+abJ
+abJ
+beJ
+abJ
+abJ
+aOE
+aOE
+abC
+abJ
+abJ
+abJ
+aZa
+beH
+aOE
+aRP
+abZ
+aqr
+awh
+aab
+aab
+aab
+aat
+aph
+apR
+apR
+ayO
+aWA
+aRt
+azb
+aMN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aWs
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aKz
+aYy
+aED
+aZk
+aEF
+aAb
+aAb
+aAb
+aAb
+aEF
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(83,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+akW
+aaZ
+aOE
+aOE
+amk
+aOE
+aOE
+aOE
+aOE
+abJ
+acv
+acM
+acv
+adB
+acv
+adB
+acv
+adB
+acv
+adB
+acv
+acM
+aqr
+aab
+aah
+aab
+aah
+aab
+aah
+aab
+ahY
+aab
+agc
+ahB
+aae
+aiX
+akz
+ala
+aOE
+aOE
+aDI
+aqr
+ash
+aqr
+aqr
+axw
+aDI
+aDI
+aDI
+aqI
+arF
+aqI
+aqr
+aCv
+aoR
+aoR
+aoR
+aoR
+aoR
+aoR
+aoR
+aoR
+aoR
+aoR
+aoR
+aFF
+aOE
+aqr
+aOE
+aFF
+aOE
+aOE
+aOE
+aOE
+aKm
+abJ
+abJ
+abJ
+aOE
+aFF
+aOE
+aOE
+aqv
+acy
+awl
+awl
+awl
+awl
+azF
+apR
+apR
+apR
+ayO
+aWA
+aRt
+azb
+aMN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aKz
+aRq
+aYW
+aEF
+aEF
+aAb
+aAb
+aAb
+aEF
+aEF
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(84,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+akW
+aba
+aOE
+aOE
+aqr
+aqr
+aqr
+aqr
+aqr
+abJ
+abJ
+abJ
+act
+adC
+act
+adC
+act
+adC
+act
+adC
+act
+acL
+aqr
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aab
+agc
+ahB
+aae
+aiX
+akz
+alb
+alX
+abZ
+aDI
+akz
+asu
+aHT
+awS
+axB
+aDM
+aOE
+aOE
+aHi
+arF
+aqI
+aqr
+aOE
+aoR
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+aoR
+aFF
+aOE
+aqr
+aOF
+aFF
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+aAg
+aOE
+aZH
+beI
+aLC
+aLC
+aLC
+aQQ
+aRu
+aRd
+aRd
+aRd
+aRd
+aRd
+aRd
+aRd
+aGM
+aRo
+aRD
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aYI
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aED
+aED
+aED
+aZk
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(85,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aFw
+aFw
+aFw
+aFw
+aFw
+aFw
+aFw
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aOE
+aOE
+aOE
+aOE
+aqr
+aCe
+abQ
+aca
+aqr
+abJ
+acw
+abJ
+acv
+adE
+acv
+adE
+acv
+adE
+acv
+adE
+acv
+acM
+aqr
+aqr
+aqr
+aqr
+afi
+aat
+aNf
+aab
+ahY
+aaG
+aqr
+adR
+aDI
+aiZ
+akz
+alc
+aOo
+aHT
+aqa
+arf
+asv
+aon
+alX
+axC
+aDI
+aOE
+aqr
+aHm
+arF
+aqI
+aqr
+agN
+aoR
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+aoR
+aFF
+abZ
+aqr
+aar
+aDe
+aar
+aar
+abJ
+abJ
+aOE
+aOE
+aOE
+arI
+abJ
+beJ
+abJ
+abJ
+aOE
+acy
+awk
+awk
+azC
+awk
+awk
+apR
+apR
+apR
+ayO
+aWA
+aRt
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aYI
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aGv
+aCy
+aED
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(86,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aFw
+aDC
+aOC
+aze
+aYM
+aGz
+aFw
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aaL
+aOE
+aOE
+aOE
+aqr
+aqr
+abS
+aqr
+aqr
+acn
+acx
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+aqr
+abJ
+aen
+acy
+afj
+aHI
+awl
+awl
+ahZ
+awo
+aIj
+aQN
+aae
+aiX
+akz
+ald
+ama
+apq
+aDI
+akz
+asw
+avo
+aOE
+axN
+aDM
+aOE
+aar
+aqI
+arF
+aqI
+aqr
+aOE
+aoR
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+aoR
+aFF
+aOE
+aqr
+aCa
+aFF
+aOE
+aEu
+abJ
+abJ
+aOE
+aOE
+aOE
+abJ
+abJ
+beJ
+abJ
+abJ
+aOE
+aqr
+aab
+aab
+aab
+aab
+aat
+aph
+apR
+apR
+ayO
+aWA
+aRt
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aUl
+aMp
+aED
+aED
+aED
+aED
+aZk
+aEF
+aJn
+aEF
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(87,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aFw
+aPO
+aTX
+aKi
+aGz
+aAo
+aFw
+aac
+aac
+aac
+ags
+ayV
+aZS
+aNS
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+abL
+aaN
+aqr
+akW
+aOE
+abp
+aOE
+acy
+abJ
+abJ
+aoD
+aci
+aco
+acz
+aFt
+adn
+aFt
+aFt
+aFt
+aFt
+aFt
+aFt
+aFt
+aFt
+aFt
+aLC
+aFt
+aFt
+aeo
+azq
+azr
+azB
+azB
+ajG
+ayO
+agc
+aHt
+aid
+aja
+ako
+ale
+amJ
+aEc
+aDI
+aDI
+asz
+aDI
+aDI
+aDI
+aDI
+aOE
+aar
+aqI
+arF
+aqI
+aqr
+aOE
+aoR
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+aoR
+aFF
+aAk
+aqr
+aCb
+aFF
+aDR
+aQO
+abJ
+abJ
+aOE
+aOE
+aOE
+abJ
+abJ
+beJ
+abJ
+abJ
+aVn
+aqr
+awh
+aab
+aab
+aab
+aab
+aph
+apR
+awm
+ayO
+aWA
+aRt
+aWA
+aKq
+aaN
+aaN
+aYI
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aMp
+aMp
+aNR
+aMp
+aMp
+aOW
+aVk
+aEF
+aEF
+aEF
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aRT
+ags
+ags
+aac
+ags
+ags
+aZS
+aZS
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(88,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aFw
+aGJ
+aFn
+aZb
+azp
+aTX
+aFw
+aac
+aac
+aZS
+aZS
+aZS
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aaP
+aOE
+aOE
+aOE
+aqr
+abJ
+abT
+acb
+aqr
+acp
+acx
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+aqr
+abJ
+abJ
+acy
+afC
+aKS
+awk
+awk
+ajJ
+azA
+acy
+aQN
+aae
+ajH
+akz
+alf
+ani
+aOE
+aOE
+aDI
+asG
+alI
+aOE
+axP
+aKd
+aOE
+aar
+aqI
+arF
+aqI
+aqr
+aOE
+aoR
+apz
+apz
+apz
+apz
+atm
+apz
+apz
+apz
+apz
+aoR
+aFF
+aOE
+aqr
+aOE
+aOE
+aOE
+aEv
+abJ
+abJ
+aOE
+aOE
+aOE
+abJ
+abJ
+beJ
+abJ
+abJ
+aOE
+aqr
+aab
+aab
+aab
+aab
+aat
+aph
+apR
+apR
+ayO
+aWA
+aRt
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aWs
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aMp
+aMp
+aED
+aOR
+aMp
+aYi
+aVk
+aEF
+aEF
+aEF
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aZS
+aZS
+ags
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(89,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aFw
+aRm
+aHF
+aZm
+aYh
+aAt
+aFw
+aac
+aac
+aac
+ags
+aZS
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aOE
+aOE
+aOE
+aOE
+aqr
+abE
+abU
+acc
+aqr
+abJ
+acw
+abJ
+act
+adG
+act
+adG
+act
+adG
+act
+adG
+act
+acL
+aqr
+aqr
+aqr
+aqr
+afi
+aat
+aab
+aab
+ahY
+aaE
+aqr
+ahC
+aDI
+aiZ
+akz
+aon
+anr
+aHT
+aHT
+arA
+aHT
+avv
+aHT
+axR
+aDI
+aEB
+aqr
+aHm
+arF
+aqI
+aqr
+aOE
+aoR
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+aoR
+aFF
+abZ
+aqr
+aCd
+aOE
+aDS
+aar
+aAF
+abJ
+abo
+aOE
+aOE
+abJ
+abJ
+beJ
+abJ
+abJ
+aOE
+acy
+azc
+awl
+awl
+awl
+azI
+apR
+apR
+apR
+ayO
+aWA
+aRt
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aYI
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aNH
+aZv
+aJc
+aNe
+aMp
+aQx
+aVk
+aEF
+aEF
+aEF
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(90,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aFw
+aEX
+aIJ
+aFK
+aQz
+aUK
+aFw
+aac
+ags
+ayV
+aZS
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aaQ
+aOE
+aOE
+aOE
+aqr
+aqr
+aqr
+aqr
+aqr
+abJ
+abJ
+abJ
+acv
+adQ
+acv
+adQ
+acv
+adQ
+acv
+adQ
+acv
+aem
+aqr
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aab
+agc
+aJz
+aae
+ajH
+akz
+aOE
+aOE
+aOE
+abZ
+aDI
+asH
+aOE
+aqI
+aya
+aQO
+aEK
+aOE
+aHs
+arF
+aqI
+aqr
+aVh
+aoR
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+aoR
+aFF
+aOE
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+akw
+aOE
+aRP
+aZK
+beK
+aLC
+aLC
+aLC
+aQQ
+aQT
+aRd
+aRd
+aRd
+aRd
+aRd
+aRd
+aRd
+aGM
+aRo
+aSk
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aED
+aED
+aED
+aMp
+aMp
+aYV
+aVk
+aEF
+aEF
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aRT
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(91,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aFw
+aYb
+aWi
+aQW
+aFM
+aTX
+aFw
+aac
+aZS
+aZS
+aac
+aac
+aac
+aNF
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+abC
+aOE
+aOE
+aOE
+amk
+aOE
+aOE
+aOE
+aOE
+abJ
+act
+acL
+act
+adU
+act
+adU
+act
+adU
+act
+adU
+act
+acL
+aqr
+aab
+aJD
+aab
+aab
+aab
+aaB
+aab
+ahY
+aab
+agc
+aJz
+aae
+ajH
+akz
+alg
+anS
+anS
+anS
+aDI
+aon
+aon
+awW
+ayb
+aDI
+aDI
+aDI
+aqI
+arF
+aqI
+aqr
+agN
+aoR
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+aoR
+aFF
+aOE
+aAX
+aNu
+aNu
+aqr
+aEx
+aqr
+aEx
+aqr
+akW
+aOE
+aOE
+aOE
+aFF
+aOE
+aOE
+aVJ
+acy
+awk
+awk
+awk
+azD
+awk
+apR
+apR
+apR
+ayO
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aOO
+aMp
+aED
+aED
+aNR
+aED
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(92,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aFw
+aUr
+aGd
+aEF
+aKi
+aOC
+aFw
+aZk
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aaR
+aOE
+aOE
+aOE
+amk
+abD
+abD
+aOE
+aOE
+abJ
+acv
+acM
+acv
+acM
+acv
+acM
+acv
+acM
+acv
+acM
+acv
+acM
+aqr
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aaD
+aqr
+ahq
+aic
+ajH
+akz
+alk
+aOE
+aOE
+aOE
+aDI
+aDI
+aDI
+aDI
+ayU
+aDI
+aFC
+aDI
+aqI
+arF
+aJi
+aqr
+aOE
+aoR
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+apz
+aoR
+aFF
+aOE
+aqr
+aCe
+aDg
+aqr
+aAO
+aqr
+aAO
+aqr
+aIg
+aOE
+aOE
+aOE
+aFF
+aOE
+akw
+abZ
+aqr
+awh
+aab
+aab
+aab
+aat
+aph
+apR
+apR
+ayO
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aQU
+aMp
+aMp
+aMp
+aMp
+aTT
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(93,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aFw
+aXK
+aKa
+aGz
+aOC
+aEF
+aEF
+aEF
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aqr
+aqr
+abn
+aqr
+aqr
+abn
+aqr
+aqr
+aqr
+aqr
+acr
+aqr
+aqr
+acr
+aqr
+aqr
+acr
+aqr
+aqr
+acr
+aqr
+aqr
+aqr
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aab
+agc
+ahB
+aae
+ajH
+akz
+alx
+aOE
+apr
+aqb
+aDI
+asK
+avP
+aDI
+ayX
+aDO
+aGb
+aDI
+aqI
+arF
+aJh
+aqr
+aOE
+aoR
+aoR
+aoR
+aoR
+aoR
+aoR
+aoR
+aoR
+aoR
+aoR
+aoR
+aFF
+aOE
+aqr
+aCe
+ans
+aqr
+aNu
+aPs
+aNu
+aqr
+aTS
+aOE
+aOE
+aOE
+aFF
+azG
+akW
+amF
+aar
+aab
+aab
+aab
+aab
+aab
+aph
+apR
+apR
+ayO
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aPC
+aAe
+aMK
+aBZ
+aEH
+aED
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(94,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+ags
+aFw
+aFw
+aEF
+aEF
+aFw
+aEF
+aEF
+aGJ
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aJV
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aab
+agc
+ahB
+aae
+ajH
+akq
+aly
+aOE
+apF
+aqe
+aDI
+asI
+avQ
+aDI
+azz
+aqI
+aGc
+aDI
+aqI
+aIw
+aqE
+anG
+aLC
+aLC
+aLC
+aLC
+aLC
+aLC
+atn
+aLC
+aLC
+aLC
+aLC
+aLC
+baX
+aOE
+aqr
+aCe
+aNu
+aDT
+aEy
+ajr
+ajr
+aGX
+aLC
+aOl
+aTj
+aLC
+baX
+aOE
+akY
+aOE
+aqr
+aab
+aab
+aab
+aab
+aab
+aph
+apR
+apR
+ayO
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aED
+aED
+aED
+aED
+aED
+aED
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aRT
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(95,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aXE
+ags
+ags
+ags
+aBL
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aaE
+aqr
+aBm
+aDI
+aiY
+akz
+aDI
+aDI
+aDI
+aDI
+aDI
+asJ
+aDI
+ake
+alR
+aDU
+aDI
+ake
+aqI
+arF
+aqI
+acy
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+aFF
+aOE
+auD
+auD
+awA
+auD
+auD
+abZ
+aqr
+aCe
+aNu
+aqr
+aEA
+aFk
+aFZ
+aqr
+anP
+anP
+aNE
+aJQ
+anP
+anP
+aqr
+aqr
+aqr
+aaN
+aaN
+aaN
+aaN
+aab
+aph
+apR
+apR
+ayO
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aWs
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aWs
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aSl
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(96,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aLF
+ags
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aab
+agc
+ahB
+aae
+ajH
+akz
+ahC
+aQN
+ahC
+aqf
+aqI
+aqI
+aqI
+axp
+aqI
+aqI
+aqI
+aqI
+aqI
+arF
+aqI
+aqr
+aOE
+aOE
+aOE
+aOE
+aOE
+akj
+ato
+aqr
+auF
+avx
+awC
+auF
+auF
+aqr
+aqr
+aCf
+aDi
+aqr
+aqr
+aqr
+aqr
+aqr
+aOE
+aOE
+aFF
+aOE
+aOE
+aOE
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+apR
+apR
+ayO
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aYI
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(97,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aKy
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+avF
+aac
+aac
+aZS
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aab
+agc
+ahD
+aae
+ajI
+ako
+akV
+aHt
+aoW
+aHt
+aqE
+aup
+aqE
+aqE
+aqE
+aqE
+aqE
+aqE
+aqE
+aIK
+aqI
+aqr
+agN
+aOE
+aOE
+aOE
+aOE
+aOE
+atp
+aqr
+auG
+apy
+apy
+avy
+apy
+aAl
+aqr
+aCi
+aDl
+aDV
+aEE
+aFl
+aGa
+aqr
+aHz
+aIf
+aIM
+akw
+aOE
+aLi
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+apR
+awk
+awn
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(98,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aFV
+ags
+ags
+ags
+ags
+ags
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aab
+aqr
+aOE
+aDI
+ajK
+akr
+adR
+aQN
+adR
+aQN
+arB
+arF
+aww
+aqI
+aqI
+aqI
+aqI
+awB
+aqI
+aqI
+aJo
+aqr
+aOE
+azG
+akW
+amF
+aOE
+aOE
+atq
+atL
+auI
+auI
+auI
+auI
+axX
+aAm
+aqr
+aCj
+aDn
+aDW
+aEI
+arJ
+arJ
+aqr
+aHA
+aOE
+aIN
+akW
+aOE
+aHA
+aar
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aLU
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(99,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aau
+aqr
+aDI
+aDI
+aBm
+ake
+aDI
+anT
+aDI
+aqr
+aQN
+aNE
+aQN
+aqr
+aqr
+aDY
+aqr
+aOJ
+aqr
+aIX
+aqr
+aqr
+agB
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+aqr
+auJ
+apy
+apy
+axz
+axY
+aAn
+aqr
+apy
+aCk
+apy
+arJ
+arJ
+aGl
+aqr
+akY
+aOE
+aIR
+akY
+aOE
+akY
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aLU
+ags
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aZS
+aZS
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aRU
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRU
+aac
+aac
+aJx
+"}
+(100,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ayV
+aZS
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aSl
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aab
+aqr
+ahF
+aie
+ajL
+aqr
+acc
+abJ
+apG
+aqr
+aOE
+aFF
+aOE
+aqr
+acc
+abJ
+aGf
+aqr
+acc
+abJ
+aJE
+aqr
+akw
+aOE
+aOE
+akw
+aOE
+aOE
+akw
+aar
+auK
+apy
+awT
+awT
+axY
+apy
+axO
+aCk
+aDn
+apy
+aEI
+arJ
+arJ
+aGY
+aOE
+aOE
+aFF
+aOE
+aVJ
+aOE
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aLU
+aZS
+aZS
+aZS
+aZS
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aZS
+aZS
+aZS
+ags
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aRU
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+"}
+(101,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ayV
+aac
+aac
+aac
+aac
+aac
+aNF
+ags
+ags
+ags
+ags
+ags
+ags
+aBD
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aab
+aqr
+ahG
+aiz
+akb
+aqr
+alA
+anV
+abE
+aqr
+aOE
+aFF
+aOE
+aqr
+alA
+anV
+abE
+aqr
+alA
+anV
+abE
+aqr
+aof
+aOE
+akj
+aqJ
+amF
+aOE
+atr
+aar
+auL
+apy
+auK
+auK
+axZ
+auI
+aBa
+auI
+aDo
+aDX
+aEM
+aFo
+aGm
+aqr
+aOE
+aOE
+aDA
+aOE
+aOE
+aOE
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+ags
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aZS
+aZS
+aac
+aac
+aac
+aac
+ags
+aZS
+aac
+aac
+aac
+aRT
+ags
+ags
+ags
+ags
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+"}
+(102,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+avE
+ags
+aEb
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aab
+aqr
+aqr
+adR
+aqr
+aqr
+aqr
+aar
+aqr
+aqr
+aIj
+ahr
+acy
+aqr
+aqr
+aar
+aqr
+aqr
+aqr
+aar
+aqr
+aqr
+akY
+aOE
+aOE
+akY
+aOE
+aOE
+akY
+aar
+auW
+avy
+awU
+axA
+ayc
+aAq
+aqr
+aCn
+aDq
+aEa
+aqr
+aqr
+aqr
+aqr
+akw
+aOE
+aIM
+akw
+aOE
+akw
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aqr
+aaN
+aqr
+aac
+aac
+aac
+aac
+aZS
+aZS
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+"}
+(103,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aab
+aab
+aab
+aab
+aab
+abK
+aab
+aab
+aab
+acT
+aHI
+aRk
+awo
+aeD
+aeW
+aab
+aab
+agz
+aab
+aab
+aaF
+aqr
+aOE
+aOE
+aOE
+aOE
+aOE
+ase
+aOE
+aqr
+avl
+avO
+awV
+axM
+apy
+aAs
+aqr
+aqr
+aDr
+aqr
+aqr
+aFp
+aFp
+aqr
+akW
+aOE
+aIS
+aJZ
+aOE
+akW
+aar
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aEN
+aaN
+aMR
+aBE
+aqr
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aMv
+aMv
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aMv
+aMv
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+"}
+(104,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aWL
+ags
+ags
+aac
+aac
+aZS
+ayV
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aab
+aab
+aab
+aab
+aab
+abK
+aab
+aab
+aab
+aab
+aKP
+ano
+ayO
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+acy
+aOE
+aOE
+akj
+aqK
+amF
+aOE
+aOE
+atM
+apy
+awq
+apy
+apy
+ayd
+apy
+atM
+aOE
+aFF
+aLC
+aLC
+aFs
+aEc
+aqr
+aHB
+aOE
+aIR
+akY
+aOE
+aLj
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aYA
+aOE
+aAU
+aqr
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aMv
+aNY
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aNY
+aMv
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+"}
+(105,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aab
+aab
+aab
+aab
+aNw
+abK
+aab
+aab
+aab
+aab
+aKP
+ano
+ayO
+aat
+aab
+aab
+aaF
+apR
+aab
+aau
+aab
+aqr
+aqr
+aar
+aqr
+aqr
+aqr
+aar
+aqr
+aqr
+aqr
+awr
+aqr
+axO
+atM
+aqr
+aqr
+agN
+aDs
+aOE
+aqr
+aFu
+aGp
+aqr
+aHC
+aJM
+aFF
+aOE
+aOE
+aVJ
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+abY
+aZB
+aSj
+aMc
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aMv
+aOf
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aPF
+aMv
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+"}
+(106,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aab
+aab
+aab
+aab
+aNw
+abK
+aab
+aab
+aab
+aab
+aKP
+ano
+ayO
+aab
+aeX
+aeX
+aeX
+apR
+aeX
+aeX
+aeX
+anP
+aNu
+aNu
+apA
+akv
+aNu
+aNu
+aNu
+akv
+aNu
+aNu
+awX
+aNu
+aNu
+aAv
+aqr
+aCo
+aDw
+auF
+aqr
+aqr
+aqr
+aqr
+aOE
+aOE
+aFF
+aOE
+aOE
+aOE
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aXX
+aaN
+afZ
+abY
+aBH
+aqr
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aMv
+aOf
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aPF
+aMv
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+"}
+(107,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aab
+aab
+aab
+aab
+aab
+abK
+aab
+aab
+aab
+aab
+aKP
+ano
+ayO
+aab
+aLU
+aLU
+aLU
+apR
+aLU
+aLU
+ahE
+anP
+aom
+aoS
+aoS
+aoS
+aNu
+aoS
+aoS
+aoS
+aNu
+aoS
+aoS
+aoS
+aNu
+aAx
+aqr
+aOE
+aFF
+abZ
+aqr
+aFv
+aGs
+aGZ
+auD
+aOE
+aFF
+akw
+aOE
+aOE
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aEZ
+aWR
+aaN
+aqr
+aqr
+aac
+aqr
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aMv
+aOQ
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aPF
+aMv
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+"}
+(108,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aat
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+ahY
+aab
+aab
+aab
+aab
+aab
+abK
+aab
+aab
+aab
+aat
+aKP
+ano
+ayO
+aab
+aLU
+aeX
+aeX
+apR
+aeX
+aeX
+aLU
+anP
+aNu
+aNu
+aNu
+aNu
+aNu
+aNu
+aNu
+aNu
+ard
+aNu
+aNu
+aNu
+aNu
+aNu
+axO
+aOE
+aDA
+aOE
+aEP
+aNu
+aNu
+aGZ
+awA
+aOE
+aIW
+aJZ
+amF
+aOE
+aar
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aMG
+aEF
+aEF
+aEF
+aEF
+aPG
+aEF
+aEF
+aEF
+aEF
+aMG
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+"}
+(109,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aiT
+azB
+azB
+azB
+azB
+azB
+azB
+aRd
+aRd
+aRd
+aRd
+aRd
+aRd
+aRd
+aRd
+akd
+aRd
+aRd
+aRd
+aRd
+aRd
+aRd
+aRd
+aRd
+aRd
+aRd
+azr
+aTc
+ayO
+aCI
+aCI
+aCI
+aCI
+apR
+aCI
+aCI
+aCI
+anQ
+aNu
+aNu
+apB
+aqL
+ard
+aNu
+ats
+atN
+aNu
+awu
+awY
+aNu
+aNu
+aNu
+aBc
+aOE
+aFF
+aOE
+aEQ
+aNu
+aNu
+aHa
+auD
+aOE
+aFF
+akY
+aIh
+aOE
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aMG
+aEF
+aEF
+aEF
+aEF
+aPG
+aEF
+aEF
+aEF
+aEF
+aMG
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+"}
+(110,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ayV
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aaN
+aab
+aab
+ano
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aat
+apR
+aab
+aab
+aab
+aab
+aab
+abK
+aab
+aab
+aab
+aat
+aKP
+ano
+ayO
+aab
+aLU
+aeX
+aeX
+apR
+aeX
+aeX
+aLU
+anP
+aNu
+aNu
+aNu
+aNu
+aNu
+aNu
+ard
+aNu
+aNu
+aNu
+aNu
+aNu
+aNu
+aNu
+auF
+aOE
+aFF
+aVJ
+aCo
+aNu
+aGt
+aGZ
+auD
+aOE
+aFF
+aOE
+aOE
+aOE
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aMv
+aNY
+aEF
+aEF
+aEF
+aPG
+aEF
+aEF
+aEF
+aNY
+aMv
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+"}
+(111,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+ags
+aTO
+ags
+ags
+aTO
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aNv
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aqr
+aqr
+aqr
+aar
+aar
+aqr
+aqr
+aqr
+aab
+aab
+aab
+aab
+aab
+ano
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+apR
+aab
+aab
+aab
+aab
+aab
+abK
+aab
+aab
+aab
+aab
+aKP
+ano
+ayO
+aaF
+aLU
+aLU
+aLU
+apR
+aLU
+aLU
+ahE
+anP
+aom
+aoS
+aoS
+aoS
+aNu
+aoS
+aoS
+aoS
+aNu
+aoS
+aoS
+aoS
+aNu
+aAx
+aqr
+aCr
+aFF
+aEc
+aqr
+aNu
+aNu
+aGZ
+aHG
+aOE
+aFF
+akw
+aOE
+abZ
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aMv
+aPe
+aEF
+aEF
+aEF
+aPG
+aEF
+aEF
+aEF
+aPF
+aMv
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+"}
+(112,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aZS
+aZS
+aac
+aac
+aac
+aNv
+aNv
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aqr
+aFu
+aqr
+aOE
+aOE
+aOE
+asK
+aOE
+aqr
+aqr
+aqr
+aab
+aab
+aab
+ano
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+apR
+aab
+aab
+aab
+aab
+aab
+abK
+aab
+aab
+aab
+aab
+aKP
+ano
+ayO
+aab
+aeX
+aeX
+aeX
+apR
+aeX
+aeX
+aeX
+anP
+aNu
+aNu
+apE
+aqM
+aNu
+aNu
+aNu
+aqM
+avn
+aNu
+apE
+aNu
+aNu
+aAy
+aqr
+aqr
+aDF
+aqr
+aqr
+aFx
+aNu
+aHb
+auD
+aOE
+aIY
+aKb
+amF
+aOE
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aRW
+aRW
+aRW
+aMv
+aPf
+aEF
+aEF
+aEF
+aPG
+aEF
+aEF
+aEF
+aPF
+aMv
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+"}
+(113,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+ags
+ags
+ags
+ags
+aTO
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+ags
+aZS
+aZS
+aZS
+aZS
+aZS
+aNv
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aqr
+aar
+aqr
+aqr
+abb
+aOE
+aaS
+aOE
+aRP
+aOE
+aOE
+aOE
+aOE
+aga
+aqr
+aab
+aab
+aat
+ano
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aab
+aab
+aab
+aab
+abK
+aab
+aab
+aab
+aab
+aKP
+ano
+ayO
+aat
+aab
+aab
+aab
+apR
+aaD
+aab
+aab
+aqr
+aqr
+aar
+aqr
+aqr
+aqr
+arm
+aiF
+aqr
+aqr
+avr
+aqr
+aqr
+avr
+aqr
+aqr
+aCw
+aFF
+aEd
+aqr
+aNu
+aNu
+aHc
+auD
+aOE
+aFF
+akY
+aOE
+aOE
+aar
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aRT
+aRW
+aRW
+aRW
+aMv
+aPg
+aEF
+aEF
+aEF
+aPG
+aEF
+aEF
+aEF
+aPF
+aMv
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+"}
+(114,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ayV
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aZS
+aZS
+aNv
+aLU
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aak
+aOE
+aCw
+aqr
+abc
+aOE
+aqr
+aOE
+aby
+aby
+aby
+aby
+aby
+aOE
+aar
+aHI
+awl
+awl
+aoZ
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aab
+aab
+aab
+aab
+abK
+aab
+aab
+aab
+aab
+aKP
+ano
+ayO
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+anR
+aoo
+aoT
+apI
+aqr
+arg
+arm
+auU
+atO
+aqr
+aOE
+axr
+axQ
+aLC
+aAz
+aqr
+aCz
+beH
+abZ
+aqr
+aNu
+aNu
+aGZ
+auD
+aOE
+aFF
+aOE
+aCv
+aOE
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aRW
+aRW
+aRW
+aMv
+aPh
+aEF
+aEF
+aEF
+aPG
+aEF
+aEF
+aEF
+aPF
+aMv
+aRW
+aRW
+aRW
+aRU
+aac
+aac
+aJx
+"}
+(115,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ayV
+aNS
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aNv
+aLU
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aCz
+aOE
+aaz
+aqr
+abf
+aJM
+abu
+auD
+aby
+aby
+aby
+aby
+aby
+aLC
+acW
+azr
+azB
+azB
+aqD
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aab
+aab
+aab
+aab
+abK
+aab
+aab
+aab
+acU
+aKS
+aRg
+awn
+aeE
+aeZ
+aab
+aab
+agA
+aaF
+aab
+aab
+aqr
+aop
+auU
+apJ
+aqr
+ark
+asf
+asf
+auU
+avr
+aOE
+aOE
+aFF
+ayY
+aAB
+aqr
+aCB
+aFF
+aOE
+aqr
+aNu
+aNu
+aGZ
+aHJ
+aOE
+aFF
+aOE
+aOE
+aOE
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+ayO
+aWA
+aWA
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aMv
+aPk
+aEF
+aEF
+aEF
+aPG
+aEF
+aEF
+aEF
+aPF
+aMv
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+"}
+(116,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+ags
+ags
+aTO
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aLU
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aOE
+aVJ
+aOE
+aqr
+abg
+aOE
+abh
+auD
+aby
+aby
+aby
+aby
+aby
+aOE
+aar
+aKP
+aCI
+aCI
+ayO
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aab
+aab
+aab
+aab
+aqr
+aqr
+aar
+aqr
+aqr
+acy
+ahr
+acy
+aqr
+aqr
+aar
+aqr
+aqr
+aqr
+aar
+aqr
+aqr
+aop
+auU
+apK
+aqP
+arm
+asf
+asf
+atP
+aqr
+aqr
+aqr
+axS
+aqr
+aqr
+aqr
+aqr
+aDF
+aqr
+aqr
+aFz
+aqr
+aqr
+aqr
+aqr
+aNE
+aQN
+aqr
+aqr
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+apR
+awl
+awo
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aMv
+aPn
+aEF
+aEF
+aEF
+aPG
+aEF
+aEF
+aEF
+aPF
+aMv
+aRW
+aRW
+aRW
+aac
+aac
+aac
+aJx
+"}
+(117,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aal
+aHJ
+aOE
+aaS
+aOE
+aOE
+abh
+auD
+aRP
+aOE
+aOE
+aOE
+aOE
+acC
+aqr
+aKS
+awk
+awk
+awn
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aab
+aab
+aab
+aab
+aqr
+aej
+aOE
+afp
+aqr
+ahg
+ahs
+ahg
+aqr
+aiW
+ajV
+aks
+alz
+ajV
+amK
+aiW
+aqr
+aop
+auU
+apJ
+aqr
+auU
+asf
+asf
+arm
+avs
+aFt
+aVe
+bef
+aFt
+aFt
+aFt
+aFt
+aFt
+aFt
+aFt
+aFt
+aFt
+aFt
+aFt
+aFt
+aTD
+abJ
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aph
+apR
+apR
+ayO
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aMv
+aPp
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aPF
+aMv
+aRW
+aRW
+aRW
+aac
+aac
+aac
+aJx
+"}
+(118,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+abh
+abq
+abh
+aOE
+aOE
+aOE
+aVh
+aOE
+aCv
+acj
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aab
+aab
+aab
+aab
+aar
+aek
+aOE
+afz
+agu
+ahg
+ahx
+aiA
+aiE
+ajb
+aLC
+aLC
+alT
+aLC
+aLC
+anm
+anU
+aor
+apa
+apJ
+aqr
+arw
+asg
+att
+auU
+aqr
+abJ
+beJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+beJ
+abJ
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+ayQ
+awk
+awk
+awn
+aWA
+aRs
+aWA
+aKq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aMv
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aMv
+aRW
+aRW
+aRW
+aac
+aac
+aac
+aJx
+"}
+(119,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aag
+aam
+aay
+aaA
+aqr
+aqr
+aOE
+aOE
+aby
+aby
+aby
+aby
+aOE
+aOE
+aqr
+aqr
+aaA
+aay
+aam
+aag
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aab
+aab
+aab
+aab
+aqr
+aez
+aOE
+aOE
+agv
+ahg
+ahs
+ahg
+aiF
+ajc
+ajW
+aOE
+alY
+aOE
+amO
+ann
+aiF
+aop
+apb
+apM
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+abJ
+beJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+abJ
+aTE
+abJ
+aqr
+aqr
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aMv
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aMv
+aRW
+aRW
+aRW
+aac
+aac
+aac
+aJx
+"}
+(120,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaf
+aOE
+aOE
+aRP
+aOE
+aaT
+aqr
+aOE
+aOE
+abz
+abM
+abN
+acd
+aOE
+aOE
+acE
+acY
+aOE
+aOE
+aOE
+aOE
+ael
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aHI
+awl
+awl
+awl
+awo
+aqr
+aeA
+aOE
+aOE
+aqr
+aOE
+aFF
+aOE
+aiG
+ajd
+aOE
+akt
+aqr
+amE
+aqr
+aqr
+aqr
+aop
+apb
+apJ
+aqr
+arx
+auU
+atu
+atQ
+aqr
+aBt
+beJ
+abJ
+aqr
+aqr
+aqr
+aqr
+aqr
+aBY
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aNE
+aQN
+aqr
+aOE
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aMv
+aNY
+aEF
+aNZ
+aNZ
+aNZ
+aNZ
+aNZ
+aEF
+aNY
+aMv
+aRW
+aRW
+aRW
+aac
+aac
+aac
+aJx
+"}
+(121,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaf
+aOE
+aOE
+aOE
+agl
+agl
+abi
+aCv
+aOE
+abz
+abN
+abV
+acd
+aOE
+aOE
+acH
+adf
+aii
+aOE
+aIh
+aOE
+ael
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aKS
+awk
+apR
+apR
+ayO
+aqr
+aqr
+aOE
+afA
+aqr
+aOE
+aFF
+aiC
+aqr
+aiW
+ajV
+aku
+aqr
+aNu
+amQ
+anp
+anW
+aop
+apb
+apJ
+aqr
+arx
+asi
+atv
+atR
+aqr
+aar
+aJp
+aar
+aqr
+aAC
+aBd
+aCC
+aqr
+aEe
+aEf
+aFB
+aOE
+aOE
+aHK
+aqr
+aFF
+aJM
+aQO
+aRb
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aMv
+aMG
+aMG
+aMv
+aMv
+aMv
+aMv
+aMv
+aMv
+aMv
+aPH
+aRW
+aRW
+aRW
+aac
+aac
+aac
+aJx
+"}
+(122,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaf
+aai
+aOE
+aOE
+agl
+aaU
+abj
+aOE
+aOE
+abz
+abO
+abN
+acd
+aOE
+aOE
+aOJ
+adh
+adA
+aOE
+aOE
+aOE
+ael
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aaF
+aKP
+apR
+abr
+aqr
+aeB
+aOE
+aOE
+aqr
+agB
+aFF
+abZ
+aqr
+aqr
+aqr
+aqr
+aqr
+aNu
+aNu
+aNu
+aNu
+aop
+apb
+apJ
+aqr
+ary
+asj
+atx
+atS
+aqr
+agN
+aFF
+agQ
+aqN
+aAE
+aBe
+aCD
+aqr
+aEf
+aEf
+aqr
+aGw
+aCv
+aHL
+aqr
+aQb
+aLC
+aQR
+baX
+aar
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aac
+aJx
+"}
+(123,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aED
+aED
+aED
+aED
+aED
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aaj
+aOE
+aOE
+aaH
+aaV
+aOJ
+aOE
+aOE
+abz
+abP
+abN
+acd
+aVJ
+aOE
+aqr
+adi
+aii
+aOE
+aai
+acu
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aab
+aKP
+apR
+abr
+aqr
+aeC
+aVJ
+aOE
+aqr
+agO
+aFF
+aOE
+aiH
+ajk
+ajk
+ajk
+ajk
+ajk
+ajk
+ajk
+ajk
+aos
+apb
+apJ
+aqr
+arz
+asj
+asj
+auo
+avt
+aOE
+aXj
+aHT
+azt
+aAH
+aqN
+aAI
+aqr
+aqr
+aqr
+aqr
+aOE
+aOE
+abZ
+aqr
+aQc
+aOE
+aQO
+aQO
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aED
+aED
+aED
+aED
+aED
+aED
+aED
+aED
+aED
+aED
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aac
+aJx
+"}
+(124,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aMp
+aMp
+aPx
+aAZ
+aED
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aqr
+aqr
+aao
+aqr
+aqr
+aqr
+aqr
+aOE
+aby
+aby
+aby
+aby
+aOE
+aqr
+aqr
+aqr
+aqr
+aao
+aqr
+aqr
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aab
+aKP
+aCI
+ayO
+aar
+aeF
+aOE
+afE
+aqr
+aOE
+ahP
+aqv
+aiL
+ajm
+ajm
+ajm
+alZ
+ajm
+ajm
+ajm
+anX
+aot
+apd
+apV
+aqQ
+arE
+asx
+aty
+auU
+aar
+aOE
+aFF
+agQ
+azx
+aqN
+aqN
+aCH
+aqr
+aEh
+aET
+aFD
+aby
+aby
+aby
+aqr
+aFF
+aOE
+aOE
+abZ
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aCx
+aYy
+aYy
+aKg
+aKZ
+aWS
+aIz
+aMp
+aMp
+aED
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aRU
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRU
+aRW
+aRW
+aRW
+aRW
+aRW
+aRU
+aac
+aac
+aac
+aJx
+"}
+(125,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aED
+aMp
+aMp
+aMp
+aMp
+aED
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aOq
+aan
+aqr
+aan
+abl
+aqr
+agN
+aOE
+aOE
+aIh
+aOE
+abZ
+aqr
+abl
+aan
+aqr
+aan
+aOq
+aqr
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aab
+aaM
+abd
+awn
+aqr
+aeG
+aOE
+aga
+agx
+aOE
+ahP
+aOE
+aqr
+ajn
+aNu
+aNu
+aNu
+aNu
+aNu
+ans
+aqr
+aop
+apb
+apJ
+aqr
+arH
+asy
+atH
+auq
+aqr
+aOE
+aFF
+agQ
+azH
+aAI
+aBh
+aqN
+aqr
+aET
+aET
+aqr
+aGA
+aby
+aee
+aIj
+aFF
+aOE
+aOE
+aOE
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aYy
+aYy
+aTH
+aED
+aLQ
+aLQ
+aED
+aMp
+aKY
+aED
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aMv
+aMG
+aMG
+aMv
+aMv
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aac
+aac
+aJx
+"}
+(126,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aac
+aac
+aac
+aac
+aac
+aED
+aMp
+aMp
+aQs
+aWo
+aED
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aan
+aOg
+aqr
+aaW
+aan
+aqr
+acP
+aOE
+aOE
+aOE
+aOE
+acP
+aqr
+aan
+aaW
+aqr
+aOg
+aan
+aqr
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aaD
+aqr
+aqr
+aqr
+aqr
+aqr
+aeI
+aOE
+aOE
+aqr
+aqv
+aFF
+aOE
+aqr
+ajo
+ajo
+ajo
+ajo
+ajo
+ang
+ant
+aqr
+aou
+apb
+apM
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aOE
+aFF
+aar
+aqr
+aAK
+aAK
+aAK
+aqr
+aqr
+aqr
+aqr
+aby
+aby
+aee
+anP
+beH
+aOE
+aOE
+aOE
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aYy
+aXU
+aYy
+aED
+aED
+aED
+aJc
+aMp
+aUX
+aED
+aXF
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aZS
+aZS
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aMI
+aMI
+aMI
+aNi
+aMv
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(127,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aED
+aED
+aED
+aED
+aGo
+aED
+aED
+aED
+aED
+aED
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aqr
+aqr
+aqr
+aqr
+abm
+aqr
+aqr
+aqr
+aVh
+aOE
+aqr
+aqr
+aqr
+abm
+aqr
+aqr
+aqr
+aqr
+aqr
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aqr
+acO
+ady
+adS
+aqr
+aeI
+afh
+aeO
+aqr
+aOE
+ahQ
+abZ
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aov
+apb
+apJ
+aqr
+amH
+amH
+aon
+aon
+aqr
+aOE
+aFF
+aOE
+aqr
+aqR
+arh
+aqN
+aqr
+aPV
+aEW
+aFG
+aGF
+aby
+aby
+acy
+aFF
+aOE
+aOE
+aOE
+aar
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aED
+aED
+aED
+aED
+aPc
+aPx
+aMp
+aMp
+aMp
+aAc
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aZS
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aNc
+aMI
+aMI
+aPt
+aMv
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aac
+aac
+aac
+aJx
+aJx
+"}
+(128,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aED
+aER
+alw
+aMp
+aVD
+aED
+aQF
+aYy
+aCx
+aED
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aaI
+aOE
+aOE
+aFN
+abv
+aOJ
+aOE
+aOE
+aOJ
+ack
+acq
+aOE
+aai
+acu
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aqr
+adg
+adF
+adT
+aqr
+aeJ
+afk
+agb
+aqr
+aOE
+ahR
+aOE
+aqr
+ajp
+ajX
+akv
+amb
+aqr
+anh
+anu
+anZ
+aop
+apb
+apJ
+aar
+aOE
+aOE
+aOE
+aOE
+aqr
+aOE
+aFF
+aOE
+aqr
+aqN
+ari
+aqN
+aqr
+aEi
+aEY
+aqr
+aQi
+aHe
+aHO
+aqr
+aFF
+ajO
+ajO
+ajO
+aqr
+aaN
+aaN
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aQx
+aZj
+aZj
+aMp
+aMp
+aNb
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aNc
+aMI
+aMI
+aPu
+aMv
+aRW
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aac
+aac
+aac
+aJx
+aJx
+aJx
+"}
+(129,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aED
+aNG
+alQ
+aMp
+aMp
+aGo
+aYy
+aKc
+aYy
+aED
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaq
+aai
+aOE
+aJM
+aFN
+abw
+abA
+aOE
+aCv
+ace
+acl
+acq
+aCv
+aOE
+aOE
+aeg
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aqr
+aqr
+aqr
+adI
+aqr
+aqr
+aqr
+aqr
+aqr
+ahj
+beI
+aLC
+aiM
+ajr
+ajY
+aNu
+amc
+aqr
+anh
+anC
+aNu
+aop
+aps
+apV
+aqT
+aLC
+asA
+atJ
+aur
+aqr
+agN
+aFF
+aOE
+aqu
+aqO
+ari
+aES
+aqr
+aqr
+aqr
+aqr
+aOE
+aHh
+aHP
+aqr
+aQc
+ajO
+ajO
+aRf
+aqr
+aab
+aab
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aVr
+aQx
+aNg
+aMp
+aMp
+abe
+aXF
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aNc
+aMI
+aMI
+aPw
+aMv
+aRW
+aRW
+aRW
+aRU
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+aJx
+aJx
+"}
+(130,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aED
+aTi
+arl
+aCE
+aMp
+aED
+aVR
+aYy
+aOk
+aED
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaq
+aOE
+aOE
+aOE
+aOE
+aOE
+abB
+aOE
+aOE
+acf
+aOE
+aOE
+aOE
+aOE
+aOE
+aeg
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aae
+adj
+aOE
+aFF
+aef
+aeK
+aeK
+aOE
+aOE
+aeK
+aFF
+aOE
+aqr
+ajC
+aNu
+akX
+amd
+aqr
+anj
+anD
+anu
+aop
+apb
+apJ
+aar
+aon
+aOE
+atK
+aus
+aqr
+aOE
+aFF
+aOE
+aqr
+aqN
+ari
+aHM
+aqr
+aPW
+aPX
+aFD
+aOE
+aeK
+aHQ
+aqr
+aFF
+ajO
+aQZ
+aRh
+aqr
+aab
+aab
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aZS
+ayV
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aPc
+aMp
+aBw
+aMp
+aKY
+aED
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aNc
+aMI
+aMI
+aPy
+aMv
+aRW
+aRW
+aRW
+aac
+aac
+aac
+aac
+aac
+aJx
+aJx
+aJx
+aJx
+aJx
+"}
+(131,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aBD
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aED
+aFP
+aMp
+aMp
+aIQ
+aED
+aYy
+aYy
+aYy
+aED
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaq
+aOE
+aOE
+aOE
+aOE
+abx
+aqr
+aOE
+aOE
+aqr
+acm
+aOE
+aOE
+aVJ
+aOE
+aeg
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aae
+adk
+adH
+adV
+aeh
+aLC
+afl
+age
+aLC
+ahk
+ahV
+aOE
+aqr
+ajD
+ajZ
+alh
+amx
+aqr
+ank
+anE
+anE
+aop
+apb
+apJ
+aqr
+arL
+aOE
+aii
+aii
+aqr
+aOE
+aFF
+aOE
+aqr
+aqS
+arj
+aJj
+aqr
+aEf
+aQh
+aqr
+aQj
+aOE
+aQm
+aqr
+aFF
+ajO
+ajO
+aRj
+aqr
+aab
+aab
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aZS
+aZS
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+azy
+aKB
+aMp
+aMp
+aZE
+aED
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aNd
+aMI
+aMI
+aPt
+aMv
+aRW
+aRW
+aRW
+aac
+aac
+aac
+aac
+aJx
+azQ
+azQ
+azQ
+azQ
+azQ
+"}
+(132,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+ags
+ags
+aFh
+aMp
+aMp
+aCA
+aNa
+aED
+aYy
+aXU
+aYy
+aED
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aaJ
+aaX
+aay
+abo
+aqr
+aqr
+aOE
+aOE
+aqr
+aqr
+abo
+aay
+aaX
+aaJ
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aqr
+adl
+adI
+adl
+aqr
+aqr
+aqr
+aqr
+aqr
+aOE
+aFF
+aqv
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aow
+apt
+apY
+aqr
+aar
+aar
+aar
+aqr
+aqr
+aar
+aJp
+aar
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aQf
+ajO
+ajO
+ajO
+aqr
+aab
+aab
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aVE
+ags
+aAL
+aKt
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aED
+aED
+aED
+aED
+aED
+aED
+aED
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aNi
+aMI
+aMI
+aMI
+aMv
+aRW
+aRW
+aRW
+aac
+aac
+aac
+aJx
+azQ
+aOz
+aEO
+aEO
+aUo
+azQ
+"}
+(133,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aCO
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+ags
+alv
+abe
+aED
+aED
+aED
+aED
+aED
+aED
+aED
+aED
+aED
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aaQ
+aby
+aby
+acg
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aqr
+adm
+aFF
+adX
+aqr
+aeO
+afm
+agf
+aqr
+ahg
+ahs
+ahg
+aOE
+ajE
+aeK
+aeK
+aeK
+aOE
+aOE
+aOE
+ajE
+ahg
+ahs
+ahg
+aOE
+aOE
+aOE
+aOE
+asK
+acy
+abJ
+beJ
+axT
+aqr
+aAM
+aqr
+aAM
+aqr
+aNk
+aNk
+aNk
+aNk
+aNk
+aqr
+ayf
+aFF
+aOE
+aOE
+aOE
+aqr
+aab
+aab
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aXI
+ags
+ags
+aKt
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aMI
+aMI
+aMI
+aNi
+aMv
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+aJx
+azQ
+aNO
+aEO
+aEO
+aXa
+azQ
+"}
+(134,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aar
+abC
+aby
+aby
+abW
+aar
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aqr
+ado
+adJ
+adY
+aqr
+aqv
+aOE
+anJ
+aqr
+ahg
+ahs
+ahg
+aOE
+aeK
+aeK
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+ahg
+ahs
+ahg
+aOE
+aOE
+aOE
+aOE
+aOE
+anP
+abJ
+beJ
+abJ
+aqr
+aAO
+aqr
+aAO
+aqr
+aNu
+aOI
+aNu
+aNu
+aNu
+aqr
+ayg
+aQL
+ajO
+ajO
+aVh
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aWz
+ags
+aSl
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aQa
+aZL
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aNm
+aMI
+aMI
+aPt
+aMv
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+azQ
+azQ
+aTR
+aEO
+aEO
+aBg
+azQ
+"}
+(135,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aar
+aaR
+aby
+aby
+ach
+aar
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aae
+adp
+adK
+adZ
+aqr
+aeS
+aOE
+agg
+aqr
+ahg
+ahW
+aiA
+aLC
+aLC
+aLC
+aTj
+aLC
+aLC
+age
+age
+aLC
+aiA
+apv
+aiA
+aLC
+aTj
+aLC
+aLC
+aLC
+anF
+aFt
+axs
+abJ
+aNu
+aNu
+aPs
+aNu
+aqr
+aqr
+aqr
+bfd
+aqr
+aqr
+aqr
+azo
+aQL
+ajO
+ajO
+aOE
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aFJ
+aBA
+ags
+aEb
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aRO
+aEG
+aEG
+aAi
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aNm
+aPq
+aMI
+aPt
+aMv
+aRW
+aRW
+aRW
+aRW
+aac
+aJx
+azQ
+aEO
+aEO
+aGC
+aCQ
+aWK
+azQ
+"}
+(136,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aqr
+aJM
+aOE
+aqr
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aqr
+adq
+adL
+aea
+aqr
+aeT
+aOE
+agh
+aqr
+agd
+aif
+aiD
+aqr
+aqr
+aqr
+adI
+aqr
+aqr
+aqr
+afU
+acS
+aox
+aqr
+aqr
+aqr
+arM
+aqr
+aqr
+aqr
+aqr
+awv
+beJ
+abJ
+aqr
+aNu
+apE
+apE
+aqr
+aNx
+aPs
+aNu
+aNu
+aNu
+aNu
+aOE
+aQL
+ajO
+ajO
+aOE
+aRn
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aWz
+aWz
+aUi
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aBb
+aEG
+aNq
+aEG
+aAi
+ags
+ags
+aac
+aac
+aac
+aac
+aNm
+aMI
+aMI
+aPt
+aMv
+aRW
+aRW
+aRW
+aRU
+aac
+aJx
+azQ
+aBF
+aEO
+aEO
+aXh
+azQ
+azQ
+"}
+(137,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aDj
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aar
+aar
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aqr
+ads
+aFF
+aeb
+aqr
+aeU
+afn
+aOE
+aqr
+aqr
+aqr
+aqr
+aqr
+ajF
+aka
+ali
+amy
+amG
+aqr
+aqr
+aqr
+aqr
+aqr
+aqd
+aOE
+aFF
+asB
+asB
+asB
+aqr
+abJ
+beJ
+axU
+aqr
+aqr
+agK
+agK
+aqr
+aNL
+aNu
+aNu
+aNu
+aNu
+aqr
+aAP
+aQL
+ajO
+ajO
+aOE
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aDE
+aXZ
+ags
+aYY
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+ags
+ags
+aZS
+ags
+ags
+ags
+ags
+ags
+aBR
+aLL
+aAN
+aEG
+aEw
+ags
+aac
+aac
+aac
+aac
+aNm
+aMI
+aMI
+aPt
+aMv
+aRW
+aRW
+aRW
+aRW
+aac
+aJx
+azQ
+aEO
+aEO
+aEO
+aKl
+azQ
+aJx
+"}
+(138,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aae
+adu
+adM
+aec
+aqr
+aeV
+aOE
+adN
+aqr
+akg
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+aeK
+aeK
+aeK
+aOE
+aoa
+aoy
+aqr
+aqg
+aLC
+baX
+aOE
+aOE
+aOE
+aqr
+abJ
+beJ
+abJ
+aqr
+aNu
+awX
+awX
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aCv
+aQL
+ajO
+ajO
+abZ
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aDH
+aac
+aac
+aFY
+ags
+ags
+ags
+aWz
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aZS
+aZS
+ags
+ags
+ags
+ags
+aRO
+aEG
+aUx
+aEG
+aUn
+ags
+ags
+ags
+aac
+aac
+aac
+aNm
+aMI
+aMI
+aPt
+aMv
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+azQ
+aRQ
+aAr
+aEO
+aKp
+azQ
+aJx
+"}
+(139,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aqr
+adv
+adO
+aed
+aqr
+afc
+aOE
+agp
+agy
+aOE
+aig
+ahg
+ahg
+aOE
+ahg
+ahg
+ahg
+aqv
+ahg
+ahg
+ahg
+aOE
+aqr
+aqs
+aOE
+aOE
+aOE
+aOE
+aOE
+aqr
+awx
+beJ
+abJ
+aNu
+aNu
+aBi
+aNu
+aqr
+aEj
+aOE
+aqr
+aEj
+aOE
+aqr
+aFN
+aFF
+aOE
+aOE
+aOE
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aIV
+aZS
+ags
+ags
+aBD
+aDE
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aBb
+aEG
+aEG
+aUn
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aMI
+aMI
+aMI
+aNi
+aMv
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+azQ
+aPD
+aEO
+aEO
+aJY
+azQ
+aJx
+"}
+(140,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aqr
+adw
+adP
+aee
+aqr
+afd
+afo
+agq
+aqr
+ahl
+aih
+ahg
+ahg
+aOE
+ahg
+ahg
+ahg
+aOE
+ahg
+ahg
+amB
+aoz
+aqr
+aqF
+aOE
+arN
+asC
+asC
+asC
+aqr
+abJ
+beJ
+abJ
+aqr
+aAO
+aqr
+aAO
+aqr
+aEk
+aOE
+aqr
+agN
+aOE
+aqr
+aOE
+aFF
+aVJ
+aOE
+aOE
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aIV
+ayV
+ayV
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aQv
+aQk
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aNi
+aMI
+aMI
+aMI
+aMv
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+azQ
+azQ
+azQ
+azQ
+azQ
+azQ
+aJx
+"}
+(141,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aHp
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+apR
+aab
+aqr
+aqr
+adR
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+ahm
+ahg
+ahg
+aiU
+ajM
+ahg
+ahg
+amB
+amH
+amB
+ahg
+aob
+aoA
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+acy
+ahr
+acy
+aqr
+aAS
+aqr
+aAS
+aqr
+aEl
+aOE
+aqr
+aGH
+aOE
+aqr
+aOE
+aFF
+aOE
+aOE
+aOE
+aar
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aIV
+aDH
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+ags
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aMI
+aMI
+aMI
+aMI
+aMv
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+"}
+(142,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+ags
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+apR
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aho
+aiq
+aOE
+aiV
+ajU
+akn
+alj
+amC
+amI
+anl
+aOE
+agp
+aoB
+aqr
+akg
+aRP
+aOE
+asK
+aOE
+aOE
+aOE
+abJ
+beJ
+abJ
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aFe
+aFH
+aqr
+aHl
+aqr
+acy
+ahr
+acy
+aqr
+aRl
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aNd
+aMI
+aMI
+aPt
+aMv
+aRW
+aRW
+aRW
+aac
+aac
+aac
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+"}
+(143,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ayV
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+apR
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aqr
+aqr
+aqr
+aqr
+aar
+aqr
+aqr
+aqr
+aar
+aqr
+aqr
+aqr
+aqr
+aqr
+aOE
+aOE
+aOE
+aVJ
+aOE
+aOE
+aOE
+abJ
+axt
+aFt
+aLC
+aLC
+aBj
+aLC
+aLC
+aLC
+aFf
+aBj
+aLC
+aLC
+aLC
+aLC
+baX
+aOE
+aqr
+aQO
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aYI
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aZS
+aZS
+aZS
+aZS
+aZS
+aac
+aac
+aNc
+aMI
+aMI
+aPz
+aMv
+aRW
+aRW
+aRW
+aRU
+aac
+aac
+aac
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+"}
+(144,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ags
+aac
+ags
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+apR
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aau
+aab
+aab
+aeW
+aab
+aab
+aab
+aab
+aab
+aau
+aab
+aqr
+aJM
+aOE
+aOE
+aOE
+aOE
+aCv
+aOE
+abJ
+abJ
+abJ
+aOE
+aOE
+aOE
+aOE
+aJM
+aOE
+aOE
+aOE
+aVJ
+aOE
+aOE
+aga
+aOE
+abZ
+aqr
+aqr
+aqr
+aaN
+aaN
+aaN
+aaN
+aYI
+aYI
+aYI
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aZS
+aac
+aac
+aNc
+aMI
+aMI
+aPB
+aMv
+aRW
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aac
+aac
+aJx
+aJx
+aJx
+aJx
+"}
+(145,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+ags
+ags
+ags
+ags
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaC
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+apR
+acy
+aOE
+aOE
+aOE
+asL
+aOE
+aOE
+aOE
+abJ
+abJ
+axV
+aOE
+aVh
+aOE
+aOE
+aOE
+aOE
+aOE
+aVJ
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aYI
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+ags
+aac
+aac
+aNc
+aMI
+aMI
+aPE
+aMv
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aac
+aac
+aJx
+aJx
+aJx
+"}
+(146,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aGn
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aZS
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aqr
+aar
+aqr
+aqr
+aar
+aqr
+aqr
+acy
+anP
+acy
+aqr
+aqr
+aar
+aqr
+aqr
+aar
+aqr
+aqr
+aar
+aqr
+aqr
+aar
+aqr
+aqr
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aac
+aac
+aac
+aNV
+aMI
+aMI
+aPt
+aMv
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRU
+aac
+aac
+aac
+aJx
+aJx
+aJx
+"}
+(147,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+amL
+aHI
+awl
+awo
+aWy
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aMI
+aMI
+aMI
+aNi
+aMv
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aac
+aJx
+aJx
+"}
+(148,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+ags
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aYI
+aaN
+aaN
+aaN
+aaN
+aWs
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aRv
+aaN
+azK
+aaN
+aaN
+azK
+aaN
+aaN
+aAD
+aab
+aab
+aab
+aVt
+aaN
+aVt
+aaN
+aRv
+aKP
+ana
+ayO
+aaD
+aab
+azK
+aaN
+aaN
+azK
+aaN
+aaN
+aRv
+aaN
+azK
+aaN
+aaN
+azK
+aaN
+aaN
+aAD
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aMv
+aMG
+aMG
+aMv
+aMv
+aRW
+aRW
+aRW
+aRU
+aRW
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aac
+aJx
+"}
+(149,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aFc
+aaN
+aaN
+aYI
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aWs
+aaN
+aZM
+aGr
+aaN
+aaN
+azK
+aaN
+aWs
+aaN
+aaN
+aab
+aab
+aab
+aaN
+aaN
+aaN
+aAD
+amM
+aKP
+apR
+ayO
+afq
+afK
+aaN
+aaN
+azK
+aaN
+aaN
+aaN
+aZM
+aGr
+aaN
+aWs
+azK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aRU
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRU
+aac
+aac
+aJx
+"}
+(150,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+ags
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aYI
+aYI
+aYI
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aRv
+aaN
+aaN
+aHD
+azK
+aaN
+aVt
+aGr
+aHD
+aAD
+aaN
+aYI
+aYI
+aWs
+azK
+azE
+aaN
+aRr
+apR
+aPr
+aaD
+aab
+aaN
+aHD
+azK
+aaN
+aVt
+aGr
+aRv
+aFc
+aaN
+aHD
+azK
+aaN
+aVt
+aGr
+aHD
+aAD
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+"}
+(151,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aYI
+aaN
+aaN
+aYI
+aaN
+aaN
+aaN
+aaN
+aaN
+aFc
+aaN
+aaN
+aaN
+aaN
+aRv
+aAD
+azK
+aVt
+aaN
+aaN
+aVt
+aaN
+aaN
+aaN
+aaN
+aYI
+aaN
+aaN
+aGr
+aaN
+aRv
+aKP
+apR
+ayO
+aaD
+afs
+azK
+aVt
+aaN
+aaN
+aVt
+aaN
+aRv
+aAD
+azK
+aVt
+aaN
+aaN
+aVt
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+"}
+(152,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aYI
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+azE
+aYI
+aYI
+aaN
+azK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aVt
+aaN
+aaN
+aml
+aaN
+aKP
+ana
+ayO
+amm
+afL
+aaN
+aaN
+aWs
+azK
+aaN
+aaN
+aaN
+azE
+aaN
+aaN
+aaN
+azK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aRW
+aRW
+aRW
+aMv
+aMv
+aMG
+aMG
+aMv
+aMv
+aMv
+aMv
+aMv
+aMv
+aMv
+aMv
+aMv
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+"}
+(153,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aLh
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aFc
+aaN
+aaN
+aaN
+aaN
+aaN
+aYI
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+azK
+azK
+aaN
+aaN
+aaN
+aYI
+aaN
+aaN
+aFc
+aaN
+aaN
+aaN
+aaN
+azK
+aaN
+aRr
+ana
+aPr
+aab
+aab
+azK
+azK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+azK
+azK
+aFc
+aaN
+aaN
+aaN
+aWs
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aRW
+aRW
+aRW
+aMv
+aNY
+aEF
+aEF
+aPF
+aPF
+aNY
+aEF
+aPF
+aPF
+aEF
+aNY
+aMv
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+"}
+(154,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+azv
+aaN
+aVt
+aaN
+aaN
+aYI
+aaN
+azK
+aaN
+aaN
+aYI
+aaN
+aHD
+aYI
+aaN
+aHD
+aGg
+aWs
+azK
+aRr
+anw
+ayO
+afr
+aab
+aaN
+aaN
+aaN
+azK
+aaN
+aYI
+aVt
+aaN
+aaN
+aYI
+aaN
+azK
+aaN
+aaN
+aaN
+aaN
+aHD
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aRW
+aRW
+aRW
+aMv
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aMv
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+"}
+(155,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aWs
+aaN
+aaN
+aaN
+aaN
+aWs
+aaN
+aaN
+aaN
+aaN
+aaN
+aAD
+aaN
+aaN
+aaN
+aHD
+aaN
+aFc
+aHD
+aaN
+aGr
+aaN
+aaN
+aYI
+aVt
+aaN
+aaN
+aaN
+anb
+anx
+aPr
+afs
+aab
+aaN
+aFc
+aHD
+aaN
+aYI
+aUf
+aAD
+aaN
+aaN
+aFc
+aHD
+aYI
+aaN
+aHD
+aYI
+aGr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aZS
+aac
+aac
+aRW
+aRW
+aRW
+aMv
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aMv
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+"}
+(156,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aHD
+aaN
+aGr
+aaN
+aaN
+aaN
+aYI
+aaN
+aaN
+aaN
+aAD
+aaN
+aaN
+aaN
+aaN
+aPm
+azK
+anc
+anb
+aPr
+aft
+aab
+aGr
+aaN
+aaN
+aaN
+aaN
+aaN
+aHD
+aaN
+aGr
+aaN
+aaN
+aaN
+aaN
+aYI
+aYI
+aaN
+aAD
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aZS
+ags
+aac
+aac
+aRW
+aRW
+aRW
+aMG
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aMG
+aRW
+aRW
+aRW
+aac
+aac
+aJx
+"}
+(157,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aFc
+aaN
+aaN
+aaN
+aVt
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aYI
+aaN
+aaN
+aHD
+aaN
+aaN
+afs
+aab
+aTG
+ana
+ana
+aab
+afr
+aaN
+aaN
+aaN
+aYI
+aaN
+aWs
+aaN
+aVt
+aaN
+aaN
+aFc
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+ags
+aac
+aac
+aRW
+aRW
+aRW
+aRW
+aMG
+aEF
+aEF
+aEF
+aEF
+aEF
+aPG
+aPG
+aEF
+aEF
+aEF
+aEF
+aMG
+aRW
+aRW
+aRW
+aRW
+aac
+aJx
+"}
+(158,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aQd
+ags
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aFc
+aaN
+aYI
+aaN
+aaN
+aYI
+aYI
+aaN
+aaN
+aWs
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aGr
+aaN
+aaN
+aYI
+aaN
+aVt
+aWs
+aAD
+afK
+aab
+aab
+aaN
+ana
+aab
+aab
+aWs
+aaN
+aaN
+aaN
+aaN
+aGr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aWs
+aGr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aRU
+aRW
+aRW
+aRW
+aMv
+aNZ
+aEF
+aEF
+aEF
+aEF
+aPG
+aPG
+aEF
+aEF
+aEF
+aPF
+aMv
+aRW
+aRW
+aRW
+aRU
+aac
+aJx
+"}
+(159,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aYI
+aYI
+aaN
+aaN
+aaN
+aaN
+aaN
+aVt
+aaN
+aWs
+aaN
+aaN
+aaN
+aHD
+aaN
+aaN
+aaN
+aaN
+alL
+aab
+aGD
+aab
+agr
+aMM
+aab
+aab
+aaN
+aVt
+aaN
+aaN
+aFc
+aaN
+aaN
+aYI
+aaN
+aVt
+aaN
+aaN
+aaN
+aaN
+aaN
+aHD
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aRW
+aMv
+aNZ
+aEF
+aEF
+aEF
+aEF
+aPG
+aPG
+aEF
+aEF
+aEF
+aPF
+aMv
+aRW
+aRW
+aRW
+aRW
+aac
+aJx
+"}
+(160,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aYI
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aGr
+aaN
+aaN
+aaN
+aaN
+aaN
+aHD
+aaN
+aaN
+aaN
+aaN
+aCU
+aaN
+aab
+aft
+aab
+aft
+ana
+aab
+aab
+aoY
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aWs
+aGr
+aaN
+aaN
+aaN
+aaN
+aaN
+aHD
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aRW
+aMv
+aNZ
+aEF
+aEF
+aEF
+aEF
+aPG
+aPG
+aEF
+aEF
+aEF
+aPF
+aMv
+aRW
+aRW
+aRW
+aRW
+aac
+aJx
+"}
+(161,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ayV
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aWs
+aaN
+aaN
+aaN
+aaN
+aaN
+aWs
+aaN
+aab
+afr
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aGr
+aaN
+aaN
+aaN
+aaN
+aaN
+afr
+aab
+afs
+aab
+anH
+amm
+afr
+aaN
+aYI
+aaN
+aaN
+aaN
+aaN
+aaN
+aVt
+aaN
+aaN
+aaN
+aYI
+aYI
+aaN
+aaN
+aGr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aRW
+aMv
+aNZ
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aPF
+aMv
+aRW
+aRW
+aRW
+aRW
+aac
+aJx
+"}
+(162,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aaN
+aaN
+aaN
+aaN
+aGr
+aaN
+aaN
+aaN
+aaN
+aYI
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aGr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aYI
+aGr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aRW
+aMv
+aNZ
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aPF
+aMv
+aRW
+aRW
+aRW
+aRW
+aac
+aJx
+"}
+(163,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aGr
+aAD
+aaN
+aaN
+aaN
+aAD
+aaN
+aHD
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+aab
+aaN
+aGr
+aAD
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aGr
+aAD
+aaN
+aaN
+aaN
+aAD
+aaN
+aHD
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aRW
+aMv
+aNY
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aEF
+aNY
+aMv
+aRW
+aRW
+aRW
+aRW
+aac
+aJx
+"}
+(164,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aab
+aab
+aab
+aab
+aab
+afs
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+amm
+aab
+aab
+aab
+amm
+aab
+afs
+aab
+aab
+aab
+aGD
+aab
+aab
+aab
+afs
+aab
+aab
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aRW
+aMv
+aMv
+aMv
+aNY
+aEF
+aEF
+aEF
+aEF
+aEF
+aNY
+aMv
+aMv
+aMv
+aRW
+aRW
+aRW
+aRW
+aac
+aJx
+"}
+(165,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+avq
+avq
+avq
+avq
+avq
+aeN
+acN
+aeN
+avq
+acN
+acN
+acN
+acN
+avq
+avq
+avq
+avq
+aeN
+avq
+avq
+acN
+avq
+avq
+and
+any
+aJm
+avq
+aeN
+avq
+acN
+avq
+aeN
+avq
+acN
+acN
+avq
+avq
+aeN
+avq
+avq
+avq
+avq
+aeN
+avq
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aac
+aJx
+"}
+(166,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQK
+aaN
+aaN
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+acI
+acZ
+aau
+ada
+aaF
+adD
+aab
+aau
+aab
+aau
+ada
+aaF
+adD
+aab
+aau
+aab
+ada
+aaF
+adD
+aab
+aau
+aab
+amN
+aRr
+anz
+anI
+anY
+adD
+acZ
+aau
+ada
+aaF
+adD
+adD
+acZ
+adD
+acZ
+aau
+ada
+aaF
+adD
+aab
+aau
+acK
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aac
+aJx
+"}
+(167,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+acJ
+aab
+aaF
+aab
+aau
+aab
+aeW
+acZ
+aab
+aaF
+aab
+aau
+aab
+aeW
+acZ
+aab
+aab
+aau
+aab
+aeW
+acZ
+aab
+amN
+ane
+anA
+anI
+amm
+aaF
+aab
+aaF
+aab
+aau
+aab
+aaF
+aab
+aaF
+aab
+aaF
+aab
+aau
+aab
+aeW
+acZ
+acK
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aac
+aJx
+"}
+(168,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+acK
+ada
+adD
+acZ
+aaF
+aaF
+aau
+aab
+aeW
+adD
+acZ
+aaF
+aaF
+aau
+aab
+aeW
+acZ
+aaF
+aaF
+aau
+aab
+amn
+amm
+anf
+anB
+aIn
+amN
+aab
+aUz
+adD
+acZ
+aaF
+aaF
+aab
+ada
+aab
+ada
+adD
+acZ
+aaF
+aaF
+aau
+aab
+awg
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aRU
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRW
+aRU
+aac
+aJx
+"}
+(169,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQK
+aQK
+aQK
+aQK
+aWZ
+aKQ
+aKQ
+aKQ
+aKQ
+aJK
+aQK
+aQK
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+aqr
+aqr
+aqr
+alB
+aht
+aht
+agV
+aht
+aqr
+aqr
+aqr
+ajy
+ajy
+aqr
+ask
+ask
+ask
+ask
+ajy
+aqr
+aqr
+ajy
+apN
+apN
+aqh
+aqr
+ajy
+ajy
+aqr
+azV
+ask
+ask
+azV
+aqr
+aqr
+avz
+aqr
+azV
+ask
+azV
+ask
+ajy
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(170,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aLU
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQK
+aQK
+aQK
+aWZ
+aCs
+aOy
+aHk
+aHk
+aYQ
+azU
+aJK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+afF
+aii
+agj
+aii
+aii
+aii
+aii
+adN
+aOE
+ajq
+aqr
+akg
+akw
+aOE
+aqv
+aOE
+adN
+anJ
+aog
+aoF
+apf
+aqr
+ahg
+ahg
+ahg
+aqr
+aoF
+arn
+arP
+asl
+asQ
+asm
+atT
+aqr
+auM
+avA
+avT
+awD
+awZ
+awZ
+awZ
+auU
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(171,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aLU
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQK
+aQK
+aQK
+aWZ
+aCs
+aOy
+aTw
+aTw
+aTw
+aTw
+aYQ
+azU
+aJK
+aQK
+aQK
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+afG
+aii
+agC
+agC
+agC
+aii
+aij
+aiN
+aOE
+abW
+aqr
+akh
+akx
+all
+akz
+akz
+akz
+aqv
+aqr
+aqr
+aqr
+aqr
+apO
+apO
+apO
+aqr
+aqr
+aqr
+aqr
+asm
+asR
+asm
+atU
+aqr
+auN
+ahL
+ahL
+ahL
+ahL
+axD
+ahL
+ayq
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(172,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aLU
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQK
+aQK
+aQK
+aQK
+aWZ
+aCs
+aOy
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aYQ
+azU
+aJK
+aQK
+aQK
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+aii
+aii
+agD
+agW
+ahu
+ahS
+aii
+aOE
+aqv
+abX
+aqr
+aOE
+aky
+akD
+akz
+ame
+ame
+acj
+aqr
+aoG
+aoI
+aqv
+apP
+ahg
+ahg
+aOE
+aoI
+aOE
+aqr
+asm
+asS
+asm
+atV
+aqr
+auO
+ahL
+avU
+ahL
+axa
+ahL
+ayh
+ayr
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(173,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ayV
+aZS
+ags
+aLU
+aLU
+aLU
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQK
+aQK
+aWZ
+aKQ
+aKQ
+aCs
+aOy
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aYQ
+azU
+aKQ
+aJK
+aQK
+aQK
+aQK
+aaN
+aaN
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+afH
+agi
+agE
+agX
+ahv
+ahS
+aii
+aOE
+agt
+aqv
+aqr
+aki
+akz
+akz
+akz
+amf
+amf
+amA
+aqr
+aOE
+aoI
+aOE
+avp
+azS
+avp
+abY
+aoI
+aOE
+aqr
+asm
+asT
+asm
+atW
+aqr
+auP
+ahL
+avV
+ahL
+axb
+ahL
+ahL
+ays
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(174,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ahJ
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+ags
+ags
+ags
+ags
+aLU
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQK
+aQK
+aWZ
+aCs
+aOy
+aHk
+aHk
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aTw
+aHk
+aYQ
+aFE
+aQK
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+aii
+aii
+agF
+agY
+ahw
+ahS
+aii
+aOE
+aOE
+ajs
+ajy
+aOE
+akz
+alm
+alC
+akz
+akz
+anJ
+aqr
+aOE
+api
+aOE
+ahg
+ahg
+ahg
+aOE
+api
+aOE
+aqr
+asm
+asU
+asm
+atX
+aqr
+auQ
+ahL
+ahL
+awE
+axc
+axE
+ahL
+ayt
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(175,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ayV
+ags
+aWU
+ags
+ags
+ags
+aLU
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQK
+aQK
+aWZ
+aCs
+aOy
+aTw
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aTw
+aYa
+azU
+aKQ
+aJK
+aQK
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+afu
+aii
+agj
+agG
+agZ
+agG
+aii
+aii
+aOE
+aOE
+aju
+ajy
+aOE
+akB
+akD
+akz
+amg
+amP
+anK
+aqr
+aOE
+apg
+aOE
+ahg
+ahg
+ahg
+aOE
+api
+aOE
+aqr
+asm
+asV
+asm
+atY
+aqr
+auR
+avB
+avW
+awF
+axd
+axF
+ahL
+ayu
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(176,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aLU
+aLU
+aaN
+aaN
+aaN
+aaN
+aQK
+aQK
+aQK
+aWZ
+aCs
+aOy
+aTw
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aTw
+aHk
+aYQ
+aFE
+aQK
+aQK
+aQK
+aQK
+aaN
+aaN
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+afI
+aii
+aii
+aii
+aii
+aii
+aii
+aiO
+aje
+ajv
+aqr
+akj
+akC
+akD
+alD
+amh
+amh
+akS
+aqr
+aOE
+api
+aOE
+ahg
+ahg
+ahg
+aOE
+aqW
+aOE
+aqr
+asm
+asW
+asm
+atZ
+aqr
+auS
+ahL
+ahL
+ahL
+axe
+ahL
+ahL
+ayv
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aZS
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(177,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aLU
+aaN
+aaN
+aaN
+aQK
+aQK
+aWZ
+aWQ
+aCs
+aOy
+aTw
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aYa
+azU
+aJK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+afJ
+aOE
+aOE
+aOE
+arp
+aOE
+aqv
+aOE
+aOE
+ajw
+aqr
+aje
+akD
+akD
+akz
+akz
+akz
+aOE
+aqr
+aOE
+api
+aOE
+ahg
+ahg
+ahg
+aOE
+api
+arp
+aqr
+asm
+asX
+asm
+asQ
+ajy
+auT
+ahL
+ahL
+ahL
+avU
+ahL
+axD
+ayw
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+ags
+ags
+aZS
+aZS
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(178,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aEJ
+ags
+aZS
+aZS
+ags
+aLU
+aaN
+aaN
+aaN
+aQK
+aQK
+aXS
+aOy
+aHk
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aYQ
+azU
+aKQ
+aJK
+aQK
+aQK
+aQK
+aQK
+aaN
+aQK
+aaN
+aaN
+aaN
+aaN
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aQK
+aaN
+aaN
+aQK
+aaN
+aQK
+aaN
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aik
+aOE
+aqv
+afZ
+aqr
+akj
+akD
+aln
+alD
+ami
+ami
+amz
+aqr
+aOE
+apj
+aOE
+ahg
+ahg
+ahg
+aOE
+azT
+aOE
+aqr
+asm
+asY
+asm
+aua
+ajy
+auU
+avC
+avC
+auU
+auU
+avC
+avC
+ayx
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aLU
+aLU
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+ags
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(179,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aZS
+aac
+ayV
+ags
+aLU
+aaN
+aaN
+aQK
+aQK
+aQK
+aIc
+aRV
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aHk
+aYQ
+azU
+aJK
+aQK
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aQK
+aaN
+aaN
+aaN
+aaN
+aQK
+aaN
+aaN
+aaN
+aaN
+aQK
+aaN
+aQK
+aQK
+aQK
+aaN
+aaN
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+afv
+afM
+aqr
+agH
+aqr
+agH
+aqr
+ail
+aOE
+aOE
+aOE
+ajy
+aOE
+akD
+akD
+alE
+amj
+amR
+alN
+aqr
+aOE
+aoI
+aOE
+ahg
+ahg
+ahg
+aOE
+aoI
+aOE
+aqr
+asm
+asT
+asm
+aub
+ajy
+auV
+auV
+avX
+auU
+aoX
+awd
+awd
+awd
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aNv
+aZS
+aZS
+aZS
+aZS
+aZS
+aZS
+ags
+ags
+ags
+aac
+ags
+ags
+ags
+ags
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(180,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aSl
+ags
+ags
+ags
+aZS
+aZS
+aac
+aac
+aac
+aZS
+anv
+aaN
+aaN
+aQK
+aRy
+aQK
+aGT
+aRV
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aTw
+aYQ
+azU
+aJK
+aQK
+aQK
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aQK
+aaN
+aaN
+aaN
+aaN
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+afv
+afN
+aqr
+afN
+aqr
+afN
+aqr
+aim
+aOE
+aOE
+aOE
+ajy
+akk
+akE
+alo
+alD
+akz
+amS
+aOE
+aqr
+aoH
+apk
+aOE
+ahg
+ahg
+ahg
+aOE
+aoI
+aro
+aqr
+asm
+asZ
+asm
+auc
+ajy
+auX
+auX
+avY
+auU
+auU
+axG
+ayi
+ayy
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aLU
+aLU
+aNv
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(181,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aZS
+aZS
+aac
+aac
+aac
+aac
+aPI
+aQK
+aQK
+aQK
+aQK
+aWZ
+aCs
+aRV
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aTw
+aYQ
+azU
+aKQ
+aJK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aaN
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+afv
+agl
+agk
+agl
+agl
+agl
+aqr
+ain
+anJ
+aOE
+aOE
+ajy
+aOE
+akD
+akD
+akz
+ame
+ame
+acj
+aqr
+aoH
+aOE
+aOE
+apQ
+ahg
+ahg
+afZ
+aOE
+aro
+aqr
+asm
+ata
+asm
+aud
+ajy
+auX
+auX
+avZ
+auU
+auU
+aVi
+ayi
+ayz
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aNv
+aNv
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(182,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aVY
+aVY
+aKQ
+aJK
+aWZ
+aCs
+aOy
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aTw
+aTw
+aHk
+aYQ
+aFE
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aWZ
+aKQ
+aKQ
+aKQ
+aJK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+afw
+afO
+agl
+agl
+agk
+agl
+aqr
+aio
+aOE
+afZ
+aOE
+aqr
+aqv
+akz
+akz
+akz
+ame
+ame
+anL
+aqr
+aoH
+aqv
+aOE
+ahg
+ahg
+aqi
+aOE
+aOE
+aro
+aqr
+asm
+atb
+asm
+aue
+ajy
+auX
+auX
+avZ
+auU
+auU
+aVi
+ayi
+ayi
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aLU
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(183,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aHk
+aHk
+aYQ
+aRL
+aCs
+aOy
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aTw
+aTw
+aYa
+azU
+aJK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aWZ
+aCs
+aOy
+aHk
+aYQ
+aFE
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+afw
+afP
+agl
+agI
+agl
+agk
+aqr
+aip
+aOE
+aqv
+ajx
+aqr
+aOE
+aOE
+aOE
+aOE
+aqv
+aOE
+aje
+aqr
+aoH
+abY
+aOE
+ahg
+ahg
+ahg
+aOE
+aOE
+aro
+aqr
+asm
+atc
+asm
+asR
+ajy
+auY
+auX
+avZ
+auU
+auU
+aVi
+ayj
+atw
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(184,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aTw
+aTw
+aTw
+aHk
+aHk
+aTw
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aTw
+aTw
+aYQ
+azU
+aJK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+azW
+aQK
+aQK
+aWZ
+aCs
+aOy
+aTw
+aTw
+aYa
+aFE
+aQK
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+afw
+afQ
+agl
+agl
+agl
+agl
+aqr
+aqr
+acy
+acy
+ajy
+aqr
+aqr
+acy
+acy
+aqr
+aqr
+aqr
+aqr
+aqr
+aoI
+aOE
+aOE
+ahg
+ahg
+ahg
+aqv
+aOE
+aoI
+aqr
+aOE
+ata
+aOE
+als
+ajy
+auV
+auV
+avX
+auU
+auU
+awd
+awd
+awd
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aOJ
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(185,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aTw
+aYQ
+azU
+aKQ
+aKQ
+aJK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aXS
+aOy
+aTw
+aUy
+aTw
+aYa
+azU
+aKQ
+aJK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+afv
+afR
+agl
+agJ
+aha
+agl
+acy
+ajO
+ajO
+ajO
+ajO
+ajN
+ajO
+ajO
+ajO
+ajO
+acB
+acB
+acB
+acB
+ajO
+ajO
+ajO
+ahg
+ahg
+ahg
+aOE
+aOE
+arp
+aqr
+aqr
+acy
+acy
+aqr
+ajy
+aqr
+aqr
+aqr
+acy
+acy
+aqr
+aqr
+aqr
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aTp
+aKC
+aOE
+aqv
+aOE
+aqr
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(186,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ayV
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aTw
+aHk
+aHk
+aYQ
+azU
+aKQ
+aKQ
+aKQ
+aKQ
+aKQ
+aKQ
+aJK
+aQK
+aQK
+aWZ
+aCs
+aRV
+aTw
+aUy
+aTw
+aTw
+aHk
+aYQ
+aFE
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+aqr
+aqr
+agK
+ahb
+aqr
+aqr
+air
+ajO
+ajO
+ajO
+ajO
+ajO
+ajO
+alp
+ajO
+amk
+amk
+amk
+amk
+ajO
+ajO
+ajO
+ahg
+aqc
+ahg
+aqw
+aqw
+aqw
+aqw
+aqw
+aqw
+aqw
+aqw
+arq
+aqw
+aqw
+aqw
+aqw
+aqw
+aqw
+aqw
+ayB
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aOL
+aNt
+aqv
+aFa
+agS
+aag
+aqr
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(187,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aTw
+aTw
+aHk
+aHk
+aHk
+aHk
+aHk
+aHk
+aYQ
+azU
+aKQ
+aKQ
+aCs
+aOy
+aTw
+aUy
+aUy
+aUy
+aUy
+aTw
+aYa
+azU
+aJK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+afv
+afS
+agl
+agL
+agL
+agl
+acy
+ajO
+ajO
+ajO
+ajO
+ajO
+ajO
+ajO
+ajO
+ajO
+acD
+acD
+acD
+acD
+ajO
+ajO
+ajO
+ahg
+ahg
+ahg
+aqx
+aqw
+arq
+aqw
+aqw
+aqw
+arq
+aqw
+aqw
+aqw
+aqw
+aqw
+aqw
+aqw
+arq
+aqw
+ayC
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aRa
+aaN
+aaN
+aaN
+aaN
+aRa
+aaN
+aaN
+aaN
+aOL
+aIx
+aOE
+abY
+aSj
+aOE
+aqr
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(188,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ayV
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aHk
+aHk
+aHk
+aHk
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aYQ
+aFE
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+afw
+afR
+agl
+agk
+agl
+agl
+aqr
+aqr
+acy
+aqr
+aqr
+aqr
+acy
+aqr
+aqr
+acy
+aqr
+aqr
+aqr
+aqr
+aoI
+adr
+aOE
+aqj
+aqj
+aqj
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+awG
+axf
+aqr
+aqr
+aqr
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aRa
+aaN
+aaN
+aaN
+aRa
+aaN
+aaN
+aaN
+aaN
+aaN
+aOJ
+aay
+aOE
+aOE
+aOE
+aqv
+aqr
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(189,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aYa
+aFE
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+afv
+afO
+agl
+agI
+agl
+agl
+aqr
+ais
+aOE
+ajf
+aqr
+ajP
+aOE
+akF
+aqr
+aOE
+agS
+amT
+aqr
+aqr
+ajx
+aOE
+aoI
+aqj
+aqj
+aqj
+aqr
+aqX
+arr
+aqv
+aOE
+adN
+atz
+auf
+aqr
+auZ
+avD
+awa
+awH
+axg
+axi
+ayk
+ayD
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aRa
+aaN
+aaN
+aaN
+aaN
+aqr
+ahe
+aSj
+aOE
+adN
+aOE
+aqr
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(190,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aLh
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aVG
+aVG
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aYa
+aFE
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+afw
+afP
+agl
+agl
+agk
+agl
+aqr
+ait
+aiv
+ajg
+aqr
+ajQ
+aby
+akG
+aqr
+alF
+akz
+amU
+aqr
+aqr
+aqr
+aqr
+aqr
+aqj
+aqj
+aqj
+aqr
+aqY
+agj
+aii
+asn
+aii
+aii
+atz
+aqr
+ava
+aqN
+awb
+aqN
+aqN
+axI
+aqN
+ayE
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aqr
+aSH
+aOE
+aOE
+aVy
+aOE
+aqr
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(191,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aDk
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aVG
+aVG
+aVG
+aVG
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aYa
+azU
+aJK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+afv
+afv
+afv
+agl
+agl
+agl
+aqr
+aiu
+aiv
+aiv
+ajz
+aby
+aby
+akH
+alq
+akz
+amo
+amV
+aqr
+aol
+aoJ
+apl
+aqr
+aqj
+aqj
+aqj
+aqr
+aqv
+ars
+arQ
+arQ
+arQ
+ahS
+arp
+aqr
+avb
+aqN
+aqN
+awI
+axh
+aqN
+ayl
+ayF
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aab
+aZQ
+afZ
+aOE
+aZB
+aOE
+aOE
+aqr
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(192,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZg
+aac
+aac
+ags
+aQK
+aQK
+aac
+aPI
+aPI
+aac
+aac
+ags
+aDk
+ags
+aac
+aac
+aac
+aac
+aac
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aYQ
+aFE
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+afx
+agl
+agl
+agl
+aqr
+afN
+aqr
+aiv
+aiv
+aiv
+aqr
+aby
+aby
+aby
+aqr
+alG
+akz
+akz
+aqr
+aon
+aOE
+apm
+aqr
+aqj
+apS
+aqj
+aqr
+aOE
+art
+arQ
+aso
+arQ
+atA
+aOE
+aqr
+avc
+aqO
+awc
+awd
+awd
+axJ
+aqN
+ayG
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aOL
+aIU
+aHN
+aLR
+aRp
+aZU
+aqr
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(193,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aED
+aED
+aED
+aED
+aDy
+abe
+aac
+aac
+aZS
+ags
+aQK
+aQK
+aQK
+aQK
+aPI
+aQK
+aQK
+ags
+aac
+aac
+aac
+aac
+aac
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aYa
+aFE
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+afy
+agl
+agk
+agl
+aqr
+ahy
+aqr
+aiw
+aiP
+ajj
+aqr
+ajR
+akl
+akI
+aqr
+alH
+aap
+amW
+aqr
+aon
+aoK
+aOE
+aqr
+aqj
+aqj
+aqj
+aqy
+aii
+ars
+arQ
+asp
+arQ
+ahS
+aOE
+aqr
+avd
+avG
+awd
+awd
+awd
+awd
+aym
+ayH
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aOJ
+aqr
+aqr
+aOL
+aOL
+aqr
+aOJ
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(194,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aED
+aER
+aJw
+aMp
+aEr
+aED
+aac
+aac
+aac
+aZS
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aac
+aac
+aac
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aYa
+azU
+aJK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+aqr
+aqr
+aqr
+ahc
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aOE
+agS
+aOE
+aqr
+aqj
+apS
+aqj
+aqy
+agj
+art
+arQ
+aso
+arQ
+atB
+aOE
+aqr
+avc
+avH
+awd
+awd
+awd
+awd
+ayn
+ayG
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(195,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aED
+aNG
+aMp
+aMp
+aYw
+aED
+aac
+aac
+aac
+aPI
+aLW
+aKQ
+aKQ
+aKQ
+aKQ
+aKQ
+aKQ
+aKQ
+aac
+aLM
+aLM
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aTw
+aYQ
+aFE
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+afT
+afW
+aqr
+ahd
+ahz
+ahT
+ahT
+ajh
+ahT
+ajA
+aOE
+aqr
+akJ
+alr
+alI
+alO
+amX
+aqr
+aqr
+aqr
+acy
+aqr
+aqj
+aqj
+aqj
+aqy
+aii
+ars
+arQ
+asp
+arQ
+ahS
+aOE
+aqr
+ave
+avI
+awd
+awd
+awd
+awd
+aym
+ayI
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(196,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aED
+aTi
+aXQ
+aCE
+aMp
+aED
+aac
+aac
+aac
+aPI
+aXS
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aLM
+aLM
+aVG
+aVG
+aVG
+aVG
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aVG
+aVG
+aVG
+aVG
+aVG
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aYa
+aFE
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+afU
+afV
+aqr
+aOE
+aOE
+agl
+agl
+agl
+agl
+aOE
+aOE
+aqr
+akK
+adr
+alJ
+afZ
+aOE
+acy
+aqj
+aqj
+aqj
+aqj
+apS
+aqj
+apS
+aqr
+aOE
+aru
+arQ
+aso
+arQ
+atB
+aOE
+aqr
+avc
+aqN
+awe
+awd
+awd
+axK
+aqO
+ayG
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(197,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aED
+aCF
+aMp
+aMp
+aMp
+aED
+aac
+aac
+aac
+aVY
+aCs
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aVG
+aVG
+aUL
+aLM
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aVG
+aVG
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aYa
+aFE
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+acS
+agm
+aqr
+aOE
+agl
+aby
+agl
+ahU
+agl
+agl
+aOE
+aqr
+acX
+als
+alK
+amq
+amY
+aqr
+aoq
+aqj
+aqj
+aqj
+aqj
+aqj
+aqj
+aqr
+aje
+ars
+arQ
+asp
+arQ
+ahS
+aOE
+aqr
+avf
+avJ
+aqN
+awJ
+awL
+aqN
+aqO
+ayJ
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(198,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aED
+azy
+aMp
+aCA
+aGq
+aED
+aac
+aac
+aac
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aLM
+aLM
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aTw
+aTw
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aYa
+aFE
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+acP
+afV
+aqr
+ahe
+agl
+aby
+agl
+agl
+aby
+agl
+ajS
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+acy
+acy
+aqr
+aqr
+aOE
+art
+arQ
+asq
+arQ
+atB
+aOE
+aqr
+avc
+aqN
+aqN
+awK
+aqN
+aqN
+aqN
+ayG
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(199,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aED
+aED
+aED
+aED
+aED
+aED
+aac
+aac
+aVG
+aTw
+aTw
+aTw
+aTw
+aTw
+aWd
+azP
+azP
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aTw
+aTw
+aTw
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aYa
+aFE
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+afV
+afW
+aqr
+ahf
+agl
+agl
+agl
+agl
+aby
+agl
+agS
+acy
+aOE
+akw
+akw
+amr
+amZ
+akw
+akw
+akw
+apn
+akw
+aOE
+aOE
+aqr
+aqr
+agS
+aii
+aii
+agj
+agj
+aii
+aqv
+aqr
+avg
+avK
+awf
+avK
+axj
+axH
+axL
+ayK
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(200,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aVG
+aTw
+aTw
+aTw
+aWd
+azP
+azP
+aJU
+aQK
+aQK
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aYa
+aFE
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+afW
+agn
+agM
+ahg
+agl
+agl
+agl
+aiQ
+agl
+agl
+aOE
+acy
+aOE
+aby
+aby
+aby
+aby
+aby
+aby
+aby
+aee
+aby
+apT
+aOE
+aOE
+aqr
+aOE
+aOE
+aOE
+aOE
+aOE
+aOE
+anJ
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(201,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aVG
+aVG
+aVG
+aLM
+aTw
+aWd
+aJU
+aQK
+aQK
+aQK
+aQK
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aDz
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aBN
+aBN
+aBN
+aBN
+aBN
+aBN
+aBN
+aBN
+aBN
+aBN
+aBN
+aBN
+aBN
+aBN
+aBN
+aBN
+aBN
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aYa
+aFE
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+afV
+afW
+aqr
+ahf
+agl
+agl
+agl
+agl
+aby
+agl
+aOE
+acy
+agS
+aee
+aby
+ams
+aby
+aby
+aby
+aby
+aby
+aby
+aby
+aOE
+aql
+aqr
+aqZ
+arv
+arR
+asr
+atd
+atC
+aug
+aqr
+avh
+avi
+avj
+avi
+avj
+avi
+avj
+avi
+avh
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(202,1,1) = {"
+ayN
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aLM
+aac
+azP
+aJU
+aeY
+aQK
+aTm
+aQK
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aPA
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+azP
+azP
+azP
+azP
+azP
+azP
+azP
+azP
+azP
+azP
+azP
+azP
+azP
+azP
+azP
+azP
+aIp
+aRV
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aYa
+azU
+aJK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+afU
+afV
+aqr
+aOE
+agl
+ahU
+agl
+agl
+aby
+agl
+ajT
+aqr
+akL
+aby
+aby
+aby
+aby
+anM
+aby
+aoL
+aby
+apC
+aby
+aOE
+aqr
+aqz
+apy
+apy
+apy
+apy
+apy
+apy
+aqA
+aqr
+avi
+avL
+avM
+avM
+axk
+avM
+avM
+ayL
+avi
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(203,1,1) = {"
+ayN
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aac
+aac
+aac
+aac
+aEz
+aQK
+aQK
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aXS
+aAJ
+aBN
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aYQ
+aFE
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+acS
+afW
+aqr
+aOE
+agl
+aby
+agl
+ahU
+agl
+agl
+aOE
+aqr
+akM
+aby
+aby
+amt
+aee
+aby
+aby
+aby
+aby
+aby
+aby
+aOE
+aqm
+aqA
+apy
+apy
+arS
+ass
+ass
+ass
+auh
+aqr
+avj
+avM
+awp
+avM
+avM
+avM
+awp
+avM
+avj
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(204,1,1) = {"
+ayN
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aVG
+aac
+aac
+aac
+aac
+aac
+aQK
+ags
+aDk
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aQK
+aaN
+aQK
+aQK
+aQK
+aQK
+aFi
+azP
+aIp
+aAJ
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aYa
+aFE
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+acP
+afV
+aqr
+aOE
+aOE
+agl
+agl
+agl
+agl
+aOE
+aOE
+aqr
+akN
+alt
+aby
+aby
+aby
+aby
+aby
+aby
+aby
+aby
+aby
+aOE
+aqn
+aqA
+ara
+apy
+arT
+aqr
+aqr
+aqr
+aqr
+atk
+avh
+avM
+avM
+awM
+axl
+avM
+avM
+avM
+avi
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(205,1,1) = {"
+ayN
+aVG
+aVG
+aVG
+aVG
+aVG
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ags
+aDk
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aSl
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aQK
+aQK
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQK
+aQK
+aQK
+aFi
+aIp
+aAJ
+aBN
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aYa
+aFE
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+afT
+ago
+aqr
+ahh
+ahA
+ahT
+ahT
+ahT
+ahT
+ajB
+aOE
+aqr
+akO
+aby
+aby
+aby
+aby
+anN
+aby
+aby
+apo
+aby
+apU
+aOE
+aqo
+aqA
+apy
+apy
+arU
+aqr
+ate
+atD
+aui
+auB
+avk
+avM
+avM
+awN
+axm
+avM
+ayp
+avM
+avj
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(206,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aQK
+aaN
+aaN
+aaN
+aSN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQK
+aQK
+aFi
+azP
+aIp
+aAJ
+aBN
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aYa
+aFE
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+akP
+aby
+aby
+amu
+aby
+aby
+aee
+aby
+aby
+aby
+aby
+aOE
+aqp
+aqA
+apy
+apy
+arV
+aqr
+atf
+arJ
+auj
+atk
+avh
+avM
+avM
+awO
+axn
+avM
+avM
+avM
+avi
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(207,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQK
+aQK
+aQK
+aFi
+azP
+aIp
+aRV
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aYa
+aTx
+aQK
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+afX
+aOE
+aOE
+aOE
+afX
+aqr
+aix
+agS
+aOE
+aqv
+aix
+aqr
+akQ
+alu
+aby
+aby
+aby
+aby
+aby
+aoM
+aby
+aby
+aby
+aOE
+aqq
+aqB
+apy
+ara
+arW
+aqr
+atg
+atE
+auk
+atk
+avi
+avM
+avM
+avM
+avM
+avM
+avM
+avM
+avj
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(208,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aqr
+aqr
+aHf
+aHf
+aHf
+aqr
+aOJ
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQK
+aQK
+aQK
+aQK
+aXS
+aRV
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aYa
+azU
+aJK
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+aOE
+agl
+agl
+ahi
+aOE
+aBY
+aiy
+aiR
+aji
+ahf
+aOE
+ajy
+aOE
+aby
+aby
+aby
+aby
+anO
+aby
+aby
+aby
+aby
+aby
+aOE
+aqr
+aqz
+apy
+apy
+arX
+aqr
+atf
+arJ
+aul
+atk
+avj
+avM
+awp
+avM
+axo
+avM
+axo
+avM
+avi
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(209,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aNF
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aqr
+aJy
+aCc
+aXM
+aSF
+aWq
+aHf
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQK
+aQK
+aXS
+aAJ
+aBN
+aBN
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aTw
+aYQ
+azU
+aJK
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+amp
+agl
+agl
+agl
+aOE
+aBY
+aiy
+aOE
+aRC
+aOE
+aOE
+akm
+aOE
+aby
+aee
+amv
+aby
+aby
+aby
+aoN
+aby
+apD
+aby
+aOE
+aqr
+aqC
+apy
+apy
+arY
+aqr
+ath
+arJ
+aum
+atk
+avi
+avM
+avM
+awP
+avM
+avM
+avM
+avM
+avj
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(210,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aqr
+aOE
+aIh
+aRP
+aVy
+aOE
+aws
+aab
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQK
+aFi
+azP
+azP
+aIp
+aRV
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aTw
+aYQ
+azU
+aJK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+aOE
+agl
+agl
+agl
+aOE
+aBY
+aiy
+aiR
+aOE
+ahf
+aOE
+ajy
+aOE
+aby
+aby
+aby
+aby
+aby
+aby
+aby
+aee
+aby
+aby
+aOE
+acy
+aqA
+apy
+apy
+arZ
+aqr
+ati
+arJ
+aum
+atk
+avj
+avM
+avM
+avM
+axo
+awp
+axo
+avM
+avi
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(211,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aqr
+aRX
+abJ
+abJ
+abJ
+apH
+aqr
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQK
+aQK
+aQK
+aQK
+aXS
+aRV
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aTw
+aYQ
+aFE
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+afX
+aOE
+aOE
+aOE
+afX
+aqr
+aix
+aOE
+aOE
+abY
+aix
+aqr
+akR
+akY
+alM
+amw
+akY
+akY
+alM
+akY
+app
+akY
+aOE
+aOE
+acy
+aqA
+aqA
+aqA
+aqA
+ast
+atj
+atF
+aun
+atk
+avi
+avN
+avM
+avM
+avM
+avM
+avM
+ayM
+avj
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(212,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aNF
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aNF
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aqr
+acu
+abJ
+aBT
+abJ
+aBK
+aHf
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aSN
+aaN
+aaN
+aaN
+aaN
+aQK
+aQK
+aQK
+aXS
+aAJ
+aBN
+aBN
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aYa
+aFE
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+avq
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+atk
+atk
+atk
+atk
+avh
+avi
+avj
+avi
+avj
+avi
+avj
+avi
+avh
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(213,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aqr
+aOE
+abJ
+abJ
+abJ
+aWq
+aHf
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQK
+aQK
+aQK
+azP
+azP
+aIp
+aRV
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aYa
+aFE
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+avq
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(214,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aqr
+ahe
+aOE
+aSb
+aOE
+aVh
+aqr
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aDB
+aaN
+aaN
+aQK
+aQK
+aQK
+aQK
+aXS
+aRV
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aYa
+aFE
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(215,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aqr
+aay
+aJM
+aOE
+aTu
+agd
+aqr
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aQK
+aQK
+aQK
+aQK
+aXS
+aRV
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aYa
+aFE
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(216,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aNF
+aZS
+ags
+aZS
+ags
+aac
+aac
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aqr
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aQK
+aQK
+aQK
+aXS
+aRV
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aYa
+aFE
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(217,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aZS
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aQK
+aXS
+aRV
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aYa
+aFE
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(218,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ayV
+ayV
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aQK
+aXS
+aRV
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aTw
+aYa
+aFE
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aPT
+aPT
+aPT
+aFw
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aLU
+aLU
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(219,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ags
+ags
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ayV
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aLU
+aaN
+aaN
+aaN
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aTw
+aYa
+aFE
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aPT
+aYJ
+aDZ
+aGy
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aNv
+aLU
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(220,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ayV
+ayV
+aZS
+aZS
+ayV
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aTw
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aTw
+aMh
+aFE
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aPT
+aVj
+aLx
+aAp
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aNv
+aNv
+aLU
+aLU
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(221,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ayV
+ayV
+ayV
+aZS
+ayV
+aZS
+aac
+aZS
+ags
+aZS
+ags
+ags
+ags
+ags
+ayV
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aYa
+aWd
+aJU
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aLV
+aUt
+aWY
+aAb
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ayV
+aLU
+aLU
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(222,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+ayV
+ayV
+ags
+ayV
+ags
+ags
+ags
+ags
+ags
+aZS
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aYa
+aFE
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aXw
+aFw
+aFw
+aAb
+aFw
+aAb
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aZS
+aNv
+aNv
+aLU
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(223,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ayV
+ags
+ags
+aZS
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aTw
+aTw
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aYa
+aFE
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aZk
+aAb
+aTN
+aPO
+aOD
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aZS
+aZS
+aZS
+aLU
+aLU
+aLU
+aLU
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aJx
+"}
+(224,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+ags
+ayV
+ags
+ags
+ayV
+ags
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aYa
+aFE
+aQK
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aPT
+aKi
+aOC
+aKi
+aEF
+aIv
+aAb
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+ayV
+aZS
+aZS
+aac
+aLU
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aJx
+"}
+(225,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aZS
+ags
+ags
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aMh
+aFE
+aQK
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aAb
+aDD
+aKi
+aEF
+aSt
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aJx
+"}
+(226,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ayV
+aZS
+ayV
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aTw
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aMh
+aWd
+aJU
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aFw
+aGz
+aEF
+aFw
+aEF
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aJx
+"}
+(227,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aZS
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aMB
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aNS
+aZS
+ayV
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aTw
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aYa
+aWd
+aJU
+aQK
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aXP
+ags
+ags
+ags
+aYO
+aJr
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aJx
+"}
+(228,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+aRE
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aZS
+aZS
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+aMB
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aTw
+aUy
+aUy
+aUy
+aUy
+aUy
+aTw
+aTw
+aYa
+aFE
+aaa
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aNl
+ags
+ags
+aXJ
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aHv
+ags
+ags
+ags
+aSR
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aJx
+"}
+(229,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+aSW
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+ags
+ags
+aMB
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aTw
+aYa
+aFE
+aQK
+aQK
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aNF
+aYO
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aRc
+ags
+ags
+aLF
+aCN
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aJx
+"}
+(230,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aNF
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aDz
+ags
+ags
+aMB
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aTw
+aTw
+aTw
+aTw
+aYa
+aFE
+aQK
+aQK
+aaN
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aDh
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aJx
+"}
+(231,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aWf
+aYa
+aWt
+aPI
+aQK
+aQK
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aLF
+aDz
+ags
+ags
+aSl
+ags
+aSR
+aLF
+aVm
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(232,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aDz
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aPI
+aIV
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aAh
+ags
+ags
+ags
+aUE
+ags
+aBW
+aDz
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aFw
+aFw
+aPT
+aFw
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(233,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aEb
+aIH
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aFw
+aPT
+aPT
+aQV
+aZA
+aKj
+aGx
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(234,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aYH
+ags
+ags
+ags
+ags
+aYU
+ags
+ags
+aMu
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aPT
+aOj
+aIq
+aPT
+aGe
+aZA
+aZA
+aZA
+aPT
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(235,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aZS
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aDh
+ags
+aLF
+ags
+aPY
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aMb
+aIq
+aKx
+aZA
+aZA
+aZI
+aQe
+aPT
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(236,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+aZS
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aZS
+aZS
+aZS
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aFR
+aTM
+aFw
+aZA
+aZA
+aQe
+aQe
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(237,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aNF
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aNF
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aDz
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aNF
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ayV
+aZS
+aZS
+aYG
+ayV
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aZz
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aPT
+aLr
+aTe
+aFw
+azh
+aZA
+aNI
+aWj
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(238,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aZS
+aZS
+aNS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aFw
+aFw
+aPT
+aFw
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZz
+ags
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aFw
+aFw
+aFw
+aFw
+aGk
+aFw
+aFw
+aFw
+aAb
+aPO
+aFw
+aAb
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(239,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+ayV
+aNS
+aNS
+ayV
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aFR
+aIq
+aIq
+aOj
+aPT
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aFw
+aQI
+aZA
+aZC
+aZA
+aFw
+aPO
+aSK
+aAb
+aYz
+aEF
+aAb
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aNF
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(240,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aDz
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFb
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aZS
+aZS
+ayV
+ayV
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aPT
+aMb
+aIq
+aPJ
+aIq
+aPT
+aPT
+aPT
+aPT
+aFw
+aFw
+aPT
+aFw
+aFw
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+ags
+aZS
+aZS
+aZS
+aZS
+ags
+ags
+ags
+aac
+aac
+aac
+aPT
+aZA
+aME
+aME
+aZA
+aFw
+aID
+aRS
+aUr
+aEF
+aAb
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(241,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aZS
+aZS
+aZS
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ayV
+aZS
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aWO
+aTe
+aIq
+aIq
+aFw
+aPT
+aQI
+aZA
+aMl
+aSP
+aZA
+aZA
+aFw
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aZS
+ags
+ags
+ags
+ags
+aac
+aac
+aPT
+aOb
+aME
+aME
+aRB
+aTX
+aTX
+aTX
+aGL
+aGz
+aTX
+aEF
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(242,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aZS
+ayV
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aFw
+aFw
+aKx
+aFw
+aFw
+aFw
+aQI
+aME
+aYr
+aME
+aRe
+aZA
+aLl
+aEF
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aZS
+ags
+ags
+ags
+ags
+aac
+aac
+aFw
+aJS
+aZA
+aQS
+aMS
+aFw
+aAb
+aAb
+aIP
+aMX
+aAb
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(243,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aNF
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aaN
+aaN
+aaN
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aVf
+aZA
+aGx
+aIT
+aFw
+aZA
+aME
+aYp
+aME
+aME
+aZA
+aRz
+aEF
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aLl
+aGP
+aFw
+aFw
+aFw
+aFw
+aFw
+aFw
+aAb
+aFw
+aFw
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(244,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aNF
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aaN
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aPT
+aQV
+aZA
+aZA
+aZA
+aGk
+aZA
+aME
+aME
+aME
+aME
+aQX
+aFw
+aZk
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aNF
+ags
+ags
+ags
+ags
+aMn
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(245,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aGe
+aZA
+aAG
+aBz
+aFw
+aJF
+aPj
+aYf
+aUD
+aMS
+aVv
+aFw
+aLt
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(246,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aPT
+aYs
+aZA
+aBz
+aBz
+aFw
+aFw
+aPT
+aFw
+aPT
+aFw
+aFw
+aFw
+aac
+aIl
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aSl
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(247,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aZS
+aZS
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aPT
+aKh
+aFT
+aBz
+aPb
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aZS
+aZS
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(248,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aZS
+aZS
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aFw
+aFw
+aPT
+aPT
+aFw
+aFw
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aZS
+aZS
+aZS
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+aZS
+aZS
+ags
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(249,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+ags
+ags
+ags
+aZS
+aZS
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+ags
+ags
+aZS
+aZS
+aZS
+aac
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+aac
+aac
+aac
+aNF
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(250,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+aZS
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aNF
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+ags
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(251,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+aac
+ags
+ags
+ags
+ags
+aZS
+aZS
+ags
+ags
+ags
+ags
+ags
+ags
+aZS
+aZS
+aZS
+ags
+ags
+ags
+ags
+ags
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(252,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+ags
+ags
+ags
+ags
+aac
+ags
+ags
+aac
+aac
+aac
+ags
+ags
+ags
+aZS
+aZS
+aZS
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(253,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(254,1,1) = {"
+aJx
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aac
+aJx
+"}
+(255,1,1) = {"
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
+aJx
 "}
diff --git a/_maps/map_files/SpookyStation/SpookyStation_2019.dmm b/_maps/map_files/SpookyStation/SpookyStation_2019.dmm
deleted file mode 100644
index 8e0d55361a..0000000000
--- a/_maps/map_files/SpookyStation/SpookyStation_2019.dmm
+++ /dev/null
@@ -1,78043 +0,0 @@
-//MAP CONVERTED BY dmm2tgm.py THIS HEADER COMMENT PREVENTS RECONVERSION, DO NOT REMOVE
-"aa" = (
-/obj/vehicle/ridden/bicycle,
-/turf/open/floor/spooktime/beach,
-/area/eventmap/outside)
-"ab" = (
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"ac" = (
-/turf/closed/mineral/ash_rock,
-/area/eventmap/mountain)
-"ad" = (
-/obj/structure/bed,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"ae" = (
-/obj/structure/window/reinforced/tinted/fulltile,
-/turf/closed/wall/mineral/wood,
-/area/eventmap/inside)
-"af" = (
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury01,
-/obj/effect/spawner/structure/window/reinforced,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ag" = (
-/obj/structure/bed,
-/obj/item/bedsheet/random,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ah" = (
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ai" = (
-/obj/machinery/vending/boozeomat{
-	req_access = null
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"aj" = (
-/obj/structure/dresser,
-/obj/machinery/light{
-	dir = 1;
-	light_color = "#e8eaff"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ak" = (
-/obj/structure/reagent_dispensers/keg/gargle,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"al" = (
-/obj/structure/reagent_dispensers/keg/mead,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"am" = (
-/obj/structure/reagent_dispensers/keg/semen,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"an" = (
-/obj/structure/closet/secure_closet/freezer/meat,
-/obj/item/stamp/hop,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ao" = (
-/obj/structure/table/wood,
-/obj/item/reagent_containers/food/drinks/bottle/wine,
-/obj/machinery/light{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ap" = (
-/obj/structure/bed,
-/obj/effect/spawner/lootdrop/bedsheet,
-/mob/living/simple_animal/lazy_bones,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"aq" = (
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/inside)
-"ar" = (
-/obj/effect/spawner/structure/window/reinforced,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"as" = (
-/obj/structure/chair/comfy/shuttle{
-	dir = 4;
-	icon_state = ""
-	},
-/obj/machinery/light/floor{
-	alpha = 0;
-	light_range = 20;
-	max_integrity = 9999;
-	mouse_opacity = 0
-	},
-/turf/open/floor/plasteel/dark{
-	icon_state = "bus"
-	},
-/area/shuttle/arrival)
-"at" = (
-/obj/item/flashlight/lantern{
-	anchored = 1;
-	can_be_unanchored = 1;
-	light_color = "#EE9933";
-	light_range = 5;
-	on = 1
-	},
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"au" = (
-/obj/structure/flora/junglebush{
-	icon_state = "busha1"
-	},
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"av" = (
-/obj/structure/fluff/bus/passable,
-/obj/structure/window/reinforced{
-	dir = 8
-	},
-/turf/open/floor/spooktime/cobble/roadmid,
-/area/eventmap/outside)
-"aw" = (
-/obj/machinery/light/small{
-	dir = 4;
-	light_color = "#d8b1b1"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ax" = (
-/obj/structure/holohoop,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"ay" = (
-/obj/structure/rack,
-/obj/item/stack/sheet/mineral/wood/fifty,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"az" = (
-/obj/machinery/door/airlock/silver{
-	name = "Bathroom"
-	},
-/obj/effect/turf_decal/stripes/line{
-	dir = 8
-	},
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/inside)
-"aA" = (
-/obj/structure/toilet{
-	dir = 8
-	},
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/inside)
-"aB" = (
-/obj/structure/flora/tree/jungle,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"aC" = (
-/obj/structure/signpost,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"aD" = (
-/obj/structure/flora/junglebush,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"aE" = (
-/obj/machinery/light/small,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"aF" = (
-/obj/structure/flora/junglebush{
-	icon_state = "bushb1"
-	},
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"aG" = (
-/obj/machinery/camera/emp_proof{
-	c_tag = "Containment - Particle Accelerator";
-	dir = 1;
-	network = list("singularity")
-	},
-/obj/machinery/light/small,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"aH" = (
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury02,
-/obj/effect/spawner/structure/window/reinforced,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"aI" = (
-/obj/structure/reagent_dispensers/beerkeg,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"aJ" = (
-/obj/structure/reagent_dispensers/keg/milk,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"aK" = (
-/obj/structure/reagent_dispensers/keg/aphro,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"aL" = (
-/obj/structure/fireplace{
-	dir = 4;
-	pixel_x = -8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"aM" = (
-/obj/structure/chair/comfy/plywood{
-	dir = 8
-	},
-/turf/open/floor/spooktime/cobble/cornerNE,
-/area/eventmap/outside)
-"aN" = (
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"aO" = (
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"aP" = (
-/obj/structure/chair/wood/normal,
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"aQ" = (
-/obj/structure/dresser,
-/obj/machinery/light{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"aR" = (
-/obj/structure/bed,
-/obj/item/bedsheet,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"aS" = (
-/obj/machinery/door/airlock{
-	name = "Bar Backroom";
-	req_access_txt = "25"
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"aT" = (
-/obj/structure/mineral_door/woodrustic,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"aU" = (
-/obj/machinery/button/door/dorms/luxury1,
-/obj/machinery/vending/coffee,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"aV" = (
-/obj/structure/chair/wood/normal{
-	dir = 4
-	},
-/obj/structure/curtain{
-	color = "#B22222";
-	pixel_y = -32
-	},
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"aW" = (
-/obj/structure/table/wood,
-/obj/item/clothing/head/festive,
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"aX" = (
-/obj/structure/mirror{
-	pixel_x = 28
-	},
-/obj/effect/turf_decal/bot,
-/obj/machinery/shower{
-	dir = 8;
-	pixel_y = -4
-	},
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/inside)
-"aY" = (
-/obj/structure/table/wood,
-/obj/machinery/light{
-	dir = 4
-	},
-/obj/item/reagent_containers/food/drinks/bottle/wine,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"aZ" = (
-/obj/structure/closet/secure_closet/freezer/kitchen/maintenance,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ba" = (
-/obj/structure/table/wood/fancy/red,
-/obj/machinery/microwave,
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bb" = (
-/obj/structure/table/wood/fancy/red,
-/obj/machinery/chem_dispenser/drinks/beer/fullupgrade,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bc" = (
-/obj/structure/table/wood/fancy/red,
-/obj/machinery/chem_dispenser/drinks/fullupgrade,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bd" = (
-/obj/structure/chair/comfy/plywood{
-	dir = 8
-	},
-/turf/open/floor/spooktime/cobble/sideE,
-/area/eventmap/outside)
-"be" = (
-/obj/structure/sign/poster/official/no_erp,
-/turf/closed/wall/mineral/wood,
-/area/eventmap/mountaininside)
-"bf" = (
-/obj/structure/table/wood/fancy/red,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bg" = (
-/obj/structure/mineral_door/woodrustic{
-	name = "Event Hall"
-	},
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury01,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bh" = (
-/obj/structure/toilet{
-	dir = 4
-	},
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/inside)
-"bi" = (
-/obj/machinery/door/airlock/silver{
-	name = "Bathroom"
-	},
-/obj/effect/turf_decal/stripes/line{
-	dir = 4
-	},
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"bj" = (
-/obj/effect/decal/cleanable/glass{
-	dir = 8
-	},
-/turf/open/floor/plasteel/elevatorshaft,
-/area/eventmap/inside)
-"bk" = (
-/obj/effect/decal/cleanable/glass{
-	dir = 4
-	},
-/turf/open/floor/plasteel/elevatorshaft,
-/area/eventmap/inside)
-"bl" = (
-/obj/machinery/vending/dinnerware,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bm" = (
-/obj/structure/table/wood/fancy/red,
-/obj/item/reagent_containers/food/snacks/waffles,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bn" = (
-/obj/structure/chair/wood/normal,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bo" = (
-/obj/structure/fireplace{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bp" = (
-/obj/structure/table/wood/fancy/red,
-/obj/machinery/light/small{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bq" = (
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"br" = (
-/obj/structure/chair/comfy/plywood{
-	dir = 1
-	},
-/turf/open/floor/spooktime/cobble/sideS,
-/area/eventmap/outside)
-"bs" = (
-/obj/structure/fluff/bus/passable,
-/turf/open/floor/spooktime/cobble/roadmid,
-/area/eventmap/outside)
-"bt" = (
-/obj/machinery/vending/autodrobe/all_access,
-/turf/open/floor/spooktime/cobble/cornerSE,
-/area/eventmap/outside)
-"bu" = (
-/obj/structure/table/wood,
-/obj/item/phone,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bv" = (
-/obj/structure/table/wood,
-/obj/item/clothing/head/festive,
-/obj/structure/curtain{
-	color = "#B22222";
-	pixel_y = -32
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bw" = (
-/obj/machinery/button/door/dorms/luxury2,
-/obj/machinery/vending/coffee,
-/turf/open/floor/wood/damturf/broken6,
-/area/eventmap/inside)
-"bx" = (
-/obj/structure/chair/stool/bar,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"by" = (
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"bz" = (
-/obj/structure/chair/wood/wings,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"bA" = (
-/obj/structure/mineral_door/woodrustic{
-	name = "Event Hall"
-	},
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury02,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bB" = (
-/obj/structure/chair/sofa/right,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bC" = (
-/obj/structure/chair/sofa,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bD" = (
-/obj/structure/chair/sofa/left,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bE" = (
-/obj/effect/decal/cleanable/glass,
-/turf/open/floor/plasteel/elevatorshaft,
-/area/eventmap/inside)
-"bF" = (
-/obj/machinery/vending/donksofttoyvendor,
-/turf/open/floor/spooktime/cobble/cornerNW,
-/area/eventmap/outside)
-"bG" = (
-/obj/structure/table/wood,
-/obj/item/stack/sheet/plastic/fifty{
-	pixel_x = 4;
-	pixel_y = -4
-	},
-/obj/item/stack/sheet/metal/fifty,
-/turf/open/floor/spooktime/cobble/sideN,
-/area/eventmap/outside)
-"bH" = (
-/obj/machinery/autoylathe,
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/spooktime/cobble/sideN,
-/area/eventmap/outside)
-"bI" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bJ" = (
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"bK" = (
-/turf/closed/wall/mineral/iron,
-/area/eventmap/outside)
-"bL" = (
-/obj/effect/decal/cleanable/glass{
-	dir = 1
-	},
-/turf/open/floor/plasteel/elevatorshaft,
-/area/eventmap/inside)
-"bM" = (
-/obj/structure/table/wood/fancy/red,
-/obj/item/reagent_containers/food/snacks/soup/hotchili,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"bN" = (
-/obj/structure/table/wood/fancy/red,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"bO" = (
-/obj/structure/table/wood/fancy/red,
-/obj/item/reagent_containers/food/snacks/sausage,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"bP" = (
-/obj/structure/table/wood/fancy/red,
-/obj/item/reagent_containers/food/snacks/cubancarp,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"bQ" = (
-/obj/structure/table/wood/fancy/red,
-/obj/item/reagent_containers/food/snacks/taco,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"bR" = (
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bS" = (
-/obj/structure/piano{
-	icon_state = "piano"
-	},
-/obj/machinery/light/small{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bT" = (
-/obj/structure/chair/wood/wings{
-	dir = 1
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"bU" = (
-/obj/structure/mineral_door/woodrustic{
-	name = "Event Hall"
-	},
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bV" = (
-/obj/machinery/light/small,
-/obj/structure/chair/sofa/left{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bW" = (
-/obj/structure/chair/sofa/left{
-	dir = 1;
-	icon_state = "sofamiddle"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bX" = (
-/obj/structure/chair/sofa/left{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"bY" = (
-/turf/open/floor/wood{
-	icon_state = "wood-broken2"
-	},
-/area/eventmap/inside)
-"bZ" = (
-/obj/machinery/light/small,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ca" = (
-/obj/structure/table/wood,
-/obj/machinery/light{
-	dir = 1
-	},
-/obj/item/phone,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"cb" = (
-/obj/machinery/button/door/dorms/luxury3,
-/obj/machinery/vending/coffee,
-/turf/open/floor/wood/damturf/broken1,
-/area/eventmap/inside)
-"cc" = (
-/obj/machinery/holopad,
-/mob/living/simple_animal/jacq{
-	active = 0;
-	light_color = "#EE9933";
-	light_range = 5
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"cd" = (
-/obj/structure/chair/wood/normal{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ce" = (
-/turf/open/floor/plasteel{
-	dir = 1;
-	icon_state = "chapel"
-	},
-/area/eventmap/inside)
-"cf" = (
-/turf/open/floor/plasteel{
-	dir = 4;
-	icon_state = "chapel"
-	},
-/area/eventmap/inside)
-"cg" = (
-/obj/structure/table/wood/fancy,
-/obj/item/clothing/head/hardhat/pumpkinhead/jaqc{
-	light_range = 3
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"ch" = (
-/obj/item/barthpot{
-	active = 0
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"ci" = (
-/obj/structure/bookcase/random/adult,
-/obj/machinery/light/small,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"cj" = (
-/obj/structure/bookcase/random/adult,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ck" = (
-/obj/structure/mineral_door/woodrustic{
-	name = "Event Hall"
-	},
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury04,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"cl" = (
-/turf/open/floor/plasteel{
-	dir = 8;
-	icon_state = "chapel"
-	},
-/area/eventmap/inside)
-"cm" = (
-/turf/open/floor/plasteel{
-	icon_state = "chapel"
-	},
-/area/eventmap/inside)
-"cn" = (
-/obj/machinery/button/door/dorms/luxury4,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"co" = (
-/obj/structure/chair/wood/normal{
-	dir = 4
-	},
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"cp" = (
-/obj/structure/table/wood,
-/obj/item/clothing/head/festive,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"cq" = (
-/obj/machinery/light{
-	dir = 1
-	},
-/obj/structure/chair/wood/normal{
-	dir = 8
-	},
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"cr" = (
-/obj/structure/spirit_board,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"cs" = (
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"ct" = (
-/obj/structure/table/wood,
-/obj/item/phone,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"cu" = (
-/obj/structure/dresser,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"cv" = (
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03,
-/obj/effect/spawner/structure/window/reinforced,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"cw" = (
-/obj/effect/turf_decal/bot,
-/obj/machinery/shower{
-	dir = 4
-	},
-/obj/structure/mirror{
-	pixel_x = -28
-	},
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/inside)
-"cx" = (
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury04,
-/obj/effect/spawner/structure/window/reinforced,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"cy" = (
-/obj/structure/mineral_door/wood,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"cz" = (
-/obj/effect/decal/cleanable/glass,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"cA" = (
-/obj/effect/wisp/pumpkin,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/inside)
-"cB" = (
-/turf/open/floor/plasteel/stairs/left,
-/area/eventmap/inside)
-"cC" = (
-/obj/effect/landmark/start/chaplain,
-/turf/open/floor/plasteel/stairs/medium,
-/area/eventmap/inside)
-"cD" = (
-/turf/open/floor/plasteel/stairs/right,
-/area/eventmap/inside)
-"cE" = (
-/obj/machinery/vending/wardrobe/cargo_wardrobe,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"cF" = (
-/obj/machinery/vending/wardrobe/chap_wardrobe,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"cG" = (
-/obj/machinery/vending/wardrobe/bar_wardrobe,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"cH" = (
-/obj/machinery/vending/wardrobe/chef_wardrobe,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"cI" = (
-/obj/structure/flora/grass/jungle/b{
-	icon_state = "busha2"
-	},
-/obj/vehicle/ridden/atv,
-/obj/item/key,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"cJ" = (
-/obj/structure/flora/junglebush{
-	icon_state = "bushb1"
-	},
-/obj/vehicle/ridden/atv,
-/obj/item/key,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"cK" = (
-/obj/vehicle/ridden/atv,
-/obj/item/key,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"cL" = (
-/obj/machinery/vending/wardrobe/curator_wardrobe,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"cM" = (
-/obj/machinery/cryopod{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"cN" = (
-/obj/structure/spacevine,
-/turf/closed/wall/rust,
-/area/eventmap/outside)
-"cO" = (
-/obj/machinery/cryopod,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"cP" = (
-/obj/machinery/vending/kink,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"cQ" = (
-/obj/machinery/light/small{
-	dir = 4;
-	light_color = "#d8b1b1"
-	},
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"cR" = (
-/obj/machinery/vending/autodrobe/all_access,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"cS" = (
-/obj/machinery/vending/clothing,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"cT" = (
-/obj/machinery/camera/emp_proof{
-	c_tag = "Containment - Fore Port";
-	dir = 4;
-	network = list("singularity")
-	},
-/obj/machinery/light/small{
-	dir = 8
-	},
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"cU" = (
-/obj/structure/sign/departments/medbay/alt{
-	pixel_x = 32
-	},
-/obj/machinery/light/small{
-	dir = 4;
-	light_color = "#d8b1b1"
-	},
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"cV" = (
-/obj/machinery/computer/arcade/minesweeper,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"cW" = (
-/obj/machinery/computer/arcade/orion_trail,
-/obj/structure/window/reinforced/tinted{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"cX" = (
-/obj/machinery/washing_machine,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"cY" = (
-/obj/structure/window/reinforced/tinted{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"cZ" = (
-/obj/structure/flora/grass/jungle/b{
-	icon_state = "grassa3"
-	},
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"da" = (
-/obj/structure/flora/grass/jungle/b{
-	icon_state = "grassa1"
-	},
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"db" = (
-/obj/structure/window/reinforced/tinted,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dc" = (
-/obj/structure/mineral_door/wood,
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dd" = (
-/obj/effect/spawner/structure/window,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"de" = (
-/obj/machinery/cryopod{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"df" = (
-/obj/effect/spawner/lootdrop/costume,
-/obj/structure/table/wood/fancy/orange,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dg" = (
-/obj/structure/closet/cabinet,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"dh" = (
-/obj/structure/dresser,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"di" = (
-/obj/structure/dresser,
-/obj/effect/decal/cleanable/cobweb,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"dj" = (
-/obj/structure/bed,
-/obj/item/bedsheet/cmo,
-/obj/item/restraints/handcuffs,
-/obj/effect/decal/cleanable/blood/gibs/old,
-/obj/item/reagent_containers/syringe,
-/obj/item/clothing/suit/straight_jacket,
-/obj/effect/decal/cleanable/cobweb,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dk" = (
-/obj/structure/table/wood,
-/obj/item/razor,
-/obj/item/trash/candle,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dl" = (
-/obj/structure/spider/stickyweb,
-/turf/open/floor/wood{
-	icon_state = "wood-broken2"
-	},
-/area/eventmap/inside)
-"dm" = (
-/obj/structure/spider/stickyweb,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dn" = (
-/obj/machinery/smartfridge/chemistry/preloaded,
-/turf/closed/wall/mineral/wood,
-/area/eventmap/inside)
-"do" = (
-/obj/structure/statue/silver/md,
-/obj/structure/sign/poster/official/do_not_question{
-	pixel_y = 32
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dp" = (
-/obj/structure/easel,
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken6"
-	},
-/area/eventmap/inside)
-"dq" = (
-/obj/machinery/door/firedoor/border_only/closed{
-	dir = 4;
-	name = "Therapist's Office"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dr" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken3"
-	},
-/area/eventmap/inside)
-"ds" = (
-/obj/structure/bookcase/random/nonfiction,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dt" = (
-/obj/structure/closet/secure_closet/medical3,
-/obj/item/healthanalyzer/advanced,
-/obj/item/defibrillator/loaded,
-/obj/item/clothing/glasses/hud/health,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"du" = (
-/obj/machinery/computer/med_data,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"dv" = (
-/obj/structure/table/wood/fancy/red,
-/obj/item/paper_bin,
-/obj/item/pen,
-/obj/item/storage/pill_bottle/mannitol,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"dw" = (
-/obj/structure/table/wood/fancy/red,
-/obj/item/flashlight/lamp/green,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"dx" = (
-/obj/machinery/vending/wardrobe/law_wardrobe,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dy" = (
-/obj/machinery/vending/wardrobe/medi_wardrobe,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dz" = (
-/obj/machinery/vending/wardrobe/robo_wardrobe,
-/obj/machinery/light/small,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dA" = (
-/obj/machinery/vending/wardrobe/science_wardrobe,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dB" = (
-/obj/machinery/vending/wardrobe/engi_wardrobe,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dC" = (
-/obj/structure/table/wood/fancy/orange,
-/obj/item/clothing/suit/armor/riot/knight{
-	pixel_x = 4;
-	pixel_y = -4
-	},
-/obj/item/clothing/suit/armor/riot/knight,
-/obj/item/clothing/suit/armor/riot/knight{
-	pixel_x = -4;
-	pixel_y = 4
-	},
-/obj/item/clothing/head/helmet/knight{
-	pixel_x = 4;
-	pixel_y = -4
-	},
-/obj/item/clothing/head/helmet/knight,
-/obj/item/clothing/head/helmet/knight{
-	pixel_x = -4;
-	pixel_y = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dD" = (
-/obj/structure/flora/grass/jungle/b{
-	icon_state = "busha2"
-	},
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"dE" = (
-/obj/machinery/sleeper/syndie/fullupgrade{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dF" = (
-/obj/machinery/door/airlock/wood/dorms/dorm04,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dG" = (
-/obj/machinery/door/airlock/wood/dorms/dorm17,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dH" = (
-/obj/effect/decal/cleanable/blood/tracks,
-/obj/machinery/light/small/broken{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dI" = (
-/obj/item/chair/wood,
-/obj/item/ectoplasm,
-/obj/effect/decal/cleanable/blood/old,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dJ" = (
-/obj/structure/barricade/wooden,
-/obj/structure/mineral_door/wood,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dK" = (
-/obj/effect/decal/cleanable/dirt,
-/obj/effect/decal/cleanable/blood/tracks{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dL" = (
-/obj/structure/window/reinforced/tinted/frosted{
-	dir = 4
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken2"
-	},
-/area/eventmap/inside)
-"dM" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/effect/decal/cleanable/blood/tracks,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dN" = (
-/turf/open/floor/wood{
-	icon_state = "wood-broken5"
-	},
-/area/eventmap/inside)
-"dO" = (
-/obj/structure/chair/office/dark{
-	dir = 4
-	},
-/mob/living/simple_animal/pet/cat/Runtime,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"dP" = (
-/obj/structure/table/wood/fancy/red,
-/obj/item/folder/white,
-/obj/item/storage/briefcase,
-/obj/item/stamp/rd,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"dQ" = (
-/obj/structure/table/wood/fancy/orange,
-/obj/item/clothing/suit/armor/riot/knight/yellow{
-	pixel_x = 4;
-	pixel_y = -4
-	},
-/obj/item/clothing/suit/armor/riot/knight/yellow,
-/obj/item/clothing/suit/armor/riot/knight/yellow{
-	pixel_x = -4;
-	pixel_y = 4
-	},
-/obj/item/clothing/head/helmet/knight/yellow{
-	pixel_x = 4;
-	pixel_y = -4
-	},
-/obj/item/clothing/head/helmet/knight/yellow,
-/obj/item/clothing/head/helmet/knight/yellow{
-	pixel_x = -4;
-	pixel_y = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"dR" = (
-/obj/structure/bed,
-/obj/item/bedsheet/random,
-/obj/machinery/button/door/dorms/dorm04,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"dS" = (
-/obj/machinery/light/small,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"dT" = (
-/obj/machinery/button/door/dorms/dorm17,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"dU" = (
-/obj/structure/bed,
-/obj/item/bedsheet/random,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"dV" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken2"
-	},
-/area/eventmap/inside)
-"dW" = (
-/obj/item/toy/beach_ball/holoball,
-/turf/open/floor/spooktime/cobble/roadmid,
-/area/eventmap/outside)
-"dX" = (
-/obj/effect/decal/cleanable/dirt,
-/obj/effect/decal/cleanable/blood/tracks{
-	dir = 4
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken"
-	},
-/area/eventmap/inside)
-"dY" = (
-/obj/structure/chair/sofa/left{
-	dir = 1
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken7"
-	},
-/area/eventmap/inside)
-"dZ" = (
-/obj/structure/chair/sofa/right{
-	dir = 1
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken2"
-	},
-/area/eventmap/inside)
-"ea" = (
-/obj/structure/window/reinforced/tinted/frosted{
-	dir = 4
-	},
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"eb" = (
-/obj/structure/bed,
-/obj/item/clothing/suit/straight_jacket,
-/obj/item/clothing/mask/muzzle,
-/obj/item/clothing/glasses/sunglasses/blindfold,
-/turf/open/floor/wood{
-	icon_state = "wood-broken4"
-	},
-/area/eventmap/inside)
-"ec" = (
-/obj/structure/chair/comfy/teal{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ed" = (
-/obj/structure/filingcabinet/medical,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"ee" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"ef" = (
-/obj/item/twohanded/required/kirbyplants/random,
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"eg" = (
-/obj/structure/table/wood/fancy/orange,
-/obj/item/clothing/suit/armor/riot/knight/red{
-	pixel_x = 4;
-	pixel_y = -4
-	},
-/obj/item/clothing/suit/armor/riot/knight/red,
-/obj/item/clothing/suit/armor/riot/knight/red{
-	pixel_x = -4;
-	pixel_y = 4
-	},
-/obj/item/clothing/head/helmet/knight/red{
-	pixel_x = 4;
-	pixel_y = -4
-	},
-/obj/item/clothing/head/helmet/knight/red,
-/obj/item/clothing/head/helmet/knight/red{
-	pixel_x = -4;
-	pixel_y = 4
-	},
-/obj/machinery/light/small{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"eh" = (
-/obj/machinery/light/small{
-	dir = 8
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"ei" = (
-/obj/machinery/light/small{
-	dir = 4
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"ej" = (
-/obj/structure/barricade/wooden/crude,
-/turf/open/floor/wood{
-	icon_state = "wood-broken4"
-	},
-/area/eventmap/inside)
-"ek" = (
-/obj/structure/barricade/wooden/crude,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"el" = (
-/obj/structure/table/wood/fancy/orange,
-/obj/item/clothing/suit/armor/riot/knight/blue{
-	pixel_x = 4;
-	pixel_y = -4
-	},
-/obj/item/clothing/suit/armor/riot/knight/blue,
-/obj/item/clothing/suit/armor/riot/knight/blue{
-	pixel_x = -4;
-	pixel_y = 4
-	},
-/obj/item/stamp/clown,
-/obj/item/clothing/head/helmet/knight/blue{
-	pixel_x = 4;
-	pixel_y = -4
-	},
-/obj/item/clothing/head/helmet/knight/blue,
-/obj/item/clothing/head/helmet/knight/blue{
-	pixel_x = -4;
-	pixel_y = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"em" = (
-/obj/structure/dresser,
-/obj/effect/decal/cleanable/cobweb/cobweb2,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"en" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken7"
-	},
-/area/eventmap/inside)
-"eo" = (
-/obj/structure/filingcabinet/medical,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ep" = (
-/obj/item/reagent_containers/spray/cleaner,
-/obj/machinery/light/small{
-	dir = 1
-	},
-/obj/structure/table/wood/fancy/purple,
-/obj/item/gun/magic/wand/resurrection,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"eq" = (
-/obj/machinery/vending/medical,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"er" = (
-/obj/machinery/rnd/production/techfab/department/medical,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"es" = (
-/obj/structure/window/reinforced,
-/obj/structure/table/wood/fancy/green,
-/obj/item/storage/firstaid/toxin{
-	pixel_x = -3;
-	pixel_y = 3
-	},
-/obj/item/storage/firstaid/toxin,
-/obj/effect/decal/cleanable/cobweb,
-/obj/item/gun/syringe,
-/obj/item/gun/syringe,
-/obj/item/gun/syringe,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"et" = (
-/obj/structure/table/wood/fancy/green,
-/obj/item/storage/firstaid/fire{
-	pixel_x = -3;
-	pixel_y = 3
-	},
-/obj/item/storage/firstaid/fire,
-/obj/machinery/door/window/southleft,
-/obj/item/holosign_creator/medical,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"eu" = (
-/obj/structure/table/wood/fancy/green,
-/obj/machinery/door/window/southright,
-/obj/item/storage/firstaid/regular{
-	pixel_x = 3;
-	pixel_y = 3
-	},
-/obj/item/storage/firstaid/regular,
-/obj/item/clothing/accessory/medal/ribbon/medical_doctor,
-/obj/item/gun/magic/wand/resurrection,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ev" = (
-/obj/structure/window/reinforced,
-/obj/structure/window/reinforced{
-	dir = 4
-	},
-/obj/structure/table/wood/fancy/green,
-/obj/item/storage/firstaid/o2{
-	pixel_x = 3;
-	pixel_y = 3
-	},
-/obj/item/storage/firstaid/o2,
-/obj/item/storage/firstaid/regular{
-	pixel_x = -3;
-	pixel_y = -3
-	},
-/obj/item/gun/magic/staff/healing,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ew" = (
-/obj/structure/closet/secure_closet/medical3,
-/obj/item/healthanalyzer/advanced,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ex" = (
-/obj/machinery/vending/wardrobe/bar_wardrobe,
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ey" = (
-/obj/structure/closet/crate/medical{
-	icon_state = "medicalcrateopen"
-	},
-/obj/item/gun/magic/wand/resurrection,
-/obj/item/gun/magic/wand/resurrection,
-/obj/item/gun/magic/staff/healing,
-/obj/item/gun/magic/staff/healing,
-/obj/item/paper/fluff/balls/spookyasylum/healstaffnote,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ez" = (
-/obj/structure/table/wood,
-/obj/item/wrench/medical,
-/obj/item/storage/firstaid/regular,
-/obj/item/clothing/head/beret/cmo,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"eA" = (
-/obj/structure/table/wood,
-/obj/item/storage/box/masks{
-	pixel_x = 3;
-	pixel_y = 3
-	},
-/obj/item/storage/box/gloves,
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"eB" = (
-/obj/item/clothing/accessory/armband/medblue{
-	pixel_x = 3;
-	pixel_y = 3
-	},
-/obj/item/clothing/accessory/armband/med,
-/obj/item/rack_parts,
-/obj/item/storage/briefcase/medical,
-/turf/open/floor/wood{
-	icon_state = "wood-broken6"
-	},
-/area/eventmap/inside)
-"eC" = (
-/obj/structure/rack,
-/obj/effect/spawner/bundle/costume/plaguedoctor,
-/obj/item/stamp/cmo,
-/obj/item/gun/magic/staff/healing,
-/obj/item/gun/magic/wand/resurrection,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"eD" = (
-/obj/machinery/light/small/broken{
-	dir = 8
-	},
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"eE" = (
-/obj/structure/sign/departments/medbay/alt{
-	pixel_x = 32
-	},
-/obj/machinery/light/small/broken{
-	dir = 4
-	},
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"eF" = (
-/obj/structure/rack,
-/obj/effect/spawner/lootdrop/maintenance{
-	lootcount = 2;
-	name = "2maintenance loot spawner"
-	},
-/obj/structure/window/reinforced/tinted{
-	dir = 4
-	},
-/obj/item/reagent_containers/blood/random,
-/obj/item/clothing/neck/stethoscope,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"eG" = (
-/obj/machinery/shower{
-	desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well...";
-	pixel_y = 24
-	},
-/obj/structure/curtain,
-/obj/item/storage/pill_bottle/penis_enlargement,
-/obj/item/storage/pill_bottle/breast_enlargement,
-/obj/effect/decal/cleanable/cobweb/cobweb2,
-/obj/item/ectoplasm,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"eH" = (
-/obj/structure/mineral_door/wood{
-	name = "Costumes and Luxury Dorms"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"eI" = (
-/obj/machinery/door/airlock/wood/dorms/dorm03,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"eJ" = (
-/obj/machinery/door/airlock/wood/dorms/dorm05,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"eK" = (
-/obj/machinery/door/airlock/wood/dorms/dorm08,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"eL" = (
-/obj/effect/decal/cleanable/dirt,
-/obj/machinery/door/airlock/wood/dorms/dorm11,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"eM" = (
-/obj/machinery/door/airlock/wood/dorms/dorm14,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"eN" = (
-/obj/structure/flora/grass/jungle/b,
-/turf/closed/wall/rust,
-/area/eventmap/outside)
-"eO" = (
-/obj/machinery/door/airlock/wood/dorms/dorm18,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"eP" = (
-/obj/effect/landmark/start/chief_medical_officer,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"eQ" = (
-/obj/machinery/light{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"eR" = (
-/obj/effect/decal/cleanable/dirt,
-/obj/machinery/light/small/broken{
-	dir = 4
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken3"
-	},
-/area/eventmap/inside)
-"eS" = (
-/obj/machinery/vending/wardrobe/viro_wardrobe,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"eT" = (
-/obj/effect/decal/cleanable/blood/old,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"eU" = (
-/obj/effect/decal/cleanable/blood/gibs/old,
-/obj/effect/decal/cleanable/glass,
-/obj/item/shard,
-/obj/item/organ/eyes,
-/obj/machinery/light/small/broken{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"eV" = (
-/obj/structure/bed,
-/obj/item/bedsheet/random,
-/obj/machinery/button/door/dorms/dorm03,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"eW" = (
-/obj/structure/flora/junglebush{
-	icon_state = "grassa4"
-	},
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"eX" = (
-/obj/machinery/hydroponics/soil,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/outside)
-"eY" = (
-/obj/item/storage/crayons,
-/turf/open/floor/spooktime/beach,
-/area/eventmap/outside)
-"eZ" = (
-/obj/machinery/camera/emp_proof{
-	c_tag = "Containment - Fore Starboard";
-	dir = 8;
-	network = list("singularity")
-	},
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"fa" = (
-/obj/machinery/button/door/dorms/dorm05,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"fb" = (
-/obj/structure/bed,
-/obj/item/bedsheet/random,
-/obj/machinery/button/door/dorms/dorm08,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"fc" = (
-/obj/machinery/button/door/dorms/dorm11,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"fd" = (
-/obj/structure/bed,
-/obj/item/bedsheet/random,
-/obj/machinery/button/door/dorms/dorm14,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"fe" = (
-/obj/machinery/button/door/dorms/dorm18,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"ff" = (
-/obj/structure/closet/secure_closet/CMO,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"fg" = (
-/obj/structure/chair/wood,
-/obj/item/toy/plush/borgplushie/medihound,
-/obj/item/clothing/glasses/hud/health/sunglasses{
-	pixel_x = -4;
-	pixel_y = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"fh" = (
-/obj/item/twohanded/required/kirbyplants/random,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"fi" = (
-/obj/effect/decal/cleanable/glass/plasma,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"fj" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/machinery/light/small,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"fk" = (
-/obj/machinery/vending/wardrobe/gene_wardrobe,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"fl" = (
-/turf/open/floor/wood{
-	icon_state = "wood-broken7"
-	},
-/area/eventmap/inside)
-"fm" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/structure/fireaxecabinet{
-	pixel_y = -32
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"fn" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/machinery/light/small/built,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"fo" = (
-/obj/effect/decal/cleanable/generic,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"fp" = (
-/turf/closed/wall/mineral/wood,
-/area/eventmap/inside)
-"fq" = (
-/obj/structure/flora/bush,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"fr" = (
-/obj/structure/flora/ausbushes/sparsegrass,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"fs" = (
-/obj/structure/flora/ausbushes/leafybush,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"ft" = (
-/obj/structure/flora/ausbushes/lavendergrass,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"fu" = (
-/obj/structure/sign/poster/official/fruit_bowl,
-/turf/closed/wall/mineral/wood,
-/area/eventmap/inside)
-"fv" = (
-/obj/structure/spacevine,
-/turf/closed/wall/rust,
-/area/eventmap/inside)
-"fw" = (
-/turf/closed/wall/rust,
-/area/eventmap/inside)
-"fx" = (
-/obj/structure/urinal,
-/turf/closed/wall/rust,
-/area/eventmap/inside)
-"fy" = (
-/obj/structure/urinal,
-/obj/structure/spacevine,
-/turf/closed/wall/rust,
-/area/eventmap/inside)
-"fz" = (
-/obj/machinery/light/small/broken{
-	dir = 8
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken"
-	},
-/area/eventmap/inside)
-"fA" = (
-/obj/machinery/light/small/broken{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"fB" = (
-/obj/structure/table/wood,
-/obj/item/reagent_containers/glass/bottle/charcoal,
-/obj/item/reagent_containers/food/drinks/mug/tea,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"fC" = (
-/obj/machinery/computer/med_data{
-	dir = 1
-	},
-/obj/structure/window/reinforced,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"fD" = (
-/obj/machinery/door/airlock/medical/glass{
-	name = "Medbay Storage";
-	req_access_txt = "5"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"fE" = (
-/obj/structure/mineral_door/wood,
-/obj/effect/decal/cleanable/blood/old,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"fF" = (
-/obj/machinery/vending/boozeomat/all_access,
-/obj/effect/decal/cleanable/cobweb,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"fG" = (
-/obj/machinery/vending/coffee,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"fH" = (
-/obj/structure/fireplace,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"fI" = (
-/obj/machinery/vending/snack/orange,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"fJ" = (
-/obj/machinery/vending/games,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"fK" = (
-/obj/structure/flora/rock/pile/icy,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"fL" = (
-/obj/structure/flora/ausbushes/ywflowers,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"fM" = (
-/obj/structure/toilet{
-	dir = 4
-	},
-/obj/effect/decal/cleanable/cobweb,
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"fN" = (
-/obj/structure/mineral_door/wood,
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"fO" = (
-/obj/machinery/shower{
-	desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well...";
-	pixel_y = 24
-	},
-/obj/structure/curtain,
-/obj/machinery/atmospherics/components/unary/vent_pump{
-	icon_state = "vent_in"
-	},
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"fP" = (
-/obj/machinery/shower{
-	desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well...";
-	pixel_y = 24
-	},
-/obj/structure/curtain,
-/obj/item/bikehorn/rubberducky,
-/obj/machinery/atmospherics/components/unary/vent_pump{
-	icon_state = "vent_in"
-	},
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"fQ" = (
-/obj/machinery/shower{
-	desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well...";
-	pixel_y = 24
-	},
-/obj/structure/curtain,
-/obj/item/bikehorn/rubberducky,
-/obj/item/soap/homemade,
-/obj/machinery/atmospherics/components/unary/vent_pump{
-	icon_state = "vent_in"
-	},
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"fR" = (
-/obj/machinery/shower{
-	desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well...";
-	pixel_y = 24
-	},
-/obj/structure/curtain,
-/obj/item/soap/homemade,
-/obj/machinery/atmospherics/components/unary/vent_pump{
-	icon_state = "vent_in"
-	},
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"fS" = (
-/obj/machinery/shower{
-	desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well...";
-	pixel_y = 24
-	},
-/obj/effect/decal/cleanable/cobweb,
-/obj/structure/curtain,
-/obj/item/bikehorn/rubberducky,
-/obj/item/soap/homemade,
-/obj/machinery/atmospherics/components/unary/vent_pump{
-	icon_state = "vent_in"
-	},
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"fT" = (
-/obj/machinery/vending/magivend,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"fU" = (
-/obj/machinery/vending/autodrobe,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"fV" = (
-/obj/effect/spawner/lootdrop/costume,
-/mob/living/simple_animal/hostile/skeleton{
-	a_intent = "friendly";
-	attack_sound = 'sound/vox_fem/bone.ogg';
-	attacktext = "attempts to bone";
-	harm_intent_damage = -5;
-	melee_damage_lower = 1;
-	melee_damage_type = "arousal";
-	melee_damage_upper = 10;
-	name = "Closet Skeleton"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"fW" = (
-/mob/living/simple_animal/hostile/skeleton{
-	a_intent = "friendly";
-	attack_sound = 'sound/vox_fem/bone.ogg';
-	attacktext = "attempts to bone";
-	harm_intent_damage = -5;
-	melee_damage_lower = 1;
-	melee_damage_type = "arousal";
-	melee_damage_upper = 10;
-	name = "Closet Skeleton"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"fX" = (
-/obj/item/clothing/head/hardhat/pumpkinhead,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"fY" = (
-/turf/open/floor/spooktime/cobble/sideW{
-	icon_state = "cobble_corner_nw"
-	},
-/area/eventmap/outside)
-"fZ" = (
-/turf/open/floor/wood{
-	icon_state = "wood-broken4"
-	},
-/area/eventmap/inside)
-"ga" = (
-/obj/structure/sign/directions/medical{
-	dir = 4;
-	pixel_x = 32;
-	pixel_y = 24
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"gb" = (
-/obj/machinery/camera/emp_proof,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"gc" = (
-/obj/structure/noticeboard/cmo{
-	pixel_y = 32
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"gd" = (
-/obj/machinery/vending/coffee,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ge" = (
-/obj/effect/decal/cleanable/cobweb,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"gf" = (
-/obj/structure/table/wood/fancy/green,
-/obj/item/clothing/suit/straight_jacket,
-/obj/machinery/light/broken{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"gg" = (
-/obj/structure/table_frame/wood,
-/obj/item/stack/sheet/mineral/wood,
-/obj/effect/decal/cleanable/generic,
-/obj/item/gun/magic/staff/healing,
-/obj/item/gun/magic/wand/resurrection,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"gh" = (
-/obj/structure/table/wood/fancy/green,
-/obj/effect/decal/cleanable/cobweb/cobweb2,
-/obj/item/storage/backpack/satchel/med,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"gi" = (
-/obj/structure/chair/comfy/plywood,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"gj" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"gk" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"gl" = (
-/obj/item/twohanded/required/kirbyplants/random,
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"gm" = (
-/obj/item/stack/sheet/bone,
-/mob/living/simple_animal/hostile/skeleton{
-	a_intent = "friendly";
-	attack_sound = 'sound/vox_fem/bone.ogg';
-	attacktext = "attempts to bone";
-	harm_intent_damage = -5;
-	melee_damage_lower = 1;
-	melee_damage_type = "arousal";
-	melee_damage_upper = 10;
-	name = "Closet Skeleton"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"gn" = (
-/obj/item/stack/sheet/bone,
-/obj/effect/spawner/lootdrop/costume,
-/mob/living/simple_animal/hostile/skeleton{
-	a_intent = "friendly";
-	attack_sound = 'sound/vox_fem/bone.ogg';
-	attacktext = "attempts to bone";
-	harm_intent_damage = -5;
-	melee_damage_lower = 1;
-	melee_damage_type = "arousal";
-	melee_damage_upper = 10;
-	name = "Closet Skeleton"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"go" = (
-/obj/item/shadowcloak,
-/mob/living/simple_animal/hostile/skeleton{
-	a_intent = "friendly";
-	attack_sound = 'sound/vox_fem/bone.ogg';
-	attacktext = "attempts to bone";
-	harm_intent_damage = -5;
-	melee_damage_lower = 1;
-	melee_damage_type = "arousal";
-	melee_damage_upper = 10;
-	name = "Closet Skeleton"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"gp" = (
-/obj/machinery/door/airlock/wood/dorms/dorm06,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"gq" = (
-/obj/effect/decal/cleanable/dirt,
-/obj/machinery/door/airlock/wood/dorms/dorm09,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"gr" = (
-/obj/structure/flora/grass/jungle/b,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"gs" = (
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"gt" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken5"
-	},
-/area/eventmap/inside)
-"gu" = (
-/obj/machinery/door/airlock/wood/dorms/dorm12,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"gv" = (
-/obj/machinery/door/airlock/wood/dorms/dorm15,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"gw" = (
-/obj/machinery/vending/cola/red,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"gx" = (
-/obj/item/caution,
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"gy" = (
-/obj/structure/chair/wood{
-	dir = 1
-	},
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"gz" = (
-/obj/machinery/light/small{
-	dir = 8
-	},
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"gA" = (
-/obj/machinery/light/small{
-	dir = 4
-	},
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"gB" = (
-/obj/structure/chair/wood{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"gC" = (
-/obj/structure/chair/wood/wings{
-	dir = 4
-	},
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"gD" = (
-/obj/structure/table/wood/poker,
-/obj/item/toy/cards/deck,
-/obj/item/stamp/qm{
-	pixel_x = -5;
-	pixel_y = 3
-	},
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"gE" = (
-/obj/structure/table/wood/poker,
-/obj/item/storage/fancy/donut_box,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"gF" = (
-/obj/structure/table/wood/poker,
-/obj/item/storage/fancy/candle_box,
-/obj/item/storage/fancy/candle_box,
-/obj/item/storage/fancy/candle_box,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"gG" = (
-/obj/structure/chair/wood/wings{
-	dir = 8
-	},
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"gH" = (
-/obj/structure/toilet{
-	dir = 4
-	},
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"gI" = (
-/mob/living/simple_animal/hostile/retaliate/nanotrasenpeace{
-	a_intent = "friendly";
-	alpha = 150;
-	attack_sound = 'sound/items/towelwipe.ogg';
-	attacktext = "towels down";
-	desc = "A ghost who is intent on spraying you with purfume and toweling you, then expecting a tip after!! Spooky!!!";
-	friendly = "towels down";
-	icon_state = "paperwizard";
-	melee_damage_lower = 0;
-	melee_damage_upper = 0;
-	name = "Spooky Restroom attendant"
-	},
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"gJ" = (
-/obj/structure/sink{
-	dir = 4;
-	pixel_x = 11
-	},
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"gK" = (
-/obj/structure/mirror,
-/turf/closed/wall/mineral/wood,
-/area/eventmap/inside)
-"gL" = (
-/obj/structure/sink{
-	dir = 8;
-	pixel_x = -12
-	},
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"gM" = (
-/obj/structure/mineral_door/wood{
-	name = "closet"
-	},
-/obj/structure/barricade/wooden/crude,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"gN" = (
-/obj/machinery/button/door/dorms/dorm06,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"gO" = (
-/obj/structure/bed,
-/obj/item/bedsheet/random,
-/obj/machinery/button/door/dorms/dorm09,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"gP" = (
-/obj/machinery/button/door/dorms/dorm12,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"gQ" = (
-/obj/structure/bed,
-/obj/item/bedsheet/random,
-/obj/machinery/button/door/dorms/dorm15,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"gR" = (
-/obj/structure/sign/directions/medical{
-	dir = 4;
-	pixel_x = 32;
-	pixel_y = -24
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"gS" = (
-/turf/open/floor/wood{
-	icon_state = "wood-broken3"
-	},
-/area/eventmap/inside)
-"gT" = (
-/obj/structure/sign/departments/chemistry{
-	pixel_y = -32
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"gU" = (
-/obj/machinery/vending/snack/green,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"gV" = (
-/obj/structure/window/fulltile,
-/obj/structure/barricade/wooden/crude,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"gW" = (
-/obj/structure/table/wood/poker,
-/obj/item/toy/cards/deck/cas,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"gX" = (
-/obj/structure/table/wood/poker,
-/obj/item/trash/candle,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"gY" = (
-/obj/structure/table/wood/poker,
-/obj/item/toy/cards/deck/syndicate,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"gZ" = (
-/obj/item/chair/wood/wings,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"ha" = (
-/obj/structure/sink{
-	dir = 4;
-	pixel_x = 11
-	},
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"hb" = (
-/obj/structure/mirror,
-/obj/structure/mirror{
-	dir = 8
-	},
-/turf/closed/wall/mineral/wood,
-/area/eventmap/inside)
-"hc" = (
-/obj/effect/decal/cleanable/cobweb,
-/turf/closed/wall/mineral/wood,
-/area/eventmap/inside)
-"hd" = (
-/obj/effect/decal/cleanable/cobweb,
-/turf/open/floor/wood{
-	icon_state = "wood-broken7"
-	},
-/area/eventmap/inside)
-"he" = (
-/obj/structure/fireplace,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"hf" = (
-/obj/item/candle/infinite,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"hg" = (
-/turf/open/floor/carpet/green,
-/area/eventmap/inside)
-"hh" = (
-/obj/item/rupee,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"hi" = (
-/obj/effect/meteor/pumpkin{
-	lifetime = 2.14748e+009;
-	light_color = "#FFCC66";
-	light_range = 3
-	},
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"hj" = (
-/obj/machinery/light/small/broken{
-	dir = 8
-	},
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken6"
-	},
-/area/eventmap/inside)
-"hk" = (
-/obj/machinery/light/small/broken{
-	dir = 4
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken3"
-	},
-/area/eventmap/inside)
-"hl" = (
-/obj/structure/table/wood,
-/obj/item/stack/medical/bruise_pack,
-/obj/item/stack/medical/ointment,
-/obj/item/candle/infinite,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"hm" = (
-/obj/machinery/smartfridge/food,
-/turf/closed/wall/mineral/wood,
-/area/eventmap/inside)
-"hn" = (
-/obj/structure/table/wood,
-/obj/item/folder/white,
-/obj/item/folder/blue,
-/obj/item/reagent_containers/food/drinks/mug/coco,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ho" = (
-/obj/structure/fluff/broken_flooring,
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/effect/turf_decal/tile/green{
-	dir = 4
-	},
-/obj/effect/turf_decal/tile/green{
-	dir = 1
-	},
-/obj/effect/turf_decal/tile/green{
-	dir = 8
-	},
-/turf/open/floor/plating{
-	icon_state = "panelscorched"
-	},
-/area/eventmap/inside)
-"hp" = (
-/obj/effect/turf_decal/tile/green{
-	dir = 4
-	},
-/obj/effect/turf_decal/tile/green,
-/obj/effect/turf_decal/tile/green{
-	dir = 1
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"hq" = (
-/obj/structure/mineral_door/wood,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"hr" = (
-/obj/structure/chair/wood{
-	dir = 4
-	},
-/obj/item/chair/wood,
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"hs" = (
-/obj/structure/table/wood/fancy/green,
-/obj/item/trash/plate,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ht" = (
-/obj/structure/window/fulltile,
-/obj/structure/barricade/wooden/crude,
-/obj/structure/spacevine,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"hu" = (
-/obj/structure/table/wood/poker,
-/obj/item/toy/cards/deck/cas/black,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"hv" = (
-/obj/structure/table/wood/poker,
-/obj/item/dice/d6,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"hw" = (
-/obj/structure/table/wood/poker,
-/obj/item/dice/d20,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"hx" = (
-/turf/open/floor/wood{
-	icon_state = "wood-broken6"
-	},
-/area/eventmap/inside)
-"hy" = (
-/obj/structure/toilet{
-	dir = 8
-	},
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"hz" = (
-/obj/structure/table/wood/fancy/royalblack,
-/obj/item/ship_in_a_bottle,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"hA" = (
-/obj/structure/table/wood/fancy/royalblack,
-/obj/item/soapstone/infinite,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"hB" = (
-/obj/machinery/chem_master,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"hC" = (
-/obj/structure/chair/wood{
-	dir = 1
-	},
-/obj/effect/landmark/start/chemist,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"hD" = (
-/obj/structure/table/glass,
-/obj/item/reagent_containers/dropper,
-/obj/item/reagent_containers/dropper,
-/obj/item/reagent_containers/glass/beaker/large,
-/obj/item/reagent_containers/glass/beaker/large,
-/obj/item/stack/sheet/mineral/plasma,
-/obj/item/stack/sheet/mineral/plasma,
-/obj/item/storage/box/beakers,
-/obj/item/storage/box/beakers,
-/obj/item/storage/box/beakers/bluespace,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"hE" = (
-/obj/machinery/light,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/outside)
-"hF" = (
-/obj/structure/chair/wood{
-	dir = 1
-	},
-/obj/item/toy/plush/catgirl/fermis,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"hG" = (
-/obj/effect/turf_decal/tile/green{
-	dir = 1
-	},
-/obj/effect/turf_decal/tile/green{
-	dir = 8
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"hH" = (
-/obj/effect/turf_decal/tile/green{
-	dir = 4
-	},
-/obj/effect/turf_decal/tile/green,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"hI" = (
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"hJ" = (
-/obj/structure/spacevine,
-/turf/closed/mineral/ash_rock,
-/area/eventmap/mountain)
-"hK" = (
-/obj/machinery/iv_drip,
-/obj/structure/closet/crate/freezer/blood,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"hL" = (
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"hM" = (
-/obj/machinery/vending/wallmed{
-	pixel_y = 32
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"hN" = (
-/obj/effect/decal/cleanable/cobweb/cobweb2,
-/obj/structure/bed/roller,
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/item/clothing/suit/straight_jacket,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"hO" = (
-/obj/effect/decal/cleanable/dirt,
-/obj/machinery/light/small{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"hP" = (
-/obj/structure/table/wood,
-/obj/item/reagent_containers/spray/cleaner{
-	pixel_x = 8;
-	pixel_y = 3
-	},
-/obj/item/reagent_containers/glass/bucket,
-/obj/effect/decal/cleanable/cobweb,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"hQ" = (
-/obj/structure/chair/wood{
-	dir = 4
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken5"
-	},
-/area/eventmap/inside)
-"hR" = (
-/obj/structure/table/wood/fancy/green,
-/obj/item/storage/fancy/donut_box,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"hS" = (
-/obj/structure/chair/wood/wings{
-	dir = 1
-	},
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"hT" = (
-/obj/structure/table/wood/fancy/royalblack,
-/obj/item/clothing/head/hardhat/pumpkinhead/jaqc,
-/obj/effect/wisp/pumpkin,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"hU" = (
-/obj/item/candle/infinite,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"hV" = (
-/obj/machinery/door/airlock/wood/dorms/dorm02,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"hW" = (
-/obj/machinery/door/airlock/wood/dorms/dorm07,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"hX" = (
-/obj/machinery/door/airlock/wood/dorms/dorm10,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"hY" = (
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/wood{
-	icon_state = "wood-broken7"
-	},
-/area/eventmap/inside)
-"hZ" = (
-/obj/effect/decal/cleanable/dirt,
-/obj/machinery/door/airlock/wood/dorms/dorm13,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ia" = (
-/obj/machinery/door/airlock/wood/dorms/dorm16,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ib" = (
-/obj/machinery/door/airlock/wood/dorms/dorm19,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ic" = (
-/obj/machinery/chem_dispenser,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"id" = (
-/obj/machinery/chem_heater,
-/obj/effect/decal/cleanable/greenglow,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ie" = (
-/obj/structure/closet/crate/freezer/surplus_limbs,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"if" = (
-/obj/structure/table/wood,
-/obj/item/cautery{
-	pixel_y = 3
-	},
-/obj/item/retractor,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"ig" = (
-/obj/item/mop,
-/obj/machinery/light/small{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ih" = (
-/obj/structure/table/wood/fancy/green,
-/obj/item/chair/wood,
-/obj/item/clothing/glasses/hud/health,
-/obj/item/clothing/glasses/hud/health,
-/obj/item/clothing/glasses/hud/health,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ii" = (
-/obj/item/twohanded/required/kirbyplants/random,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"ij" = (
-/mob/living/simple_animal/mouse/brown/Tom,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"ik" = (
-/obj/machinery/computer/slot_machine,
-/turf/open/floor/wood{
-	icon_state = "wood-broken2"
-	},
-/area/eventmap/inside)
-"il" = (
-/obj/machinery/computer/arcade/orion_trail/kobayashi,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"im" = (
-/obj/machinery/computer/arcade/battle,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"in" = (
-/obj/machinery/computer/arcade/minesweeper,
-/turf/open/floor/wood{
-	icon_state = "wood-broken4"
-	},
-/area/eventmap/inside)
-"io" = (
-/obj/machinery/computer/arcade/amputation,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ip" = (
-/obj/machinery/computer/arcade/orion_trail,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"iq" = (
-/turf/open/floor/carpet/purple,
-/area/eventmap/inside)
-"ir" = (
-/obj/structure/sign/departments/restroom{
-	pixel_y = 32
-	},
-/turf/open/floor/carpet/purple,
-/area/eventmap/inside)
-"is" = (
-/obj/structure/closet/cabinet,
-/obj/item/camera/timefreeze,
-/obj/item/cane,
-/obj/item/cardboard_cutout,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"it" = (
-/obj/structure/dresser,
-/turf/open/floor/carpet/cyan,
-/area/eventmap/inside)
-"iu" = (
-/obj/structure/fireplace,
-/turf/open/floor/carpet/cyan,
-/area/eventmap/inside)
-"iv" = (
-/turf/open/floor/carpet/cyan,
-/area/eventmap/inside)
-"iw" = (
-/obj/structure/table/wood,
-/obj/item/flashlight/lamp,
-/turf/open/floor/carpet/cyan,
-/area/eventmap/inside)
-"ix" = (
-/obj/effect/temp_visual/cult/turf/floor,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"iy" = (
-/obj/effect/decal/cleanable/blood/tracks,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"iz" = (
-/obj/structure/bed,
-/obj/item/bedsheet/random,
-/obj/machinery/button/door/dorms/dorm02,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"iA" = (
-/obj/machinery/button/door/dorms/dorm07,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"iB" = (
-/obj/structure/bed,
-/obj/item/bedsheet/random,
-/obj/machinery/button/door/dorms/dorm10,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"iC" = (
-/obj/machinery/button/door/dorms/dorm13,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"iD" = (
-/obj/structure/bed,
-/obj/item/bedsheet/random,
-/obj/machinery/button/door/dorms/dorm16,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"iE" = (
-/obj/machinery/button/door/dorms/dorm19,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"iF" = (
-/obj/structure/closet/wardrobe/chemistry_white,
-/obj/machinery/light/small{
-	dir = 8
-	},
-/obj/item/grenade/chem_grenade/glitter/blue,
-/obj/item/grenade/chem_grenade/glitter/pink,
-/obj/item/grenade/chem_grenade/glitter/white,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"iG" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/effect/decal/cleanable/chem_pile,
-/obj/machinery/light/small,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"iH" = (
-/obj/structure/closet/secure_closet/medical1,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"iI" = (
-/obj/machinery/light{
-	dir = 8
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"iJ" = (
-/obj/effect/landmark/start/medical_doctor,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"iK" = (
-/obj/structure/table/wood,
-/obj/item/circular_saw,
-/obj/item/hemostat,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"iL" = (
-/obj/effect/decal/cleanable/vomit/old,
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"iM" = (
-/obj/effect/decal/cleanable/glass,
-/obj/item/organ/tail/cat,
-/obj/machinery/light/broken{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"iN" = (
-/obj/structure/showcase/machinery/tv,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"iO" = (
-/mob/living/simple_animal/mouse/brown,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"iP" = (
-/obj/structure/bed,
-/obj/effect/spawner/lootdrop/bedsheet,
-/turf/open/floor/carpet/cyan,
-/area/eventmap/inside)
-"iQ" = (
-/obj/structure/bed,
-/obj/item/bedsheet/cosmos,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"iR" = (
-/obj/effect/decal/cleanable/blood/tracks,
-/obj/item/candle/infinite,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"iS" = (
-/obj/item/toy/plush/catgirl/skylar,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"iT" = (
-/obj/machinery/vending/wardrobe/chem_wardrobe,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"iU" = (
-/obj/structure/table/glass,
-/obj/machinery/reagentgrinder,
-/obj/item/reagent_containers/glass/beaker/large,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"iV" = (
-/obj/structure/cloth_pile,
-/obj/effect/turf_decal/tile/green{
-	dir = 4
-	},
-/obj/effect/turf_decal/tile/green,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"iW" = (
-/obj/machinery/sleeper/syndie/fullupgrade{
-	dir = 8
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"iX" = (
-/obj/structure/closet/secure_closet/medical2,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"iY" = (
-/obj/machinery/computer/operating{
-	dir = 1
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"iZ" = (
-/obj/structure/table/optable,
-/obj/item/healthanalyzer/advanced,
-/obj/item/clothing/gloves/color/latex/nitrile,
-/obj/item/clothing/mask/surgical,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"ja" = (
-/obj/structure/table/wood,
-/obj/item/scalpel,
-/obj/item/surgical_drapes,
-/obj/item/surgicaldrill,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"jb" = (
-/obj/structure/table/wood,
-/obj/item/storage/box/donkpockets,
-/obj/machinery/light/small{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jc" = (
-/obj/structure/chair/wood{
-	dir = 4
-	},
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"jd" = (
-/obj/structure/table/wood/fancy/green,
-/obj/item/storage/pill_bottle/dice,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"je" = (
-/turf/open/floor/wood{
-	icon_state = "wood-broken"
-	},
-/area/eventmap/inside)
-"jf" = (
-/obj/structure/table/wood,
-/obj/item/pen,
-/obj/item/folder/documents,
-/obj/item/folder/paperwork_correct,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jg" = (
-/obj/structure/chair/office/light{
-	dir = 8
-	},
-/turf/open/floor/carpet/cyan,
-/area/eventmap/inside)
-"jh" = (
-/obj/structure/table/wood,
-/obj/item/hemostat/supermatter,
-/obj/item/camera/spooky,
-/turf/open/floor/carpet/cyan,
-/area/eventmap/inside)
-"ji" = (
-/obj/item/toy/plush/mammal/dog,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jj" = (
-/obj/effect/decal/remains/human,
-/obj/effect/rune/apocalypse,
-/obj/effect/decal/cleanable/blood/splatter,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jk" = (
-/obj/item/toy/plush/borgplushie/bhijn,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jl" = (
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"jm" = (
-/obj/machinery/door/airlock/medical/glass{
-	name = "Chemistry Lab";
-	req_access_txt = "5; 33"
-	},
-/obj/machinery/door/firedoor,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jn" = (
-/obj/structure/table/wood,
-/obj/machinery/microwave,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jo" = (
-/obj/structure/chair/wood{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jp" = (
-/obj/structure/table/wood/fancy/green,
-/obj/item/toy/figure/cmo,
-/obj/item/megaphone/command,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jq" = (
-/obj/structure/chair/sofa/right{
-	dir = 1
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken"
-	},
-/area/eventmap/inside)
-"jr" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/item/twohanded/required/kirbyplants/random,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"js" = (
-/obj/structure/table/wood,
-/obj/item/toy/cards/deck/cas/black,
-/obj/item/toy/cards/deck/cas/black,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jt" = (
-/obj/structure/chair/comfy/plywood,
-/turf/open/floor/spooktime/cobble,
-/area/eventmap/outside)
-"ju" = (
-/obj/structure/table/wood,
-/obj/item/toy/cards/deck/syndicate,
-/obj/item/toy/cards/deck/syndicate,
-/obj/item/toy/cards/deck/syndicate,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jv" = (
-/obj/structure/table/wood,
-/obj/item/toy/cards/deck/cas,
-/obj/item/toy/cards/deck/cas,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jw" = (
-/obj/structure/table/wood,
-/obj/item/toy/cards/deck,
-/obj/item/toy/cards/deck,
-/obj/item/toy/cards/deck,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jx" = (
-/obj/item/twohanded/required/kirbyplants/random,
-/obj/item/clothing/suit/ghost_sheet,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jy" = (
-/obj/structure/spacevine,
-/turf/closed/wall/mineral/wood,
-/area/eventmap/inside)
-"jz" = (
-/obj/item/paper/pamphlet/ruin/originalcontent/yelling,
-/turf/closed/wall/mineral/wood,
-/area/eventmap/inside)
-"jA" = (
-/obj/structure/table/wood/fancy/royalblack,
-/obj/item/key/collar,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jB" = (
-/obj/structure/table/wood/fancy/royalblack,
-/obj/item/lipstick,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jC" = (
-/obj/item/toy/plush/lizardplushie/durgit,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jD" = (
-/obj/machinery/door/airlock/wood/dorms/dorm01,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jE" = (
-/obj/machinery/door/airlock/wood/dorms/dorm20,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jF" = (
-/obj/machinery/chem_heater,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jG" = (
-/obj/structure/closet/wardrobe/chemistry_white,
-/obj/machinery/light/small{
-	dir = 4;
-	light_color = "#d8b1b1"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jH" = (
-/obj/structure/chair/wood{
-	dir = 4
-	},
-/obj/effect/landmark/start/virologist,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"jI" = (
-/obj/structure/table/wood/fancy/black,
-/obj/item/storage/box/gloves,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"jJ" = (
-/obj/machinery/atmospherics/components/unary/cryo_cell,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"jK" = (
-/obj/machinery/atmospherics/pipe/simple{
-	dir = 6
-	},
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"jL" = (
-/obj/machinery/atmospherics/components/unary/thermomachine/freezer{
-	dir = 8
-	},
-/obj/effect/decal/cleanable/cobweb/cobweb2,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"jM" = (
-/obj/structure/table/wood/fancy/green,
-/obj/item/camera,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jN" = (
-/obj/item/twohanded/required/kirbyplants/random,
-/obj/item/clothing/suit/ghost_sheet,
-/turf/open/floor/carpet/purple,
-/area/eventmap/inside)
-"jO" = (
-/obj/item/twohanded/required/kirbyplants/random,
-/turf/open/floor/carpet/purple,
-/area/eventmap/inside)
-"jP" = (
-/obj/structure/table/wood,
-/obj/item/pen,
-/obj/item/folder/paperwork,
-/obj/item/storage/box/fountainpens,
-/obj/effect/decal/cleanable/cobweb,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jQ" = (
-/obj/structure/chair/office/dark{
-	dir = 8
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"jR" = (
-/obj/structure/table/wood,
-/obj/item/flashlight/lantern,
-/obj/item/folder/syndicate/red,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"jS" = (
-/obj/item/statuebust,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jT" = (
-/obj/item/statuebust,
-/turf/open/floor/wood{
-	icon_state = "wood-broken2"
-	},
-/area/eventmap/inside)
-"jU" = (
-/obj/structure/bed,
-/obj/item/bedsheet/random,
-/obj/machinery/button/door/dorms/dorm01,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"jV" = (
-/obj/machinery/camera/emp_proof{
-	c_tag = "Containment - Particle Accelerator";
-	dir = 1;
-	network = list("singularity")
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"jW" = (
-/obj/machinery/button/door/dorms/dorm20,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"jX" = (
-/obj/structure/chair/wood,
-/obj/effect/landmark/start/chemist,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jY" = (
-/obj/structure/table/glass,
-/obj/item/reagent_containers/dropper,
-/obj/item/reagent_containers/glass/beaker/large,
-/obj/item/stack/sheet/mineral/plasma,
-/obj/item/storage/box/beakers,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"jZ" = (
-/obj/structure/chair/wood{
-	dir = 4
-	},
-/obj/machinery/light/small{
-	dir = 8
-	},
-/obj/effect/landmark/start/medical_doctor,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"ka" = (
-/obj/machinery/light/small,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"kb" = (
-/obj/structure/table/wood/fancy/black,
-/obj/item/stack/medical/bruise_pack,
-/obj/item/stack/medical/ointment,
-/obj/item/stack/medical/gauze,
-/obj/item/storage/pill_bottle/mutadone,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"kc" = (
-/obj/machinery/atmospherics/pipe/simple{
-	dir = 5
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"kd" = (
-/obj/machinery/atmospherics/pipe/manifold,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"ke" = (
-/obj/machinery/atmospherics/pipe/manifold4w,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"kf" = (
-/obj/machinery/atmospherics/components/unary/portables_connector/visible{
-	dir = 8
-	},
-/obj/machinery/portable_atmospherics/canister/oxygen,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"kg" = (
-/obj/effect/decal/cleanable/cobweb,
-/obj/item/twohanded/required/kirbyplants/random,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kh" = (
-/obj/structure/chair/wood/wings,
-/mob/living/simple_animal/astral,
-/turf/open/floor/wood{
-	icon_state = "wood-broken5"
-	},
-/area/eventmap/inside)
-"ki" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/mob/living/simple_animal/hostile/retaliate/bat,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kj" = (
-/obj/structure/chair/wood/wings,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kk" = (
-/obj/structure/chair/wood/wings,
-/turf/open/floor/wood{
-	icon_state = "wood-broken2"
-	},
-/area/eventmap/inside)
-"kl" = (
-/obj/structure/bed,
-/obj/effect/spawner/lootdrop/bedsheet,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"km" = (
-/obj/structure/mineral_door/woodrustic,
-/obj/structure/barricade/wooden/crude,
-/obj/structure/spacevine,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kn" = (
-/obj/structure/table/wood,
-/obj/item/paper/fluff/balls/spookyasylum/traffickingvictim,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ko" = (
-/obj/structure/mineral_door/wood,
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"kp" = (
-/obj/structure/table/wood,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kq" = (
-/obj/structure/table/wood/fancy/purple,
-/obj/item/reagent_containers/syringe/charcoal,
-/obj/item/reagent_containers/glass/bottle/epinephrine,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"kr" = (
-/obj/effect/turf_decal/tile/green,
-/obj/effect/turf_decal/tile/green{
-	dir = 4
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"ks" = (
-/obj/structure/table/wood/fancy/purple,
-/obj/item/reagent_containers/glass/beaker/cryoxadone,
-/obj/item/reagent_containers/glass/beaker/cryoxadone,
-/obj/item/reagent_containers/glass/beaker/cryoxadone,
-/obj/item/reagent_containers/glass/beaker/cryoxadone,
-/obj/item/wrench/medical,
-/obj/item/storage/pill_bottle/mannitol,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"kt" = (
-/obj/machinery/atmospherics/pipe/simple{
-	dir = 5
-	},
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"ku" = (
-/obj/machinery/vending/cigarette/beach,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kv" = (
-/obj/structure/chair/wood,
-/turf/open/floor/carpet/orange,
-/area/eventmap/inside)
-"kw" = (
-/obj/structure/chair/wood/wings{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kx" = (
-/obj/structure/table/wood/fancy/red,
-/obj/item/book_of_babel,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"ky" = (
-/obj/structure/table/wood/fancy/red,
-/obj/item/candle/infinite,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"kz" = (
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"kA" = (
-/turf/open/floor/spooktime/riverwatermotion,
-/area/eventmap/outside)
-"kB" = (
-/obj/structure/table/wood/fancy/red,
-/obj/item/toy/plush/lampplushie,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"kC" = (
-/obj/structure/table/wood/fancy/red,
-/obj/item/book/granter/action/drink_fling,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"kD" = (
-/obj/structure/table/wood/fancy/red,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"kE" = (
-/obj/structure/table/wood/fancy/red,
-/obj/item/storage/bag/books,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"kF" = (
-/obj/structure/closet/cabinet,
-/obj/item/codespeak_manual/unlimited,
-/obj/item/cookiesynth,
-/obj/item/fugu_gland,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kG" = (
-/obj/structure/dresser,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"kH" = (
-/obj/item/ectoplasm,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"kI" = (
-/obj/structure/table/wood,
-/obj/item/flashlight/lamp/bananalamp,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"kJ" = (
-/obj/machinery/washing_machine,
-/obj/effect/decal/cleanable/cobweb,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kK" = (
-/mob/living/simple_animal/hostile/retaliate/bat{
-	attack_sound = 'sound/spookoween/ahaha.ogg';
-	attacktext = "washes at";
-	desc = "A spooky, floating washing machine possesed by some specture! Responsibilities, clearly the scariest thing imaginable.";
-	icon = 'icons/obj/machines/washing_machine.dmi';
-	icon_dead = "wm_1_0";
-	icon_gib = "wm_1_0";
-	icon_living = "wm_1_0";
-	icon_state = "wm_1_0";
-	melee_damage_lower = 0;
-	melee_damage_upper = 0;
-	name = "Posessed washing machine"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kL" = (
-/obj/structure/closet/cabinet,
-/obj/item/instrument/accordion,
-/obj/item/instrument/bikehorn,
-/obj/item/instrument/eguitar,
-/obj/item/instrument/glockenspiel,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kM" = (
-/obj/structure/table/wood/fancy/monochrome,
-/obj/item/instrument/violin/golden,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kN" = (
-/obj/structure/table/wood/fancy/monochrome,
-/obj/machinery/chem_dispenser/drinks/fullupgrade,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kO" = (
-/obj/structure/table/wood/fancy/monochrome,
-/obj/machinery/chem_dispenser/drinks/beer/fullupgrade,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kP" = (
-/obj/structure/table/wood/fancy/monochrome,
-/obj/item/instrument/trumpet/spectral,
-/obj/item/instrument/trombone/spectral,
-/obj/item/instrument/saxophone/spectral,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kQ" = (
-/obj/structure/closet/cabinet,
-/obj/item/instrument/guitar,
-/obj/item/instrument/harmonica,
-/obj/item/instrument/piano_synth,
-/obj/item/instrument/recorder,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kR" = (
-/obj/machinery/jukebox,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kS" = (
-/obj/structure/bookcase/random/reference,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kT" = (
-/obj/machinery/bookbinder,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kU" = (
-/obj/item/storage/box/matches,
-/obj/item/shovel,
-/obj/item/flashlight/flare/torch,
-/obj/item/hatchet,
-/obj/item/pickaxe/mini,
-/obj/structure/rack,
-/obj/item/umbrella,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kV" = (
-/obj/structure/bookcase/random/adult,
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kW" = (
-/obj/structure/table/wood/fancy,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kX" = (
-/obj/structure/table/wood/fancy,
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kY" = (
-/obj/structure/chair/wood/wings{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"kZ" = (
-/obj/machinery/light{
-	dir = 1
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"la" = (
-/obj/effect/decal/cleanable/dirt,
-/obj/effect/turf_decal/tile/green{
-	dir = 4
-	},
-/obj/effect/turf_decal/tile/green{
-	dir = 8
-	},
-/obj/effect/turf_decal/tile/green{
-	dir = 1
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"lb" = (
-/obj/effect/turf_decal/tile/green{
-	dir = 4
-	},
-/obj/effect/turf_decal/tile/green{
-	dir = 1
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"lc" = (
-/obj/effect/turf_decal/tile/green{
-	dir = 1
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"ld" = (
-/obj/effect/turf_decal/tile/green{
-	dir = 4
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"le" = (
-/obj/machinery/recharge_station,
-/obj/effect/turf_decal/tile/green{
-	dir = 4
-	},
-/obj/effect/turf_decal/tile/green{
-	dir = 1
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"lf" = (
-/obj/machinery/limbgrower,
-/obj/effect/turf_decal/tile/green{
-	dir = 4
-	},
-/obj/effect/turf_decal/tile/green{
-	dir = 1
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"lg" = (
-/obj/effect/turf_decal/tile/green,
-/obj/effect/turf_decal/tile/green{
-	dir = 4
-	},
-/obj/effect/turf_decal/tile/green{
-	dir = 1
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"lh" = (
-/obj/effect/spawner/lootdrop/keg,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"li" = (
-/obj/structure/table/wood/fancy/green,
-/obj/effect/spawner/lootdrop/costume,
-/obj/machinery/light,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"lj" = (
-/obj/structure/table/wood/fancy/green,
-/obj/item/defibrillator/loaded,
-/obj/item/defibrillator/loaded,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"lk" = (
-/obj/structure/table_frame/wood,
-/obj/item/chair/wood,
-/obj/item/stack/sheet/mineral/wood,
-/obj/item/storage/backpack/satchel/vir,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ll" = (
-/obj/structure/table/wood/fancy/red,
-/obj/item/book/granter/crafting_recipe/under_the_oven,
-/obj/item/book/granter/crafting_recipe/cooking_sweets_101,
-/obj/item/book/granter/crafting_recipe/coldcooking,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"lm" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"ln" = (
-/obj/structure/table/wood/fancy/red,
-/obj/item/storage/book/bible/booze,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"lo" = (
-/obj/structure/table/wood/fancy/red,
-/obj/machinery/computer/libraryconsole,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"lp" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/carpet/purple,
-/area/eventmap/inside)
-"lq" = (
-/obj/structure/sign/poster/official/ian,
-/turf/closed/wall/mineral/wood,
-/area/eventmap/inside)
-"lr" = (
-/mob/living/simple_animal/crab/evil,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ls" = (
-/mob/living/simple_animal/mouse/gray,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"lt" = (
-/mob/living/simple_animal/hostile/retaliate/bat{
-	attack_sound = 'sound/spookoween/ahaha.ogg';
-	attacktext = "plays at";
-	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
-	icon = 'icons/obj/musician.dmi';
-	icon_dead = "synth";
-	icon_gib = "synth";
-	icon_living = "synth";
-	icon_state = "synth";
-	melee_damage_lower = 0;
-	melee_damage_upper = 0;
-	name = "Posessed synth"
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"lu" = (
-/mob/living/simple_animal/hostile/retaliate/bat{
-	attack_sound = 'sound/spookoween/ahaha.ogg';
-	attacktext = "plays at";
-	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
-	icon = 'icons/obj/musician.dmi';
-	icon_dead = "glockenspiel";
-	icon_gib = "glockenspiel";
-	icon_living = "glockenspiel";
-	icon_state = "glockenspiel";
-	melee_damage_lower = 0;
-	melee_damage_upper = 0;
-	name = "Posessed glockenspiel"
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"lv" = (
-/obj/machinery/light/small,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"lw" = (
-/obj/structure/table/wood,
-/obj/item/toy/cards/deck/syndicate,
-/turf/open/floor/wood/damturf/broken3,
-/area/eventmap/mountaininside)
-"lx" = (
-/obj/machinery/hydroponics/constructable,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ly" = (
-/obj/effect/turf_decal/tile/green{
-	dir = 8
-	},
-/obj/effect/turf_decal/tile/green{
-	dir = 1
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"lz" = (
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"lA" = (
-/obj/item/banner/medical,
-/obj/effect/turf_decal/tile/green,
-/obj/effect/turf_decal/tile/green{
-	dir = 4
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"lB" = (
-/obj/structure/window/fulltile,
-/obj/structure/barricade/wooden/crude,
-/obj/effect/spawner/structure/window,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"lC" = (
-/mob/living/simple_animal/hostile/retaliate/bat/secbat,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"lD" = (
-/obj/structure/chair/wood/wings{
-	dir = 1
-	},
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"lE" = (
-/mob/living/simple_animal/hostile/retaliate/bat,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"lF" = (
-/obj/item/toy/cattoy,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"lG" = (
-/obj/structure/dresser,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"lH" = (
-/obj/structure/closet/cabinet,
-/obj/item/storage/daki,
-/obj/item/valentine,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"lI" = (
-/obj/machinery/pdapainter,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"lJ" = (
-/mob/living/simple_animal/hostile/retaliate/bat{
-	attack_sound = 'sound/spookoween/ahaha.ogg';
-	attacktext = "plays at";
-	desc = "A floating shopping list. It has the words Milk, eggs and cheese on it.";
-	icon = 'icons/obj/bureaucracy.dmi';
-	icon_dead = "paper_words";
-	icon_living = "paper_words";
-	icon_state = "paper_words";
-	melee_damage_lower = 0;
-	melee_damage_upper = 0;
-	name = "Floating Shopping List"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"lK" = (
-/obj/structure/bedsheetbin/towel,
-/obj/structure/table/reinforced/brass,
-/obj/item/storage/fancy/heart_box,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"lL" = (
-/obj/structure/flora/ausbushes/sunnybush,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"lM" = (
-/obj/item/chair/wood/wings{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"lN" = (
-/obj/structure/bookcase/manuals/engineering,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"lO" = (
-/obj/machinery/photocopier,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"lP" = (
-/obj/structure/table/wood/bar,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"lQ" = (
-/obj/structure/table/wood,
-/obj/item/toy/cards/deck/cas/black,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"lR" = (
-/obj/structure/sink{
-	dir = 8;
-	pixel_x = -12
-	},
-/obj/machinery/camera/emp_proof{
-	c_tag = "Containment - Fore Port";
-	dir = 4;
-	network = list("singularity")
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"lS" = (
-/obj/machinery/biogenerator,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"lT" = (
-/obj/structure/sink{
-	dir = 4;
-	pixel_x = 11
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"lU" = (
-/obj/effect/turf_decal/tile/green,
-/obj/effect/turf_decal/tile/green{
-	dir = 8
-	},
-/obj/effect/turf_decal/tile/green{
-	dir = 1
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"lV" = (
-/obj/effect/turf_decal/tile/green,
-/obj/effect/turf_decal/tile/green{
-	dir = 8
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"lW" = (
-/obj/effect/decal/cleanable/dirt,
-/obj/effect/turf_decal/tile/green,
-/obj/effect/turf_decal/tile/green{
-	dir = 8
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"lX" = (
-/obj/machinery/light/small,
-/obj/effect/turf_decal/tile/green,
-/obj/effect/turf_decal/tile/green{
-	dir = 8
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"lY" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/effect/turf_decal/tile/green,
-/obj/effect/turf_decal/tile/green{
-	dir = 8
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"lZ" = (
-/obj/effect/turf_decal/tile/green,
-/obj/effect/turf_decal/tile/green{
-	dir = 8
-	},
-/obj/effect/turf_decal/tile/green{
-	dir = 4
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"ma" = (
-/obj/structure/table/wood,
-/obj/item/storage/box/bodybags{
-	pixel_x = -3;
-	pixel_y = 3
-	},
-/obj/item/storage/box/bodybags,
-/obj/effect/decal/cleanable/cobweb,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"mb" = (
-/obj/structure/table/wood,
-/obj/effect/decal/cleanable/dirt,
-/obj/item/paper/guides/jobs/medical/morgue,
-/obj/item/gun/magic/staff/healing,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"mc" = (
-/obj/structure/table/wood,
-/obj/effect/decal/cleanable/dirt,
-/obj/structure/bedsheetbin,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"md" = (
-/obj/structure/table_frame/wood,
-/obj/item/stack/sheet/mineral/wood,
-/obj/effect/decal/cleanable/glass,
-/obj/item/shard,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"me" = (
-/obj/structure/bookcase/random/adult,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"mf" = (
-/obj/structure/bookcase/random/fiction,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"mg" = (
-/obj/structure/bookcase/random/nonfiction{
-	book_count = 5
-	},
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"mh" = (
-/obj/structure/bookcase/random/reference,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"mi" = (
-/obj/structure/bookcase/random/religion,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"mj" = (
-/obj/structure/bookcase/manuals/medical,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"mk" = (
-/turf/open/floor/plasteel/stairs/medium,
-/area/eventmap/inside)
-"ml" = (
-/obj/structure/flora/grass/jungle/b,
-/obj/effect/wisp,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"mm" = (
-/obj/item/candle/infinite,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"mn" = (
-/obj/structure/flora/junglebush{
-	icon_state = "grassa4"
-	},
-/obj/effect/wisp,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"mo" = (
-/obj/item/toy/tennis/rainbow,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"mp" = (
-/obj/item/wisp_lantern/pumpkin,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"mq" = (
-/obj/structure/bedsheetbin/color,
-/obj/structure/table/reinforced/brass,
-/obj/item/storage/fancy/donut_box,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"mr" = (
-/obj/item/chair/wood/wings{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ms" = (
-/mob/living/simple_animal/hostile/retaliate/bat{
-	attack_sound = 'sound/spookoween/ahaha.ogg';
-	attacktext = "plays at";
-	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
-	icon = 'icons/obj/musician.dmi';
-	icon_dead = "trumpet";
-	icon_gib = "trumpet";
-	icon_living = "trumpet";
-	icon_state = "trumpet";
-	melee_damage_lower = 0;
-	melee_damage_upper = 0;
-	name = "Posessed trumpet"
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"mt" = (
-/mob/living/simple_animal/hostile/retaliate/bat{
-	attack_sound = 'sound/spookoween/ahaha.ogg';
-	attacktext = "plays at";
-	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
-	icon = 'icons/obj/musician.dmi';
-	icon_dead = "guitar";
-	icon_gib = "guitar";
-	icon_living = "guitar";
-	icon_state = "guitar";
-	melee_damage_lower = 0;
-	melee_damage_upper = 0;
-	name = "Posessed Guitar"
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"mu" = (
-/mob/living/simple_animal/hostile/retaliate/bat{
-	attack_sound = 'sound/spookoween/ahaha.ogg';
-	attacktext = "plays at";
-	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
-	icon = 'icons/obj/musician.dmi';
-	icon_dead = "violin";
-	icon_gib = "violin";
-	icon_living = "violin";
-	icon_state = "violin";
-	melee_damage_lower = 0;
-	melee_damage_upper = 0;
-	name = "Posessed violin"
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"mv" = (
-/mob/living/simple_animal/hostile/retaliate/bat{
-	attack_sound = 'sound/spookoween/ahaha.ogg';
-	attacktext = "plays at";
-	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
-	icon = 'icons/obj/musician.dmi';
-	icon_dead = "saxophone";
-	icon_gib = "saxophone";
-	icon_living = "saxophone";
-	icon_state = "saxophone";
-	melee_damage_lower = 0;
-	melee_damage_upper = 0;
-	name = "Posessed saxophone"
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"mw" = (
-/obj/structure/chair/wood/wings{
-	dir = 8
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken6"
-	},
-/area/eventmap/inside)
-"mx" = (
-/obj/structure/bookcase/manuals/medical,
-/obj/machinery/light/small/broken{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"my" = (
-/obj/machinery/libraryscanner,
-/turf/open/floor/wood{
-	icon_state = "wood-broken5"
-	},
-/area/eventmap/inside)
-"mz" = (
-/obj/structure/bookcase/random/religion,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"mA" = (
-/obj/structure/bookcase/random/fiction,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"mB" = (
-/obj/machinery/light/small{
-	dir = 4
-	},
-/turf/open/floor/wood/damturf/broken5,
-/area/eventmap/inside)
-"mC" = (
-/obj/item/paper/fluff/balls/spookyasylum/healstaffnote,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"mD" = (
-/obj/structure/table/reinforced,
-/obj/structure/table/reinforced,
-/obj/item/paper/fluff/balls/spookyasylum{
-	name = "paper - 10/7/2559"
-	},
-/turf/open/floor/plating,
-/area/eventmap/mountaininside)
-"mE" = (
-/obj/machinery/light/small{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"mF" = (
-/obj/structure/chair/wood/wings{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"mG" = (
-/obj/structure/table/wood/fancy,
-/obj/machinery/light/small{
-	dir = 4
-	},
-/obj/item/reagent_containers/food/condiment/saltshaker,
-/obj/item/reagent_containers/food/condiment/peppermill,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"mH" = (
-/obj/machinery/seed_extractor,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"mI" = (
-/obj/machinery/light{
-	dir = 4
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"mJ" = (
-/obj/effect/decal/cleanable/dirt,
-/obj/machinery/door/airlock/medical/glass{
-	name = "Chemistry Lab";
-	req_access_txt = "5; 33"
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"mK" = (
-/obj/structure/mineral_door/wood,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"mL" = (
-/obj/item/candle/infinite,
-/obj/machinery/light/small/broken{
-	dir = 8
-	},
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"mM" = (
-/obj/structure/flora/ausbushes/palebush,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"mN" = (
-/obj/item/candle/infinite,
-/obj/structure/flora/grass/jungle/b,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"mO" = (
-/obj/structure/barricade/wooden,
-/obj/structure/mineral_door/wood,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"mP" = (
-/obj/structure/bookcase/random/nonfiction,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"mQ" = (
-/obj/structure/dead_ratvar,
-/turf/open/floor/spooktime/riverwatermotion,
-/area/eventmap/outside)
-"mR" = (
-/obj/structure/bookcase/manuals/research_and_development,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"mS" = (
-/obj/item/hot_potato/harmless/toy{
-	name = "Rotato potato"
-	},
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"mT" = (
-/obj/structure/bed/dogbed,
-/mob/living/simple_animal/pet/dog/corgi{
-	icon_state = "corgigrey";
-	name = "Ghost corgi"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"mU" = (
-/obj/item/stack/sheet/bone,
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"mV" = (
-/obj/structure/bed/dogbed{
-	name = "cat bed"
-	},
-/mob/living/simple_animal/pet/cat/custom_cat{
-	name = "Ghost cat"
-	},
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"mW" = (
-/obj/structure/table/wood,
-/obj/item/flashlight/lamp,
-/obj/item/reagent_containers/food/snacks/grown/tea/catnip{
-	icon_state = "coffee_robusta"
-	},
-/turf/open/floor/carpet/royalblue,
-/area/eventmap/inside)
-"mX" = (
-/obj/item/mop,
-/obj/item/mop/advanced,
-/obj/structure/closet/jcloset,
-/obj/item/reagent_containers/spray/cleaner,
-/obj/item/reagent_containers/spray/cleaner,
-/obj/item/reagent_containers/spray/cleaner,
-/obj/item/extinguisher/advanced,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"mY" = (
-/obj/structure/bedsheetbin,
-/obj/structure/table/reinforced/brass,
-/obj/item/storage/fancy/candle_box,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"mZ" = (
-/obj/structure/chair/wood/wings{
-	dir = 4
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken5"
-	},
-/area/eventmap/inside)
-"na" = (
-/obj/structure/flora/grass/jungle/b,
-/turf/open/floor/spooktime/cobble,
-/area/eventmap/outside)
-"nb" = (
-/turf/open/floor/grass/fakebasalt,
-/area/eventmap/outside)
-"nc" = (
-/obj/structure/flora/grass/jungle/b,
-/turf/open/floor/grass/fakebasalt,
-/area/eventmap/outside)
-"nd" = (
-/obj/structure/mineral_door/woodrustic,
-/turf/open/floor/spooktime/cobble/cornerNW,
-/area/eventmap/outside)
-"ne" = (
-/obj/structure/flora/grass/jungle/b{
-	icon_state = "bushb"
-	},
-/turf/open/floor/spooktime/cobble/sideN,
-/area/eventmap/outside)
-"nf" = (
-/obj/structure/flora/grass/jungle/b{
-	icon_state = "grassb2"
-	},
-/turf/open/floor/spooktime/cobble/cornerNE,
-/area/eventmap/outside)
-"ng" = (
-/obj/structure/bookcase/manuals/research_and_development,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"nh" = (
-/obj/structure/table/wood,
-/obj/machinery/computer/libraryconsole/bookmanagement,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ni" = (
-/obj/structure/bookcase/random/religion,
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"nj" = (
-/obj/structure/sink{
-	dir = 8;
-	pixel_x = -12
-	},
-/obj/structure/mirror{
-	icon_state = "mirror_broke";
-	pixel_x = -28
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"nk" = (
-/obj/structure/fluff/broken_flooring,
-/obj/effect/decal/cleanable/cobweb,
-/turf/open/floor/plating{
-	icon_state = "panelscorched"
-	},
-/area/eventmap/inside)
-"nl" = (
-/obj/structure/table/glass,
-/obj/item/storage/box/pillbottles,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"nm" = (
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"nn" = (
-/obj/machinery/chem_heater,
-/obj/effect/decal/cleanable/greenglow,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"no" = (
-/obj/machinery/clonepod,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"np" = (
-/obj/machinery/computer/cloning,
-/turf/open/floor/plasteel/white/side,
-/area/eventmap/inside)
-"nq" = (
-/obj/machinery/dna_scannernew,
-/turf/open/floor/plasteel/white/side,
-/area/eventmap/inside)
-"nr" = (
-/obj/item/book/manual/wiki/medical_cloning,
-/obj/structure/table/wood/fancy/black,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"ns" = (
-/obj/structure/table/wood,
-/obj/item/roller,
-/obj/item/surgical_drapes,
-/obj/effect/decal/cleanable/cobweb,
-/obj/item/clothing/suit/straight_jacket,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"nt" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/machinery/light/small/broken{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"nu" = (
-/obj/effect/decal/cleanable/vomit/old,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"nv" = (
-/obj/structure/spacevine,
-/obj/structure/spacevine,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/outside)
-"nw" = (
-/obj/structure/flora/rock/jungle,
-/turf/open/floor/spooktime/cobble,
-/area/eventmap/outside)
-"nx" = (
-/obj/structure/flora/rock/pile/largejungle,
-/turf/open/indestructible/cobble,
-/area/eventmap/outside)
-"ny" = (
-/obj/structure/mineral_door/woodrustic,
-/turf/open/floor/spooktime/cobble/sideW,
-/area/eventmap/outside)
-"nz" = (
-/obj/structure/flora/grass/jungle/b{
-	icon_state = "bushb3"
-	},
-/turf/open/floor/spooktime/cobble,
-/area/eventmap/outside)
-"nA" = (
-/obj/structure/fluff/fokoff_sign{
-	desc = "A crudely-made sign with the words 'too spooky' written in some sort of red paint."
-	},
-/turf/open/floor/spooktime/cobble,
-/area/eventmap/outside)
-"nB" = (
-/obj/structure/flora/grass/jungle/b{
-	icon_state = "bushb2"
-	},
-/turf/open/floor/spooktime/cobble/sideE,
-/area/eventmap/outside)
-"nC" = (
-/obj/item/chair/wood,
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"nD" = (
-/obj/structure/closet/secure_closet/medical2,
-/obj/item/restraints/handcuffs/fake,
-/obj/effect/decal/cleanable/cobweb/cobweb2,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"nE" = (
-/obj/structure/mineral_door/wood,
-/obj/effect/decal/cleanable/blood/tracks{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"nF" = (
-/obj/effect/decal/cleanable/blood/tracks{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"nG" = (
-/obj/effect/decal/cleanable/dirt,
-/obj/machinery/light/small/broken{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"nH" = (
-/obj/structure/flora/ausbushes/leafybush,
-/turf/open/floor/spooktime/cobble,
-/area/eventmap/outside)
-"nI" = (
-/obj/structure/flora/grass/jungle/b{
-	icon_state = "grassa5"
-	},
-/turf/open/floor/spooktime/cobble/sideS,
-/area/eventmap/outside)
-"nJ" = (
-/obj/item/twohanded/required/kirbyplants/random,
-/turf/open/floor/wood{
-	icon_state = "wood-broken7"
-	},
-/area/eventmap/inside)
-"nK" = (
-/obj/structure/bookcase/random/nonfiction,
-/turf/open/floor/wood{
-	icon_state = "wood-broken"
-	},
-/area/eventmap/inside)
-"nL" = (
-/obj/structure/bookcase/random/adult,
-/turf/open/floor/wood{
-	icon_state = "wood-broken5"
-	},
-/area/eventmap/inside)
-"nM" = (
-/mob/living/simple_animal/hostile/retaliate/bat{
-	attack_sound = 'sound/spookoween/ahaha.ogg';
-	attacktext = "plays at";
-	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
-	icon = 'icons/obj/musician.dmi';
-	icon_dead = "golden_violin";
-	icon_gib = "golden_violin";
-	icon_living = "golden_violin";
-	icon_state = "golden_violin";
-	melee_damage_lower = 0;
-	melee_damage_upper = 0;
-	name = "Posessed golden violin"
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"nN" = (
-/obj/machinery/jukebox/disco/indestructible{
-	req_one_access = list()
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"nO" = (
-/mob/living/simple_animal/hostile/retaliate/bat{
-	attack_sound = 'sound/spookoween/ahaha.ogg';
-	attacktext = "plays at";
-	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
-	icon = 'icons/obj/musician.dmi';
-	icon_dead = "eguitar";
-	icon_gib = "eguitar";
-	icon_living = "eguitar";
-	icon_state = "eguitar";
-	melee_damage_lower = 0;
-	melee_damage_upper = 0;
-	name = "Posessed electric guitar"
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"nP" = (
-/obj/structure/toilet{
-	dir = 4
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"nQ" = (
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/plasteel/white,
-/area/eventmap/inside)
-"nR" = (
-/obj/machinery/chem_dispenser,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"nS" = (
-/turf/open/floor/plasteel/white/side{
-	dir = 6
-	},
-/area/eventmap/inside)
-"nT" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/plasteel/white,
-/area/eventmap/inside)
-"nU" = (
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/plasteel/white/side{
-	dir = 10
-	},
-/area/eventmap/inside)
-"nV" = (
-/obj/structure/table/wood/fancy/green,
-/obj/item/clothing/head/hardhat/pumpkinhead/extra_bright,
-/obj/item/clothing/head/hardhat/pumpkinhead/extra_bright,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"nW" = (
-/obj/item/storage/box/bodybags{
-	pixel_x = 3;
-	pixel_y = 3
-	},
-/obj/structure/table/wood/fancy/black,
-/obj/item/storage/box/bodybags,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"nX" = (
-/obj/structure/table_frame/wood,
-/obj/item/scalpel,
-/obj/item/surgicaldrill,
-/obj/item/stack/sheet/mineral/wood,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"nY" = (
-/obj/item/candle/infinite,
-/obj/structure/flora/grass/jungle/b{
-	icon_state = "grassb2"
-	},
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"nZ" = (
-/obj/item/ectoplasm,
-/obj/item/organ/appendix,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"oa" = (
-/obj/effect/decal/cleanable/blood/gibs,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ob" = (
-/obj/structure/mirror{
-	icon_state = "mirror_broke";
-	pixel_x = 28
-	},
-/obj/effect/decal/cleanable/glass,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"oc" = (
-/obj/structure/bodycontainer/morgue,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"od" = (
-/obj/item/ectoplasm,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"oe" = (
-/obj/structure/bodycontainer/morgue{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"of" = (
-/obj/machinery/camera/emp_proof{
-	c_tag = "Containment - Fore Starboard";
-	dir = 8;
-	network = list("singularity")
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"og" = (
-/obj/effect/decal/cleanable/blood/tracks,
-/obj/structure/falsewall/wood,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"oh" = (
-/obj/machinery/light,
-/turf/open/floor/spooktime/cobble/sideS,
-/area/eventmap/outside)
-"oi" = (
-/obj/machinery/camera/emp_proof{
-	c_tag = "Containment - Particle Accelerator";
-	dir = 1;
-	network = list("singularity")
-	},
-/turf/open/floor/spooktime/cobble/sideS,
-/area/eventmap/outside)
-"oj" = (
-/obj/machinery/light,
-/obj/item/banner/security,
-/obj/structure/sign/departments/security{
-	pixel_y = -32
-	},
-/turf/open/floor/spooktime/cobble/sideS,
-/area/eventmap/outside)
-"ok" = (
-/obj/structure/sign/departments/security{
-	pixel_y = -32
-	},
-/obj/item/banner/security,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"ol" = (
-/obj/structure/table/wood,
-/obj/item/clothing/glasses/regular,
-/obj/item/reagent_containers/food/drinks/bottle/rum{
-	name = "Cookie's home made rum"
-	},
-/obj/effect/decal/cleanable/cobweb,
-/obj/item/candle/infinite,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"om" = (
-/obj/structure/table/wood,
-/obj/item/folder/paperwork{
-	name = "Student Debt"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"on" = (
-/obj/structure/table/wood,
-/obj/item/folder/paperwork{
-	name = "Taxes"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"oo" = (
-/obj/item/folder/paperwork{
-	name = "Taxes"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"op" = (
-/turf/open/floor/carpet/blackred,
-/area/eventmap/inside)
-"oq" = (
-/obj/structure/reagent_dispensers/water_cooler,
-/turf/open/floor/carpet/blackred,
-/area/eventmap/inside)
-"or" = (
-/obj/structure/chair/wood/wings{
-	dir = 8
-	},
-/obj/machinery/light/small,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"os" = (
-/obj/structure/table/wood/fancy,
-/obj/machinery/light/small,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ot" = (
-/obj/effect/landmark/start/botanist,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"ou" = (
-/obj/structure/table/wood,
-/obj/machinery/plantgenes/seedvault,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"ov" = (
-/obj/machinery/smartfridge/chemistry/preloaded,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"ow" = (
-/turf/open/floor/plasteel/white/side{
-	dir = 5
-	},
-/area/eventmap/inside)
-"ox" = (
-/obj/effect/landmark/start/geneticist,
-/turf/open/floor/plasteel/white,
-/area/eventmap/inside)
-"oy" = (
-/turf/open/floor/plasteel/white,
-/area/eventmap/inside)
-"oz" = (
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/plasteel/white/side{
-	dir = 9
-	},
-/area/eventmap/inside)
-"oA" = (
-/obj/item/storage/box/rxglasses,
-/obj/structure/table/wood/fancy/black,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"oB" = (
-/obj/structure/table/wood,
-/obj/item/hemostat,
-/obj/item/retractor,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"oC" = (
-/obj/structure/table/optable,
-/obj/item/soap/deluxe,
-/obj/item/razor,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"oD" = (
-/obj/structure/frame/computer{
-	dir = 1
-	},
-/obj/item/circuitboard/computer/operating,
-/obj/effect/decal/cleanable/glass,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"oE" = (
-/obj/effect/decal/cleanable/blood/tracks,
-/turf/open/floor/wood{
-	icon_state = "wood-broken"
-	},
-/area/eventmap/inside)
-"oF" = (
-/obj/effect/temp_visual/love_heart,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"oG" = (
-/obj/effect/decal/cleanable/cobweb,
-/obj/item/twohanded/required/kirbyplants/random,
-/turf/open/floor/wood{
-	icon_state = "wood-broken2"
-	},
-/area/eventmap/inside)
-"oH" = (
-/obj/structure/chair/bronze,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"oI" = (
-/obj/structure/life_candle,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"oJ" = (
-/obj/mecha/working/ripley/deathripley{
-	equipment_disabled = 1;
-	light_color = "#FAA019";
-	lights_power = 3
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"oK" = (
-/obj/structure/chair/office/dark{
-	dir = 1
-	},
-/mob/living/simple_animal/astral{
-	desc = "...Is haunting Space Station Three.";
-	name = "Carmen Miranda"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"oL" = (
-/mob/living/simple_animal/hostile/retaliate/bat{
-	attack_sound = 'sound/spookoween/ahaha.ogg';
-	attacktext = "plays at";
-	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
-	icon = 'icons/obj/musician.dmi';
-	icon_dead = "bike_horn";
-	icon_living = "bike_horn";
-	icon_state = "bike_horn";
-	melee_damage_lower = 0;
-	melee_damage_upper = 0;
-	name = "Posessed Bike Horn"
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"oM" = (
-/mob/living/simple_animal/hostile/retaliate/bat{
-	attack_sound = 'sound/spookoween/ahaha.ogg';
-	attacktext = "plays at";
-	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
-	icon = 'icons/obj/musician.dmi';
-	icon_dead = "pianobroken";
-	icon_gib = "pianobroken";
-	icon_living = "piano";
-	icon_state = "piano";
-	melee_damage_lower = 0;
-	melee_damage_upper = 0;
-	name = "Posessed piano"
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"oN" = (
-/mob/living/simple_animal/hostile/retaliate/bat{
-	attack_sound = 'sound/spookoween/ahaha.ogg';
-	attacktext = "plays at";
-	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
-	icon = 'icons/obj/musician.dmi';
-	icon_dead = "recorder";
-	icon_gib = "recorder";
-	icon_living = "recorder";
-	icon_state = "recorder";
-	melee_damage_lower = 0;
-	melee_damage_upper = 0;
-	name = "Posessed recorder"
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"oO" = (
-/obj/structure/noticeboard{
-	pixel_y = 32
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"oP" = (
-/obj/machinery/door/airlock{
-	name = "Kitchen";
-	req_access_txt = "28"
-	},
-/obj/machinery/door/firedoor,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"oQ" = (
-/obj/structure/table/wood,
-/obj/machinery/smartfridge/disks,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"oR" = (
-/obj/effect/decal/cleanable/generic,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"oS" = (
-/obj/machinery/chem_master,
-/obj/effect/decal/cleanable/dirt,
-/obj/machinery/light/small,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"oT" = (
-/obj/structure/window/reinforced{
-	dir = 1;
-	layer = 2.9
-	},
-/obj/machinery/shower{
-	dir = 4
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"oU" = (
-/obj/machinery/door/window/northleft{
-	name = "Cloning Shower";
-	req_access_txt = "24"
-	},
-/obj/structure/mirror{
-	pixel_y = -32
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"oV" = (
-/obj/structure/window/reinforced{
-	dir = 4
-	},
-/obj/machinery/door/window/northright{
-	name = "Cloning Shower"
-	},
-/obj/machinery/light/small,
-/turf/open/floor/plasteel/white/side{
-	dir = 1
-	},
-/area/eventmap/inside)
-"oW" = (
-/obj/structure/closet/secure_closet/personal/patient,
-/turf/open/floor/plasteel/white/side{
-	dir = 1
-	},
-/area/eventmap/inside)
-"oX" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"oY" = (
-/obj/structure/flora/rock/pile/icy,
-/obj/effect/wisp,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"oZ" = (
-/obj/structure/table/wood/fancy/black,
-/obj/item/gun/magic/staff/healing,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"pa" = (
-/obj/structure/table/wood,
-/obj/item/circular_saw,
-/obj/item/cautery,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"pb" = (
-/obj/machinery/light/small/built,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"pc" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/machinery/light/small/broken,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"pd" = (
-/obj/effect/decal/cleanable/dirt,
-/obj/effect/decal/cleanable/ash/crematorium,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"pe" = (
-/obj/effect/decal/cleanable/blood/gibs/old,
-/obj/item/organ/stomach,
-/obj/item/organ/heart,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"pf" = (
-/obj/item/toy/plush/narplush/hugbox,
-/obj/item/toy/toy_dagger,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"pg" = (
-/obj/structure/table/wood/fancy/green,
-/obj/item/clothing/head/hardhat/pumpkinhead/extra_bright,
-/obj/item/clothing/head/hardhat/pumpkinhead/extra_bright,
-/turf/open/floor/wood{
-	icon_state = "wood-broken2"
-	},
-/area/eventmap/inside)
-"ph" = (
-/turf/open/floor/spooktime/cobble/sideW{
-	icon_state = "cobble_side_n"
-	},
-/area/eventmap/outside)
-"pi" = (
-/obj/structure/table/wood/fancy/green,
-/obj/item/clothing/head/hardhat/pumpkinhead/jaqc,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"pj" = (
-/obj/structure/table/wood/fancy/green,
-/obj/item/gun/magic/staff/healing,
-/obj/item/gun/magic/staff/healing,
-/obj/item/gun/medbeam,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"pk" = (
-/obj/structure/life_candle,
-/turf/open/floor/wood{
-	icon_state = "wood-broken5"
-	},
-/area/eventmap/inside)
-"pl" = (
-/obj/structure/closet/cabinet,
-/obj/item/clothing/head/helmet/space/hardsuit/deathsquad,
-/obj/item/clothing/shoes/magboots/deathsquad,
-/obj/item/clothing/suit/space/hardsuit/deathsquad,
-/obj/item/circlegame,
-/obj/item/nullrod/scythe,
-/obj/item/card/id/silver/reaper,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"pm" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken6"
-	},
-/area/eventmap/inside)
-"pn" = (
-/obj/item/chair/wood/wings{
-	dir = 1
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken"
-	},
-/area/eventmap/inside)
-"po" = (
-/mob/living/simple_animal/hostile/retaliate/bat{
-	attack_sound = 'sound/spookoween/ahaha.ogg';
-	attacktext = "plays at";
-	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
-	icon = 'icons/obj/musician.dmi';
-	icon_dead = "minimoogbroken";
-	icon_gib = "minimoogbroken";
-	icon_living = "minimoog";
-	icon_state = "minimoog";
-	melee_damage_lower = 0;
-	melee_damage_upper = 0;
-	name = "Posessed minimoog"
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"pp" = (
-/obj/structure/chair/wood/wings{
-	dir = 8
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken5"
-	},
-/area/eventmap/inside)
-"pq" = (
-/obj/effect/decal/cleanable/cobweb,
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"pr" = (
-/obj/structure/closet/l3closet/janitor,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"ps" = (
-/obj/structure/table,
-/obj/item/reagent_containers/food/condiment/enzyme,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"pt" = (
-/obj/structure/table/wood,
-/obj/item/twohanded/required/kirbyplants{
-	icon_state = "plant-05"
-	},
-/obj/machinery/light/small{
-	dir = 8
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"pu" = (
-/obj/effect/spawner/trap,
-/turf/open/indestructible/airblock,
-/area/eventmap/mountaininside)
-"pv" = (
-/obj/structure/table,
-/obj/machinery/reagentgrinder,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/mountaininside)
-"pw" = (
-/obj/structure/table,
-/obj/machinery/light/small{
-	dir = 1
-	},
-/obj/item/storage/box/ingredients/carnivore,
-/obj/item/reagent_containers/food/condiment/enzyme,
-/obj/item/reagent_containers/food/condiment/enzyme,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"px" = (
-/obj/structure/sink/kitchen{
-	pixel_y = 28
-	},
-/obj/structure/closet/crate/bin{
-	storage_capacity = 300
-	},
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"py" = (
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"pz" = (
-/obj/machinery/camera/emp_proof{
-	c_tag = "Containment - Fore Starboard";
-	dir = 8;
-	network = list("singularity")
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"pA" = (
-/obj/machinery/door/airlock{
-	name = "Hydroponics Backroom";
-	req_access_txt = "35"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"pB" = (
-/obj/effect/decal/cleanable/dirt,
-/obj/machinery/door/airlock/medical/glass{
-	name = "Old Chemistry Lab"
-	},
-/obj/machinery/door/firedoor,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"pC" = (
-/mob/living/simple_animal/hostile/retaliate/bat{
-	attack_sound = 'sound/spookoween/ahaha.ogg';
-	attacktext = "plays at";
-	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
-	icon = 'icons/obj/musician.dmi';
-	icon_dead = "xylophone-broken";
-	icon_gib = "xylophone-broken";
-	icon_living = "xylophone";
-	icon_state = "xylophone";
-	melee_damage_lower = 0;
-	melee_damage_upper = 0;
-	name = "Posessed xylophone"
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"pD" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/mob/living/simple_animal/hostile/retaliate/bat{
-	attack_sound = 'sound/spookoween/ahaha.ogg';
-	attacktext = "plays at";
-	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
-	icon = 'icons/obj/musician.dmi';
-	icon_dead = "accordion";
-	icon_gib = "accordion";
-	icon_living = "accordion";
-	icon_state = "accordion";
-	melee_damage_lower = 0;
-	melee_damage_upper = 0;
-	name = "Posessed accordion"
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"pE" = (
-/obj/structure/table/wood,
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"pF" = (
-/obj/structure/chair/sofa/left{
-	dir = 4
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"pG" = (
-/turf/open/floor/light/colour_cycle/dancefloor_a,
-/area/eventmap/inside)
-"pH" = (
-/obj/machinery/button/door/dorms/luxury3{
-	id = "C02";
-	pixel_y = -24
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"pI" = (
-/obj/effect/landmark/start/cook,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"pJ" = (
-/obj/structure/table/reinforced,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"pK" = (
-/obj/machinery/vending/hydroseeds,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"pL" = (
-/obj/structure/sign/departments/chemistry{
-	pixel_y = 32
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"pM" = (
-/obj/structure/sign/departments/medbay/alt{
-	pixel_y = 32
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"pN" = (
-/obj/structure/barricade/wooden,
-/obj/structure/spacevine,
-/obj/structure/mineral_door/woodrustic,
-/turf/open/floor/carpet/green,
-/area/eventmap/inside)
-"pO" = (
-/obj/structure/mineral_door/wood,
-/turf/open/floor/carpet/green,
-/area/eventmap/inside)
-"pP" = (
-/obj/item/stack/sheet/mineral/wood,
-/turf/open/floor/carpet/green,
-/area/eventmap/inside)
-"pQ" = (
-/mob/living/simple_animal/hostile/retaliate/bat,
-/turf/open/floor/carpet/green,
-/area/eventmap/inside)
-"pR" = (
-/turf/open/floor/spooktime/cobble,
-/area/eventmap/outside)
-"pS" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/carpet/blackred,
-/area/eventmap/inside)
-"pT" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/mob/living/simple_animal/hostile/retaliate/bat{
-	attack_sound = 'sound/spookoween/ahaha.ogg';
-	attacktext = "plays at";
-	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
-	icon = 'icons/obj/musician.dmi';
-	icon_dead = "harmonica";
-	icon_gib = "harmonica";
-	icon_living = "harmonica";
-	icon_state = "harmonica";
-	melee_damage_lower = 0;
-	melee_damage_upper = 0;
-	name = "Posessed harmonica"
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"pU" = (
-/mob/living/simple_animal/hostile/retaliate/bat{
-	attack_sound = 'sound/spookoween/ahaha.ogg';
-	attacktext = "plays at";
-	desc = "A spooky, floating instrument possesed by some specture! Wooo~!";
-	icon = 'icons/obj/musician.dmi';
-	icon_dead = "trombone";
-	icon_gib = "trombone";
-	icon_living = "trombone";
-	icon_state = "trombone";
-	melee_damage_lower = 0;
-	melee_damage_upper = 0;
-	name = "Posessed trombone"
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"pV" = (
-/obj/structure/chair/sofa{
-	dir = 4
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"pW" = (
-/obj/structure/table,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"pX" = (
-/obj/structure/table,
-/obj/item/storage/box/ingredients/delights,
-/obj/item/storage/box/ingredients/exotic,
-/obj/item/storage/box/ingredients/italian,
-/obj/item/storage/box/ingredients/grains,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"pY" = (
-/obj/structure/sink{
-	dir = 8;
-	pixel_x = -12
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"pZ" = (
-/obj/machinery/vending/hydronutrients,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"qa" = (
-/obj/structure/closet/secure_closet/hydroponics,
-/obj/machinery/camera/emp_proof{
-	c_tag = "Containment - Fore Port";
-	dir = 4;
-	network = list("singularity")
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"qb" = (
-/obj/structure/sign/departments/botany{
-	pixel_x = -32
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"qc" = (
-/mob/living/simple_animal/hostile/retaliate/bat{
-	desc = "A spookster!";
-	icon_state = "flan0";
-	name = "Name"
-	},
-/turf/open/floor/carpet/green,
-/area/eventmap/inside)
-"qd" = (
-/obj/machinery/deepfryer,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"qe" = (
-/obj/machinery/smartfridge/food,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"qf" = (
-/obj/machinery/light/small{
-	dir = 8
-	},
-/obj/structure/closet/secure_closet/hydroponics,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"qg" = (
-/obj/structure/sign/departments/restroom{
-	pixel_y = -32
-	},
-/obj/machinery/camera/emp_proof{
-	c_tag = "Containment - Particle Accelerator";
-	dir = 1;
-	network = list("singularity")
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"qh" = (
-/obj/structure/barricade/wooden,
-/turf/open/floor/carpet/green,
-/area/eventmap/inside)
-"qi" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/carpet/green,
-/area/eventmap/inside)
-"qj" = (
-/obj/item/twohanded/required/kirbyplants/random,
-/turf/open/floor/carpet/blackred,
-/area/eventmap/inside)
-"qk" = (
-/obj/structure/piano{
-	icon_state = "piano"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ql" = (
-/obj/structure/chair/wood/wings{
-	dir = 8;
-	icon_state = "brass_chair"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"qm" = (
-/obj/structure/table/reinforced,
-/obj/item/storage/box/ingredients/delights,
-/obj/item/reagent_containers/food/condiment/soysauce,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"qn" = (
-/obj/structure/table/reinforced,
-/obj/item/storage/box/ingredients/carnivore,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"qo" = (
-/obj/structure/table/reinforced,
-/obj/item/storage/box/ingredients/american,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"qp" = (
-/obj/structure/table/reinforced,
-/obj/item/storage/box/donkpockets,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"qq" = (
-/obj/structure/table/reinforced,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"qr" = (
-/obj/machinery/vending/boozeomat/all_access,
-/turf/closed/wall/mineral/wood,
-/area/eventmap/inside)
-"qs" = (
-/obj/structure/chair/sofa/right{
-	dir = 4
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"qt" = (
-/obj/structure/noticeboard{
-	dir = 8;
-	pixel_x = 32
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"qu" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/structure/falsewall/wood,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"qv" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/mob/living/simple_animal/shade/howling_ghost,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"qw" = (
-/turf/open/floor/carpet/monochrome,
-/area/eventmap/inside)
-"qx" = (
-/mob/living/simple_animal/hostile/retaliate/bat,
-/turf/open/floor/carpet/monochrome,
-/area/eventmap/inside)
-"qy" = (
-/obj/structure/mineral_door/wood,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"qz" = (
-/obj/machinery/deepfryer,
-/turf/open/floor/plasteel/vaporwave,
-/area/eventmap/inside)
-"qA" = (
-/turf/open/floor/plasteel/vaporwave,
-/area/eventmap/inside)
-"qB" = (
-/obj/structure/reagent_dispensers/keg/milk,
-/turf/open/floor/plasteel/vaporwave,
-/area/eventmap/inside)
-"qC" = (
-/obj/structure/sink/kitchen{
-	pixel_y = 28
-	},
-/turf/open/floor/plasteel/vaporwave,
-/area/eventmap/inside)
-"qD" = (
-/obj/machinery/door/airlock{
-	name = "Bar Staff Entrance";
-	req_access_txt = "25"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"qE" = (
-/obj/structure/reagent_dispensers/watertank/high,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"qF" = (
-/obj/machinery/processor,
-/obj/machinery/light/small,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"qG" = (
-/obj/structure/noticeboard{
-	dir = 1;
-	pixel_y = -32
-	},
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/structure/closet/secure_closet/freezer/fridge,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"qH" = (
-/obj/structure/reagent_dispensers/watertank/high,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"qI" = (
-/obj/machinery/light,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"qJ" = (
-/obj/structure/fermenting_barrel,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"qK" = (
-/obj/structure/closet/crate/hydroponics,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"qL" = (
-/obj/structure/beebox/unwrenched,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"qM" = (
-/obj/structure/table,
-/obj/effect/decal/cleanable/cobweb,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"qN" = (
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"qO" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"qP" = (
-/obj/machinery/dna_scannernew,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"qQ" = (
-/obj/machinery/computer/prototype_cloning,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"qR" = (
-/obj/machinery/clonepod/experimental,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"qS" = (
-/obj/structure/showcase/horrific_experiment,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"qT" = (
-/obj/machinery/light/small{
-	dir = 1
-	},
-/obj/structure/toilet{
-	dir = 4
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"qU" = (
-/obj/machinery/door/airlock{
-	name = "Toilet Unit"
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"qV" = (
-/obj/machinery/light/small{
-	dir = 1
-	},
-/obj/structure/toilet{
-	dir = 8
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"qW" = (
-/obj/structure/table/wood/fancy/green,
-/obj/item/clothing/head/hardhat/pumpkinhead/jaqc,
-/turf/open/floor/wood{
-	icon_state = "wood-broken5"
-	},
-/area/eventmap/inside)
-"qX" = (
-/obj/structure/table/wood/fancy/blackred,
-/obj/item/reagent_containers/food/snacks/grown/tomato/blood,
-/obj/item/reagent_containers/food/snacks/grown/tomato/blood,
-/obj/item/reagent_containers/food/snacks/grown/tomato/blood,
-/obj/item/candle/infinite,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"qY" = (
-/obj/structure/table/wood/fancy/blackred,
-/obj/item/reagent_containers/food/snacks/soup/blood,
-/obj/item/reagent_containers/food/snacks/soup/blood,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"qZ" = (
-/obj/structure/table/reinforced,
-/obj/item/candle/infinite,
-/obj/item/reagent_containers/food/condiment/sugar,
-/turf/open/floor/plasteel/vaporwave,
-/area/eventmap/inside)
-"ra" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"rb" = (
-/obj/structure/chair/wood,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"rc" = (
-/obj/structure/sign/barsign,
-/turf/closed/wall/mineral/wood,
-/area/eventmap/inside)
-"rd" = (
-/obj/machinery/door/airlock/freezer,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"re" = (
-/obj/machinery/smartfridge/food,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"rf" = (
-/obj/machinery/door/airlock{
-	name = "Bar Backroom";
-	req_access_txt = "25"
-	},
-/obj/machinery/door/firedoor,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"rg" = (
-/obj/structure/table,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"rh" = (
-/obj/machinery/atmospherics/pipe/simple{
-	dir = 5
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"ri" = (
-/obj/machinery/atmospherics/pipe/simple{
-	dir = 8
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"rj" = (
-/obj/machinery/atmospherics/pipe/simple{
-	dir = 9
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"rk" = (
-/obj/machinery/light/small{
-	dir = 8
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"rl" = (
-/obj/structure/table/wood,
-/obj/item/toy/cards/deck/cas,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"rm" = (
-/obj/machinery/light/small{
-	dir = 4;
-	light_color = "#d8b1b1"
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"rn" = (
-/obj/item/toy/plush/plushvar,
-/obj/item/toy/clockwork_watch,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ro" = (
-/obj/structure/chair/comfy{
-	dir = 1;
-	icon_state = "shuttle_chair"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"rp" = (
-/obj/item/twohanded/required/kirbyplants/random,
-/turf/open/floor/wood{
-	icon_state = "wood-broken6"
-	},
-/area/eventmap/inside)
-"rq" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/carpet/monochrome,
-/area/eventmap/inside)
-"rr" = (
-/obj/structure/closet/crate/freezer/blood,
-/turf/open/floor/wood{
-	icon_state = "wood-broken2"
-	},
-/area/eventmap/inside)
-"rs" = (
-/obj/structure/chair/wood/wings,
-/mob/living/simple_animal/hostile/retaliate/bat,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"rt" = (
-/obj/structure/chair/wood/wings,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"ru" = (
-/obj/structure/chair/wood/wings,
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"rv" = (
-/obj/structure/table/reinforced,
-/obj/item/storage/bag/tray,
-/obj/item/reagent_containers/food/snacks/kebab/human,
-/obj/item/reagent_containers/food/snacks/kebab/human,
-/obj/item/reagent_containers/food/snacks/kebab/human,
-/turf/open/floor/plasteel/vaporwave,
-/area/eventmap/inside)
-"rw" = (
-/obj/structure/closet/secure_closet/personal,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"rx" = (
-/obj/structure/table,
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ry" = (
-/obj/structure/table,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"rz" = (
-/obj/structure/table,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"rA" = (
-/obj/machinery/shower{
-	dir = 8
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"rB" = (
-/obj/structure/chair,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"rC" = (
-/obj/machinery/light{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"rD" = (
-/obj/structure/table/wood,
-/obj/machinery/computer/security/wooden_tv{
-	pixel_y = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"rE" = (
-/obj/structure/table/wood,
-/obj/item/reagent_containers/food/snacks/donut/chaos,
-/obj/item/reagent_containers/food/snacks/donut/jelly{
-	pixel_x = 4;
-	pixel_y = 2
-	},
-/obj/item/reagent_containers/food/snacks/donut{
-	pixel_x = -3;
-	pixel_y = 5
-	},
-/obj/item/reagent_containers/food/snacks/donut{
-	pixel_x = -2;
-	pixel_y = -4
-	},
-/obj/item/reagent_containers/food/snacks/donut{
-	pixel_x = -4
-	},
-/obj/item/reagent_containers/food/snacks/donut{
-	pixel_x = 5;
-	pixel_y = -1
-	},
-/obj/item/toy/plush/mammal/redtail{
-	pixel_y = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"rF" = (
-/obj/structure/table,
-/obj/item/watertank/janitor,
-/obj/item/mop/advanced,
-/obj/item/grenade/chem_grenade/cleaner,
-/obj/item/grenade/chem_grenade/cleaner,
-/obj/item/grenade/chem_grenade/cleaner,
-/obj/item/grenade/chem_grenade/cleaner,
-/obj/item/grenade/chem_grenade/cleaner,
-/obj/item/grenade/chem_grenade/cleaner,
-/obj/item/grenade/chem_grenade/cleaner,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"rG" = (
-/obj/structure/janitorialcart,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"rH" = (
-/obj/item/twohanded/required/kirbyplants{
-	icon_state = "plant-05"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"rI" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"rJ" = (
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"rK" = (
-/obj/structure/window/reinforced/spawner/east,
-/obj/structure/kitchenspike,
-/obj/effect/decal/cleanable/cobweb/cobweb2,
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"rL" = (
-/obj/structure/sink/kitchen{
-	pixel_y = 28
-	},
-/obj/machinery/light/small{
-	dir = 4
-	},
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"rM" = (
-/obj/machinery/smartfridge/drinks,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"rN" = (
-/obj/structure/closet/secure_closet/bar,
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"rO" = (
-/obj/structure/table/optable,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"rP" = (
-/obj/effect/decal/cleanable/cobweb{
-	icon_state = "stickyweb2"
-	},
-/obj/structure/falsewall/wood,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"rQ" = (
-/obj/structure/table/wood/fancy/blackred,
-/obj/item/trash/plate,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"rR" = (
-/obj/structure/table/reinforced,
-/obj/item/storage/bag/tray,
-/obj/item/reagent_containers/food/snacks/pie/pumpkinpie,
-/turf/open/floor/plasteel/vaporwave,
-/area/eventmap/inside)
-"rS" = (
-/obj/structure/closet/secure_closet/freezer/fridge,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/soymilk,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/flour,
-/obj/item/reagent_containers/food/condiment/rice,
-/obj/item/reagent_containers/food/condiment/rice,
-/obj/item/reagent_containers/food/condiment/rice,
-/obj/item/storage/fancy/egg_box,
-/obj/item/storage/fancy/egg_box,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"rT" = (
-/obj/structure/table/reinforced,
-/obj/machinery/dish_drive,
-/obj/item/reagent_containers/food/condiment/enzyme,
-/turf/open/floor/plasteel/vaporwave,
-/area/eventmap/inside)
-"rU" = (
-/obj/structure/table/reinforced,
-/obj/machinery/reagentgrinder,
-/turf/open/floor/plasteel/vaporwave,
-/area/eventmap/inside)
-"rV" = (
-/obj/structure/table/reinforced,
-/obj/item/storage/box/condimentbottles,
-/turf/open/floor/plasteel/vaporwave,
-/area/eventmap/inside)
-"rW" = (
-/obj/structure/table/reinforced,
-/obj/item/storage/box/ingredients/wildcard,
-/obj/item/storage/box/ingredients/vegetarian,
-/turf/open/floor/plasteel/vaporwave,
-/area/eventmap/inside)
-"rX" = (
-/obj/structure/table/reinforced,
-/obj/item/storage/box/ingredients/sweets,
-/obj/item/storage/box/ingredients/italian,
-/turf/open/floor/plasteel/vaporwave,
-/area/eventmap/inside)
-"rY" = (
-/obj/structure/table/reinforced,
-/obj/item/storage/box/ingredients/grains,
-/obj/item/storage/box/ingredients/fruity,
-/turf/open/floor/plasteel/vaporwave,
-/area/eventmap/inside)
-"rZ" = (
-/obj/structure/table/reinforced,
-/obj/item/storage/box/ingredients/fiesta,
-/obj/item/storage/box/ingredients/exotic,
-/turf/open/floor/plasteel/vaporwave,
-/area/eventmap/inside)
-"sa" = (
-/obj/structure/table,
-/obj/structure/bedsheetbin/towel,
-/obj/machinery/light/small{
-	dir = 8
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"sb" = (
-/obj/machinery/shower{
-	dir = 8
-	},
-/obj/item/soap,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"sc" = (
-/obj/structure/chair{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sd" = (
-/obj/effect/landmark/start/detective,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"se" = (
-/obj/structure/table/wood/bar,
-/obj/machinery/recharger,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sf" = (
-/obj/structure/chair/office/dark{
-	dir = 8
-	},
-/obj/effect/landmark/start/depsec/supply,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sg" = (
-/obj/structure/table/wood/fancy/orange,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sh" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/machinery/vending/games,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"si" = (
-/obj/machinery/door/airlock{
-	name = "Bar Backroom";
-	req_access_txt = "25"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sj" = (
-/obj/machinery/door/airlock{
-	name = "Bar Storage";
-	req_access_txt = "25"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sk" = (
-/obj/structure/barricade/wooden/crude,
-/obj/effect/spawner/structure/window,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sl" = (
-/obj/effect/decal/cleanable/cobweb{
-	icon_state = "stickyweb2"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sm" = (
-/obj/structure/easel,
-/obj/item/paper/pamphlet/ruin/originalcontent/yelling,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sn" = (
-/obj/structure/chair/wood/wings{
-	dir = 4;
-	icon_state = "brass_chair"
-	},
-/mob/living/simple_animal/hostile/retaliate/bat,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"so" = (
-/obj/structure/table/wood/fancy/blackred,
-/obj/item/candle/infinite,
-/obj/item/reagent_containers/food/condiment/saltshaker,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"sp" = (
-/obj/structure/table/wood/fancy/blackred,
-/obj/item/candle/infinite,
-/obj/item/reagent_containers/food/condiment/peppermill,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"sq" = (
-/obj/structure/table/wood/fancy/blackred,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"sr" = (
-/obj/structure/table/reinforced,
-/obj/item/storage/bag/tray,
-/obj/item/reagent_containers/food/snacks/store/cake/pumpkinspice,
-/turf/open/floor/plasteel/vaporwave,
-/area/eventmap/inside)
-"ss" = (
-/obj/structure/table/reinforced,
-/obj/machinery/microwave,
-/turf/open/floor/plasteel/vaporwave,
-/area/eventmap/inside)
-"st" = (
-/obj/structure/mineral_door/iron,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"su" = (
-/obj/structure/table,
-/obj/structure/window/reinforced/tinted,
-/obj/item/reagent_containers/rag/towel,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"sv" = (
-/obj/machinery/shower{
-	dir = 8
-	},
-/obj/structure/window/reinforced/tinted,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"sw" = (
-/obj/structure/chair/sofa/left,
-/obj/effect/landmark/start/quartermaster,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sx" = (
-/obj/machinery/shower{
-	desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well...";
-	pixel_y = 24
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"sy" = (
-/obj/machinery/camera/emp_proof{
-	c_tag = "Containment - Particle Accelerator";
-	dir = 1;
-	network = list("singularity")
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sz" = (
-/obj/structure/window/reinforced/spawner/east,
-/obj/structure/kitchenspike,
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"sA" = (
-/obj/machinery/icecream_vat,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"sB" = (
-/obj/machinery/vending/wardrobe/chef_wardrobe,
-/obj/machinery/camera/emp_proof{
-	c_tag = "Containment - Fore Starboard";
-	dir = 8;
-	network = list("singularity")
-	},
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"sC" = (
-/obj/structure/reagent_dispensers/keg/semen,
-/obj/machinery/light/small,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sD" = (
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/mineral/titanium/white{
-	name = "padded floor"
-	},
-/area/eventmap/inside)
-"sE" = (
-/turf/open/floor/mineral/titanium/white{
-	name = "padded floor"
-	},
-/area/eventmap/inside)
-"sF" = (
-/obj/machinery/light/small{
-	dir = 1
-	},
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/mineral/titanium/white{
-	name = "padded floor"
-	},
-/area/eventmap/inside)
-"sG" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/mineral/titanium/white{
-	name = "padded floor"
-	},
-/area/eventmap/inside)
-"sH" = (
-/obj/machinery/light/small/broken{
-	dir = 1
-	},
-/obj/effect/decal/cleanable/cobweb,
-/obj/effect/decal/cleanable/glass,
-/turf/open/floor/mineral/titanium/white{
-	name = "padded floor"
-	},
-/area/eventmap/inside)
-"sI" = (
-/obj/item/bodypart/head,
-/obj/item/clothing/head/collectable/kitty,
-/obj/item/clothing/mask/scarecrow,
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "gibbearcore"
-	},
-/obj/item/stamp/ce,
-/turf/open/floor/mineral/titanium/white{
-	name = "padded floor"
-	},
-/area/eventmap/inside)
-"sJ" = (
-/obj/machinery/light/small{
-	dir = 1
-	},
-/obj/item/reagent_containers/glass/bowl,
-/obj/item/clothing/neck/petcollar,
-/turf/open/floor/mineral/titanium/white{
-	name = "padded floor"
-	},
-/area/eventmap/inside)
-"sK" = (
-/obj/machinery/shower{
-	desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well...";
-	dir = 4
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"sL" = (
-/obj/structure/table/wood,
-/obj/structure/bedsheetbin/towel,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"sM" = (
-/obj/structure/table/wood,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"sN" = (
-/obj/structure/closet/secure_closet/personal/cabinet,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sO" = (
-/obj/structure/sign/plaques/deempisi{
-	pixel_y = 32
-	},
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sP" = (
-/obj/structure/bed,
-/obj/item/bedsheet/random,
-/obj/machinery/button/door/dorms/patient1,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sQ" = (
-/obj/item/toy/crayon/red,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sR" = (
-/obj/item/paint/anycolor,
-/obj/item/toy/crayon/rainbow,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sS" = (
-/obj/item/stack/spacecash/c20,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sT" = (
-/obj/item/paper/crumpled/ruins/originalcontent,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sU" = (
-/obj/item/paint/anycolor,
-/obj/item/toy/crayon/green,
-/turf/open/floor/wood{
-	icon_state = "wood-broken3"
-	},
-/area/eventmap/inside)
-"sV" = (
-/obj/item/toy/crayon/purple,
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sW" = (
-/obj/item/paint/anycolor,
-/obj/item/stack/spacecash/c50,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sX" = (
-/obj/item/paint/anycolor,
-/obj/item/toy/crayon/blue,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sY" = (
-/obj/item/toy/crayon/white,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"sZ" = (
-/obj/item/stack/spacecash/c1,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ta" = (
-/obj/item/paint/anycolor,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"tb" = (
-/obj/item/stack/spacecash/c500,
-/obj/item/toy/crayon/mime,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"tc" = (
-/obj/item/toy/crayon/rainbow,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"td" = (
-/obj/structure/table/reinforced,
-/obj/item/storage/bag/tray,
-/obj/item/reagent_containers/food/snacks/burger/ghost,
-/obj/item/reagent_containers/food/snacks/burger/ghost,
-/obj/item/reagent_containers/food/snacks/burger/ghost,
-/turf/open/floor/plasteel/vaporwave,
-/area/eventmap/inside)
-"te" = (
-/obj/machinery/icecream_vat{
-	name = "Spooky ice cream vat"
-	},
-/obj/item/toy/snowball,
-/obj/effect/turf_decal/weather/snow/corner{
-	dir = 9
-	},
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"tf" = (
-/obj/structure/fluff/snowlegion,
-/obj/effect/turf_decal/weather/snow/corner,
-/obj/effect/turf_decal/weather/snow/corner{
-	dir = 1
-	},
-/turf/open/floor/spooktime/snow,
-/area/eventmap/inside)
-"tg" = (
-/obj/structure/reagent_dispensers/cooking_oil{
-	name = "Chilled vat of hatmium";
-	reagent_id = "hatmium"
-	},
-/obj/effect/turf_decal/weather/snow/corner{
-	dir = 1
-	},
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"th" = (
-/obj/machinery/gibber/autogibber,
-/obj/effect/turf_decal/weather/snow/corner{
-	dir = 1
-	},
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"ti" = (
-/obj/structure/kitchenspike,
-/obj/item/toy/snowball,
-/obj/effect/turf_decal/weather/snow/corner{
-	dir = 1
-	},
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"tj" = (
-/obj/effect/turf_decal/weather/snow/corner{
-	dir = 5
-	},
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"tk" = (
-/turf/closed/wall/mineral/snow,
-/area/eventmap/inside)
-"tl" = (
-/obj/structure/closet/athletic_mixed,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"tm" = (
-/obj/structure/closet/athletic_mixed,
-/obj/structure/window/reinforced/tinted{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"tn" = (
-/obj/machinery/light,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"to" = (
-/obj/machinery/door/airlock{
-	name = "Unisex Showers"
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"tp" = (
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "floor4-old"
-	},
-/turf/open/floor/mineral/titanium/white{
-	name = "padded floor"
-	},
-/area/eventmap/inside)
-"tq" = (
-/obj/structure/table/reinforced,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"tr" = (
-/obj/machinery/smartfridge/drinks,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"ts" = (
-/obj/machinery/vending/boozeomat/all_access,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"tt" = (
-/obj/item/organ/heart,
-/obj/effect/decal/cleanable/blood/gibs/old,
-/turf/open/floor/mineral/titanium/white{
-	name = "padded floor"
-	},
-/area/eventmap/inside)
-"tu" = (
-/obj/item/pet_carrier,
-/obj/item/reagent_containers/glass/bottle/hexacrocin,
-/obj/effect/decal/cleanable/semen,
-/turf/open/floor/mineral/titanium/white,
-/area/eventmap/inside)
-"tv" = (
-/obj/item/toy/tennis/red,
-/turf/open/floor/mineral/titanium/white,
-/area/eventmap/inside)
-"tw" = (
-/obj/structure/bed,
-/obj/effect/spawner/lootdrop/bedsheet,
-/obj/machinery/light/small,
-/mob/living/carbon/human/species/zombie{
-	icon_state = "zombie";
-	lying = 1;
-	name = "Romerol";
-	name_override = "Romerol";
-	resting = 1
-	},
-/mob/living/carbon/human/species/zombie{
-	gender = "female";
-	icon_state = "zombie";
-	lying = 1;
-	name = "Juliet";
-	name_override = "Juliet";
-	resting = 1
-	},
-/turf/open/floor/clockwork/reebe,
-/area/eventmap/inside)
-"tx" = (
-/obj/machinery/light/small{
-	dir = 4
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"ty" = (
-/obj/machinery/door/airlock/wood/dorms/patient1,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"tz" = (
-/obj/structure/table/wood/fancy/blackred,
-/obj/item/reagent_containers/blood/random,
-/obj/item/reagent_containers/blood/random,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"tA" = (
-/obj/structure/chair/wood/wings{
-	dir = 1
-	},
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/mob/living/simple_animal/hostile/retaliate/bat,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"tB" = (
-/obj/structure/chair/wood/wings{
-	dir = 1
-	},
-/mob/living/simple_animal/hostile/retaliate/bat,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"tC" = (
-/obj/structure/table/reinforced,
-/obj/item/storage/bag/tray,
-/obj/item/reagent_containers/food/snacks/candiedapple,
-/obj/item/reagent_containers/food/snacks/candiedapple,
-/obj/item/reagent_containers/food/snacks/candy,
-/obj/item/reagent_containers/food/snacks/candy_corn,
-/obj/item/reagent_containers/food/snacks/candyheart,
-/obj/item/reagent_containers/food/snacks/chocolatebanana,
-/obj/item/reagent_containers/food/snacks/chocolatebanana,
-/obj/item/reagent_containers/food/snacks/sugarcookie/spookycoffin,
-/obj/item/reagent_containers/food/snacks/sugarcookie/spookyskull,
-/turf/open/floor/plasteel/vaporwave,
-/area/eventmap/inside)
-"tD" = (
-/obj/effect/turf_decal/weather/snow/corner{
-	dir = 8
-	},
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"tE" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"tF" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/effect/turf_decal/weather/snow/corner{
-	dir = 4
-	},
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"tG" = (
-/obj/machinery/door/airlock/security/glass{
-	name = "Security Office";
-	req_access_txt = "63"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"tH" = (
-/obj/machinery/door/airlock/security/glass{
-	name = "Security Desk";
-	req_access_txt = "63"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"tI" = (
-/obj/structure/curtain{
-	color = "#B22222"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"tJ" = (
-/obj/structure/mirror{
-	icon_state = "mirror_broke";
-	pixel_x = 28
-	},
-/obj/structure/sink{
-	dir = 4;
-	pixel_x = 11
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"tK" = (
-/obj/structure/closet/chefcloset,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"tL" = (
-/obj/machinery/recharge_station,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"tM" = (
-/obj/machinery/food_cart,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"tN" = (
-/obj/machinery/chem_dispenser/drinks/beer/fullupgrade{
-	dir = 4
-	},
-/obj/structure/table/wood/fancy/orange,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"tO" = (
-/obj/machinery/camera/emp_proof,
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"tP" = (
-/obj/machinery/door/airlock{
-	name = "Bar Staff Entrance";
-	req_access_txt = "25"
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"tQ" = (
-/obj/machinery/door/airlock/wood/glass,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"tR" = (
-/obj/machinery/door/airlock/wood/glass,
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"tS" = (
-/obj/machinery/door/airlock/wood/glass,
-/obj/effect/decal/cleanable/blood/old,
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"tT" = (
-/obj/item/toy/crayon/black,
-/turf/open/floor/wood{
-	icon_state = "wood-broken6"
-	},
-/area/eventmap/inside)
-"tU" = (
-/obj/item/paint/anycolor,
-/obj/item/toy/crayon/white,
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"tV" = (
-/obj/item/toy/crayon/spraycan/infinite{
-	icon_state = "deathcan2_cap"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"tW" = (
-/obj/item/paint/anycolor,
-/obj/item/stack/spacecash/c100,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"tX" = (
-/obj/item/paper/crumpled/ruins/originalcontent,
-/obj/item/toy/crayon/orange,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"tY" = (
-/mob/living/carbon/monkey{
-	color = "#009900";
-	icon_state = "monkey1";
-	name = "Painting Goblin"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"tZ" = (
-/obj/item/paint/anycolor,
-/obj/item/toy/crayon/yellow,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ua" = (
-/obj/item/paint/anycolor,
-/obj/item/stack/spacecash/c20,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ub" = (
-/obj/item/paper/crumpled/ruins/originalcontent,
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"uc" = (
-/obj/item/toy/crayon/blue,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ud" = (
-/obj/item/paint/anycolor,
-/obj/item/toy/crayon/purple,
-/turf/open/floor/wood{
-	icon_state = "wood-broken5"
-	},
-/area/eventmap/inside)
-"ue" = (
-/obj/item/stack/spacecash/c50,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"uf" = (
-/obj/structure/table/wood/fancy/blackred,
-/obj/item/reagent_containers/blood/random,
-/obj/item/reagent_containers/blood/random,
-/obj/item/reagent_containers/blood/random,
-/obj/item/candle/infinite,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ug" = (
-/obj/structure/table/reinforced,
-/obj/item/candle/infinite,
-/turf/open/floor/plasteel/vaporwave,
-/area/eventmap/inside)
-"uh" = (
-/obj/machinery/vending/dinnerware,
-/turf/open/floor/plasteel/vaporwave,
-/area/eventmap/inside)
-"ui" = (
-/obj/structure/closet/secure_closet/freezer/fridge,
-/obj/effect/turf_decal/weather/snow/corner{
-	dir = 8
-	},
-/obj/item/organ/liver,
-/obj/item/organ/liver,
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"uj" = (
-/obj/structure/closet/secure_closet/freezer/fridge,
-/obj/effect/turf_decal/weather/snow/corner,
-/obj/item/organ/heart,
-/obj/item/organ/heart,
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"uk" = (
-/obj/structure/closet/secure_closet/freezer/fridge,
-/obj/item/reagent_containers/food/snacks/snowcones/apple,
-/obj/item/reagent_containers/food/snacks/snowcones/blue,
-/obj/item/reagent_containers/food/snacks/snowcones/clown,
-/obj/item/reagent_containers/food/snacks/snowcones/fruitsalad,
-/obj/item/reagent_containers/food/snacks/snowcones/grape,
-/obj/item/reagent_containers/food/snacks/snowcones/honey,
-/obj/item/reagent_containers/food/snacks/snowcones/kiwi,
-/obj/item/reagent_containers/food/snacks/snowcones/lemon,
-/obj/item/reagent_containers/food/snacks/snowcones/lime,
-/obj/item/reagent_containers/food/snacks/snowcones/mime,
-/obj/item/reagent_containers/food/snacks/snowcones/mix,
-/obj/item/reagent_containers/food/snacks/snowcones/orange,
-/obj/item/reagent_containers/food/snacks/snowcones/peach,
-/obj/item/reagent_containers/food/snacks/snowcones/pineapple,
-/obj/item/reagent_containers/food/snacks/snowcones/pwgrmer,
-/obj/item/reagent_containers/food/snacks/snowcones/rainbow,
-/obj/item/reagent_containers/food/snacks/snowcones/red,
-/obj/item/reagent_containers/food/snacks/snowcones/soda,
-/obj/item/reagent_containers/food/snacks/snowcones/strawberry,
-/obj/effect/turf_decal/weather/snow/corner,
-/obj/effect/turf_decal/weather/snow/corner,
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"ul" = (
-/obj/structure/fluff/snowlegion,
-/obj/effect/turf_decal/weather/snow/corner,
-/obj/effect/turf_decal/weather/snow/corner,
-/turf/open/floor/spooktime/snow,
-/area/eventmap/inside)
-"um" = (
-/obj/structure/closet/secure_closet/freezer/cream_pie,
-/obj/item/reagent_containers/food/snacks/pie/cream,
-/obj/item/reagent_containers/food/snacks/pie/cream,
-/obj/effect/turf_decal/weather/snow/corner,
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"un" = (
-/obj/structure/closet/secure_closet/freezer/cream_pie,
-/obj/item/reagent_containers/food/snacks/pie/cream,
-/obj/item/reagent_containers/food/snacks/pie/cream,
-/obj/effect/turf_decal/weather/snow/corner,
-/obj/effect/turf_decal/weather/snow/corner{
-	dir = 6
-	},
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"uo" = (
-/obj/structure/closet/secure_closet/injection,
-/obj/effect/decal/cleanable/cobweb,
-/obj/effect/decal/cleanable/generic,
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/item/stamp/hos,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"up" = (
-/obj/effect/decal/cleanable/cobweb,
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/machinery/light/small/broken{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"uq" = (
-/obj/structure/chair/e_chair,
-/obj/effect/decal/cleanable/ash/large,
-/obj/effect/decal/cleanable/generic,
-/obj/effect/decal/cleanable/glass{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ur" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/effect/decal/cleanable/ash/crematorium,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"us" = (
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "splatter1"
-	},
-/obj/item/twohanded/required/kirbyplants/random,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ut" = (
-/obj/machinery/chem_dispenser/drinks/fullupgrade{
-	dir = 4
-	},
-/obj/structure/table/wood/fancy/orange,
-/obj/machinery/light/small{
-	dir = 8
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"uu" = (
-/obj/effect/landmark/start/bartender,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"uv" = (
-/obj/structure/noticeboard{
-	pixel_y = 32
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"uw" = (
-/obj/effect/decal/cleanable/blood/tracks,
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"ux" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/structure/noticeboard{
-	pixel_y = 32
-	},
-/obj/item/paper/fluff/balls/spookyasylum/cell03,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"uy" = (
-/obj/effect/decal/cleanable/cobweb{
-	icon_state = "cobweb2"
-	},
-/obj/structure/noticeboard{
-	pixel_y = 32
-	},
-/obj/item/paper/fluff/balls/spookyasylum/cell04,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"uz" = (
-/obj/structure/bed,
-/obj/item/bedsheet/random,
-/obj/machinery/button/door/dorms/patient2,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"uA" = (
-/obj/effect/landmark/start/captain,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"uB" = (
-/obj/structure/barricade/wooden/snowed,
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"uC" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/effect/decal/cleanable/glass{
-	dir = 8
-	},
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken6"
-	},
-/area/eventmap/inside)
-"uD" = (
-/obj/machinery/door/airlock/security{
-	aiControlDisabled = 1;
-	name = "Prisoner Transfer Centre";
-	req_access_txt = "2"
-	},
-/obj/effect/decal/cleanable/vomit/old,
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"uE" = (
-/obj/effect/decal/cleanable/ash/crematorium,
-/turf/open/floor/wood{
-	icon_state = "wood-broken2"
-	},
-/area/eventmap/inside)
-"uF" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/effect/decal/cleanable/shreds,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"uG" = (
-/obj/effect/decal/cleanable/generic,
-/turf/open/floor/wood{
-	icon_state = "wood-broken7"
-	},
-/area/eventmap/inside)
-"uH" = (
-/obj/effect/landmark/start/head_of_personnel,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"uI" = (
-/obj/structure/table/wood/fancy/orange,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"uJ" = (
-/obj/effect/decal/cleanable/blood/old,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"uK" = (
-/obj/effect/decal/cleanable/blood/tracks{
-	dir = 4
-	},
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"uL" = (
-/obj/machinery/door/airlock/wood/dorms/patient2,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"uM" = (
-/obj/structure/table,
-/obj/effect/meteor/meaty{
-	lifetime = 1e+009
-	},
-/obj/effect/decal/cleanable/cobweb,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"uN" = (
-/obj/machinery/dominator,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"uO" = (
-/obj/machinery/sleeper,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"uP" = (
-/obj/machinery/hydroponics,
-/obj/effect/decal/cleanable/glass,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"uQ" = (
-/obj/machinery/computer/operating,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"uR" = (
-/obj/structure/table/optable,
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "floor5"
-	},
-/obj/effect/decal/cleanable/glass,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"uS" = (
-/obj/item/storage/backpack/duffelbag/med/surgery,
-/obj/item/book/manual/wiki/surgery,
-/obj/structure/table,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"uT" = (
-/obj/machinery/computer/crew,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"uU" = (
-/obj/item/twohanded/required/kirbyplants/random,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"uV" = (
-/obj/structure/spacevine,
-/turf/closed/indestructible/riveted,
-/area/eventmap/inside)
-"uW" = (
-/obj/structure/alien/resin/membrane,
-/obj/structure/spacevine,
-/obj/structure/spacevine,
-/obj/item/twohanded/required/kirbyplants/random,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"uX" = (
-/obj/structure/alien/resin/membrane,
-/obj/structure/spacevine,
-/obj/structure/spacevine,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"uY" = (
-/obj/structure/alien/resin/membrane,
-/obj/structure/spacevine,
-/obj/structure/spacevine,
-/mob/living/simple_animal/hostile/venus_human_trap{
-	a_intent = "friendly";
-	attacktext = "wrangles it's vines";
-	friendly = "wrangles it's vines around";
-	harm_intent_damage = 0;
-	melee_damage_lower = 0;
-	melee_damage_type = "arousal";
-	melee_damage_upper = 0
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"uZ" = (
-/obj/structure/kitchenspike,
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "gib3"
-	},
-/obj/effect/decal/cleanable/cobweb,
-/obj/item/stack/sheet/animalhide/human,
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 9
-	},
-/turf/open/floor/plasteel/dark/corner,
-/area/eventmap/inside)
-"va" = (
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 1
-	},
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 1
-	},
-/obj/machinery/iv_drip,
-/turf/open/floor/plasteel/dark/side,
-/area/eventmap/inside)
-"vb" = (
-/obj/structure/kitchenspike,
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "floor5"
-	},
-/obj/effect/decal/remains/xeno/larva,
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 1
-	},
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "xgiblarvahead"
-	},
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "xgibmid2"
-	},
-/turf/open/floor/plasteel/dark/side,
-/area/eventmap/inside)
-"vc" = (
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 1
-	},
-/obj/machinery/iv_drip,
-/turf/open/floor/plasteel/dark/side,
-/area/eventmap/inside)
-"vd" = (
-/obj/structure/kitchenspike,
-/obj/effect/decal/cleanable/blood/splatter,
-/obj/effect/decal/remains/human,
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 1
-	},
-/turf/open/floor/plasteel/dark/side,
-/area/eventmap/inside)
-"ve" = (
-/obj/structure/kitchenspike,
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "gibmid3"
-	},
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "remainsxeno"
-	},
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 1
-	},
-/turf/open/floor/plasteel/dark/side,
-/area/eventmap/inside)
-"vf" = (
-/obj/structure/kitchenspike,
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "floor5"
-	},
-/obj/item/stack/sheet/animalhide/human,
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 1
-	},
-/turf/open/floor/plasteel/dark/side,
-/area/eventmap/inside)
-"vg" = (
-/obj/structure/kitchenspike,
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "gibtorso"
-	},
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 5
-	},
-/turf/open/floor/plasteel/dark/corner{
-	dir = 8
-	},
-/area/eventmap/inside)
-"vh" = (
-/turf/closed/indestructible/necropolis,
-/area/eventmap/inside)
-"vi" = (
-/obj/screen/alert/status_effect/blooddrunk{
-	desc = "You see your disfigured skull screaming on the wall.";
-	icon = 'icons/mob/screen_gen.dmi';
-	icon_state = "Devil-6";
-	name = "Foolish creature of meat and bone."
-	},
-/turf/closed/indestructible/necropolis,
-/area/eventmap/inside)
-"vj" = (
-/obj/screen/alert/status_effect/blooddrunk{
-	desc = "You feel hollow and empy inside.";
-	icon = 'icons/effects/cult_effects.dmi';
-	icon_state = "cultshield";
-	name = "You should not have come here."
-	},
-/turf/closed/indestructible/necropolis,
-/area/eventmap/inside)
-"vk" = (
-/obj/structure/necropolis_gate,
-/obj/structure/mineral_door/iron,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"vl" = (
-/obj/effect/decal/cleanable/blood/old,
-/obj/structure/barricade/wooden/crude,
-/obj/structure/mineral_door/wood,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"vm" = (
-/obj/structure/closet,
-/obj/item/stack/sheet/glass/fifty,
-/obj/item/stack/sheet/glass/fifty,
-/obj/item/stack/sheet/metal/fifty,
-/obj/item/stack/sheet/metal/fifty,
-/obj/item/stack/sheet/metal/fifty,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"vn" = (
-/obj/machinery/door/airlock/security{
-	name = "Armoury";
-	req_access_txt = "3"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"vo" = (
-/obj/structure/chair/wood/wings{
-	dir = 4
-	},
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/wood/damturf/broken1,
-/area/eventmap/inside)
-"vp" = (
-/obj/structure/life_candle,
-/turf/open/floor/carpet/green,
-/area/eventmap/inside)
-"vq" = (
-/turf/closed/wall/rust,
-/area/eventmap/outside)
-"vr" = (
-/obj/structure/table/wood/fancy/black,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"vs" = (
-/obj/structure/chair/wood/wings{
-	dir = 8
-	},
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"vt" = (
-/obj/structure/table/wood/fancy/orange,
-/obj/item/clothing/suit/straight_jacket{
-	pixel_x = -8;
-	pixel_y = 8
-	},
-/obj/item/clothing/suit/straight_jacket,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"vu" = (
-/obj/structure/table/wood/fancy/orange,
-/obj/item/clothing/under/suit_jacket/navy,
-/obj/item/clothing/accessory/lawyers_badge,
-/obj/item/restraints/handcuffs/fake,
-/obj/item/stamp/law,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"vv" = (
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"vw" = (
-/obj/effect/decal/cleanable/dirt,
-/obj/machinery/light/small,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"vx" = (
-/obj/structure/table/wood/fancy/orange,
-/obj/effect/decal/cleanable/dirt,
-/obj/item/clothing/under/scarecrow,
-/obj/item/clothing/head/scarecrow_hat,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"vy" = (
-/obj/structure/table/wood/fancy/orange,
-/obj/item/reagent_containers/rag/towel,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"vz" = (
-/obj/effect/decal/cleanable/plasma,
-/turf/closed/wall/mineral/wood,
-/area/eventmap/inside)
-"vA" = (
-/obj/machinery/doppler_array,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"vB" = (
-/obj/effect/decal/cleanable/blood/tracks,
-/obj/effect/decal/cleanable/blood/splatter,
-/mob/living/simple_animal/pet/cat/custom_cat{
-	name = "Ghost cat"
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"vC" = (
-/obj/machinery/iv_drip,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"vD" = (
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 8;
-	name = "Blood"
-	},
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "floor2"
-	},
-/turf/open/floor/plasteel/dark/side{
-	dir = 4
-	},
-/area/eventmap/inside)
-"vE" = (
-/obj/item/storage/box/donkpockets,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"vF" = (
-/obj/item/storage/box/fakesyndiesuit,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"vG" = (
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111"
-	},
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "gib5"
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"vH" = (
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111"
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"vI" = (
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111"
-	},
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "floor5"
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"vJ" = (
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "gib4"
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"vK" = (
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 4
-	},
-/obj/effect/gibspawner/human,
-/turf/open/floor/plasteel/dark/side{
-	dir = 8
-	},
-/area/eventmap/inside)
-"vL" = (
-/obj/screen/alert/status_effect/blooddrunk{
-	desc = "I'M WATCHING YOU, COWARD.";
-	name = "???"
-	},
-/turf/open/indestructible/spooknecropolis,
-/area/eventmap/inside)
-"vM" = (
-/turf/open/indestructible/spooknecropolis,
-/area/eventmap/inside)
-"vN" = (
-/obj/screen/alert/status_effect/blooddrunk{
-	desc = "YOUR SOUL IS MINE, MORTAL.";
-	name = "???"
-	},
-/turf/open/indestructible/spooknecropolis,
-/area/eventmap/inside)
-"vO" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"vP" = (
-/obj/structure/rack,
-/obj/item/gun/ballistic/shotgun/automatic/combat,
-/obj/item/gun/ballistic/shotgun/automatic/combat,
-/obj/item/gun/ballistic/shotgun/automatic/combat,
-/obj/item/gun/ballistic/shotgun/automatic/combat,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"vQ" = (
-/obj/item/clothing/head/helmet/justice,
-/obj/structure/closet/secure_closet/warden,
-/obj/item/clothing/suit/armor/hos/trenchcoat,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"vR" = (
-/obj/structure/closet/secure_closet/security,
-/obj/item/clothing/under/rank/security/navyblue,
-/obj/item/clothing/head/beret/sec/navyofficer,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"vS" = (
-/obj/structure/closet/secure_closet/security,
-/obj/machinery/light{
-	dir = 1
-	},
-/obj/item/clothing/under/rank/security/navyblue,
-/obj/item/clothing/head/beret/sec/navyofficer,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"vT" = (
-/obj/structure/fluff/empty_cryostasis_sleeper,
-/obj/effect/decal/cleanable/glass,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"vU" = (
-/mob/living/simple_animal/astral{
-	desc = "...Is haunting Space Station Three.";
-	name = "Ghost"
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"vV" = (
-/obj/machinery/loot_locator,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"vW" = (
-/obj/effect/decal/cleanable/blood/tracks,
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "gib3"
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"vX" = (
-/turf/closed/indestructible/riveted,
-/area/eventmap/inside)
-"vY" = (
-/obj/machinery/door/airlock/virology,
-/obj/structure/spacevine,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"vZ" = (
-/obj/structure/spacevine,
-/obj/effect/spawner/structure/window/reinforced,
-/turf/open/floor/clockwork/reebe,
-/area/eventmap/inside)
-"wa" = (
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 8;
-	name = "Blood"
-	},
-/obj/effect/gibspawner/human,
-/turf/open/floor/plasteel/dark/side{
-	dir = 4
-	},
-/area/eventmap/inside)
-"wb" = (
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "floor2"
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"wc" = (
-/obj/structure/reagent_dispensers/cooking_oil,
-/obj/structure/showcase/horrific_experiment{
-	icon_state = "cover-on";
-	layer = 4.5
-	},
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 6
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"wd" = (
-/turf/closed/wall/r_wall/rust,
-/area/eventmap/inside)
-"we" = (
-/obj/structure/reagent_dispensers/cooking_oil,
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 10
-	},
-/obj/structure/showcase/horrific_experiment{
-	icon_state = "cover-on";
-	layer = 4.5
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"wf" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 4
-	},
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "gibmid1"
-	},
-/obj/item/organ/brain,
-/turf/open/floor/plasteel/dark/side{
-	dir = 8
-	},
-/area/eventmap/inside)
-"wg" = (
-/obj/structure/flora/junglebush{
-	icon_state = "grassa4"
-	},
-/obj/vehicle/ridden/atv,
-/obj/item/key,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"wh" = (
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"wi" = (
-/obj/structure/fluff/bus/dense,
-/turf/open/floor/spooktime/cobble/sideW{
-	icon_state = "cobble_side_n"
-	},
-/area/shuttle/arrival)
-"wj" = (
-/obj/structure/fluff/bus/dense{
-	icon_state = "hoodtop"
-	},
-/obj/docking_port/mobile/arrivals,
-/turf/open/floor/spooktime/cobble/sideS,
-/area/eventmap/outside)
-"wk" = (
-/turf/open/floor/spooktime/cobble/sideE,
-/area/eventmap/outside)
-"wl" = (
-/turf/open/floor/spooktime/cobble/sideW,
-/area/eventmap/outside)
-"wm" = (
-/obj/effect/landmark/observer_start,
-/turf/open/floor/spooktime/cobble,
-/area/eventmap/outside)
-"wn" = (
-/turf/open/floor/spooktime/cobble/cornerSE,
-/area/eventmap/outside)
-"wo" = (
-/turf/open/floor/spooktime/cobble/cornerSW,
-/area/eventmap/outside)
-"wp" = (
-/mob/living/carbon/true_devil,
-/turf/open/indestructible/spooknecropolis,
-/area/eventmap/inside)
-"wq" = (
-/obj/machinery/door/airlock/engineering{
-	name = "Telecommunications Chamber";
-	req_access_txt = "61"
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"wr" = (
-/obj/structure/curtain{
-	color = "#B22222"
-	},
-/obj/effect/spawner/structure/window/reinforced,
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
-	id = "C01"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ws" = (
-/obj/structure/mineral_door/wood,
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
-	id = "C02"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"wt" = (
-/obj/structure/rack,
-/obj/item/gun/ballistic/shotgun/automatic/dual_tube,
-/obj/item/gun/ballistic/shotgun/automatic/dual_tube,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"wu" = (
-/obj/machinery/button/door{
-	id = "armory";
-	name = "Armory Shutters";
-	pixel_x = 26;
-	req_access_txt = "3"
-	},
-/obj/item/storage/box/rubbershot,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"wv" = (
-/obj/effect/landmark/start/security_officer,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ww" = (
-/obj/effect/landmark/start/security_officer,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"wx" = (
-/obj/vehicle/ridden/secway,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"wy" = (
-/obj/structure/chair/wood{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"wz" = (
-/obj/machinery/vending/wardrobe/jani_wardrobe,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"wA" = (
-/obj/structure/closet/jcloset,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"wB" = (
-/obj/structure/table/wood/fancy/orange,
-/obj/machinery/chem_dispenser/drinks/beer/fullupgrade{
-	dir = 1
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken6"
-	},
-/area/eventmap/inside)
-"wC" = (
-/obj/structure/chair/sofa/right{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"wD" = (
-/obj/machinery/droneDispenser,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"wE" = (
-/obj/effect/decal/cleanable/salt,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"wF" = (
-/obj/effect/decal/cleanable/blood/tracks,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"wG" = (
-/obj/structure/mineral_door/wood,
-/turf/open/floor/plasteel/dark/side,
-/area/eventmap/inside)
-"wH" = (
-/turf/open/floor/plasteel/dark/side{
-	dir = 6
-	},
-/area/eventmap/inside)
-"wI" = (
-/obj/effect/decal/cleanable/blood/tracks{
-	dir = 4
-	},
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 4
-	},
-/obj/effect/gibspawner/human,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"wJ" = (
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 8;
-	name = "Blood"
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"wK" = (
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "gibup1"
-	},
-/obj/item/organ/stomach,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"wL" = (
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 8;
-	name = "Blood"
-	},
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "coatblood"
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"wM" = (
-/obj/structure/table/wood/fancy/blackred,
-/obj/item/toy/toy_dagger,
-/turf/open/indestructible/spooknecropolis,
-/area/eventmap/inside)
-"wN" = (
-/obj/structure/table/wood/fancy/blackred,
-/obj/item/clothing/neck/devilwings,
-/turf/open/indestructible/spooknecropolis,
-/area/eventmap/inside)
-"wO" = (
-/obj/structure/table/wood/fancy/blackred,
-/obj/item/blood_beam,
-/turf/open/indestructible/spooknecropolis,
-/area/eventmap/inside)
-"wP" = (
-/obj/structure/fluff/drake_statue,
-/turf/open/indestructible/spooknecropolis,
-/area/eventmap/inside)
-"wQ" = (
-/obj/item/clothing/glasses/wraith_spectacles,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountaininside)
-"wR" = (
-/obj/structure/chair/sofa/right{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"wS" = (
-/turf/open/floor/engine,
-/area/eventmap/inside)
-"wT" = (
-/obj/structure/rack,
-/obj/item/gun/ballistic/automatic/shotgun/bulldog/unrestricted,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"wU" = (
-/obj/structure/rack,
-/obj/item/storage/box/beanbag,
-/obj/item/storage/box/beanbag,
-/obj/item/storage/box/fireshot,
-/obj/item/storage/box/lethalshot,
-/obj/item/storage/box/lethalslugs,
-/obj/item/storage/box/lethalshot,
-/obj/item/storage/box/rubbershot,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"wV" = (
-/obj/structure/rack,
-/obj/item/gun/energy/pulse{
-	pixel_x = 4;
-	pixel_y = -4
-	},
-/obj/item/gun/energy/pulse,
-/obj/item/gun/energy/pulse{
-	pixel_x = -4;
-	pixel_y = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"wW" = (
-/obj/structure/rack,
-/obj/item/gun/ballistic/shotgun/riot{
-	pixel_x = 4;
-	pixel_y = -4
-	},
-/obj/item/gun/ballistic/shotgun/riot,
-/obj/item/gun/ballistic/shotgun/riot{
-	pixel_x = -4;
-	pixel_y = 4
-	},
-/turf/open/floor/wood/damturf/broken4,
-/area/eventmap/inside)
-"wX" = (
-/obj/structure/table/wood/fancy/cyan,
-/obj/item/stamp/captain,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"wY" = (
-/obj/structure/table/wood/fancy/orange,
-/obj/machinery/chem_dispenser/drinks/fullupgrade{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"wZ" = (
-/obj/structure/bodycontainer/morgue,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"xa" = (
-/obj/structure/showcase/horrific_experiment{
-	icon_state = "pod_1"
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"xb" = (
-/obj/structure/showcase/machinery/implanter,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"xc" = (
-/obj/machinery/computer/cloning,
-/obj/effect/decal/cleanable/oil,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"xd" = (
-/obj/structure/showcase/horrific_experiment,
-/obj/effect/decal/cleanable/glass,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"xe" = (
-/obj/structure/showcase/machinery/oldpod,
-/obj/effect/decal/cleanable/oil,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"xf" = (
-/obj/structure/mineral_door/wood,
-/turf/open/floor/plasteel/dark/side{
-	dir = 1
-	},
-/area/eventmap/inside)
-"xg" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/plasteel/dark/side{
-	dir = 5
-	},
-/area/eventmap/inside)
-"xh" = (
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 4
-	},
-/obj/effect/decal/cleanable/blood/innards,
-/obj/effect/decal/cleanable/blood/splatter,
-/obj/structure/closet/secure_closet/freezer/fridge,
-/obj/item/clothing/head/hooded/human_head,
-/obj/item/reagent_containers/food/snacks/burger/human,
-/obj/item/reagent_containers/food/snacks/burger/human,
-/obj/item/reagent_containers/food/snacks/kebab/human,
-/obj/item/reagent_containers/food/snacks/meat/cutlet/plain/human,
-/obj/item/reagent_containers/food/snacks/meat/rawcutlet/plain/human,
-/obj/item/reagent_containers/food/snacks/meat/slab/human,
-/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/avian,
-/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/fly,
-/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/golem,
-/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/insect,
-/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/lizard,
-/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/plant,
-/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/shadow,
-/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/skeleton,
-/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/slime,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"xi" = (
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 8;
-	name = "Blood"
-	},
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "gibbearcore"
-	},
-/obj/item/organ/tongue,
-/turf/open/floor/plasteel/dark/side{
-	dir = 4
-	},
-/area/eventmap/inside)
-"xj" = (
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 4
-	},
-/turf/open/floor/plasteel/dark/side{
-	dir = 8
-	},
-/area/eventmap/inside)
-"xk" = (
-/obj/structure/healingfountain,
-/turf/open/indestructible/spooknecropolis,
-/area/eventmap/inside)
-"xl" = (
-/obj/structure/table/wood/fancy/blackred,
-/obj/item/tome,
-/turf/open/indestructible/spooknecropolis,
-/area/eventmap/inside)
-"xm" = (
-/obj/structure/table/wood/fancy/blackred,
-/obj/item/toy/spinningtoy{
-	name = "Gate to hell"
-	},
-/turf/open/indestructible/spooknecropolis,
-/area/eventmap/inside)
-"xn" = (
-/obj/structure/table/wood/fancy/blackred,
-/obj/item/organ/heart/demon,
-/turf/open/indestructible/spooknecropolis,
-/area/eventmap/inside)
-"xo" = (
-/obj/structure/bed,
-/obj/item/bedsheet/cult,
-/turf/open/indestructible/spooknecropolis,
-/area/eventmap/inside)
-"xp" = (
-/obj/machinery/jukebox/disco/indestructible{
-	req_one_access = list()
-	},
-/turf/open/floor/engine,
-/area/eventmap/inside)
-"xq" = (
-/obj/machinery/chem_master/condimaster,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"xr" = (
-/obj/item/reagent_containers/food/condiment/sugar,
-/obj/item/reagent_containers/food/condiment/sugar,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"xs" = (
-/obj/effect/landmark/start/head_of_security,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"xt" = (
-/obj/effect/landmark/start/warden,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"xu" = (
-/obj/structure/table/wood/bar,
-/obj/machinery/door/poddoor/shutters{
-	id = "armory";
-	name = "Armoury Shutter"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"xv" = (
-/obj/effect/landmark/start/depsec/engineering,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"xw" = (
-/obj/effect/landmark/start/depsec/medical,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"xx" = (
-/obj/effect/landmark/start/depsec/science,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"xy" = (
-/obj/structure/table,
-/obj/item/storage/box/mousetraps,
-/obj/item/storage/box/lights/mixed{
-	pixel_x = 4;
-	pixel_y = 4
-	},
-/obj/machinery/light/small{
-	dir = 8
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"xz" = (
-/obj/effect/landmark/start/janitor,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"xA" = (
-/obj/machinery/door/airlock{
-	name = "Custodial Closet";
-	req_access_txt = "26"
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"xB" = (
-/obj/structure/easel,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"xC" = (
-/obj/structure/chair/wood/normal,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"xD" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"xE" = (
-/obj/effect/decal/cleanable/glass,
-/mob/living/simple_animal/astral{
-	desc = "...Is haunting Space Station Three.";
-	name = "Ghost"
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"xF" = (
-/obj/effect/decal/cleanable/plasma,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"xG" = (
-/obj/machinery/door/airlock/virology,
-/turf/open/floor/clockwork/reebe,
-/area/eventmap/inside)
-"xH" = (
-/obj/structure/bed{
-	desc = "A large structure used to break the femurs of traitors and treasonists.";
-	icon = 'icons/obj/femur_breaker.dmi';
-	icon_state = "breaker_raised";
-	name = "Femur breaker"
-	},
-/obj/effect/decal/cleanable/blood/gibs/limb{
-	icon_state = "gibleg"
-	},
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "gib3"
-	},
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "floor2"
-	},
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 4
-	},
-/obj/item/organ/appendix,
-/turf/open/floor/plasteel/dark/side{
-	dir = 8
-	},
-/area/eventmap/inside)
-"xI" = (
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "gib6"
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"xJ" = (
-/obj/structure/reagent_dispensers/cooking_oil,
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 5
-	},
-/obj/structure/showcase/horrific_experiment{
-	icon_state = "cover-on";
-	layer = 4.5
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"xK" = (
-/obj/structure/reagent_dispensers/cooking_oil,
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 9
-	},
-/obj/structure/showcase/horrific_experiment{
-	icon_state = "cover-on";
-	layer = 4.5
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"xL" = (
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 4
-	},
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 4
-	},
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "gibmid3"
-	},
-/obj/item/organ/eyes,
-/turf/open/floor/plasteel/dark/side{
-	dir = 8
-	},
-/area/eventmap/inside)
-"xM" = (
-/obj/item/storage/box/ingredients/wildcard,
-/obj/item/storage/box/ingredients/wildcard,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"xN" = (
-/obj/structure/closet/secure_closet/freezer/fridge,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/milk,
-/obj/item/reagent_containers/food/condiment/soymilk,
-/obj/item/reagent_containers/food/condiment/soymilk,
-/obj/item/reagent_containers/food/condiment/soymilk,
-/obj/item/reagent_containers/food/condiment/soymilk,
-/obj/item/reagent_containers/food/condiment/soymilk,
-/obj/item/reagent_containers/food/condiment/soymilk,
-/obj/item/reagent_containers/food/condiment/soymilk,
-/obj/item/reagent_containers/food/condiment/soymilk,
-/obj/item/reagent_containers/food/condiment/soymilk,
-/obj/item/reagent_containers/food/condiment/soymilk,
-/obj/item/reagent_containers/food/condiment/soymilk,
-/obj/item/reagent_containers/food/condiment/soymilk,
-/obj/item/reagent_containers/food/condiment/soymilk,
-/obj/item/reagent_containers/food/condiment/soymilk,
-/obj/item/storage/fancy/egg_box,
-/obj/item/storage/fancy/egg_box,
-/obj/item/storage/fancy/egg_box,
-/obj/item/storage/fancy/egg_box,
-/obj/item/storage/fancy/egg_box,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"xO" = (
-/obj/machinery/door_timer{
-	id = "Cell 2";
-	name = "Cell 2";
-	pixel_y = -32
-	},
-/obj/effect/decal/cleanable/blood/tracks{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"xP" = (
-/obj/machinery/door_timer{
-	id = "Cell 1";
-	name = "Cell 1";
-	pixel_y = -32
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"xQ" = (
-/obj/structure/rack,
-/obj/item/gun/ballistic/shotgun/boltaction{
-	pixel_x = -4;
-	pixel_y = 4
-	},
-/obj/item/gun/ballistic/shotgun/boltaction{
-	pixel_x = 4;
-	pixel_y = -4
-	},
-/obj/item/gun/ballistic/shotgun/boltaction,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"xR" = (
-/obj/structure/rack,
-/obj/item/clothing/suit/armor/riot{
-	pixel_x = 4;
-	pixel_y = -4
-	},
-/obj/item/clothing/suit/armor/riot,
-/obj/item/clothing/suit/armor/riot{
-	pixel_x = -4;
-	pixel_y = 4
-	},
-/obj/item/clothing/head/helmet/riot{
-	pixel_x = 4;
-	pixel_y = -4
-	},
-/obj/item/clothing/head/helmet/riot,
-/obj/item/clothing/head/helmet/riot{
-	pixel_x = -4;
-	pixel_y = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"xS" = (
-/obj/structure/rack,
-/obj/item/clothing/suit/armor/bulletproof{
-	pixel_x = 4;
-	pixel_y = -4
-	},
-/obj/item/clothing/suit/armor/bulletproof,
-/obj/item/clothing/suit/armor/bulletproof{
-	pixel_x = -4;
-	pixel_y = 4
-	},
-/obj/item/clothing/head/helmet/alt{
-	pixel_x = 4;
-	pixel_y = -4
-	},
-/obj/item/clothing/head/helmet/alt,
-/obj/item/clothing/head/helmet/alt{
-	pixel_x = -4;
-	pixel_y = 4
-	},
-/turf/open/floor/wood/damturf/broken6,
-/area/eventmap/inside)
-"xT" = (
-/obj/structure/closet/secure_closet/hos,
-/obj/item/clothing/head/helmet/justice/escape{
-	name = "justice helmet"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"xU" = (
-/obj/structure/closet/secure_closet/armory3,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"xV" = (
-/obj/structure/closet/secure_closet/armory2,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"xW" = (
-/obj/structure/closet/secure_closet/armory1,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"xX" = (
-/obj/machinery/rnd/production/techfab/department/security,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"xY" = (
-/obj/vehicle/ridden/janicart/upgraded,
-/obj/item/key/janitor,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"xZ" = (
-/obj/machinery/camera/emp_proof,
-/obj/machinery/light{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ya" = (
-/obj/structure/chair/wood/wings{
-	dir = 4
-	},
-/obj/machinery/light/small,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"yb" = (
-/obj/structure/piano,
-/obj/effect/decal/cleanable/cobweb,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"yc" = (
-/obj/structure/table/wood/poker,
-/obj/item/toy/cards/deck/cas/black{
-	pixel_x = 4
-	},
-/obj/item/toy/cards/deck/cas{
-	pixel_x = -4
-	},
-/obj/item/toy/cards/deck{
-	pixel_y = 4
-	},
-/obj/machinery/light/small,
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"yd" = (
-/obj/structure/chair/wood/normal{
-	dir = 8
-	},
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"ye" = (
-/obj/structure/table/wood/fancy/royalblack,
-/obj/item/toy/dummy,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"yf" = (
-/obj/structure/table/wood/fancy/royalblack,
-/obj/item/camera/spooky,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"yg" = (
-/obj/structure/table/wood/fancy/royalblack,
-/obj/item/storage/pill_bottle/dice,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"yh" = (
-/obj/effect/decal/cleanable/chem_pile,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"yi" = (
-/turf/open/floor/clockwork/reebe,
-/area/eventmap/inside)
-"yj" = (
-/obj/item/ectoplasm,
-/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/zombie,
-/turf/open/floor/clockwork/reebe,
-/area/eventmap/inside)
-"yk" = (
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 8;
-	name = "Blood"
-	},
-/obj/effect/decal/cleanable/plasma,
-/turf/open/floor/plasteel/dark/side{
-	dir = 4
-	},
-/area/eventmap/inside)
-"yl" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/effect/decal/cleanable/blood/tracks,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"ym" = (
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 1
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"yn" = (
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 1
-	},
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "splatter1"
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/inside)
-"yo" = (
-/obj/structure/table/plasmaglass,
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"yp" = (
-/obj/structure/fluff/divine/convertaltar,
-/turf/open/indestructible/spooknecropolis,
-/area/eventmap/inside)
-"yq" = (
-/obj/machinery/dna_scannernew,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"yr" = (
-/obj/machinery/computer/cloning,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"ys" = (
-/obj/machinery/clonepod/experimental,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"yt" = (
-/obj/structure/fluff/empty_terrarium,
-/obj/effect/decal/cleanable/oil,
-/obj/effect/decal/cleanable/glass,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"yu" = (
-/obj/machinery/nuclearbomb/beer,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"yv" = (
-/obj/structure/table,
-/obj/item/hand_labeler,
-/obj/item/defibrillator/loaded,
-/obj/item/extendohand/acme,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"yw" = (
-/obj/structure/table,
-/obj/item/inducer/sci,
-/obj/item/defibrillator/loaded,
-/obj/item/defibrillator/loaded,
-/obj/item/storage/box/beakers/bluespace,
-/obj/item/storage/belt/medolier/full,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"yx" = (
-/obj/structure/table,
-/obj/item/implanter/sad_trombone,
-/obj/item/implanter/sad_trombone,
-/obj/item/implanter/tracking/gps,
-/obj/item/implanter/tracking/gps,
-/obj/item/healthanalyzer/advanced,
-/obj/item/pneumatic_cannon/pie,
-/obj/item/storage/box/hug,
-/turf/open/floor/plasteel,
-/area/eventmap/inside)
-"yy" = (
-/obj/item/organ/appendix{
-	icon_state = "blacktumor";
-	name = "Festering ooze"
-	},
-/turf/open/floor/clockwork/reebe,
-/area/eventmap/inside)
-"yz" = (
-/obj/structure/cloth_pile,
-/turf/open/floor/clockwork/reebe,
-/area/eventmap/inside)
-"yA" = (
-/obj/machinery/light/floor{
-	alpha = 0;
-	light_range = 20;
-	mouse_opacity = 0
-	},
-/obj/machinery/light/floor{
-	alpha = 0;
-	light_range = 20;
-	max_integrity = 9999;
-	mouse_opacity = 0
-	},
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"yB" = (
-/obj/machinery/recharge_station,
-/turf/open/floor/carpet/monochrome,
-/area/eventmap/inside)
-"yC" = (
-/obj/item/twohanded/required/kirbyplants/random,
-/obj/item/clothing/suit/ghost_sheet,
-/turf/open/floor/carpet/monochrome,
-/area/eventmap/inside)
-"yD" = (
-/obj/structure/kitchenspike,
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 10
-	},
-/obj/effect/decal/remains/plasma,
-/obj/effect/decal/cleanable/plasma,
-/turf/open/floor/plasteel/dark/corner{
-	dir = 4
-	},
-/area/eventmap/inside)
-"yE" = (
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111"
-	},
-/obj/machinery/iv_drip,
-/obj/effect/decal/cleanable/plasma,
-/turf/open/floor/plasteel/dark/side{
-	dir = 1
-	},
-/area/eventmap/inside)
-"yF" = (
-/obj/structure/kitchenspike,
-/obj/item/stack/sheet/animalhide/corgi,
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111"
-	},
-/obj/effect/decal/cleanable/blood/tracks,
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "itemblood"
-	},
-/obj/item/reagent_containers/food/snacks/meat/slab/corgi,
-/turf/open/floor/plasteel/dark/side{
-	dir = 1
-	},
-/area/eventmap/inside)
-"yG" = (
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111"
-	},
-/obj/machinery/iv_drip,
-/turf/open/floor/plasteel/dark/side{
-	dir = 1
-	},
-/area/eventmap/inside)
-"yH" = (
-/obj/structure/kitchenspike,
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111"
-	},
-/obj/structure/spider/stickyweb,
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "u_psycopath"
-	},
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "gibdown1"
-	},
-/turf/open/floor/plasteel/dark/side{
-	dir = 1
-	},
-/area/eventmap/inside)
-"yI" = (
-/obj/structure/kitchenspike,
-/obj/item/stack/sheet/animalhide/lizard,
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111"
-	},
-/obj/effect/decal/cleanable/blood/tracks,
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "floor4-old"
-	},
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "splatter4"
-	},
-/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/lizard,
-/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/lizard,
-/turf/open/floor/plasteel/dark/side{
-	dir = 1
-	},
-/area/eventmap/inside)
-"yJ" = (
-/obj/structure/kitchenspike,
-/obj/item/stack/sheet/animalhide/monkey,
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111"
-	},
-/obj/effect/decal/cleanable/blood/tracks,
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "gibmid3"
-	},
-/obj/item/reagent_containers/food/snacks/meat/slab/monkey,
-/obj/item/reagent_containers/food/snacks/meat/slab/monkey,
-/turf/open/floor/plasteel/dark/side{
-	dir = 1
-	},
-/area/eventmap/inside)
-"yK" = (
-/obj/structure/kitchenspike,
-/obj/item/stack/sheet/animalhide/xeno,
-/obj/effect/turf_decal/weather/snow/corner{
-	color = "#991111";
-	dir = 6
-	},
-/obj/effect/decal/cleanable/blood/tracks,
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "xgib2"
-	},
-/obj/effect/decal/cleanable/blood/splatter{
-	icon_state = "xgiblarvahead"
-	},
-/obj/item/reagent_containers/food/snacks/meat/slab/xeno,
-/obj/item/reagent_containers/food/snacks/meat/slab/xeno,
-/turf/open/floor/plasteel/dark/corner{
-	dir = 1
-	},
-/area/eventmap/inside)
-"yL" = (
-/obj/screen/alert/status_effect/blooddrunk{
-	desc = "BEWARE, I LIVE.";
-	name = "???"
-	},
-/turf/open/indestructible/spooknecropolis,
-/area/eventmap/inside)
-"yM" = (
-/obj/screen/alert/status_effect/blooddrunk{
-	desc = "WELCOME TO HELL, CURSED ONE.";
-	name = "???"
-	},
-/turf/open/indestructible/spooknecropolis,
-/area/eventmap/inside)
-"yN" = (
-/turf/closed/indestructible/spookytime/matrixblocker,
-/area/eventmap/mountain)
-"yO" = (
-/turf/open/floor/spooktime/cobble/sideS,
-/area/eventmap/outside)
-"yP" = (
-/obj/structure/fluff/bus/passable{
-	icon_state = "wheredahoodat"
-	},
-/turf/open/floor/spooktime/cobble/sideW{
-	icon_state = "cobble_side_n"
-	},
-/area/eventmap/outside)
-"yQ" = (
-/turf/open/floor/spooktime/cobble/sideW{
-	icon_state = "cobble_corner_ne"
-	},
-/area/eventmap/outside)
-"yR" = (
-/obj/effect/landmark/start/research_director,
-/turf/open/floor/spooktime/cobble/sideS,
-/area/eventmap/outside)
-"yS" = (
-/obj/effect/landmark/start/head_of_personnel,
-/turf/open/floor/spooktime/cobble/sideS,
-/area/eventmap/outside)
-"yT" = (
-/obj/effect/landmark/start/captain,
-/turf/open/floor/spooktime/cobble/sideS,
-/area/eventmap/outside)
-"yU" = (
-/obj/effect/landmark/start/quartermaster,
-/turf/open/floor/spooktime/cobble,
-/area/eventmap/outside)
-"yV" = (
-/obj/structure/spacevine,
-/obj/structure/spacevine,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"yW" = (
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/plating,
-/area/eventmap/mountaininside)
-"yX" = (
-/obj/effect/landmark/start/cargo_technician,
-/turf/open/floor/spooktime/cobble,
-/area/eventmap/outside)
-"yY" = (
-/obj/effect/landmark/start/shaft_miner,
-/turf/open/floor/spooktime/cobble,
-/area/eventmap/outside)
-"yZ" = (
-/obj/effect/landmark/start/librarian,
-/turf/open/floor/spooktime/cobble,
-/area/eventmap/outside)
-"za" = (
-/obj/effect/landmark/start/scientist,
-/turf/open/floor/spooktime/cobble/roadmid,
-/area/eventmap/outside)
-"zb" = (
-/obj/effect/landmark/start/assistant,
-/turf/open/floor/spooktime/cobble/roadmid,
-/area/eventmap/outside)
-"zc" = (
-/obj/effect/landmark/start/assistant,
-/turf/open/floor/spooktime/cobble/sideW,
-/area/eventmap/outside)
-"zd" = (
-/obj/effect/landmark/start/assistant,
-/turf/open/floor/spooktime/cobble,
-/area/eventmap/outside)
-"ze" = (
-/obj/item/reagent_containers/food/drinks/bottle/trappist,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountaininside)
-"zf" = (
-/obj/effect/landmark/start/lawyer,
-/turf/open/floor/spooktime/cobble,
-/area/eventmap/outside)
-"zg" = (
-/obj/effect/landmark/start/roboticist,
-/turf/open/floor/spooktime/cobble/roadmid,
-/area/eventmap/outside)
-"zh" = (
-/obj/structure/punching_bag,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"zi" = (
-/obj/effect/landmark/start,
-/turf/open/floor/spooktime/cobble/roadmid,
-/area/eventmap/outside)
-"zj" = (
-/obj/effect/landmark/start,
-/turf/open/floor/spooktime/cobble/cornerSW,
-/area/eventmap/outside)
-"zk" = (
-/obj/effect/landmark/start,
-/turf/open/floor/spooktime/cobble/sideS,
-/area/eventmap/outside)
-"zl" = (
-/obj/effect/landmark/start/assistant,
-/turf/open/floor/spooktime/cobble/sideS,
-/area/eventmap/outside)
-"zm" = (
-/obj/effect/landmark/start/mime,
-/turf/open/floor/spooktime/cobble/sideS,
-/area/eventmap/outside)
-"zn" = (
-/obj/effect/landmark/start/chief_engineer,
-/turf/open/floor/spooktime/cobble/roadmid,
-/area/eventmap/outside)
-"zo" = (
-/obj/effect/landmark/start/clown,
-/turf/open/floor/spooktime/cobble/roadmid,
-/area/eventmap/outside)
-"zp" = (
-/obj/item/reagent_containers/food/snacks/kebab/rat/double,
-/obj/structure/table/reinforced,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"zq" = (
-/obj/effect/landmark/start/station_engineer,
-/turf/open/floor/spooktime/cobble/roadmid,
-/area/eventmap/outside)
-"zr" = (
-/obj/effect/landmark/start/cyborg,
-/turf/open/floor/spooktime/cobble/roadmid,
-/area/eventmap/outside)
-"zs" = (
-/obj/effect/landmark/start/atmospheric_technician,
-/turf/open/floor/spooktime/cobble/roadmid,
-/area/eventmap/outside)
-"zt" = (
-/obj/structure/piano,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"zu" = (
-/obj/machinery/light/small{
-	dir = 8
-	},
-/turf/open/floor/spooktime/cobble/sideW,
-/area/eventmap/outside)
-"zv" = (
-/obj/structure/flora/tree/jungle,
-/obj/structure/flora/tree/jungle,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"zw" = (
-/obj/effect/landmark/start/chief_engineer,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"zx" = (
-/obj/structure/table/wood/bar,
-/obj/machinery/recharger,
-/obj/item/key/security,
-/obj/item/key/security,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"zy" = (
-/obj/machinery/vending/coffee,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"zz" = (
-/obj/structure/chair/wood/wings,
-/obj/effect/landmark/start/research_director,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"zA" = (
-/obj/machinery/cryopod{
-	dir = 4
-	},
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"zB" = (
-/obj/effect/landmark/start/clown,
-/turf/open/floor/spooktime/cobble,
-/area/eventmap/outside)
-"zC" = (
-/obj/effect/landmark/start/assistant,
-/turf/open/floor/spooktime/cobble/sideE,
-/area/eventmap/outside)
-"zD" = (
-/obj/effect/landmark/start/shaft_miner,
-/turf/open/floor/spooktime/cobble/sideE,
-/area/eventmap/outside)
-"zE" = (
-/obj/structure/flora/ausbushes/ywflowers,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"zF" = (
-/obj/effect/landmark/start/librarian,
-/turf/open/floor/spooktime/cobble/sideW,
-/area/eventmap/outside)
-"zG" = (
-/obj/structure/table/wood,
-/obj/machinery/light/small{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"zH" = (
-/obj/machinery/door/airlock{
-	name = "Bathroom"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"zI" = (
-/obj/effect/landmark/start/scientist,
-/turf/open/floor/spooktime/cobble/sideW,
-/area/eventmap/outside)
-"zJ" = (
-/obj/structure/closet/crate/wooden,
-/obj/item/storage/box/matches,
-/obj/item/storage/box/matches,
-/obj/item/storage/box/matches,
-/obj/item/storage/fancy/candle_box,
-/obj/item/storage/fancy/candle_box,
-/obj/item/storage/fancy/candle_box,
-/obj/item/storage/fancy/candle_box,
-/obj/item/storage/fancy/candle_box,
-/obj/item/storage/fancy/candle_box,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"zK" = (
-/obj/structure/flora/grass/jungle/b,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"zL" = (
-/obj/structure/closet/crate/wooden,
-/obj/item/storage/box/matches,
-/obj/item/storage/box/matches,
-/obj/item/storage/box/matches,
-/obj/item/storage/fancy/candle_box,
-/obj/item/storage/fancy/candle_box,
-/obj/item/storage/fancy/candle_box,
-/obj/item/storage/fancy/candle_box,
-/obj/item/storage/fancy/candle_box,
-/obj/item/storage/fancy/candle_box,
-/turf/open/floor/wood/damturf/broken7,
-/area/eventmap/inside)
-"zM" = (
-/obj/structure/table/wood/fancy/orange,
-/obj/item/candle/infinite,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"zN" = (
-/obj/structure/table/wood/fancy/purple,
-/obj/item/candle/infinite,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"zO" = (
-/obj/structure/table/wood/fancy/purple,
-/obj/item/reagent_containers/food/condiment/saltshaker,
-/obj/item/reagent_containers/food/condiment/peppermill,
-/obj/item/candle/infinite,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"zP" = (
-/turf/open/floor/spooktime/beach/coasts/coastW,
-/area/eventmap/outside)
-"zQ" = (
-/turf/closed/indestructible/spookytime/matrixblocker,
-/area/eventmap/mountaininside)
-"zR" = (
-/obj/structure/table/wood/fancy/black,
-/obj/item/reagent_containers/food/condiment/saltshaker,
-/obj/item/reagent_containers/food/condiment/peppermill,
-/obj/item/candle/infinite,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"zS" = (
-/obj/effect/wisp,
-/turf/open/floor/carpet/green,
-/area/eventmap/inside)
-"zT" = (
-/obj/structure/table/wood/fancy/green,
-/obj/item/gun/magic/staff/healing,
-/obj/item/gun/magic/staff/healing,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"zU" = (
-/turf/open/floor/spooktime/beach/coasts/coastNE,
-/area/eventmap/outside)
-"zV" = (
-/obj/structure/barricade/wooden/crude,
-/obj/structure/spacevine,
-/obj/effect/spawner/structure/window,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"zW" = (
-/obj/item/flashlight/glowstick/orange,
-/turf/open/floor/spooktime/beach,
-/area/eventmap/outside)
-"zX" = (
-/obj/structure/table/wood,
-/obj/item/paper_bin/bundlenatural,
-/obj/item/pen,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"zY" = (
-/obj/item/storage/box/matches,
-/obj/structure/table/wood,
-/obj/item/storage/fancy/candle_box,
-/obj/item/storage/fancy/candle_box,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"zZ" = (
-/obj/item/storage/pill_bottle/happy,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Aa" = (
-/obj/structure/closet,
-/obj/item/stack/sheet/glass/fifty,
-/obj/item/stack/sheet/glass/fifty,
-/obj/item/stack/sheet/metal/fifty,
-/obj/item/stack/sheet/metal/fifty,
-/turf/open/floor/wood/damturf/broken5,
-/area/eventmap/inside)
-"Ab" = (
-/turf/closed/mineral/ash_rock,
-/area/eventmap/mountaininside)
-"Ac" = (
-/obj/machinery/door/airlock/glass_large,
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
-	id = "C05"
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Ae" = (
-/obj/structure/reagent_dispensers/beerkeg,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Ag" = (
-/obj/structure/chair/comfy/black{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Ah" = (
-/obj/item/storage/fancy/cigarettes/cigpack_shadyjims,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Ai" = (
-/obj/structure/cable/pink{
-	icon_state = "6-9"
-	},
-/turf/open/floor/plating,
-/area/eventmap/mountain)
-"Aj" = (
-/obj/structure/table/wood/fancy,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Ak" = (
-/obj/structure/bonfire,
-/turf/open/floor/plasteel{
-	dir = 1;
-	icon_state = "chapel"
-	},
-/area/eventmap/inside)
-"Ao" = (
-/obj/item/chair,
-/turf/open/floor/plasteel/damturf/platdmg3,
-/area/eventmap/mountaininside)
-"Ap" = (
-/obj/item/stack/sheet/mineral/mythril,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"Ar" = (
-/obj/item/disk/tech_disk/debug,
-/obj/machinery/light/floor,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"At" = (
-/obj/item/reagent_containers/food/drinks/bottle/bottleofnothing,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountaininside)
-"Au" = (
-/obj/structure/chair/comfy/beige{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Av" = (
-/obj/effect/turf_decal/tile/green{
-	dir = 1
-	},
-/obj/effect/turf_decal/tile/green{
-	dir = 8
-	},
-/turf/open/floor/plasteel/damturf/damage2,
-/area/eventmap/inside)
-"Aw" = (
-/obj/item/storage/pill_bottle/happiness,
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"AA" = (
-/obj/item/reagent_containers/food/snacks/chips,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"AD" = (
-/obj/structure/flora/ausbushes/leafybush,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"AF" = (
-/obj/machinery/light{
-	dir = 4
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"AG" = (
-/obj/item/lighter,
-/turf/open/floor/carpet/purple,
-/area/eventmap/mountaininside)
-"AJ" = (
-/turf/open/floor/spooktime/beach/coasts/watercoastNE,
-/area/eventmap/outside)
-"AL" = (
-/obj/item/storage/pill_bottle/stimulant,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"AN" = (
-/obj/structure/bonfire,
-/turf/open/floor/engine,
-/area/eventmap/mountain)
-"AP" = (
-/obj/item/twohanded/required/kirbyplants/photosynthetic,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"AQ" = (
-/obj/machinery/light/small{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"AR" = (
-/obj/structure/bed,
-/obj/item/bedsheet/centcom,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"AU" = (
-/obj/item/reagent_containers/food/snacks/fudgedice,
-/turf/open/floor/wood{
-	icon_state = "wood-broken4"
-	},
-/area/eventmap/inside)
-"AY" = (
-/obj/machinery/light{
-	dir = 1
-	},
-/obj/structure/table/plasmaglass,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"AZ" = (
-/obj/machinery/vending/kink,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Bb" = (
-/obj/structure/cable/pink{
-	icon_state = "6-8"
-	},
-/turf/open/floor/plating,
-/area/eventmap/mountain)
-"Bf" = (
-/obj/structure/fluff/bus/passable/seat/driver,
-/obj/structure/chair/comfy/shuttle{
-	dir = 4;
-	icon_state = ""
-	},
-/obj/machinery/light/floor{
-	alpha = 0;
-	light_range = 20;
-	max_integrity = 9999;
-	mouse_opacity = 0
-	},
-/turf/open/floor/plasteel/dark{
-	icon_state = "bus"
-	},
-/area/shuttle/arrival)
-"Bg" = (
-/obj/machinery/light/floor,
-/obj/machinery/telecomms/broadcaster,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"Bo" = (
-/obj/machinery/light{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Bp" = (
-/obj/machinery/vending/kink,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"Bs" = (
-/obj/machinery/vending/assist,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Bt" = (
-/obj/structure/toilet{
-	dir = 4
-	},
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"Bv" = (
-/obj/structure/closet/secure_closet/engineering_chief,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"Bw" = (
-/obj/structure/chair/comfy/brown{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"By" = (
-/obj/item/storage/fancy/cigarettes/cigpack_midori,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Bz" = (
-/turf/open/floor/carpet/purple,
-/area/eventmap/mountaininside)
-"BA" = (
-/obj/item/reagent_containers/pill/zoom,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"BD" = (
-/obj/item/flashlight/lantern,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"BE" = (
-/obj/structure/bed,
-/obj/item/bedsheet/pirate,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"BF" = (
-/obj/machinery/telecomms/allinone/indestructable{
-	freq_listening = list(1347, 1349, 1351, 1353, 1355, 1357, 1359, 1447 )
-	},
-/obj/machinery/light/floor,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"BG" = (
-/obj/machinery/nanite_chamber,
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"BH" = (
-/obj/item/storage/pill_bottle/penis_enlargement,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"BK" = (
-/obj/structure/curtain{
-	color = "#B22222";
-	pixel_y = -32
-	},
-/turf/open/floor/wood/damturf/broken3,
-/area/eventmap/inside)
-"BL" = (
-/turf/open/floor/plasteel/damturf/damage1,
-/area/eventmap/mountain)
-"BN" = (
-/turf/open/floor/spooktime/beach/coasts/watercoastW,
-/area/eventmap/outside)
-"BR" = (
-/obj/structure/cable/pink{
-	icon_state = "2-5"
-	},
-/obj/structure/cable/pink{
-	icon_state = "2-9"
-	},
-/turf/open/floor/plating,
-/area/eventmap/mountain)
-"BT" = (
-/obj/structure/bed,
-/obj/item/bedsheet/pirate,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"BU" = (
-/turf/open/floor/wood/damturf/broken7,
-/area/eventmap/inside)
-"BW" = (
-/obj/item/lighter/greyscale,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"BX" = (
-/obj/structure/chair/comfy/black{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"BY" = (
-/obj/structure/falsewall/wood,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"BZ" = (
-/obj/structure/closet/secure_closet/freezer/meat,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Cc" = (
-/obj/item/flashlight/lantern,
-/obj/structure/curtain{
-	color = "#B22222";
-	pixel_x = -32
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Cg" = (
-/obj/item/flashlight/flare/torch,
-/obj/item/flashlight/flare/torch,
-/obj/machinery/light/floor{
-	CanAtmosPass = 0;
-	alpha = 0
-	},
-/obj/item/umbrella,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Ch" = (
-/obj/structure/toilet,
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/mountaininside)
-"Ci" = (
-/obj/effect/landmark/start/medical_doctor,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Cl" = (
-/obj/item/scythe,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Cm" = (
-/obj/structure/chair/comfy/beige,
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"Cq" = (
-/obj/machinery/light{
-	dir = 4
-	},
-/obj/structure/closet/crate,
-/obj/item/clothing/under/aviatoruniform,
-/obj/item/clothing/under/geisha,
-/obj/item/clothing/under/singery,
-/obj/item/clothing/shoes/simonshoes,
-/obj/item/clothing/neck/devilwings,
-/obj/item/clothing/shoes/kneesocks,
-/obj/item/clothing/gloves/bracer,
-/obj/item/clothing/gloves/doomguy,
-/obj/item/clothing/accessory/skullcodpiece,
-/obj/item/clothing/head/helmet/richard,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Cr" = (
-/obj/item/storage/box/rubbershot,
-/obj/item/storage/box/rubbershot,
-/obj/item/storage/box/rubbershot,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Cs" = (
-/turf/open/floor/spooktime/beach/coasts/coastSE,
-/area/eventmap/outside)
-"Cu" = (
-/obj/structure/closet/crate,
-/obj/item/clothing/mask/horsehead,
-/obj/item/clothing/mask/horsehead,
-/obj/item/clothing/mask/bandana/red,
-/obj/item/clothing/mask/rat/bat,
-/obj/item/clothing/mask/rat/bear,
-/obj/item/clothing/mask/rat/bee,
-/obj/item/clothing/mask/rat/fox,
-/obj/item/clothing/mask/rat/jackal,
-/obj/item/clothing/mask/rat/raven,
-/obj/item/clothing/mask/rat/tribal,
-/obj/item/clothing/mask/frog,
-/obj/item/clothing/mask/scarecrow,
-/obj/item/clothing/mask/neorussian,
-/obj/item/clothing/mask/gondola,
-/obj/item/clothing/head/rice_hat,
-/obj/item/clothing/head/pharaoh,
-/obj/item/clothing/head/hunter,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Cv" = (
-/obj/structure/reagent_dispensers/keg/milk,
-/turf/open/floor/wood/damturf/broken3,
-/area/eventmap/inside)
-"Cx" = (
-/obj/structure/toilet{
-	dir = 4
-	},
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/mountaininside)
-"Cy" = (
-/obj/structure/table,
-/obj/item/storage/box/drinkingglasses,
-/obj/item/storage/box/drinkingglasses,
-/obj/item/storage/box/beakers,
-/obj/item/storage/box/donkpockets,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Cz" = (
-/obj/machinery/light/small{
-	dir = 8
-	},
-/obj/structure/table/wood,
-/obj/item/twohanded/required/kirbyplants{
-	icon_state = "plant-05"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"CA" = (
-/obj/structure/table/wood,
-/obj/item/reagent_containers/food/drinks/bottle/wine,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"CE" = (
-/turf/open/floor/wood/damturf/broken2,
-/area/eventmap/mountaininside)
-"CF" = (
-/obj/machinery/light{
-	dir = 1
-	},
-/obj/machinery/vending/kink,
-/turf/open/floor/wood/damturf/broken5,
-/area/eventmap/mountaininside)
-"CG" = (
-/obj/structure/closet/toolcloset,
-/obj/item/storage/belt/durathread,
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"CI" = (
-/turf/open/indestructible/cobble,
-/area/eventmap/outside)
-"CL" = (
-/obj/structure/reagent_dispensers/keg/gargle,
-/turf/open/floor/wood/damturf/broken1,
-/area/eventmap/inside)
-"CM" = (
-/obj/structure/barricade/security,
-/turf/open/indestructible/airblock,
-/area/eventmap/mountaininside)
-"CN" = (
-/obj/item/storage/fancy/cigarettes/cigpack_cannabis,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"CO" = (
-/obj/structure/healingfountain,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"CQ" = (
-/obj/item/aiModule/reset/purge,
-/obj/machinery/light/floor,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"CT" = (
-/obj/structure/closet/crate,
-/obj/item/flashlight/flare/torch,
-/obj/item/flashlight/flare/torch,
-/obj/item/flashlight/flare/torch,
-/obj/item/flashlight/flare/torch,
-/obj/item/flashlight/flare/torch,
-/obj/item/flashlight/flare/torch,
-/obj/item/flashlight/flare/torch,
-/obj/item/flashlight/flare/torch,
-/obj/item/flashlight/flare/torch,
-/obj/item/flashlight/flare/torch,
-/obj/item/flashlight/flare/torch,
-/obj/item/flashlight/flare/torch,
-/obj/item/flashlight/flare/torch,
-/obj/item/flashlight/flare/torch,
-/obj/item/flashlight/flare/torch,
-/obj/item/flashlight/flare/torch,
-/obj/item/flashlight/flare/torch,
-/obj/item/flashlight/flare/torch,
-/obj/item/flashlight/flare/torch,
-/obj/item/flashlight/flare/torch,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"CU" = (
-/obj/structure/flora/ausbushes/leafybush,
-/obj/structure/flora/tree/spookytime,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"CV" = (
-/obj/structure/fluff/bus/dense{
-	icon_state = "hoodbottom"
-	},
-/turf/open/floor/spooktime/cobble/roadmid,
-/area/eventmap/outside)
-"CW" = (
-/obj/structure/fluff/bus/dense{
-	icon_state = "frontwallbottomrear"
-	},
-/turf/open/floor/spooktime/cobble/roadmid,
-/area/eventmap/outside)
-"CX" = (
-/obj/structure/fluff/bus/dense{
-	icon_state = "frontwallbottom"
-	},
-/turf/open/floor/spooktime/cobble/roadmid,
-/area/eventmap/outside)
-"CY" = (
-/obj/structure/fluff/bus/dense{
-	icon_state = "reartire"
-	},
-/turf/open/floor/spooktime/cobble/roadmid,
-/area/eventmap/outside)
-"CZ" = (
-/obj/structure/fluff/bus/passable{
-	icon_state = "bottomdoor";
-	layer = 3
-	},
-/turf/open/floor/spooktime/cobble/roadmid,
-/area/eventmap/outside)
-"Da" = (
-/obj/structure/fluff/bus/dense{
-	icon_state = "fronttire"
-	},
-/turf/open/floor/spooktime/cobble/roadmid,
-/area/eventmap/outside)
-"De" = (
-/turf/open/floor/wood/damturf/broken3,
-/area/eventmap/inside)
-"Dh" = (
-/obj/item/pizzabox/margherita,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Dj" = (
-/obj/item/storage/fancy/cigarettes/dromedaryco,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Dk" = (
-/turf/open/floor/spooktime/beach,
-/area/eventmap/mountain)
-"Dp" = (
-/obj/structure/trap/ctf/nomech,
-/turf/open/floor/spooktime/cobble/cornerSW,
-/area/eventmap/outside)
-"Du" = (
-/obj/structure/fluff/bus/passable/seat,
-/obj/structure/window/reinforced{
-	dir = 8
-	},
-/obj/structure/chair/comfy/shuttle{
-	dir = 4;
-	icon_state = ""
-	},
-/obj/effect/landmark/start,
-/obj/machinery/light/floor{
-	alpha = 0;
-	light_range = 20;
-	max_integrity = 9999;
-	mouse_opacity = 0
-	},
-/turf/open/floor/plasteel/dark{
-	icon_state = "bus"
-	},
-/area/shuttle/arrival)
-"Dv" = (
-/obj/structure/fluff/bus/passable/seat,
-/obj/structure/chair/comfy/shuttle{
-	dir = 4;
-	icon_state = ""
-	},
-/obj/effect/landmark/start,
-/obj/machinery/light/floor{
-	alpha = 0;
-	light_range = 20;
-	max_integrity = 9999;
-	mouse_opacity = 0
-	},
-/turf/open/floor/plasteel/dark{
-	icon_state = "bus"
-	},
-/area/shuttle/arrival)
-"Dx" = (
-/obj/structure/fluff/bus/passable/seat{
-	pixel_y = 15
-	},
-/obj/structure/chair/comfy/shuttle{
-	dir = 4;
-	icon_state = ""
-	},
-/obj/effect/landmark/start,
-/obj/machinery/light/floor{
-	alpha = 0;
-	light_range = 20;
-	max_integrity = 9999;
-	mouse_opacity = 0
-	},
-/turf/open/floor/plasteel/dark{
-	icon_state = "bus"
-	},
-/area/shuttle/arrival)
-"Dy" = (
-/obj/structure/mineral_door/wood,
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
-	id = "C03"
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Dz" = (
-/obj/structure/sink/puddle,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"DB" = (
-/obj/item/reagent_containers/food/drinks/bottle/tequila,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"DC" = (
-/obj/item/reagent_containers/food/snacks/spiderlollipop,
-/obj/effect/decal/cleanable/cobweb,
-/turf/open/floor/plasteel/damturf/scorched2,
-/area/eventmap/mountaininside)
-"DD" = (
-/obj/item/storage/pill_bottle/stimulant,
-/turf/open/floor/plasteel/damturf/platdmg1,
-/area/eventmap/mountaininside)
-"DE" = (
-/obj/item/reagent_containers/pill/breast_enlargement,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"DG" = (
-/obj/structure/closet/cabinet,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"DH" = (
-/obj/structure/spacevine,
-/obj/structure/spacevine,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"DN" = (
-/obj/machinery/vending/donksofttoyvendor,
-/turf/open/floor/spooktime/cobble/cornerNE,
-/area/eventmap/outside)
-"DU" = (
-/obj/item/chair/wood,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"DX" = (
-/obj/structure/curtain{
-	color = "#B22222";
-	pixel_x = -32
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"DZ" = (
-/obj/item/coin/diamond,
-/obj/item/stack/sheet/mineral/silver,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"Eb" = (
-/obj/item/lighter,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Eg" = (
-/obj/effect/landmark/start/janitor,
-/turf/open/floor/spooktime/cobble/roadmid,
-/area/eventmap/outside)
-"Eh" = (
-/obj/structure/bed,
-/obj/item/bedsheet/cult,
-/obj/machinery/flasher{
-	id = "Cell 2";
-	pixel_x = -28
-	},
-/obj/effect/decal/cleanable/blood/gibs/old,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"El" = (
-/obj/effect/decal/cleanable/dirt,
-/obj/effect/turf_decal/tile/green,
-/obj/effect/turf_decal/tile/green{
-	dir = 8
-	},
-/turf/open/floor/plasteel/damturf/scorched1,
-/area/eventmap/inside)
-"Eo" = (
-/obj/effect/decal/cleanable/cobweb/cobweb2,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Er" = (
-/obj/machinery/button/door/dorms/luxury3{
-	id = "C03";
-	pixel_y = -24
-	},
-/turf/open/floor/wood/damturf/broken1,
-/area/eventmap/mountaininside)
-"Eu" = (
-/obj/item/storage/box/rubbershot,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Ew" = (
-/obj/structure/cable/pink{
-	icon_state = "0-5"
-	},
-/obj/structure/cable/pink{
-	icon_state = "0-9"
-	},
-/turf/open/floor/plating,
-/area/eventmap/mountain)
-"Ey" = (
-/obj/machinery/light{
-	dir = 1
-	},
-/obj/item/storage/box/rubbershot,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Ez" = (
-/obj/effect/decal/cleanable/cobweb/cobweb2,
-/turf/open/floor/spooktime/beach,
-/area/eventmap/outside)
-"EB" = (
-/obj/machinery/vending/boozeomat/all_access,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"EC" = (
-/obj/machinery/button/door/dorms/luxury3{
-	id = "C09";
-	pixel_x = -8
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"ED" = (
-/turf/closed/wall/mineral/wood,
-/area/eventmap/mountaininside)
-"EF" = (
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountaininside)
-"EG" = (
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/mountain)
-"EH" = (
-/obj/structure/closet/secure_closet/freezer/kitchen{
-	req_access = null
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"EJ" = (
-/obj/item/flashlight/glowstick/cyan,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"EK" = (
-/obj/structure/table/wood/fancy,
-/obj/item/reagent_containers/food/condiment/saltshaker,
-/obj/item/reagent_containers/food/condiment/peppermill,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"EL" = (
-/obj/item/flashlight/glowstick/orange,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"EN" = (
-/obj/item/reagent_containers/food/drinks/bottle/whiskey,
-/turf/open/floor/wood{
-	icon_state = "wood-broken5"
-	},
-/area/eventmap/inside)
-"EO" = (
-/obj/machinery/light/floor,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"ER" = (
-/obj/structure/chair/sofa/right,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"EU" = (
-/obj/structure/blob/normal{
-	color = "#777777";
-	name = "peculiar goo"
-	},
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"EV" = (
-/obj/structure/table/plasmaglass,
-/obj/item/stock_parts/cell/hyper,
-/obj/item/stock_parts/cell/hyper,
-/obj/item/stock_parts/cell/hyper,
-/obj/item/stock_parts/cell/hyper,
-/obj/item/stock_parts/cell/hyper,
-/obj/item/stock_parts/cell/hyper,
-/obj/machinery/light/floor{
-	alpha = 0;
-	light_range = 20;
-	mouse_opacity = 0
-	},
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"EW" = (
-/obj/machinery/shower{
-	desc = "Despite their age, they seem clean and capable of providing hot water just as well as their modern counterparts. Hopefully Nanotrasen cleaned the water pipes this well...";
-	pixel_y = 24
-	},
-/obj/item/clothing/head/tinfoil,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"EX" = (
-/obj/machinery/light{
-	dir = 1
-	},
-/turf/open/floor/plasteel/damturf/scorched1,
-/area/eventmap/mountaininside)
-"EZ" = (
-/obj/item/storage/pill_bottle/breast_enlargement,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"Fa" = (
-/obj/item/flashlight/glowstick/cyan,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Fb" = (
-/obj/effect/decal/cleanable/cobweb/cobweb2,
-/obj/structure/spacevine,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Fc" = (
-/obj/structure/flora/tree/spookytimexl,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"Fh" = (
-/obj/structure/mineral_door/wood,
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
-	id = "C04"
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Fi" = (
-/turf/open/floor/spooktime/beach/coasts/innerW,
-/area/eventmap/outside)
-"Fl" = (
-/obj/machinery/vending/clothing,
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Fm" = (
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/plating,
-/area/eventmap/mountaininside)
-"Fn" = (
-/obj/item/reagent_containers/food/snacks/sausage,
-/obj/structure/table/reinforced,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Fq" = (
-/obj/item/autosurgeon/penis,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Fr" = (
-/obj/machinery/rnd/production/circuit_imprinter,
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"Fw" = (
-/turf/closed/wall/rust,
-/area/eventmap/mountaininside)
-"Fy" = (
-/obj/machinery/light/small{
-	brightness = 3;
-	dir = 8
-	},
-/obj/structure/fireplace{
-	dir = 4;
-	pixel_x = -8
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Fz" = (
-/obj/structure/chair/sofa/left,
-/turf/open/floor/wood/damturf/broken5,
-/area/eventmap/inside)
-"FA" = (
-/obj/item/restraints/handcuffs,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"FC" = (
-/obj/machinery/light/small{
-	dir = 8
-	},
-/obj/item/reagent_containers/food/snacks/meat/slab/spider,
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"FE" = (
-/turf/open/floor/spooktime/beach/coasts/coastN,
-/area/eventmap/outside)
-"FF" = (
-/obj/structure/table,
-/obj/machinery/microwave,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"FG" = (
-/obj/machinery/camera/emp_proof{
-	c_tag = "Containment - Particle Accelerator";
-	dir = 1;
-	network = list("singularity")
-	},
-/turf/open/floor/wood/damturf/broken2,
-/area/eventmap/inside)
-"FJ" = (
-/obj/effect/decal/cleanable/cobweb/cobweb2,
-/obj/item/storage/fancy/cigarettes/cigpack_cannabis,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"FK" = (
-/obj/item/reagent_containers/food/snacks/pastatomato,
-/obj/structure/table/reinforced,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"FM" = (
-/obj/item/reagent_containers/food/snacks/toastedsandwich,
-/obj/structure/table/reinforced,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"FN" = (
-/obj/machinery/light/small,
-/turf/open/floor/wood/damturf/broken4,
-/area/eventmap/inside)
-"FP" = (
-/obj/machinery/light{
-	dir = 1
-	},
-/obj/machinery/button/door/dorms/luxury3{
-	id = "C04"
-	},
-/turf/open/floor/wood/damturf/broken5,
-/area/eventmap/mountaininside)
-"FQ" = (
-/obj/machinery/computer/nanite_chamber_control{
-	dir = 1
-	},
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"FR" = (
-/obj/structure/sink/kitchen{
-	pixel_y = 30
-	},
-/turf/open/floor/sepia,
-/area/eventmap/mountaininside)
-"FT" = (
-/obj/machinery/light/small{
-	dir = 4
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"FU" = (
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/mountaininside)
-"FV" = (
-/obj/item/reagent_containers/food/drinks/bottle/whiskey,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"FW" = (
-/obj/machinery/computer/rdconsole/robotics,
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"FX" = (
-/obj/machinery/camera/emp_proof,
-/obj/machinery/vending/boozeomat/all_access,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"FY" = (
-/obj/item/storage/pill_bottle/breast_enlargement,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Ga" = (
-/obj/machinery/grandfatherclock,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Gc" = (
-/obj/structure/table/reinforced,
-/turf/open/floor/plating,
-/area/eventmap/mountaininside)
-"Gd" = (
-/obj/item/reagent_containers/food/drinks/bottle/lizardwine,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountaininside)
-"Ge" = (
-/obj/structure/closet/cabinet,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Gg" = (
-/obj/structure/flora/rock/pile/icy,
-/obj/structure/flora/tree/spookytime,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"Gh" = (
-/turf/closed/indestructible/riveted/boss,
-/area/eventmap/mountaininside)
-"Gj" = (
-/obj/structure/dresser,
-/obj/effect/decal/cleanable/cobweb,
-/obj/structure/curtain{
-	color = "#B22222";
-	pixel_x = -32
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"Gk" = (
-/obj/machinery/door/airlock/survival_pod,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Gm" = (
-/obj/item/a_gift/anything,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"Gn" = (
-/obj/structure/closet/gimmick/tacticool,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Go" = (
-/obj/structure/mineral_door/wood,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Gq" = (
-/obj/structure/bed,
-/obj/item/bedsheet/pirate,
-/turf/open/floor/wood/damturf/broken6,
-/area/eventmap/mountaininside)
-"Gr" = (
-/obj/structure/flora/rock/pile/icy,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"Gu" = (
-/obj/machinery/computer/mech_bay_power_console,
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"Gv" = (
-/obj/structure/table,
-/obj/item/storage/toolbox/mechanical,
-/obj/item/stack/cable_coil,
-/obj/item/storage/box/lights/mixed,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Gw" = (
-/obj/machinery/light/small{
-	dir = 4;
-	light_color = "#d8b1b1"
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken6"
-	},
-/area/eventmap/inside)
-"Gx" = (
-/obj/structure/table,
-/obj/item/reagent_containers/food/drinks/bottle/whiskey,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Gy" = (
-/obj/item/stack/sheet/mineral/diamond,
-/obj/item/stack/sheet/mineral/plasma,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"Gz" = (
-/turf/open/floor/plasteel/damturf/scorched2,
-/area/eventmap/mountaininside)
-"GB" = (
-/obj/structure/bed,
-/obj/item/bedsheet/hop,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"GC" = (
-/obj/item/aiModule/supplied/freeform,
-/obj/machinery/light/floor,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"GD" = (
-/obj/structure/flora/tree/spookytime,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"GI" = (
-/obj/machinery/light{
-	dir = 8
-	},
-/obj/structure/table/wood/fancy,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"GJ" = (
-/obj/item/chair,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountaininside)
-"GL" = (
-/obj/item/chair/wood,
-/turf/open/floor/plasteel/damturf/scorched,
-/area/eventmap/mountaininside)
-"GM" = (
-/turf/open/floor/spooktime/cobble/roadsideE,
-/area/eventmap/outside)
-"GP" = (
-/obj/machinery/door/airlock/survival_pod,
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
-	id = "C07"
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"GS" = (
-/obj/item/chair/wood,
-/turf/open/floor/plasteel{
-	icon_state = "chapel"
-	},
-/area/eventmap/inside)
-"GT" = (
-/obj/item/clothing/mask/frog,
-/turf/open/floor/spooktime/beach/coasts/coastS,
-/area/eventmap/outside)
-"GZ" = (
-/obj/machinery/light/small{
-	dir = 1
-	},
-/obj/machinery/vending/medical{
-	req_access = null
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Hb" = (
-/obj/structure/closet/secure_closet/freezer/meat,
-/obj/item/reagent_containers/food/snacks/carpmeat,
-/obj/item/reagent_containers/food/snacks/carpmeat,
-/obj/item/reagent_containers/food/snacks/meat/slab/gorilla,
-/obj/item/reagent_containers/food/snacks/meat/slab/gorilla,
-/obj/item/reagent_containers/food/snacks/meat/slab/gondola,
-/obj/item/reagent_containers/food/snacks/meat/slab/gondola,
-/obj/item/reagent_containers/food/snacks/meat/slab/spider,
-/obj/item/reagent_containers/food/snacks/meat/slab/spider,
-/obj/item/reagent_containers/food/snacks/meat/slab/xeno,
-/obj/item/reagent_containers/food/snacks/meat/slab/xeno,
-/obj/item/reagent_containers/food/snacks/meat/slab/corgi,
-/obj/item/reagent_containers/food/snacks/meat/slab/corgi,
-/obj/item/reagent_containers/food/snacks/meat/slab/bear,
-/obj/item/reagent_containers/food/snacks/meat/slab/bear,
-/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/lizard,
-/obj/item/reagent_containers/food/snacks/meat/slab/monkey,
-/obj/item/reagent_containers/food/snacks/meat/slab/monkey,
-/obj/item/reagent_containers/food/snacks/meat/slab/pug,
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"Hc" = (
-/obj/structure/mirror{
-	pixel_x = -28
-	},
-/turf/open/floor/wood/damturf/broken2,
-/area/eventmap/inside)
-"Hd" = (
-/obj/effect/decal/cleanable/dirt,
-/obj/structure/table/reinforced,
-/obj/item/flashlight,
-/turf/open/floor/plating,
-/area/eventmap/mountaininside)
-"Hf" = (
-/obj/effect/spawner/structure/window/reinforced,
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
-	id = "C02"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Hg" = (
-/obj/item/pizzabox/vegetable,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Hh" = (
-/obj/structure/mirror{
-	pixel_x = 28
-	},
-/obj/structure/sink{
-	dir = 4;
-	pixel_x = 11
-	},
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"Hi" = (
-/obj/structure/mineral_door/wood,
-/turf/open/floor/plasteel/stairs,
-/area/eventmap/mountaininside)
-"Hj" = (
-/obj/structure/chair/comfy/beige,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Hk" = (
-/turf/open/floor/spooktime/beach/coasts/watercoastE,
-/area/eventmap/outside)
-"Hm" = (
-/obj/structure/table/wood,
-/obj/item/clothing/head/festive,
-/obj/structure/curtain{
-	color = "#B22222";
-	pixel_y = 32
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Hn" = (
-/obj/machinery/computer/nanite_cloud_controller,
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"Hp" = (
-/obj/item/storage/box/snappops,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"Ht" = (
-/obj/structure/chair/comfy/black{
-	dir = 4
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"Hv" = (
-/obj/item/reagent_containers/food/drinks/bottle/bottleofnothing,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Hw" = (
-/obj/structure/bonfire,
-/turf/open/floor/plasteel{
-	icon_state = "chapel"
-	},
-/area/eventmap/inside)
-"HD" = (
-/obj/structure/flora/ausbushes/lavendergrass,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"HE" = (
-/obj/structure/table/reinforced,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"HF" = (
-/obj/item/reagent_containers/food/snacks/khachapuri,
-/obj/structure/table/reinforced,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"HI" = (
-/turf/open/floor/spooktime/cobble/cornerNW,
-/area/eventmap/outside)
-"HN" = (
-/obj/item/chair/wood,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"HP" = (
-/obj/item/reagent_containers/food/snacks/meat/slab/pug,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"HS" = (
-/obj/structure/table/wood/fancy,
-/obj/item/clothing/head/snake,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"HU" = (
-/obj/structure/closet/secure_closet/brig{
-	id = "Cell 2";
-	name = "Cell 2 Locker"
-	},
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/item/toy/toy_dagger,
-/obj/item/clothing/suit/cultrobes,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"HV" = (
-/obj/machinery/door/window/brigdoor/security/cell{
-	id = "Cell 1";
-	name = "Cell 1"
-	},
-/obj/effect/decal/cleanable/blood/tracks,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Ia" = (
-/obj/structure/trap/ctf/nomech,
-/turf/closed/mineral/ash_rock,
-/area/eventmap/mountain)
-"Ib" = (
-/obj/machinery/light{
-	dir = 1
-	},
-/turf/open/floor/wood/damturf/broken4,
-/area/eventmap/inside)
-"Ic" = (
-/obj/item/stack/sheet/metal/fifty,
-/turf/open/floor/spooktime/beach/coasts/coastS,
-/area/eventmap/outside)
-"Ig" = (
-/obj/machinery/light{
-	dir = 1
-	},
-/obj/structure/chair/wood/wings{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Ih" = (
-/turf/open/floor/wood/damturf/broken6,
-/area/eventmap/inside)
-"Ii" = (
-/obj/item/chair/wood,
-/turf/open/floor/plasteel{
-	dir = 1;
-	icon_state = "chapel"
-	},
-/area/eventmap/inside)
-"Ik" = (
-/obj/structure/closet/athletic_mixed,
-/obj/machinery/light/small,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Il" = (
-/obj/item/chair/wood,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"In" = (
-/obj/structure/flora/grass/jungle/b{
-	icon_state = "grassa5"
-	},
-/turf/open/floor/spooktime/cobble/cornerSE,
-/area/eventmap/outside)
-"Ip" = (
-/turf/open/floor/spooktime/beach/coasts/coastSW,
-/area/eventmap/outside)
-"Iq" = (
-/turf/open/floor/sepia,
-/area/eventmap/mountaininside)
-"Is" = (
-/obj/item/storage/pill_bottle/dice,
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Iu" = (
-/obj/structure/toilet{
-	dir = 8
-	},
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/mountaininside)
-"Iv" = (
-/obj/structure/closet/cardboard,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountaininside)
-"Ix" = (
-/obj/structure/curtain{
-	color = "#B22222";
-	pixel_y = 32
-	},
-/turf/open/floor/wood{
-	icon_state = "wood-broken3"
-	},
-/area/eventmap/inside)
-"Iz" = (
-/obj/machinery/door/airlock/wood,
-/turf/open/floor/carpet,
-/area/eventmap/mountaininside)
-"IA" = (
-/obj/machinery/cryopod{
-	dir = 4
-	},
-/obj/machinery/light/small,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ID" = (
-/obj/machinery/vending/coffee,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountaininside)
-"IH" = (
-/obj/item/storage/fancy/donut_box,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"IJ" = (
-/obj/item/reagent_containers/food/snacks/pancakes,
-/obj/structure/table/reinforced,
-/turf/open/floor/plasteel/damturf/damage4,
-/area/eventmap/mountaininside)
-"IK" = (
-/obj/effect/spawner/structure/window/reinforced,
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury04,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"IO" = (
-/obj/machinery/computer/rdconsole{
-	dir = 1
-	},
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"IP" = (
-/obj/machinery/vending/kink,
-/turf/open/floor/plasteel/damturf/scorched2,
-/area/eventmap/mountaininside)
-"IQ" = (
-/obj/structure/closet/secure_closet/freezer/fridge,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"IR" = (
-/obj/structure/bonfire,
-/turf/open/floor/plasteel{
-	dir = 8;
-	icon_state = "chapel"
-	},
-/area/eventmap/inside)
-"IS" = (
-/obj/structure/closet/crate/freezer/blood,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"IT" = (
-/obj/structure/table,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"IU" = (
-/obj/structure/curtain{
-	color = "#B22222";
-	pixel_y = 32
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"IV" = (
-/obj/structure/spacevine,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"Ja" = (
-/obj/structure/mirror{
-	pixel_x = -28
-	},
-/turf/open/floor/wood/damturf/broken7,
-/area/eventmap/inside)
-"Jb" = (
-/obj/effect/decal/cleanable/cobweb,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Jc" = (
-/obj/structure/extinguisher_cabinet,
-/turf/closed/wall/mineral/wood,
-/area/eventmap/mountaininside)
-"Je" = (
-/obj/machinery/vending/tool,
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"Jk" = (
-/obj/item/reagent_containers/food/drinks/bottle/blazaam,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Jl" = (
-/turf/open/indestructible/airblock,
-/area/eventmap/mountaininside)
-"Jm" = (
-/obj/structure/mineral_door/woodrustic,
-/turf/open/floor/spooktime/cobble/cornerSW,
-/area/eventmap/outside)
-"Jn" = (
-/obj/structure/bonfire,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountaininside)
-"Jo" = (
-/obj/structure/curtain{
-	color = "#B22222";
-	pixel_y = -32
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Jq" = (
-/obj/structure/table/wood/fancy,
-/obj/item/clothing/head/hardhat/pumpkinhead/jaqc{
-	light_range = 3
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Jr" = (
-/turf/closed/wall/rust,
-/area/eventmap/mountain)
-"Jv" = (
-/obj/structure/closet/chefcloset,
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Jw" = (
-/turf/open/floor/wood/damturf/broken3,
-/area/eventmap/mountaininside)
-"Jx" = (
-/turf/closed/indestructible/rock,
-/area/eventmap/mountain)
-"Jy" = (
-/obj/machinery/light/small{
-	dir = 8
-	},
-/obj/machinery/vending/kink,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Jz" = (
-/obj/structure/table/wood,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"JC" = (
-/obj/effect/turf_decal/bot,
-/obj/machinery/shower{
-	dir = 4
-	},
-/obj/structure/mirror{
-	pixel_x = -28
-	},
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/mountaininside)
-"JF" = (
-/obj/machinery/vending/coffee,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"JG" = (
-/obj/item/pizzabox/infinite,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"JK" = (
-/turf/open/floor/spooktime/beach/coasts/innerN,
-/area/eventmap/outside)
-"JM" = (
-/turf/open/floor/wood/damturf/broken1,
-/area/eventmap/inside)
-"JN" = (
-/obj/structure/dresser,
-/obj/effect/decal/cleanable/cobweb/cobweb2,
-/obj/structure/curtain{
-	color = "#B22222";
-	pixel_x = 32
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"JR" = (
-/obj/machinery/door/window/brigdoor/security/cell{
-	id = "Cell 2";
-	name = "Cell 2"
-	},
-/obj/effect/decal/cleanable/blood/old,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"JS" = (
-/obj/machinery/button/door/dorms/luxury3{
-	id = "C07";
-	pixel_x = -8
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"JU" = (
-/turf/open/floor/spooktime/beach/coasts/innerE,
-/area/eventmap/outside)
-"JV" = (
-/obj/item/chair/wood,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"JW" = (
-/obj/item/storage/box/matches,
-/obj/machinery/light/small{
-	dir = 8
-	},
-/obj/item/shovel,
-/obj/item/flashlight/flare/torch,
-/obj/item/hatchet,
-/obj/item/pickaxe/mini,
-/obj/structure/rack,
-/obj/item/umbrella,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"JY" = (
-/obj/machinery/ore_silo,
-/obj/machinery/light/floor,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"Ka" = (
-/turf/open/floor/plasteel/damturf/damage2,
-/area/eventmap/mountaininside)
-"Kc" = (
-/obj/item/soap/syndie,
-/obj/effect/decal/cleanable/blood/old,
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/mountaininside)
-"Kd" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/structure/fireplace{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Kf" = (
-/obj/machinery/light/small{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Kg" = (
-/obj/machinery/door/airlock/wood,
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/mountaininside)
-"Kh" = (
-/obj/structure/table,
-/obj/item/storage/pill_bottle/lsd,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Ki" = (
-/turf/open/floor/plasteel/damturf/damage1,
-/area/eventmap/mountaininside)
-"Kj" = (
-/obj/machinery/light{
-	dir = 8
-	},
-/obj/structure/table,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Kl" = (
-/obj/effect/landmark/start/ai,
-/obj/machinery/light/floor,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"Km" = (
-/turf/open/floor/plasteel/damturf/platdmg2,
-/area/eventmap/inside)
-"Kp" = (
-/obj/machinery/light/floor,
-/obj/item/stack/sheet/glass/fifty{
-	amount = 10000;
-	max_amount = 10000
-	},
-/obj/item/stack/sheet/bluespace_crystal{
-	amount = 10000;
-	max_amount = 10000
-	},
-/obj/item/stack/sheet/metal{
-	amount = 10000;
-	max_amount = 10000
-	},
-/obj/item/stack/sheet/mineral/diamond{
-	amount = 10000;
-	max_amount = 10000
-	},
-/obj/item/stack/sheet/mineral/gold{
-	amount = 10000;
-	max_amount = 10000
-	},
-/obj/item/stack/sheet/mineral/plasma{
-	amount = 10000;
-	max_amount = 10000
-	},
-/obj/item/stack/sheet/mineral/silver{
-	amount = 10000;
-	max_amount = 10000
-	},
-/obj/item/stack/sheet/mineral/titanium{
-	amount = 10000;
-	max_amount = 10000
-	},
-/obj/item/stack/sheet/mineral/uranium{
-	amount = 10000;
-	max_amount = 10000
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"Kq" = (
-/turf/open/floor/spooktime/cobble/roadsideS,
-/area/eventmap/outside)
-"Kt" = (
-/obj/item/reagent_containers/pill/stimulant,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Ku" = (
-/obj/structure/closet/crate,
-/obj/item/clothing/head/snake,
-/obj/item/clothing/head/pirate,
-/obj/item/clothing/head/santa,
-/obj/item/clothing/head/naziofficer,
-/obj/item/clothing/head/magus,
-/obj/item/clothing/head/mailman,
-/obj/item/clothing/head/griffin,
-/obj/item/clothing/head/bearpelt,
-/obj/item/clothing/head/beret,
-/obj/item/clothing/head/bowler,
-/obj/item/clothing/head/fedora,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Kv" = (
-/obj/structure/table/wood/fancy/purple,
-/obj/item/reagent_containers/food/condiment/saltshaker,
-/obj/item/reagent_containers/food/condiment/peppermill,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Kw" = (
-/obj/item/storage/box/ingredients/sweets,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"Kx" = (
-/obj/machinery/door/airlock/silver{
-	name = "Bathroom"
-	},
-/turf/open/floor/sepia,
-/area/eventmap/mountaininside)
-"Ky" = (
-/obj/item/reagent_containers/food/drinks/bottle/lizardwine,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Kz" = (
-/obj/structure/urinal{
-	pixel_y = 32
-	},
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/mountaininside)
-"KA" = (
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"KB" = (
-/obj/machinery/light{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"KC" = (
-/obj/item/reagent_containers/food/drinks/bottle/lizardwine,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"KD" = (
-/obj/machinery/nanite_programmer,
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"KG" = (
-/obj/machinery/vending/snack/random,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"KJ" = (
-/obj/structure/chair/comfy/beige{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"KM" = (
-/obj/machinery/button/door/dorms/luxury3{
-	id = "C11";
-	pixel_y = -24
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"KP" = (
-/turf/open/floor/spooktime/cobble/sideN,
-/area/eventmap/outside)
-"KQ" = (
-/turf/open/floor/spooktime/beach/coasts/coastE,
-/area/eventmap/outside)
-"KR" = (
-/obj/structure/table,
-/obj/item/storage/box/ingredients/american,
-/obj/item/storage/box/ingredients/fiesta,
-/obj/item/storage/box/ingredients/grains,
-/obj/item/storage/box/ingredients/fruity,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"KS" = (
-/turf/open/floor/spooktime/cobble/cornerNE,
-/area/eventmap/outside)
-"KY" = (
-/obj/machinery/light,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"KZ" = (
-/obj/machinery/light/small{
-	brightness = 3;
-	dir = 8
-	},
-/turf/open/floor/carpet,
-/area/eventmap/mountaininside)
-"La" = (
-/obj/item/chair/wood,
-/turf/open/floor/plasteel{
-	dir = 4;
-	icon_state = "chapel"
-	},
-/area/eventmap/inside)
-"Ld" = (
-/obj/effect/spawner/structure/window/reinforced,
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury01,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Lg" = (
-/obj/item/autosurgeon/gloweyes,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Lh" = (
-/obj/effect/decal/cleanable/cobweb,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Lk" = (
-/obj/structure/mineral_door/wood,
-/turf/open/floor/wood/damturf/broken7,
-/area/eventmap/inside)
-"Ll" = (
-/obj/structure/sign/poster/official/no_erp,
-/turf/closed/wall/rust,
-/area/eventmap/mountaininside)
-"Lr" = (
-/obj/machinery/shower{
-	dir = 8;
-	pixel_y = -4
-	},
-/obj/effect/turf_decal/bot,
-/turf/open/floor/sepia,
-/area/eventmap/mountaininside)
-"Lt" = (
-/obj/effect/decal/cleanable/cobweb/cobweb2,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountaininside)
-"Lv" = (
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/wood/damturf/broken3,
-/area/eventmap/inside)
-"Lw" = (
-/obj/item/chair/wood/wings,
-/turf/open/floor/plasteel{
-	dir = 1;
-	icon_state = "chapel"
-	},
-/area/eventmap/inside)
-"Lx" = (
-/obj/item/coin/antagtoken,
-/obj/structure/closet/crate/trashcart/moneywish,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"Ly" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/wood/damturf/broken2,
-/area/eventmap/inside)
-"LA" = (
-/obj/item/chair/wood,
-/turf/open/floor/plasteel{
-	dir = 8;
-	icon_state = "chapel"
-	},
-/area/eventmap/inside)
-"LC" = (
-/obj/structure/closet/secure_closet/freezer/cream_pie,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"LF" = (
-/obj/item/chair,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"LG" = (
-/obj/item/reagent_containers/food/drinks/bottle/whiskey,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"LL" = (
-/obj/structure/table/wood/fancy,
-/obj/item/candle/infinite{
-	pixel_x = -8
-	},
-/obj/item/reagent_containers/food/snacks/meat/steak{
-	pixel_y = 16
-	},
-/obj/item/candle/infinite{
-	pixel_x = 8
-	},
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/mountain)
-"LM" = (
-/obj/structure/spacevine,
-/turf/open/floor/spooktime/beach/watersolid,
-/area/eventmap/mountain)
-"LN" = (
-/obj/item/storage/box/techsslug,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"LQ" = (
-/obj/structure/bed,
-/obj/item/bedsheet/blue,
-/turf/open/floor/carpet,
-/area/eventmap/mountaininside)
-"LR" = (
-/obj/structure/curtain{
-	color = "#B22222";
-	pixel_x = 32
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"LU" = (
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/outside)
-"LV" = (
-/obj/item/stack/sheet/mineral/diamond,
-/obj/item/stack/sheet/mineral/adamantine,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"LW" = (
-/obj/structure/spacevine,
-/turf/open/floor/spooktime/beach/coasts/innerS,
-/area/eventmap/outside)
-"LY" = (
-/obj/machinery/button/door/dorms/luxury3{
-	id = "C10";
-	pixel_x = 24;
-	pixel_y = -12
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"LZ" = (
-/obj/item/storage/fancy/cigarettes/cigpack_mindbreaker,
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Ma" = (
-/obj/item/chair/wood/wings,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Mb" = (
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/sepia,
-/area/eventmap/mountaininside)
-"Mc" = (
-/obj/item/scythe,
-/turf/open/floor/wood{
-	icon_state = "wood-broken5"
-	},
-/area/eventmap/inside)
-"Md" = (
-/obj/structure/table/wood,
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"Mh" = (
-/turf/open/floor/spooktime/beach/coasts/watercoastSE,
-/area/eventmap/outside)
-"Ml" = (
-/obj/structure/chair/sofa/right,
-/obj/item/storage/daki,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Mn" = (
-/obj/machinery/light/small{
-	dir = 8
-	},
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Mo" = (
-/obj/machinery/mecha_part_fabricator,
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"Mp" = (
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Mq" = (
-/obj/machinery/light/floor{
-	alpha = 0;
-	light_range = 20;
-	mouse_opacity = 0
-	},
-/obj/machinery/light/floor{
-	alpha = 0;
-	light_range = 20;
-	mouse_opacity = 0
-	},
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"Mu" = (
-/obj/item/storage/fancy/rollingpapers,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"My" = (
-/obj/structure/table/plasmaglass,
-/obj/item/integrated_electronics/analyzer,
-/obj/item/integrated_electronics/debugger,
-/obj/item/integrated_electronics/detailer,
-/obj/item/integrated_electronics/wirer,
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"Mz" = (
-/obj/structure/bookcase/manuals/medical,
-/turf/closed/wall/mineral/wood,
-/area/eventmap/mountaininside)
-"MB" = (
-/obj/item/reagent_containers/food/urinalcake,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"ME" = (
-/turf/open/floor/carpet/red,
-/area/eventmap/mountaininside)
-"MH" = (
-/obj/item/flashlight/flare/torch,
-/turf/open/floor/spooktime/riverwatermotion,
-/area/eventmap/outside)
-"MK" = (
-/obj/machinery/processor,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"MM" = (
-/obj/structure/flora/tree/jungle,
-/turf/open/floor/spooktime/cobble,
-/area/eventmap/outside)
-"MN" = (
-/obj/effect/landmark/start/assistant,
-/turf/open/floor/spooktime/cobble/roadsideS,
-/area/eventmap/outside)
-"MR" = (
-/obj/item/switchblade,
-/turf/open/floor/wood{
-	icon_state = "wood-broken2"
-	},
-/area/eventmap/inside)
-"MS" = (
-/obj/structure/table,
-/obj/item/storage/pill_bottle/penis_enlargement,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"MW" = (
-/obj/machinery/light/floor{
-	alpha = 0;
-	light_range = 20;
-	max_integrity = 9999;
-	mouse_opacity = 0
-	},
-/obj/machinery/vending/tool,
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"MX" = (
-/obj/item/storage/pill_bottle/breast_enlargement,
-/turf/open/floor/plasteel/damturf/scorched,
-/area/eventmap/mountaininside)
-"Na" = (
-/obj/machinery/vending/coffee,
-/turf/open/floor/wood/damturf/broken6,
-/area/eventmap/mountaininside)
-"Nb" = (
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
-	id = "C05"
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Ne" = (
-/obj/structure/table,
-/obj/machinery/chem_dispenser/drinks/beer,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Nf" = (
-/obj/item/chair/wood,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"Ng" = (
-/obj/structure/table/wood,
-/obj/item/reagent_containers/food/drinks/mug/coco,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Nl" = (
-/obj/structure/closet/athletic_mixed,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Nn" = (
-/obj/item/reagent_containers/food/condiment/mayonnaise,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"Nq" = (
-/obj/structure/chair/wood/wings{
-	dir = 4
-	},
-/obj/item/toy/plush/lizardplushie/durgit,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/mountain)
-"Nt" = (
-/obj/item/scythe,
-/obj/structure/curtain{
-	color = "#B22222";
-	pixel_y = 32
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Nv" = (
-/obj/structure/spacevine,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/outside)
-"Nw" = (
-/obj/structure/closet/crate/trashcart,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"Nz" = (
-/obj/structure/barricade/sandbags,
-/turf/open/indestructible/airblock,
-/area/eventmap/mountaininside)
-"NA" = (
-/obj/item/storage/fancy/heart_box,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"NC" = (
-/obj/structure/holohoop{
-	dir = 1
-	},
-/turf/open/floor/spooktime/cobble/roadmid,
-/area/eventmap/outside)
-"NF" = (
-/obj/effect/decal/cleanable/cobweb/cobweb2,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"NG" = (
-/obj/structure/chair/sofa,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"NH" = (
-/obj/structure/bed,
-/obj/item/bedsheet/black,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"NI" = (
-/obj/item/bedsheet/blue,
-/obj/structure/bed,
-/turf/open/floor/carpet/green,
-/area/eventmap/mountaininside)
-"NJ" = (
-/obj/structure/mirror{
-	pixel_x = 28
-	},
-/obj/structure/sink{
-	dir = 4;
-	pixel_x = 11
-	},
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/mountaininside)
-"NK" = (
-/obj/structure/mirror{
-	pixel_x = -28
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"NL" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/wood/damturf/broken4,
-/area/eventmap/inside)
-"NN" = (
-/obj/structure/dresser,
-/obj/structure/curtain{
-	color = "#B22222";
-	pixel_x = 32
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"NO" = (
-/obj/machinery/light/floor,
-/obj/machinery/telecomms/bus{
-	appearance_flags = "bus mainframe (NULL)";
-	freq_listening = list(1347,1349,1351,1353,1355,1357,1359,1447)
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"NR" = (
-/obj/machinery/door/airlock/wood/glass,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"NS" = (
-/obj/structure/spacevine,
-/obj/structure/spacevine,
-/obj/structure/spacevine,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"NT" = (
-/obj/structure/table/plasmaglass,
-/obj/item/stock_parts/cell/hyper,
-/obj/item/stock_parts/cell/hyper,
-/obj/item/stock_parts/cell/hyper,
-/obj/item/stock_parts/cell/hyper,
-/obj/item/stock_parts/cell/hyper,
-/obj/item/stock_parts/cell/hyper,
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"NX" = (
-/obj/structure/reagent_dispensers/cooking_oil,
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"Oa" = (
-/obj/machinery/vending/medical{
-	req_access = null
-	},
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Ob" = (
-/obj/machinery/light{
-	dir = 1
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Of" = (
-/obj/structure/dresser,
-/obj/structure/curtain{
-	color = "#B22222";
-	pixel_x = -32
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"Oh" = (
-/obj/machinery/light/small,
-/turf/open/floor/wood/damturf/broken3,
-/area/eventmap/inside)
-"Oj" = (
-/obj/structure/toilet{
-	dir = 4
-	},
-/turf/open/floor/sepia,
-/area/eventmap/mountaininside)
-"Ok" = (
-/obj/machinery/light,
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/mountaininside)
-"Ow" = (
-/obj/structure/bed,
-/obj/item/bedsheet/random,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Oy" = (
-/turf/open/floor/spooktime/beach/coasts/watercoastNW,
-/area/eventmap/outside)
-"Oz" = (
-/obj/machinery/light/floor,
-/obj/machinery/telecomms/processor{
-	appearance_flags = "processor unit";
-	freq_listening = list(1347,1349,1351,1353,1355,1357,1359,1447);
-	name = "processor unit (NULL)"
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"OC" = (
-/turf/open/floor/plasteel/damturf/platdmg3,
-/area/eventmap/mountaininside)
-"OD" = (
-/obj/structure/fluff/broken_flooring,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"OJ" = (
-/obj/structure/sign/poster/official/no_erp,
-/turf/closed/wall/mineral/wood,
-/area/eventmap/inside)
-"OL" = (
-/obj/effect/spawner/structure/window/reinforced,
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
-	id = "C01"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ON" = (
-/obj/effect/decal/cleanable/cobweb/cobweb2,
-/obj/structure/table/wood,
-/obj/structure/bedsheetbin/towel,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"OO" = (
-/obj/structure/table,
-/obj/machinery/reagentgrinder,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"OQ" = (
-/obj/item/clothing/accessory/skullcodpiece,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/inside)
-"OR" = (
-/obj/structure/table,
-/obj/machinery/light{
-	dir = 1
-	},
-/obj/machinery/chem_dispenser/drinks,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"OU" = (
-/obj/structure/table/wood/fancy,
-/obj/item/clothing/head/HoS/beret/syndicate,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"OW" = (
-/obj/structure/table/wood,
-/obj/item/storage/firstaid/brute,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Pb" = (
-/obj/structure/bed,
-/obj/item/bedsheet/black,
-/turf/open/floor/carpet/purple,
-/area/eventmap/mountaininside)
-"Pc" = (
-/obj/structure/bookcase/random,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Pd" = (
-/obj/machinery/computer/rdconsole,
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"Pi" = (
-/turf/closed/indestructible/riveted/hierophant,
-/area/eventmap/mountaininside)
-"Pj" = (
-/obj/structure/filingcabinet/chestdrawer,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Pl" = (
-/obj/structure/rack,
-/obj/item/stack/sheet/mineral/wood/fifty,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Pm" = (
-/obj/item/candle/infinite,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"Po" = (
-/obj/structure/table/reinforced,
-/obj/item/storage/toolbox/syndicate,
-/obj/item/storage/toolbox/gold_real,
-/obj/item/storage/toolbox/syndicate,
-/obj/item/storage/toolbox/gold_real,
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"Pr" = (
-/obj/structure/flora/grass/jungle/b,
-/turf/open/floor/spooktime/cobble/sideS,
-/area/eventmap/outside)
-"Ps" = (
-/obj/structure/chair/wood/normal{
-	dir = 4
-	},
-/obj/structure/curtain{
-	color = "#B22222";
-	pixel_y = 32
-	},
-/turf/open/floor/carpet/red,
-/area/eventmap/inside)
-"Pv" = (
-/obj/machinery/door/airlock/vault{
-	name = "Mecha Battleground"
-	},
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"Px" = (
-/obj/machinery/light{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"PA" = (
-/obj/item/skub,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"PB" = (
-/turf/open/floor/plasteel/damturf/platdmg3,
-/area/eventmap/inside)
-"PC" = (
-/obj/structure/table,
-/obj/machinery/microwave,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"PD" = (
-/obj/machinery/rnd/production/protolathe/department/science{
-	acted_explosions = "Dumbasses";
-	allowed_department_flags = 126;
-	name = "department protolathe (Dumb powergamers)"
-	},
-/obj/machinery/light/floor,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"PI" = (
-/obj/structure/spacevine,
-/turf/open/floor/spooktime/beach,
-/area/eventmap/outside)
-"PJ" = (
-/obj/item/soap/homemade,
-/turf/open/floor/sepia,
-/area/eventmap/mountaininside)
-"PK" = (
-/obj/item/clothing/neck/petcollar,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"PL" = (
-/obj/structure/fluff/broken_flooring,
-/turf/open/floor/plating,
-/area/eventmap/mountaininside)
-"PM" = (
-/obj/machinery/recycler/lumbermill,
-/turf/open/floor/plating,
-/area/eventmap/mountaininside)
-"PO" = (
-/turf/open/floor/plasteel/damturf/platdmg2,
-/area/eventmap/mountaininside)
-"PP" = (
-/obj/machinery/door/airlock/abandoned{
-	name = "Filthy Powergame Shack"
-	},
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountaininside)
-"PS" = (
-/obj/effect/turf_decal/tile/green,
-/obj/effect/turf_decal/tile/green{
-	dir = 8
-	},
-/turf/open/floor/plasteel/damturf/scorched1,
-/area/eventmap/inside)
-"PT" = (
-/turf/closed/wall,
-/area/eventmap/mountaininside)
-"PY" = (
-/obj/item/reagent_containers/food/drinks/bottle/grappa,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Qa" = (
-/obj/structure/cable/pink{
-	icon_state = "2-5"
-	},
-/turf/open/floor/plating,
-/area/eventmap/mountain)
-"Qd" = (
-/obj/item/lighter/gold,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Qe" = (
-/turf/open/floor/carpet/green,
-/area/eventmap/mountaininside)
-"Qf" = (
-/obj/structure/table/plasmaglass,
-/obj/item/storage/backpack/duffelbag/sec/surgery,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Qg" = (
-/obj/structure/bookcase/manuals/research_and_development,
-/turf/closed/wall/mineral/wood,
-/area/eventmap/mountaininside)
-"Qi" = (
-/obj/structure/chair/sofa/left{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Qk" = (
-/obj/structure/cable/pink{
-	icon_state = "1-10"
-	},
-/turf/open/floor/plating,
-/area/eventmap/mountain)
-"Ql" = (
-/obj/item/flashlight/lantern{
-	anchored = 1;
-	can_be_unanchored = 1;
-	light_color = "#EE9933";
-	light_range = 5;
-	on = 1
-	},
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"Qq" = (
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Qs" = (
-/obj/structure/bed,
-/obj/item/bedsheet/purple,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Qv" = (
-/obj/structure/cable/pink{
-	icon_state = "2-9"
-	},
-/turf/open/floor/plating,
-/area/eventmap/mountain)
-"Qx" = (
-/obj/structure/table/wood,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Qy" = (
-/obj/structure/table/wood/fancy/orange,
-/obj/item/storage/box/drinkingglasses,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"Qz" = (
-/obj/item/reagent_containers/food/snacks/roastparsnip,
-/obj/structure/table/reinforced,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"QD" = (
-/obj/item/gun/energy/e_gun/stun,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"QF" = (
-/obj/machinery/washing_machine,
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/mountaininside)
-"QG" = (
-/obj/structure/sink{
-	dir = 8;
-	pixel_x = -12
-	},
-/obj/structure/mirror{
-	pixel_x = -28
-	},
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/mountaininside)
-"QI" = (
-/obj/structure/bookcase/random/adult,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"QJ" = (
-/obj/structure/table/wood/fancy/orange,
-/obj/item/storage/box/drinkingglasses,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"QK" = (
-/turf/open/floor/spooktime/beach,
-/area/eventmap/outside)
-"QP" = (
-/obj/structure/table/plasmaglass,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"QS" = (
-/obj/structure/table,
-/obj/item/reagent_containers/food/drinks/bottle/tequila,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"QU" = (
-/obj/structure/table,
-/obj/machinery/light{
-	dir = 1
-	},
-/obj/item/book/manual/wiki/barman_recipes,
-/obj/item/book/granter/action/drink_fling,
-/obj/item/reagent_containers/food/drinks/shaker,
-/obj/item/reagent_containers/rag,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"QV" = (
-/obj/structure/dresser,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"QW" = (
-/obj/item/reagent_containers/food/snacks/khinkali,
-/obj/structure/table/reinforced,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"QX" = (
-/obj/structure/table,
-/obj/item/reagent_containers/food/drinks/bottle/champagne,
-/obj/machinery/button/door/dorms/luxury3{
-	id = "C08";
-	pixel_y = -24
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"QY" = (
-/obj/machinery/washing_machine,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Ra" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"Rc" = (
-/obj/item/reagent_containers/food/drinks/bottle/absinthe,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Re" = (
-/obj/item/restraints/handcuffs,
-/turf/open/floor/carpet/red,
-/area/eventmap/mountaininside)
-"Rg" = (
-/obj/effect/decal/cleanable/crayon,
-/obj/machinery/light/small{
-	dir = 4;
-	light_color = "#d8b1b1"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Ri" = (
-/obj/structure/fluff/broken_flooring,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountaininside)
-"Rk" = (
-/obj/item/storage/fancy/cigarettes,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Rm" = (
-/turf/open/floor/plasteel/damturf/damage5,
-/area/eventmap/mountaininside)
-"Rp" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/obj/structure/curtain{
-	color = "#B22222";
-	pixel_x = 32
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Rq" = (
-/obj/machinery/light/small{
-	dir = 4
-	},
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/mountaininside)
-"Rr" = (
-/obj/structure/flora/grass/jungle/b,
-/turf/open/floor/spooktime/cobble/sideN,
-/area/eventmap/outside)
-"Rv" = (
-/obj/structure/flora/junglebush,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"Rw" = (
-/obj/machinery/door/airlock/wood,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Ry" = (
-/obj/item/stack/sheet/metal/fifty,
-/turf/open/floor/spooktime/beach,
-/area/eventmap/outside)
-"Rz" = (
-/obj/machinery/door/airlock/survival_pod,
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
-	id = "C08"
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"RB" = (
-/turf/open/floor/plating,
-/area/eventmap/mountaininside)
-"RE" = (
-/obj/item/reagent_containers/food/drinks/trophy/gold_cup,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"RJ" = (
-/obj/item/radio/intercom{
-	desc = "Talk through this. It looks like it has been modified to not broadcast.";
-	name = "Prison Intercom (General)";
-	pixel_x = -25;
-	pixel_y = -2;
-	prison_radio = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"RL" = (
-/obj/item/stack/sheet/metal/fifty,
-/turf/open/floor/spooktime/beach/coasts/coastNE,
-/area/eventmap/outside)
-"RO" = (
-/obj/structure/cable/pink{
-	icon_state = "4-10"
-	},
-/turf/open/floor/plating,
-/area/eventmap/mountain)
-"RP" = (
-/turf/open/floor/wood/damturf/broken2,
-/area/eventmap/inside)
-"RQ" = (
-/obj/machinery/computer/rdconsole/core,
-/obj/machinery/light/floor,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"RS" = (
-/turf/open/floor/plasteel/damturf/damage4,
-/area/eventmap/mountaininside)
-"RV" = (
-/turf/open/floor/spooktime/beach/coasts/watercoastS,
-/area/eventmap/outside)
-"RX" = (
-/obj/structure/closet/cabinet,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Sb" = (
-/obj/item/scythe,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Sc" = (
-/obj/structure/healingfountain,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Se" = (
-/obj/effect/decal/cleanable/dirt,
-/obj/machinery/vending/clothing,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Sf" = (
-/obj/item/flashlight/flare/torch,
-/obj/item/flashlight/flare/torch,
-/obj/item/umbrella,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Sg" = (
-/obj/effect/decal/cleanable/dirt,
-/obj/item/chair/stool,
-/turf/open/floor/plating,
-/area/eventmap/mountaininside)
-"Si" = (
-/obj/structure/closet{
-	name = "Official Clothing"
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Sj" = (
-/obj/item/chair/stool,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Sl" = (
-/obj/structure/bonfire,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Sn" = (
-/obj/machinery/nanite_program_hub,
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"Sq" = (
-/obj/machinery/autolathe/hacked,
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"St" = (
-/obj/item/storage/pill_bottle/zoom,
-/turf/open/floor/plasteel/damturf/scorched1,
-/area/eventmap/mountaininside)
-"Sw" = (
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/spooktime/cobble,
-/area/eventmap/outside)
-"Sy" = (
-/obj/effect/decal/cleanable/cobweb,
-/turf/open/floor/spooktime/cobble,
-/area/eventmap/outside)
-"SB" = (
-/obj/structure/table/wood/fancy,
-/obj/item/clothing/head/hardhat/pumpkinhead/jaqc{
-	light_range = 3
-	},
-/turf/open/floor/wood/damturf/broken5,
-/area/eventmap/inside)
-"SF" = (
-/obj/structure/curtain{
-	color = "#B22222";
-	pixel_x = -32
-	},
-/turf/open/floor/wood/damturf/broken5,
-/area/eventmap/inside)
-"SH" = (
-/obj/machinery/button/door/dorms/luxury3{
-	id = "C01";
-	pixel_x = -8
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"SK" = (
-/obj/item/storage/daki,
-/turf/open/floor/plasteel/damturf/scorched2,
-/area/eventmap/mountaininside)
-"SN" = (
-/obj/structure/bonfire,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"SP" = (
-/obj/machinery/light{
-	dir = 8
-	},
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"SR" = (
-/obj/item/flashlight/flare,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"SS" = (
-/obj/item/storage/box/ingredients/vegetarian,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"ST" = (
-/obj/structure/table/wood/fancy,
-/obj/item/reagent_containers/food/snacks/pastatomato,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"SU" = (
-/obj/machinery/rnd/production/protolathe/department/science{
-	acted_explosions = "Dumbasses";
-	allowed_department_flags = 126;
-	name = "department protolathe (Dumb powergamers)"
-	},
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"SV" = (
-/obj/structure/table/reinforced,
-/obj/item/twohanded/binoculars,
-/turf/open/floor/plating,
-/area/eventmap/mountaininside)
-"SW" = (
-/obj/item/a_gift/anything,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Td" = (
-/obj/structure/table/wood/fancy,
-/obj/item/clothing/head/scarecrow_hat,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Te" = (
-/obj/structure/mirror{
-	pixel_x = 28
-	},
-/turf/open/floor/sepia,
-/area/eventmap/mountaininside)
-"Ti" = (
-/obj/structure/chair/sofa/left,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Tl" = (
-/obj/item/reagent_containers/food/snacks/meat/slab/pug,
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"Tm" = (
-/obj/structure/sink/puddle,
-/turf/open/floor/spooktime/beach,
-/area/eventmap/outside)
-"Tn" = (
-/obj/item/integrated_circuit_printer,
-/obj/structure/table/plasmaglass,
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"Tp" = (
-/obj/effect/decal/cleanable/cobweb,
-/obj/machinery/vending/kink,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Tr" = (
-/obj/structure/curtain{
-	color = "#B22222";
-	pixel_x = 32
-	},
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"Tu" = (
-/obj/item/reagent_containers/food/drinks/bottle/champagne,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Tv" = (
-/obj/structure/trap/ctf/nomech,
-/turf/open/floor/spooktime/cobble/cornerSE,
-/area/eventmap/outside)
-"Tw" = (
-/turf/open/floor/spooktime/beach/water,
-/area/eventmap/outside)
-"Tx" = (
-/obj/item/fugu_gland,
-/turf/open/floor/spooktime/beach/coasts/coastN,
-/area/eventmap/outside)
-"TC" = (
-/obj/machinery/vending/kink,
-/obj/machinery/light/small{
-	brightness = 3;
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"TE" = (
-/obj/structure/table/optable,
-/obj/effect/decal/cleanable/blood/old,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"TF" = (
-/obj/structure/bonfire,
-/turf/open/floor/plasteel{
-	dir = 4;
-	icon_state = "chapel"
-	},
-/area/eventmap/inside)
-"TG" = (
-/obj/structure/flora/grass/jungle/b,
-/obj/structure/flora/tree/jungle,
-/turf/open/floor/spooktime/nonspooktimegrass,
-/area/eventmap/outside)
-"TH" = (
-/obj/machinery/light/small,
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/mountaininside)
-"TJ" = (
-/obj/structure/closet,
-/obj/item/clothing/suit/hooded/wintercoat/miner,
-/obj/item/clothing/shoes/sneakers/brown,
-/obj/item/clothing/under/pants/classicjeans,
-/obj/item/clothing/neck/scarf,
-/obj/item/clothing/neck/stripedgreenscarf,
-/obj/item/toy/tennis/rainbow,
-/obj/item/toy/tennis,
-/obj/item/clothing/suit/hooded/wintercoat/miner,
-/obj/item/clothing/shoes/sneakers/brown,
-/obj/item/clothing/under/pants/classicjeans,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"TM" = (
-/obj/item/soap/syndie,
-/turf/open/floor/sepia,
-/area/eventmap/mountaininside)
-"TN" = (
-/obj/item/storage/firstaid/tactical,
-/turf/open/floor/plasteel/damturf/platdmg1,
-/area/eventmap/mountaininside)
-"TO" = (
-/obj/item/stack/sheet/metal/fifty,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"TQ" = (
-/obj/structure/flora/junglebush{
-	icon_state = "busha1"
-	},
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"TR" = (
-/obj/machinery/light/floor,
-/obj/machinery/telecomms/message_server,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"TS" = (
-/obj/structure/sign/departments/restroom{
-	pixel_y = 32
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"TT" = (
-/obj/structure/sign/barsign,
-/turf/closed/wall/mineral/wood,
-/area/eventmap/mountaininside)
-"TU" = (
-/obj/machinery/power/port_gen/pacman/mrs,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"TV" = (
-/obj/machinery/computer/mech_bay_power_console{
-	dir = 1
-	},
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"TW" = (
-/obj/structure/table/wood,
-/obj/item/stamp/denied{
-	pixel_x = -2;
-	pixel_y = 2
-	},
-/obj/item/stamp,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"TX" = (
-/turf/open/floor/plasteel/damturf/scorched1,
-/area/eventmap/mountaininside)
-"Uc" = (
-/obj/structure/closet/secure_closet/freezer/meat,
-/obj/item/reagent_containers/food/snacks/carpmeat,
-/obj/item/reagent_containers/food/snacks/carpmeat,
-/obj/item/reagent_containers/food/snacks/meat/slab/gorilla,
-/obj/item/reagent_containers/food/snacks/meat/slab/gorilla,
-/obj/item/reagent_containers/food/snacks/meat/slab/gondola,
-/obj/item/reagent_containers/food/snacks/meat/slab/gondola,
-/obj/item/reagent_containers/food/snacks/meat/slab/spider,
-/obj/item/reagent_containers/food/snacks/meat/slab/spider,
-/obj/item/reagent_containers/food/snacks/meat/slab/xeno,
-/obj/item/reagent_containers/food/snacks/meat/slab/xeno,
-/obj/item/reagent_containers/food/snacks/meat/slab/corgi,
-/obj/item/reagent_containers/food/snacks/meat/slab/corgi,
-/obj/item/reagent_containers/food/snacks/meat/slab/bear,
-/obj/item/reagent_containers/food/snacks/meat/slab/bear,
-/obj/item/reagent_containers/food/snacks/meat/slab/human/mutant/lizard,
-/obj/item/reagent_containers/food/snacks/meat/slab/monkey,
-/obj/item/reagent_containers/food/snacks/meat/slab/monkey,
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"Ue" = (
-/obj/item/flashlight/seclite,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Uf" = (
-/obj/structure/flora/ausbushes/lavendergrass,
-/obj/structure/flora/tree/spookytimexl,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"Ug" = (
-/obj/item/storage/box/stunslug,
-/obj/item/storage/box/stunslug,
-/obj/item/storage/box/stunslug,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Ui" = (
-/obj/item/storage/pill_bottle/zoom,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Uj" = (
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Ul" = (
-/obj/structure/table,
-/obj/item/clothing/mask/gas,
-/obj/machinery/light/small{
-	dir = 1
-	},
-/obj/item/clothing/glasses/sunglasses/big,
-/obj/item/clothing/glasses/sunglasses/big,
-/obj/item/clothing/glasses/sunglasses/big,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Un" = (
-/obj/structure/cable/pink{
-	icon_state = "5-10"
-	},
-/turf/open/floor/plating,
-/area/eventmap/mountain)
-"Uo" = (
-/obj/machinery/light/floor,
-/obj/machinery/telecomms/processor{
-	freq_listening = list(1359,1441)
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"Up" = (
-/obj/structure/chair/wood,
-/turf/open/floor/wood/damturf/broken1,
-/area/eventmap/inside)
-"Ur" = (
-/turf/open/floor/plasteel/damturf/platdmg1,
-/area/eventmap/mountaininside)
-"Ut" = (
-/obj/item/stack/sheet/mineral/bananium,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"Uu" = (
-/obj/item/storage/firstaid/ancient,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Ux" = (
-/obj/structure/chair/wood/wings{
-	dir = 8
-	},
-/obj/item/toy/plush/snakeplushie/sasha,
-/turf/open/floor/carpet/royalblack,
-/area/eventmap/mountain)
-"Uy" = (
-/turf/open/floor/spooktime/beach/watersolid,
-/area/eventmap/outside)
-"Uz" = (
-/obj/structure/flora/grass/jungle/b{
-	icon_state = "grassa1"
-	},
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/outside)
-"UA" = (
-/obj/item/gun/energy/pumpaction/defender,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"UD" = (
-/obj/structure/table,
-/obj/item/reagent_containers/food/drinks/bottle/kahlua,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"UE" = (
-/obj/item/reagent_containers/food/drinks/bottle/rum,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"UK" = (
-/turf/open/floor/plasteel/damturf/scorched,
-/area/eventmap/mountaininside)
-"UL" = (
-/obj/structure/spacevine,
-/obj/structure/spacevine,
-/turf/open/floor/spooktime/beach/watersolid,
-/area/eventmap/mountain)
-"UM" = (
-/obj/item/storage/pill_bottle/lsd,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"UW" = (
-/obj/machinery/light/floor{
-	alpha = 0;
-	light_range = 20;
-	max_integrity = 9999;
-	mouse_opacity = 0
-	},
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"UX" = (
-/obj/machinery/button/door/dorms/luxury3{
-	id = "C05";
-	pixel_y = -24
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"UY" = (
-/obj/structure/trap/ctf/nomech,
-/turf/closed/mineral/ash_rock,
-/area/eventmap/outside)
-"Vd" = (
-/obj/structure/fluff/bus/passable{
-	icon_state = "topdoor"
-	},
-/turf/open/floor/spooktime/cobble/roadmid,
-/area/eventmap/outside)
-"Ve" = (
-/obj/structure/table/wood/fancy/orange,
-/obj/item/reagent_containers/food/condiment/saltshaker,
-/obj/item/reagent_containers/food/condiment/peppermill,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"Vf" = (
-/obj/machinery/vending/kink,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Vh" = (
-/turf/open/floor/wood/damturf/broken4,
-/area/eventmap/inside)
-"Vi" = (
-/obj/effect/spawner/structure/window/reinforced,
-/turf/open/floor/clockwork/reebe,
-/area/eventmap/inside)
-"Vj" = (
-/obj/item/coin/diamond,
-/obj/item/stack/sheet/mineral/adamantine,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"Vk" = (
-/obj/structure/chair/stool,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountaininside)
-"Vm" = (
-/obj/item/reagent_containers/food/drinks/bottle/fernet,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Vo" = (
-/obj/structure/dresser,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Vr" = (
-/obj/structure/table/wood,
-/obj/item/reagent_containers/food/snacks/beans,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Vt" = (
-/obj/structure/flora/ausbushes/sparsegrass,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"Vv" = (
-/obj/structure/table,
-/obj/structure/table,
-/obj/item/reagent_containers/food/drinks/bottle/cognac,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Vy" = (
-/obj/item/lighter/greyscale,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Vz" = (
-/obj/structure/closet/secure_closet/captains,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"VA" = (
-/obj/effect/spawner/structure/window/reinforced,
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury02,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"VC" = (
-/obj/item/storage/box/handcuffs,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountaininside)
-"VD" = (
-/turf/open/floor/wood/damturf/broken1,
-/area/eventmap/mountaininside)
-"VE" = (
-/obj/item/pizzabox/meat,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"VF" = (
-/turf/open/floor/plasteel/damturf/scorched,
-/area/eventmap/inside)
-"VG" = (
-/turf/open/floor/spooktime/beach/watersolid,
-/area/eventmap/mountain)
-"VJ" = (
-/turf/open/floor/wood/damturf/broken5,
-/area/eventmap/inside)
-"VP" = (
-/obj/structure/closet/secure_closet/RD,
-/turf/open/floor/sepia,
-/area/eventmap/inside)
-"VR" = (
-/obj/machinery/light{
-	dir = 1
-	},
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/mountaininside)
-"VS" = (
-/obj/item/stack/sheet/bluespace_crystal,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"VU" = (
-/obj/structure/piano,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"VV" = (
-/obj/structure/table/wood/fancy/orange,
-/obj/item/reagent_containers/food/condiment/saltshaker,
-/obj/item/reagent_containers/food/condiment/peppermill,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"VW" = (
-/obj/machinery/light/small,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"VY" = (
-/obj/structure/spacevine,
-/turf/open/floor/spooktime/beach/coasts/coastE,
-/area/eventmap/outside)
-"VZ" = (
-/obj/structure/bookcase/manuals/engineering,
-/turf/closed/wall/mineral/wood,
-/area/eventmap/mountaininside)
-"Wd" = (
-/turf/open/floor/spooktime/beach/coasts/coastNW,
-/area/eventmap/outside)
-"Wf" = (
-/obj/structure/spacevine,
-/turf/open/floor/spooktime/beach/water,
-/area/eventmap/outside)
-"Wi" = (
-/obj/item/reagent_containers/food/snacks/nachos,
-/obj/structure/table/reinforced,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Wj" = (
-/obj/structure/bed,
-/obj/item/bedsheet/black,
-/turf/open/floor/carpet/green,
-/area/eventmap/mountaininside)
-"Wk" = (
-/obj/item/clothing/head/squatter_hat,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Wl" = (
-/obj/structure/rack,
-/obj/item/gun/magic/staff/healing,
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"Wo" = (
-/obj/structure/bed,
-/obj/item/bedsheet/syndie,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Wq" = (
-/obj/item/storage/pill_bottle/dice,
-/obj/structure/curtain{
-	color = "#B22222";
-	pixel_y = -32
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Ws" = (
-/obj/structure/flora/tree/jungle,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"Wt" = (
-/obj/structure/spacevine,
-/turf/open/floor/spooktime/beach/coasts/coastN,
-/area/eventmap/outside)
-"Wu" = (
-/obj/machinery/gibber/autogibber,
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"Wv" = (
-/obj/structure/mineral_door/wood,
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
-	id = "C10"
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Wy" = (
-/obj/machinery/light/small{
-	dir = 8
-	},
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"Wz" = (
-/obj/item/reagent_containers/pill/lsd,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"WA" = (
-/turf/open/floor/spooktime/cobble/roadmid,
-/area/eventmap/outside)
-"WB" = (
-/obj/item/gun/ballistic/shotgun/automatic/combat/compact,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"WG" = (
-/obj/machinery/washing_machine,
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"WJ" = (
-/obj/structure/bed,
-/obj/item/bedsheet/hos,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"WK" = (
-/obj/machinery/light/floor,
-/obj/machinery/telecomms/bus{
-	freq_listening = list(1459,1441)
-	},
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"WL" = (
-/obj/structure/closet/gimmick/russian,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"WN" = (
-/obj/structure/table/plasmaglass,
-/obj/item/multitool,
-/obj/item/multitool,
-/obj/item/multitool,
-/obj/item/multitool,
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"WO" = (
-/obj/machinery/shower{
-	dir = 8;
-	pixel_y = -4
-	},
-/obj/effect/turf_decal/bot_red,
-/obj/effect/turf_decal/bot,
-/turf/open/floor/sepia,
-/area/eventmap/mountaininside)
-"WQ" = (
-/obj/item/stack/sheet/metal/fifty,
-/turf/open/floor/spooktime/beach/coasts/coastE,
-/area/eventmap/outside)
-"WR" = (
-/obj/item/flashlight/seclite,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"WS" = (
-/turf/open/floor/carpet,
-/area/eventmap/mountaininside)
-"WU" = (
-/obj/item/flashlight/glowstick/pink,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"WX" = (
-/obj/structure/closet/crate,
-/obj/item/clothing/head/snake,
-/obj/item/clothing/head/pirate,
-/obj/item/clothing/head/santa,
-/obj/item/clothing/head/naziofficer,
-/obj/item/clothing/head/magus,
-/obj/item/clothing/head/mailman,
-/obj/item/clothing/head/griffin,
-/obj/item/clothing/head/bearpelt,
-/obj/item/clothing/head/beret,
-/obj/item/clothing/head/fedora,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"WY" = (
-/obj/item/stack/sheet/mineral/bananium,
-/obj/item/stack/sheet/mineral/bananium,
-/obj/item/stack/sheet/mineral/bananium,
-/obj/item/stack/sheet/mineral/bananium,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"WZ" = (
-/turf/open/floor/spooktime/beach/coasts/innerS,
-/area/eventmap/outside)
-"Xa" = (
-/obj/machinery/light/floor,
-/obj/machinery/telecomms/receiver,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"Xe" = (
-/obj/structure/closet/athletic_mixed,
-/turf/open/floor/wood/damturf/broken7,
-/area/eventmap/inside)
-"Xf" = (
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/carpet,
-/area/eventmap/inside)
-"Xh" = (
-/obj/machinery/computer/upload/ai,
-/obj/machinery/light/floor,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"Xk" = (
-/obj/structure/closet/secure_closet/brig{
-	id = "Cell 1";
-	name = "Cell 1 Locker"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Xn" = (
-/obj/structure/bed,
-/obj/item/bedsheet,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Xo" = (
-/obj/item/toy/plush/lizardplushie/arfrehn,
-/obj/item/toy/plush/borgplushie{
-	pixel_w = -6;
-	pixel_x = -3;
-	pixel_y = -4
-	},
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Xp" = (
-/turf/open/floor/plasteel/damturf/damage5,
-/area/eventmap/inside)
-"Xq" = (
-/obj/machinery/light/floor{
-	alpha = 0;
-	light_range = 20;
-	mouse_opacity = 0
-	},
-/turf/closed/indestructible/riveted/boss,
-/area/eventmap/mountaininside)
-"Xs" = (
-/obj/effect/spawner/structure/window/plasma/reinforced,
-/turf/open/indestructible/airblock,
-/area/eventmap/mountaininside)
-"Xv" = (
-/obj/structure/bookcase/random/adult,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountaininside)
-"Xw" = (
-/obj/machinery/door/airlock/vault,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"Xy" = (
-/obj/item/flashlight/lantern{
-	anchored = 1;
-	can_be_unanchored = 1;
-	light_color = "#EE9933";
-	light_range = 5;
-	on = 1
-	},
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/outside)
-"Xz" = (
-/obj/machinery/vending/assist,
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"XC" = (
-/obj/machinery/vending/medical{
-	req_access = null
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"XE" = (
-/obj/item/reagent_containers/food/drinks/bottle/tequila,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"XF" = (
-/obj/machinery/light{
-	dir = 1
-	},
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"XH" = (
-/turf/open/floor/plasteel/damturf,
-/area/eventmap/inside)
-"XI" = (
-/obj/item/storage/pill_bottle/penis_enlargement,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"XJ" = (
-/obj/item/stack/sheet/mineral/sandstone,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"XK" = (
-/obj/item/reagent_containers/food/drinks/bottle/champagne,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountaininside)
-"XM" = (
-/obj/structure/curtain{
-	color = "#B22222";
-	pixel_x = -32
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"XO" = (
-/obj/structure/table/plasmaglass,
-/obj/machinery/chem_dispenser/drinks/beer/fullupgrade{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"XP" = (
-/obj/structure/girder,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"XQ" = (
-/obj/item/flashlight/lantern,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"XR" = (
-/obj/machinery/vending/coffee,
-/obj/machinery/light/small{
-	brightness = 3;
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"XS" = (
-/turf/open/floor/spooktime/beach/coasts/coastS,
-/area/eventmap/outside)
-"XU" = (
-/obj/structure/mirror{
-	pixel_x = 28
-	},
-/obj/effect/turf_decal/bot,
-/obj/machinery/shower{
-	dir = 8;
-	pixel_y = -4
-	},
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/mountaininside)
-"XW" = (
-/obj/effect/spawner/structure/window/reinforced,
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"XX" = (
-/obj/structure/mineral_door/wood,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/inside)
-"XZ" = (
-/obj/item/paicard,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Ya" = (
-/turf/open/floor/spooktime/beach/coasts/watercoastN,
-/area/eventmap/outside)
-"Yb" = (
-/obj/item/chair,
-/turf/open/floor/plasteel/damturf/scorched2,
-/area/eventmap/mountaininside)
-"Yd" = (
-/obj/machinery/light/small{
-	dir = 8
-	},
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/mountaininside)
-"Yf" = (
-/obj/item/reagent_containers/food/drinks/bottle/cream,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Yg" = (
-/obj/structure/chair/sofa{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Yh" = (
-/obj/item/reagent_containers/food/snacks/sashimi,
-/obj/structure/table/reinforced,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Yi" = (
-/obj/structure/table/wood,
-/obj/item/flashlight/lamp,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Yj" = (
-/obj/structure/bed,
-/obj/item/bedsheet/pirate,
-/obj/machinery/flasher{
-	id = "Cell 1";
-	pixel_x = -28
-	},
-/obj/effect/decal/cleanable/blood/old,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Yp" = (
-/obj/structure/chair/sofa/left,
-/obj/item/flashlight/seclite,
-/turf/open/floor/carpet/red,
-/area/eventmap/mountaininside)
-"Yr" = (
-/obj/structure/chair/sofa,
-/turf/open/floor/carpet/red,
-/area/eventmap/mountaininside)
-"Ys" = (
-/obj/structure/table,
-/obj/item/reagent_containers/food/drinks/bottle/trappist,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Yu" = (
-/obj/structure/table/wood,
-/obj/machinery/light/small{
-	dir = 8
-	},
-/obj/item/twohanded/required/kirbyplants{
-	icon_state = "plant-05"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Yw" = (
-/obj/item/restraints/handcuffs,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Yy" = (
-/turf/open/floor/plasteel/showroomfloor,
-/area/eventmap/mountaininside)
-"Yz" = (
-/obj/item/restraints/handcuffs,
-/turf/open/floor/plasteel/damturf/scorched2,
-/area/eventmap/mountaininside)
-"YA" = (
-/obj/structure/table,
-/obj/item/lighter/greyscale,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"YE" = (
-/obj/item/storage/fancy/egg_box,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"YG" = (
-/obj/structure/spacevine,
-/obj/structure/spacevine,
-/obj/structure/spacevine,
-/obj/structure/spacevine,
-/obj/structure/spacevine,
-/obj/structure/spacevine,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"YH" = (
-/obj/item/reagent_containers/food/drinks/bottle/sake,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"YI" = (
-/obj/structure/flora/tree/spookytime,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"YJ" = (
-/obj/item/coin/diamond,
-/obj/item/stack/sheet/mineral/mythril,
-/turf/open/floor/plasteel/dark,
-/area/eventmap/mountaininside)
-"YK" = (
-/obj/item/storage/fancy/egg_box,
-/turf/open/floor/plasteel/freezer,
-/area/eventmap/inside)
-"YM" = (
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/plasteel/damturf/scorched1,
-/area/eventmap/mountaininside)
-"YO" = (
-/obj/item/stack/sheet/mineral/sandstone/thirty,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"YP" = (
-/obj/item/reagent_containers/food/condiment/soysauce,
-/turf/open/floor/plasteel/cafeteria,
-/area/eventmap/inside)
-"YQ" = (
-/turf/open/floor/spooktime/beach/coasts/watercoastSW,
-/area/eventmap/outside)
-"YT" = (
-/obj/structure/mineral_door/wood,
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
-	id = "C11"
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"YU" = (
-/obj/item/storage/fancy/cigarettes/cigpack_mindbreaker,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"YV" = (
-/obj/structure/table/wood,
-/obj/item/reagent_containers/food/drinks/bottle/tequila,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"YW" = (
-/obj/machinery/door/airlock/wood/glass,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountaininside)
-"YY" = (
-/obj/item/reagent_containers/food/drinks/bottle/trappist,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"YZ" = (
-/obj/effect/decal/cleanable/dirt{
-	desc = "A thin layer of dust coating the floor.";
-	name = "dust"
-	},
-/turf/open/floor/wood/damturf/broken3,
-/area/eventmap/inside)
-"Za" = (
-/obj/structure/chair/comfy{
-	dir = 1
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"Zb" = (
-/obj/item/reagent_containers/food/snacks/powercrepe,
-/obj/structure/table/reinforced,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Zg" = (
-/obj/machinery/light/small{
-	dir = 4
-	},
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"Zi" = (
-/obj/machinery/light{
-	dir = 4
-	},
-/obj/structure/table/plasmaglass,
-/obj/machinery/chem_dispenser/drinks/fullupgrade{
-	dir = 8
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Zj" = (
-/obj/structure/chair/comfy/brown{
-	dir = 4
-	},
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Zk" = (
-/obj/machinery/light/small{
-	dir = 1
-	},
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountaininside)
-"Zm" = (
-/obj/item/reagent_containers/food/snacks/scotchegg,
-/obj/structure/table/reinforced,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"Zr" = (
-/obj/machinery/light/floor{
-	alpha = 0;
-	light_range = 20;
-	max_integrity = 9999;
-	mouse_opacity = 0
-	},
-/turf/open/indestructible/airblock,
-/area/eventmap/mountaininside)
-"Zt" = (
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"Zv" = (
-/obj/structure/bed,
-/obj/item/bedsheet/blue,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"Zx" = (
-/obj/machinery/light/floor{
-	alpha = 0;
-	light_range = 20;
-	mouse_opacity = 0
-	},
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-"Zz" = (
-/obj/item/reagent_containers/food/drinks/bottle/wine,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"ZA" = (
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"ZB" = (
-/obj/structure/bonfire,
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ZC" = (
-/obj/item/flashlight,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"ZE" = (
-/obj/structure/bed/dogbed,
-/turf/open/floor/wood,
-/area/eventmap/mountaininside)
-"ZF" = (
-/obj/structure/chair/stool/bar,
-/turf/open/floor/wood/damturf/broken7,
-/area/eventmap/inside)
-"ZI" = (
-/obj/item/lighter,
-/turf/open/floor/carpet/green,
-/area/eventmap/mountaininside)
-"ZJ" = (
-/obj/item/lipstick/random,
-/turf/open/floor/plasteel,
-/area/eventmap/mountaininside)
-"ZL" = (
-/obj/structure/cable/pink{
-	icon_state = "1-6"
-	},
-/turf/open/floor/plating,
-/area/eventmap/mountain)
-"ZM" = (
-/obj/structure/flora/bush,
-/turf/open/floor/spooktime/spooktimegrass,
-/area/eventmap/outside)
-"ZN" = (
-/obj/structure/fluff/broken_flooring,
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/plating,
-/area/eventmap/mountaininside)
-"ZO" = (
-/obj/effect/decal/cleanable/dirt,
-/turf/open/floor/wood/damturf/broken2,
-/area/eventmap/inside)
-"ZP" = (
-/obj/structure/trap/ctf/nomech,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/outside)
-"ZQ" = (
-/obj/structure/mineral_door/wood,
-/obj/machinery/door/poddoor/shutters/preopen/luxury_dorms/luxury03{
-	id = "C01"
-	},
-/turf/open/floor/wood,
-/area/eventmap/inside)
-"ZR" = (
-/turf/open/floor/spooktime/cobble/roadsideN,
-/area/eventmap/outside)
-"ZS" = (
-/obj/structure/spacevine,
-/turf/open/floor/spooktime/dirtpatch,
-/area/eventmap/mountain)
-"ZU" = (
-/obj/machinery/vending/coffee,
-/turf/open/floor/wood{
-	icon_state = "wood-broken3"
-	},
-/area/eventmap/inside)
-"ZW" = (
-/obj/machinery/mech_bay_recharge_port,
-/obj/machinery/light/floor{
-	alpha = 0;
-	light_range = 20;
-	max_integrity = 9999;
-	mouse_opacity = 0
-	},
-/turf/open/floor/circuit/off,
-/area/eventmap/mountaininside)
-
-(1,1,1) = {"
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-yN
-yN
-yN
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-"}
-(2,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-WA
-WA
-WA
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(3,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-ED
-ED
-ED
-ED
-ED
-ED
-ED
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-WA
-WA
-WA
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(4,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-Lg
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-ZS
-ZS
-ZS
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-Uj
-Mp
-Rw
-Mp
-TC
-zy
-ED
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-WA
-WA
-WA
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ZS
-ZS
-ZS
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(5,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-Xn
-Mp
-ED
-Mp
-ER
-lw
-ED
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ZS
-ZS
-ac
-ac
-ac
-ac
-ZS
-ZS
-WA
-WA
-WA
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ZS
-ZS
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(6,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-ED
-ED
-ED
-Uj
-NG
-lQ
-ED
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ZS
-ZS
-yV
-yV
-ZS
-gs
-WA
-WA
-WA
-gs
-gs
-gs
-Fq
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(7,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-FU
-JC
-ED
-Mp
-Ti
-rl
-ED
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-yV
-ZS
-gs
-gs
-WA
-WA
-WA
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(8,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-Iu
-Yy
-Kg
-Mp
-LY
-Mp
-ED
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-yV
-gs
-WA
-WA
-WA
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ZS
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(9,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-ED
-ED
-ED
-be
-ED
-Wv
-ED
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-WA
-WA
-WA
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(10,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-Mn
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-WA
-WA
-WA
-gs
-gs
-gs
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(11,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-WA
-WA
-WA
-gs
-gs
-gs
-gs
-EL
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(12,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ZS
-ZS
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ZS
-ZS
-ZS
-ZS
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-WA
-WA
-WA
-gs
-gs
-gs
-gs
-gs
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(13,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-gs
-ZS
-gs
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ZS
-ZS
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-WA
-WA
-WA
-gs
-gs
-gs
-gs
-ZS
-ZS
-ZS
-gs
-gs
-gs
-gs
-gs
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(14,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-EU
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-RE
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-Fw
-Fw
-Fw
-Fw
-Fw
-Fw
-ac
-ac
-ac
-WA
-WA
-WA
-gs
-gs
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ZS
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(15,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-EU
-EU
-EU
-EU
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Gn
-gs
-gs
-FV
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-ad
-ZA
-OC
-ZA
-Fm
-Fw
-ac
-ac
-ac
-WA
-WA
-WA
-aN
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ZS
-ac
-ac
-gs
-gs
-ac
-ED
-ED
-ED
-ED
-ED
-ED
-ED
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(16,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-EU
-EU
-EU
-EU
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-yV
-ac
-ac
-ac
-ac
-IV
-IV
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-Ob
-ZA
-ZA
-ZA
-Fm
-Fw
-ac
-ac
-ac
-WA
-WA
-WA
-gs
-aN
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ED
-Mp
-Pl
-Fy
-Mp
-Vo
-ED
-ac
-ac
-ac
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(17,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-EU
-Xo
-EU
-EU
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-JG
-gs
-gs
-Eb
-gs
-Uu
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-aN
-aN
-aN
-aN
-IV
-aN
-aN
-ac
-ac
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-TU
-ZA
-Qq
-ZA
-PM
-Fw
-ac
-ac
-ac
-WA
-WA
-WA
-aN
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-Jk
-gs
-gs
-Ue
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ED
-Uj
-Mp
-Mp
-Mp
-VW
-ED
-ac
-ac
-ac
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(18,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-EU
-EU
-EU
-EU
-EU
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-Sl
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-IV
-IV
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-ac
-aN
-aN
-ac
-ac
-ac
-ac
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-ZA
-ZA
-Rm
-ZJ
-ZA
-Fw
-ac
-ac
-yO
-WA
-WA
-WA
-aN
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ED
-Mp
-GB
-WJ
-Mp
-DG
-ED
-ac
-ac
-ac
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-Ia
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(19,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-EU
-EU
-EU
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-CN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-IV
-IV
-aN
-IV
-IV
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-ac
-aN
-aN
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-Hd
-ZA
-ZA
-ZA
-ZA
-Fw
-Fw
-Sy
-yO
-WA
-WA
-WA
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-zZ
-gs
-Eb
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ED
-Kg
-ED
-ED
-Rw
-ED
-ED
-ac
-ac
-ac
-ac
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-Ia
-Gh
-Zr
-Jl
-pu
-Jl
-Jl
-Jl
-Jl
-Jl
-Zr
-Jl
-Jl
-Jl
-Jl
-Zr
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(20,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-IV
-IV
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-Nv
-Nv
-Nv
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-mD
-Sg
-RB
-ZA
-RB
-ZA
-Hi
-pR
-yO
-WA
-WA
-WA
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-UM
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ED
-Yy
-JC
-ED
-Mp
-XR
-ED
-ac
-ac
-ac
-ac
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-Ia
-Gh
-Jl
-Zr
-Jl
-Jl
-Jl
-Zr
-Jl
-pu
-Jl
-Jl
-Jl
-Jl
-pu
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(21,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-Sl
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-IV
-IV
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-SV
-Gc
-HE
-UK
-ZA
-Fw
-Fw
-Sw
-yO
-WA
-WA
-WA
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-Sl
-gs
-gs
-VE
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ED
-Iu
-Rq
-ED
-Mp
-AZ
-ED
-ac
-ac
-ac
-ac
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-Ia
-Gh
-Jl
-Jl
-Zr
-Pi
-Zr
-Jl
-Jl
-Jl
-Jl
-Jl
-Pi
-Jl
-Jl
-Zr
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(22,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-Fw
-Fw
-Fw
-Fw
-Fw
-Fw
-ac
-pR
-yO
-WA
-WA
-WA
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-AA
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ED
-ED
-ED
-ED
-Mp
-Mp
-ED
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-Ia
-Gh
-Jl
-CM
-Jl
-Pi
-Jl
-Jl
-Pi
-Pi
-Jl
-Jl
-Pi
-Jl
-CM
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(23,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-ZR
-WA
-WA
-WA
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-Cl
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-VZ
-ER
-Mp
-AQ
-Mp
-KM
-ED
-gs
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-Ia
-Gh
-Jl
-CM
-Jl
-Pi
-Xs
-Xs
-Pi
-Pi
-Jl
-Zr
-Pi
-Jl
-CM
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(24,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-NF
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-Qg
-Ti
-Mp
-Mp
-Mp
-Mp
-YT
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-Ia
-Gh
-Jl
-CM
-Jl
-Pi
-Jl
-Zr
-Jl
-Jl
-Jl
-Jl
-Pi
-Jl
-CM
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(25,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-yV
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ED
-Mz
-Mz
-ED
-ED
-ED
-be
-KA
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-Ia
-Gh
-Jl
-Jl
-Jl
-Jl
-Jl
-Zr
-Jl
-Jl
-pu
-Jl
-Jl
-Jl
-Jl
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(26,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-yV
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-Ia
-Gh
-Jl
-pu
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(27,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-yV
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-Ia
-Gh
-Jl
-Jl
-Jl
-Pi
-Pi
-Pi
-Jl
-Jl
-Jl
-Jl
-Pi
-Pi
-Zr
-Zr
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(28,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ZS
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-aN
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-yV
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-Sl
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-Ia
-Gh
-Jl
-Jl
-Zr
-Jl
-Jl
-Jl
-Jl
-Jl
-Zr
-Jl
-Jl
-Jl
-Jl
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(29,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ZS
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ZS
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-Ia
-Gh
-Jl
-Zr
-Jl
-Jl
-Jl
-Jl
-CM
-CM
-CM
-Jl
-Jl
-Jl
-Jl
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(30,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-aN
-Nv
-IV
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-Ia
-Gh
-Jl
-Pi
-Jl
-Jl
-pu
-Jl
-Jl
-Jl
-Jl
-Jl
-Pi
-Pi
-Xs
-Pi
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(31,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-gs
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-LU
-aN
-ZS
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-Ia
-Gh
-Jl
-Pi
-Jl
-Pi
-Jl
-Jl
-Jl
-Zr
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(32,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-gs
-gs
-ED
-ED
-ED
-ED
-ED
-ED
-ED
-ED
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-Ia
-Gh
-Jl
-Pi
-Jl
-Pi
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Zr
-Jl
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(33,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-gs
-gs
-ED
-Bs
-Hj
-Aj
-GI
-KJ
-zy
-ED
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-yV
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-Ia
-Gh
-Jl
-Pi
-Jl
-Jl
-Jl
-Pi
-Pi
-Pi
-Xs
-Pi
-Jl
-Jl
-Jl
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(34,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-gs
-gs
-be
-KG
-Hj
-Aj
-Aj
-KJ
-Mp
-ED
-ED
-ED
-ED
-ED
-ED
-ED
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-Ia
-Gh
-Jl
-Jl
-Zr
-Jl
-Jl
-Zr
-Jl
-Jl
-Jl
-Jl
-Jl
-Nz
-Jl
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-Jx
-"}
-(35,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-gs
-gs
-AY
-Mp
-Hj
-Aj
-Aj
-KJ
-Mp
-Go
-Mp
-Mp
-Mp
-AQ
-IQ
-ED
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-Ia
-Gh
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Nz
-pu
-Zr
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-Jx
-"}
-(36,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-gs
-gs
-ED
-EC
-Mp
-Au
-Au
-Mp
-Mp
-Go
-Mp
-Mp
-Mp
-Mp
-IQ
-ED
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-Ia
-Gh
-Jl
-Zr
-Jl
-pu
-Jl
-Pi
-Pi
-Pi
-Jl
-Jl
-Jl
-Nz
-Jl
-Zr
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-Jx
-"}
-(37,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-Mp
-Mp
-Mp
-Mp
-VW
-ED
-ED
-ED
-ED
-Mp
-Mp
-QY
-ED
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-Ia
-Gh
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Zr
-pu
-Jl
-Nz
-Jl
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-Jx
-"}
-(38,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-Bo
-Mp
-Mp
-Mp
-Mp
-Go
-Yy
-QG
-ED
-Mp
-Mp
-Mp
-ED
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-Ia
-Gh
-Jl
-Jl
-Pi
-Pi
-Jl
-Jl
-pu
-Jl
-Jl
-Jl
-Jl
-Nz
-Jl
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-Jx
-"}
-(39,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-Jc
-Mp
-Mp
-Mp
-Mp
-TJ
-ED
-Yy
-Yy
-ED
-Mp
-Mp
-Mp
-ED
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-Ia
-Gh
-Jl
-Jl
-Jl
-Jl
-Zr
-Jl
-Jl
-Jl
-Jl
-Pi
-Jl
-Jl
-Jl
-pu
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-Jx
-"}
-(40,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-Mp
-Mp
-Mp
-Mp
-Mp
-ED
-Yy
-Yy
-ED
-Mp
-Mp
-Mp
-ED
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ZS
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-fp
-ar
-ar
-fp
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-Ia
-Gh
-Jl
-Zr
-Zr
-Xs
-Jl
-CM
-CM
-CM
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-Jx
-"}
-(41,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-QP
-QP
-QP
-QP
-Mp
-ED
-FU
-NJ
-ED
-AZ
-Kf
-Mp
-ED
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-Ri
-Ki
-Fw
-Ab
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-zA
-cM
-cM
-IA
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-gs
-gs
-gs
-gs
-gs
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-Ia
-Gh
-Jl
-Jl
-Jl
-Xs
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Zr
-Jl
-Pi
-Pi
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-Jx
-"}
-(42,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-Mp
-Mp
-Mp
-Mp
-VW
-ED
-Kg
-ED
-ED
-ED
-ED
-Rw
-ED
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Ab
-Fw
-Fw
-Zk
-EF
-Ur
-Fw
-Ab
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ar
-De
-ah
-ah
-ah
-ar
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-aN
-ac
-ac
-gs
-ZS
-ZS
-ZS
-ZS
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Ia
-Gh
-Jl
-Pi
-Jl
-Jl
-Zr
-Jl
-pu
-Jl
-Jl
-Jl
-Jl
-Zr
-Jl
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-Jx
-"}
-(43,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-AY
-Mp
-Mp
-Mp
-Mp
-ED
-Yy
-Yy
-ED
-Qx
-Mp
-Mp
-ED
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Ab
-Ab
-Jb
-EF
-PO
-Qq
-Fw
-Ab
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-cO
-ah
-BU
-de
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-LU
-ZS
-ZS
-ZS
-ZS
-ZS
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Ia
-Gh
-Jl
-Pi
-Jl
-Pi
-Jl
-Jl
-Jl
-Jl
-Jl
-Pi
-Jl
-Jl
-Jl
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-Jx
-"}
-(44,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-QP
-XO
-Zi
-QP
-EB
-ED
-Yy
-TH
-ED
-Qx
-Mp
-VW
-ED
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Ab
-Fw
-UK
-EF
-EF
-EF
-Ab
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-fp
-fp
-ah
-ah
-fp
-fp
-fp
-aN
-aN
-aN
-aN
-TQ
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-Nv
-ZS
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Ia
-Gh
-Jl
-Pi
-Jl
-Pi
-Jl
-CM
-CM
-CM
-Jl
-Pi
-Jl
-Jl
-Jl
-Zr
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ac
-ac
-ac
-ac
-Jx
-"}
-(45,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-ED
-ED
-ED
-ED
-ED
-ED
-Iu
-Yy
-ED
-Si
-Wo
-AR
-ED
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-Xv
-Ur
-EF
-ZN
-RS
-EF
-PT
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-cE
-mE
-ah
-ah
-mE
-dx
-fp
-bF
-wl
-wl
-wl
-wl
-wl
-wl
-wo
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-IV
-Nv
-Nv
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Ia
-Gh
-Jl
-Jl
-Jl
-Pi
-Jl
-Jl
-Jl
-Jl
-Jl
-Pi
-Jl
-pu
-Jl
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(46,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-ED
-ED
-ED
-ED
-ED
-ED
-ED
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-PT
-RB
-Ki
-RS
-Qq
-UK
-RB
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-NA
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-cF
-ah
-by
-by
-De
-dy
-fp
-bG
-CI
-CI
-CI
-CI
-pR
-CI
-yO
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-BY
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Ia
-Gh
-Jl
-pu
-Jl
-Pi
-Jl
-Jl
-Jl
-Jl
-Zr
-Pi
-Jl
-Zr
-Jl
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(47,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-Fw
-Eo
-RB
-EF
-LG
-Gz
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-ex
-JM
-by
-by
-ah
-dz
-fp
-bH
-CI
-pR
-pR
-pR
-pR
-CI
-yO
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-at
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-eW
-fp
-rw
-rw
-rw
-rw
-fp
-uo
-uC
-fp
-VP
-Gm
-Bv
-fp
-ah
-fp
-RJ
-Yj
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Ia
-Gh
-Jl
-Jl
-Jl
-Jl
-Zr
-Jl
-pu
-Jl
-Zr
-Jl
-Jl
-Jl
-Jl
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(48,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-Ab
-Fw
-Ab
-EF
-RB
-Ab
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-Hg
-gs
-FA
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-cH
-ah
-by
-by
-ah
-dA
-fp
-bG
-CI
-pR
-pR
-pR
-pR
-CI
-yO
-ab
-aN
-aN
-fp
-fp
-ar
-ar
-ar
-fp
-fp
-HI
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wo
-cy
-BU
-ah
-ah
-ah
-fp
-fp
-uD
-fp
-fp
-wq
-fp
-fp
-fZ
-HV
-bI
-ah
-ar
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Ia
-Gh
-Jl
-Zr
-Zr
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Pi
-Pi
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(49,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-Ab
-Ab
-Ab
-Fm
-Ab
-Ab
-Fw
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-Sl
-gs
-SR
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-cL
-ah
-ah
-ah
-ah
-dB
-fp
-DN
-wk
-wk
-wk
-wk
-pR
-CI
-yO
-ab
-aN
-aN
-ar
-kU
-JW
-kU
-kU
-kU
-ar
-KP
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-yO
-ar
-ah
-ah
-De
-ah
-fp
-up
-uE
-fp
-ah
-ah
-ah
-ah
-bI
-ar
-Gw
-Xk
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Ia
-Gh
-Jl
-Pi
-Pi
-Jl
-Jl
-Xs
-Xs
-Xs
-Jl
-Pi
-Pi
-Jl
-Jl
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(50,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ac
-ac
-ac
-Ab
-Fw
-PT
-Ab
-Fw
-Ab
-Ab
-Fw
-RB
-Fw
-Fw
-Ab
-ac
-ac
-ac
-ac
-ac
-NF
-gs
-gs
-Eb
-gs
-gs
-gs
-gs
-SR
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-fp
-cP
-RP
-ah
-df
-fp
-fp
-fp
-fp
-fp
-ab
-ab
-KP
-pR
-yO
-ab
-aN
-aN
-ar
-ah
-ah
-ah
-ah
-ah
-ar
-KP
-pR
-pR
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-pR
-pR
-yO
-cy
-ah
-ah
-ah
-tl
-fp
-uq
-uF
-vl
-bI
-bJ
-rI
-bJ
-xP
-fp
-fp
-fp
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Ia
-Gh
-Jl
-Jl
-Jl
-Jl
-Jl
-Zr
-Jl
-Jl
-Jl
-Xs
-Jl
-Zr
-Jl
-Zr
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(51,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ac
-ac
-ac
-Fw
-Ab
-PL
-Rm
-Ab
-EF
-VC
-Fw
-Fm
-Ka
-TX
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-By
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-cR
-ah
-ah
-df
-dC
-dQ
-eg
-el
-fp
-ab
-ab
-KP
-pR
-yO
-ab
-aN
-aN
-ar
-kU
-ah
-kU
-ah
-kU
-ar
-KP
-pR
-yO
-kA
-kA
-kA
-kA
-kA
-mQ
-kA
-KP
-pR
-oh
-fp
-rx
-Vh
-ah
-Ik
-fp
-ur
-uG
-fp
-vO
-bJ
-rI
-rI
-ah
-ah
-RP
-TE
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Ia
-Gh
-Jl
-Jl
-pu
-Jl
-Pi
-Pi
-Pi
-Pi
-Pi
-Jl
-Jl
-Jl
-pu
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(52,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-Fw
-UK
-Qq
-Aw
-UK
-RB
-Fm
-RB
-RB
-LZ
-Qq
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-NF
-gs
-gs
-Wk
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-Fl
-ah
-by
-by
-by
-by
-by
-by
-fp
-au
-at
-KP
-pR
-yO
-ab
-aN
-aN
-fp
-kU
-ah
-kU
-ah
-kU
-fp
-KP
-jt
-yO
-kA
-kA
-kA
-kA
-kA
-kA
-kA
-KP
-pR
-yO
-ar
-ry
-ah
-ah
-Xe
-fp
-fp
-fp
-fp
-ah
-bJ
-bJ
-Xf
-ah
-VJ
-ah
-Qf
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Ia
-Gh
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(53,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-Fw
-Ow
-RB
-RB
-Is
-Qq
-PL
-Fw
-yW
-Fm
-EF
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-cV
-Ih
-by
-OQ
-by
-by
-by
-by
-eH
-wl
-wl
-pR
-pR
-yO
-ab
-aN
-aN
-fp
-kU
-ah
-kU
-ah
-kU
-fp
-KP
-pR
-yO
-kA
-kA
-kA
-kA
-kA
-kA
-kA
-KP
-pR
-yO
-ar
-ry
-ah
-ah
-tm
-fp
-ah
-bI
-ah
-bI
-bJ
-bJ
-bJ
-xO
-fp
-fp
-fp
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-LU
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Ia
-Gh
-Zr
-Jl
-CM
-Jl
-Jl
-Zr
-Zr
-Zr
-Jl
-Jl
-CM
-Jl
-Jl
-Jl
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(54,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-Fw
-Ab
-Fw
-Ab
-Fw
-Ab
-Ab
-Fw
-Ur
-wQ
-PL
-Ab
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ar
-cW
-cY
-by
-by
-by
-OQ
-by
-by
-ar
-pR
-pR
-CI
-pR
-yO
-ab
-aN
-aN
-fp
-kU
-ah
-kU
-ah
-kU
-fp
-KP
-jt
-yO
-kA
-kA
-kA
-kA
-kA
-kA
-kA
-KP
-pR
-yO
-ar
-ry
-ah
-ah
-VJ
-fp
-ah
-RP
-ek
-ah
-ah
-bI
-ah
-bI
-ar
-RJ
-Eh
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-LU
-ac
-ac
-ac
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Gh
-Zr
-Jl
-CM
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-Jl
-CM
-Jl
-Jl
-Zr
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(55,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-Ab
-Ab
-Ab
-Ab
-Ab
-Ab
-Ab
-Fw
-PT
-Fw
-Ab
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-WG
-db
-by
-by
-by
-by
-by
-by
-eH
-wk
-wk
-CI
-CI
-yO
-ab
-aN
-aN
-fp
-kU
-ah
-kU
-ah
-kU
-fp
-KP
-pR
-yO
-kA
-kA
-kA
-kA
-kA
-kA
-kA
-KP
-pR
-yO
-fp
-fp
-fp
-fp
-ah
-fp
-ah
-ah
-fp
-fp
-fp
-fp
-ah
-bI
-JR
-iy
-dN
-ar
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-LU
-LU
-ac
-ac
-ac
-Ia
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Pv
-Pv
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(56,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-cX
-ah
-ah
-mB
-dE
-dE
-dE
-dE
-fp
-ab
-au
-KP
-pR
-yO
-ab
-fp
-fp
-fp
-kU
-ah
-kU
-Vh
-kU
-fp
-KP
-jt
-yO
-kA
-kA
-kA
-kA
-kA
-kA
-kA
-KP
-pR
-oh
-fp
-rz
-sa
-su
-hL
-fp
-ah
-ah
-fp
-vP
-wt
-fp
-fp
-fp
-fp
-Rg
-HU
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZR
-WA
-WA
-WA
-Kq
-Ql
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-Ql
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-Ql
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-LU
-LU
-LU
-Xy
-LU
-ZP
-Gh
-CG
-CG
-CG
-CG
-CG
-CG
-Gh
-ZW
-Zt
-Zt
-Zt
-Zt
-Zx
-Zx
-Zx
-Zx
-Zt
-Zt
-Zt
-Zt
-ZW
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(57,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-fp
-ar
-ar
-fp
-fp
-ar
-ar
-fp
-fp
-ab
-ab
-KP
-pR
-yO
-ab
-fp
-Oa
-aO
-aO
-aO
-JM
-ah
-ah
-ar
-KP
-pR
-yO
-kA
-kA
-kA
-kA
-kA
-kA
-kA
-KP
-pR
-yO
-fp
-hL
-hL
-hL
-hL
-fp
-ah
-ah
-ar
-ah
-Cr
-ah
-WB
-xQ
-fp
-fp
-fp
-fp
-aN
-aN
-aN
-aN
-fY
-wl
-wl
-wo
-WA
-WA
-WA
-HI
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-Dp
-PP
-Zt
-Zt
-UW
-Zt
-UW
-CG
-Gh
-Zt
-Zt
-Zt
-Zt
-Zt
-Zx
-Mq
-Mq
-Zx
-Zt
-Zt
-Zt
-Zt
-Zt
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(58,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-KP
-pR
-yO
-ab
-ar
-cR
-aO
-aO
-aO
-ah
-ah
-vm
-ar
-KP
-jt
-yO
-kA
-kA
-kA
-kA
-kA
-kA
-kA
-KP
-pR
-yO
-fp
-rA
-sb
-sv
-hL
-fp
-us
-ah
-fp
-rC
-De
-wT
-QD
-xR
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-pR
-wk
-wn
-WA
-WA
-WA
-KS
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-Tv
-PP
-Zt
-Zt
-Zt
-Zt
-Zt
-CG
-Gh
-Gu
-Zt
-Zt
-Zt
-Gh
-Wl
-Wl
-Wl
-Wl
-Gh
-Zt
-Zt
-Zt
-TV
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(59,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-KP
-pR
-yO
-ab
-ar
-cS
-aO
-aO
-aO
-ah
-ah
-Aa
-fp
-KP
-pR
-yO
-kA
-kA
-kA
-kA
-kA
-kA
-kA
-KP
-pR
-oh
-fp
-fp
-fp
-fp
-fp
-fp
-ah
-ah
-vn
-ah
-UA
-wU
-xs
-xS
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-WA
-WA
-WA
-Kq
-Ql
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-Ql
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-Ql
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-LU
-LU
-Xy
-LU
-ZP
-Gh
-CG
-UW
-Zt
-Zt
-Zt
-CG
-Gh
-Fr
-Zt
-Zt
-Zt
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Zt
-Zt
-Zt
-Zt
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(60,1,1) = {"
-Jx
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-KP
-pR
-yO
-ab
-fp
-cR
-aO
-aO
-aO
-CT
-ah
-zJ
-fp
-KP
-jt
-yO
-kA
-kA
-kA
-kA
-kA
-kA
-kA
-KP
-pR
-oi
-fp
-fh
-sc
-sc
-sc
-fp
-ah
-ah
-vn
-JM
-Eu
-wV
-xt
-xT
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-LU
-LU
-UY
-Gh
-CG
-Zt
-Po
-Po
-UW
-CG
-Gh
-FW
-Zt
-Zt
-Zt
-Sq
-Zt
-UW
-UW
-Zt
-Sq
-Zt
-UW
-Zt
-KD
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(61,1,1) = {"
-Jx
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-VS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-at
-ab
-ab
-ab
-ab
-ab
-ab
-at
-ab
-ab
-ab
-ab
-ab
-ab
-at
-KP
-pR
-yO
-ab
-ar
-cS
-aO
-aO
-aO
-ah
-ah
-zJ
-ar
-KP
-pR
-yO
-MH
-kA
-kA
-kA
-kA
-kA
-kA
-KP
-pR
-yO
-ar
-rB
-bJ
-bJ
-JM
-fp
-Ib
-ah
-fp
-Ey
-ah
-wW
-ah
-xU
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-Eg
-Eg
-Eg
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-LU
-LU
-UY
-Gh
-CG
-Zt
-Xz
-Xz
-Zt
-CG
-Gh
-Mo
-Zt
-UW
-Zt
-SU
-Zt
-Zt
-Zt
-Zt
-SU
-Zt
-UW
-Zt
-Hn
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(62,1,1) = {"
-Jx
-ac
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-ab
-KP
-pR
-yO
-ab
-ar
-cP
-aO
-aO
-aO
-Ih
-ah
-zL
-ar
-KP
-jt
-yO
-kA
-kA
-kA
-kA
-kA
-kA
-kA
-KP
-pR
-yO
-ar
-rB
-bJ
-bJ
-ah
-fp
-ah
-ah
-ar
-se
-LN
-ah
-Ug
-xV
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-Eg
-Eg
-Eg
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-LU
-UY
-Gh
-CG
-UW
-Je
-Je
-Zt
-CG
-Gh
-Fr
-Zt
-UW
-Zt
-Pd
-Zt
-Zt
-Zt
-Zt
-IO
-Zt
-Zt
-Zt
-FQ
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(63,1,1) = {"
-Jx
-ac
-gs
-gs
-gs
-ac
-gs
-gs
-RE
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-ab
-KP
-pR
-yO
-ab
-fp
-GZ
-aO
-aO
-aO
-ah
-ah
-zJ
-fp
-KP
-pR
-yO
-kA
-kA
-kA
-kA
-kA
-kA
-kA
-KP
-pR
-yO
-ar
-rB
-bJ
-bJ
-ah
-fp
-ah
-ah
-fp
-vQ
-wu
-ah
-Eu
-xW
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-wi
-Du
-av
-CW
-Eg
-Eg
-Eg
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-LU
-UY
-Gh
-CG
-Zt
-Xz
-Xz
-Zt
-CG
-Gh
-FW
-Zt
-Zt
-Zt
-Fr
-Zt
-Zt
-Zt
-Zt
-Fr
-Zt
-Zt
-Zt
-BG
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(64,1,1) = {"
-Jx
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-ab
-KP
-pR
-yO
-ab
-fp
-ar
-fp
-cy
-cy
-cy
-fp
-ar
-fp
-KP
-pR
-yO
-kA
-kA
-kA
-kA
-kA
-kA
-kA
-KP
-pR
-oj
-fp
-rC
-bJ
-bJ
-tn
-fp
-ah
-ah
-fp
-fp
-fp
-vn
-xu
-fp
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-wi
-Dv
-bs
-CX
-Eg
-Eg
-Eg
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-LU
-UY
-Gh
-CG
-Zt
-MW
-Je
-Zt
-CG
-Gh
-Mo
-Zt
-UW
-Zt
-Zt
-UW
-UW
-UW
-Zt
-Zt
-Zt
-UW
-Zt
-Sn
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(65,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ax
-WA
-WA
-WA
-WA
-WA
-WA
-dW
-WA
-WA
-WA
-WA
-WA
-NC
-ab
-KP
-pR
-pR
-wl
-wl
-wl
-zu
-wl
-wl
-wl
-zu
-wl
-wl
-pR
-pR
-pR
-wl
-wl
-wl
-wl
-wl
-wl
-wl
-pR
-pR
-yO
-cy
-RP
-bJ
-bJ
-ah
-tG
-ah
-BU
-fp
-vR
-wv
-ah
-xv
-vR
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-wi
-Dv
-bs
-CY
-Eg
-Eg
-Eg
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-LU
-UY
-Gh
-CG
-Zt
-Xz
-Xz
-UW
-CG
-Gh
-Zt
-Zt
-UW
-Zt
-Zt
-UW
-UW
-UW
-Zt
-Zt
-Zt
-UW
-Zt
-Zt
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(66,1,1) = {"
-Jx
-gs
-ac
-ac
-ac
-gs
-gs
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-gs
-gs
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-ab
-KP
-pR
-CI
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-yO
-ar
-ah
-bJ
-bJ
-ah
-ar
-ah
-ah
-fp
-vR
-ww
-bJ
-xw
-vR
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-wi
-as
-bs
-CX
-Eg
-Eg
-Eg
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-UY
-Gh
-CG
-Zt
-Je
-Je
-Zt
-CG
-Gh
-Zt
-Zt
-Zt
-Zt
-Zt
-UW
-UW
-UW
-Zt
-Zt
-Zt
-Zt
-yo
-NT
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(67,1,1) = {"
-Jx
-gs
-gs
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-VS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-ab
-KP
-pR
-CI
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wk
-wn
-cy
-ah
-sd
-ah
-VJ
-tG
-ah
-tn
-fp
-vS
-ww
-bJ
-bJ
-zx
-ar
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-wi
-Dx
-bs
-CX
-Eg
-Eg
-Eg
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-UY
-Gh
-CG
-Zt
-UW
-Zt
-Zt
-CG
-Gh
-Zt
-Zt
-UW
-Zt
-Fr
-Zt
-Zt
-Zt
-Zt
-Fr
-Zt
-UW
-Cm
-My
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(68,1,1) = {"
-Jx
-gs
-gs
-gs
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-WA
-ab
-KP
-pR
-yO
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-bK
-aF
-ab
-ab
-cQ
-ab
-ab
-ab
-cQ
-aD
-ab
-ab
-ab
-cQ
-ok
-fp
-fp
-se
-lP
-fp
-fp
-ah
-ah
-fp
-Vh
-bJ
-bJ
-bJ
-xX
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-wi
-Dv
-bs
-CX
-Eg
-Eg
-Eg
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-YI
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-UY
-Gh
-CG
-Zt
-Zt
-Zt
-Zt
-Zt
-Zt
-Zt
-Zt
-UW
-Zt
-Pd
-Zt
-Zt
-Zt
-Zt
-IO
-Zt
-UW
-Tn
-WN
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(69,1,1) = {"
-Jx
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-gs
-gs
-gs
-gs
-ac
-gs
-gs
-ac
-gs
-gs
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-at
-ab
-ab
-ab
-ab
-ab
-ab
-at
-ab
-ab
-ab
-ab
-ab
-ab
-at
-KP
-pR
-yO
-ab
-ab
-ab
-ab
-ab
-ab
-aB
-ab
-fp
-fp
-ar
-fp
-fp
-fp
-ar
-fp
-fp
-fp
-ar
-fp
-fp
-fp
-BY
-fp
-rD
-sf
-RP
-ah
-fp
-ah
-VJ
-tG
-ah
-ah
-BU
-xx
-vR
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-wi
-Dv
-bs
-CX
-Eg
-Eg
-Eg
-Kq
-fp
-fp
-ar
-ar
-fp
-fp
-fp
-aN
-aN
-aN
-aN
-aN
-YI
-YI
-YI
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-UY
-Gh
-CG
-UW
-Zt
-Zt
-Zt
-Zt
-Zt
-Zt
-Zt
-Zt
-Zt
-SU
-Zt
-Zt
-Zt
-Zt
-SU
-Zt
-UW
-Cm
-My
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(70,1,1) = {"
-Jx
-ac
-ac
-ac
-NF
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-gs
-gs
-gs
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-KP
-pR
-yO
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-fp
-kS
-fZ
-lN
-mx
-ng
-ah
-kS
-fp
-pq
-ah
-mE
-ah
-fp
-Vz
-fp
-rE
-ah
-eQ
-ah
-tH
-ah
-ah
-fp
-tL
-wx
-wx
-fp
-fp
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-wi
-Dv
-bs
-CX
-Eg
-Eg
-Eg
-MN
-Sf
-Sf
-Sf
-Sf
-Sf
-de
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-YI
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-UY
-Gh
-CG
-Zt
-Zt
-Zt
-Zt
-Zx
-Xq
-Zx
-Zt
-Zt
-Zt
-Sq
-Zt
-yA
-yA
-Zt
-Sq
-Zt
-Zt
-Tn
-EV
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(71,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-at
-ab
-ab
-ab
-ab
-aD
-ab
-ab
-ab
-cQ
-KS
-wk
-wn
-cQ
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-fp
-kS
-ah
-ah
-ah
-BU
-bI
-kS
-fp
-bR
-jo
-jo
-FG
-fp
-bI
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-BY
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-wi
-Bf
-Vd
-CZ
-Eg
-Eg
-Eg
-MN
-Sf
-Sf
-Sf
-Cg
-Sf
-de
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-Ia
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Gh
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(72,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-gs
-gs
-ZS
-gs
-gs
-gs
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-fp
-fp
-ar
-fp
-fp
-fp
-ar
-fp
-fp
-cy
-ar
-cy
-fp
-fp
-ar
-fp
-fp
-fp
-ar
-fp
-fp
-kT
-ah
-bR
-my
-nh
-ah
-ah
-ah
-rb
-pE
-zX
-wy
-BY
-ah
-BY
-ah
-ah
-ah
-ah
-ah
-ah
-ah
-ah
-BY
-ah
-wX
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-yP
-wj
-CV
-Da
-Eg
-Eg
-Eg
-MN
-Sf
-Sf
-Sf
-Sf
-Sf
-de
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-Ia
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(73,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-yV
-gs
-gs
-gs
-gs
-ZS
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-fp
-dg
-DX
-bJ
-fp
-dg
-DX
-bJ
-fp
-ah
-bI
-BU
-fp
-dg
-DX
-bJ
-fp
-dg
-DX
-bJ
-fp
-ds
-RP
-ah
-ah
-ah
-ah
-ah
-bI
-Up
-kp
-kp
-wy
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-Eg
-Eg
-Eg
-MN
-Sf
-Sf
-Sf
-Sf
-Sf
-de
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(74,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-yV
-ac
-ac
-gs
-gs
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-fp
-dh
-bJ
-dR
-fp
-em
-bJ
-eV
-fp
-ah
-bY
-bR
-fp
-dh
-bJ
-iz
-fp
-em
-bJ
-jU
-fp
-ds
-bI
-lO
-mz
-ni
-ah
-bI
-fp
-Vh
-gB
-gB
-BU
-fp
-wz
-xy
-rF
-fp
-NK
-fp
-Ja
-fp
-NK
-fp
-NK
-fp
-Hc
-fp
-NK
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yR
-za
-zg
-zn
-zq
-zs
-MN
-Sf
-Sf
-Sf
-Cg
-Sf
-de
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(75,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ZS
-gs
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-fp
-fp
-dF
-fp
-OJ
-fp
-eI
-fp
-OJ
-bI
-ah
-ah
-OJ
-fp
-hV
-fp
-OJ
-fp
-jD
-fp
-fp
-kV
-ah
-ah
-ah
-Vh
-ah
-mA
-fp
-ah
-ah
-ah
-ah
-fp
-pr
-lz
-lz
-fp
-tI
-fp
-tI
-fp
-tI
-fp
-tI
-fp
-tI
-fp
-tI
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yS
-zb
-zb
-zb
-zb
-zb
-MN
-Sf
-Sf
-Sf
-Cg
-Sf
-de
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(76,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-gs
-gs
-gs
-gs
-ZS
-ac
-ac
-gs
-gs
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-aD
-fp
-Bp
-bJ
-bJ
-eh
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-eh
-bJ
-bJ
-Bp
-fp
-cj
-ah
-mA
-mA
-ah
-JM
-mA
-fp
-sh
-ah
-NL
-zY
-fp
-wA
-xz
-lz
-fp
-ah
-WX
-ah
-RP
-ah
-fp
-bI
-Ku
-VJ
-ah
-VJ
-fp
-aN
-aN
-aN
-Ws
-aN
-aN
-aN
-ph
-yT
-zb
-zi
-zi
-zi
-zb
-MN
-Sf
-Sf
-Sf
-Sf
-Sf
-de
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-YI
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(77,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-gs
-gs
-gs
-ZS
-ZS
-ac
-gs
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-ar
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-fp
-fp
-cy
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-lz
-lz
-xY
-fp
-JM
-ah
-PK
-ah
-Cu
-fp
-ah
-ah
-PK
-ah
-Cu
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yU
-zc
-zj
-WA
-zi
-zb
-MN
-Sf
-Sf
-Sf
-Sf
-Sf
-de
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(78,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-gs
-gs
-gs
-yV
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-ar
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-ei
-bJ
-bJ
-bJ
-ei
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-fp
-ge
-ah
-bJ
-pt
-pF
-pV
-qs
-pt
-pF
-pV
-qs
-pt
-fp
-qE
-lz
-rG
-fp
-cR
-Se
-Cq
-ah
-cP
-fp
-cS
-cR
-Cq
-ah
-cP
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yX
-zd
-zk
-zi
-zi
-zb
-MN
-Sf
-Sf
-Sf
-Cg
-Sf
-de
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(79,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-gs
-gs
-gs
-gs
-yV
-ac
-gs
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-aE
-fp
-bJ
-bJ
-bJ
-OJ
-ar
-eJ
-fp
-OJ
-ar
-gp
-fp
-OJ
-ar
-hW
-fp
-OJ
-bJ
-bJ
-bJ
-cy
-ah
-ah
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-fp
-fp
-xA
-fp
-fp
-fp
-fp
-fp
-cy
-fp
-fp
-fp
-fp
-fp
-cy
-fp
-fp
-fp
-fp
-ab
-ab
-ab
-ab
-ab
-ph
-yY
-zd
-zl
-zb
-zb
-zb
-MN
-Sf
-Sf
-Sf
-Sf
-Sf
-de
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ED
-ED
-ED
-ED
-Ab
-Ab
-Ab
-Ab
-Ab
-Ab
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(80,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-SR
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-ar
-bJ
-bJ
-bJ
-fp
-Gj
-bJ
-fa
-fp
-Of
-bJ
-gN
-fp
-Of
-bJ
-iA
-fp
-bJ
-bJ
-bJ
-cy
-ah
-ah
-De
-ah
-ah
-JM
-ah
-ah
-ah
-ah
-ah
-ah
-ah
-ah
-bJ
-bJ
-eh
-Ht
-bJ
-ah
-ah
-Cz
-Qi
-Yg
-wC
-Yu
-bI
-ah
-BX
-BX
-fp
-ab
-ab
-ab
-ab
-ab
-ph
-yZ
-zf
-zm
-zo
-zr
-zb
-MN
-fp
-fp
-ar
-ar
-fp
-fp
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-Ch
-Yd
-ED
-EF
-Ab
-Ab
-Ab
-Ab
-Ab
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(81,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-gs
-gs
-gs
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-fp
-fp
-bj
-fp
-fp
-bE
-fp
-fp
-fp
-fp
-bj
-fp
-fp
-bk
-fp
-fp
-bL
-fp
-fp
-bj
-fp
-fp
-fp
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-ar
-bJ
-bJ
-bJ
-fp
-dg
-ei
-dU
-fp
-dg
-ei
-dU
-fp
-dg
-ei
-dU
-fp
-bJ
-bJ
-dS
-fp
-ah
-ah
-ah
-ah
-ah
-ah
-ah
-ah
-BU
-ah
-ah
-RP
-ah
-ah
-bJ
-bJ
-bJ
-bJ
-bJ
-ah
-ah
-bB
-bJ
-bJ
-bJ
-ah
-ah
-ah
-bI
-ah
-ar
-ab
-ab
-ab
-ab
-ab
-ph
-pR
-pR
-yO
-WA
-Eg
-zb
-MN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-ED
-Kg
-ED
-EF
-Ab
-Ab
-Ab
-Ab
-Ab
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(82,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-SB
-Td
-JM
-ah
-mk
-ah
-ah
-De
-bI
-bJ
-ce
-cl
-ce
-cl
-ce
-cl
-ce
-cl
-ce
-cl
-ce
-cl
-fp
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-aF
-fp
-bJ
-bJ
-dS
-OJ
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-bJ
-bJ
-bJ
-fp
-De
-pG
-pG
-pG
-pG
-pG
-pG
-pG
-pG
-pG
-pG
-pG
-ah
-ah
-bJ
-bJ
-bJ
-bJ
-bJ
-ah
-bI
-bC
-bJ
-bJ
-bJ
-Za
-Vh
-ah
-RP
-bZ
-fp
-wh
-ab
-ab
-ab
-at
-ph
-pR
-pR
-yO
-WA
-Eg
-zb
-MN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-Ws
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-Kz
-Yy
-ED
-Zk
-EF
-Ab
-Ab
-Ab
-Ab
-EF
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(83,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-kW
-ST
-ah
-ah
-mk
-bI
-ah
-bR
-ah
-bJ
-cf
-cm
-cf
-cm
-cf
-Km
-cf
-cm
-La
-Km
-cf
-cm
-fp
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-ar
-bJ
-bJ
-bJ
-fp
-dg
-eh
-bJ
-fp
-dg
-eh
-bJ
-fp
-dg
-eh
-bJ
-fp
-bJ
-bJ
-bJ
-fp
-ah
-pG
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-pG
-ah
-ah
-fp
-rH
-ah
-ah
-ah
-ah
-ah
-sw
-bJ
-bJ
-bJ
-ah
-ah
-ah
-ah
-bI
-cy
-wl
-wl
-wl
-wl
-zF
-pR
-pR
-pR
-yO
-WA
-Eg
-zb
-MN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-Kz
-Rq
-YW
-EF
-EF
-Ab
-Ab
-Ab
-EF
-EF
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(84,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-HS
-Jq
-ah
-ah
-fp
-fp
-fp
-fp
-fp
-bJ
-bJ
-bJ
-ce
-IR
-Ii
-cl
-PB
-cl
-Ak
-cl
-ce
-cl
-fp
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-ar
-bJ
-bJ
-bJ
-fp
-NN
-bJ
-fb
-fp
-JN
-bJ
-gO
-fp
-NN
-bJ
-iB
-fp
-bJ
-bJ
-bJ
-fp
-bq
-pG
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-pG
-ah
-ah
-fp
-Ga
-RP
-ah
-ah
-ah
-ah
-ah
-ah
-Ag
-ah
-ah
-ah
-ah
-ah
-ah
-ar
-yX
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-yO
-WA
-Eg
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-YI
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-ED
-ED
-ED
-Zk
-EF
-EF
-EF
-EF
-EF
-EF
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(85,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-Fw
-Fw
-Fw
-Fw
-Fw
-Fw
-Fw
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-De
-ah
-Vh
-ah
-fp
-EW
-nj
-nP
-fp
-bJ
-cg
-bJ
-VF
-cm
-cf
-cm
-cf
-cm
-cf
-cm
-cf
-cm
-fp
-fp
-fp
-fp
-cA
-ab
-Nf
-ab
-pR
-aG
-fp
-bJ
-bJ
-bJ
-OJ
-ar
-eK
-fp
-OJ
-ar
-gq
-fp
-OJ
-ar
-hX
-fp
-OJ
-jl
-bJ
-bJ
-fp
-ah
-pG
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-pG
-ah
-bZ
-fp
-ah
-ah
-TW
-Jz
-bJ
-RP
-ah
-ah
-ah
-rI
-bJ
-bJ
-bJ
-bJ
-ah
-cy
-wk
-wk
-zC
-wk
-wk
-pR
-pR
-pR
-yO
-WA
-Eg
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-YI
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-Gv
-Cy
-ED
-EF
-EF
-EF
-EF
-EF
-EF
-EF
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(86,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-Fw
-DC
-OC
-ze
-YM
-Gz
-Fw
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-ah
-ah
-ah
-ah
-fp
-fp
-Lk
-fp
-fp
-bJ
-cg
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-fp
-bJ
-DU
-cy
-cB
-HI
-wl
-wl
-wl
-wo
-dc
-bJ
-bJ
-bJ
-cy
-ah
-ah
-bI
-fz
-ah
-ah
-ah
-hj
-bY
-bI
-ah
-cy
-bJ
-bJ
-bJ
-fp
-ah
-pG
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-pG
-ah
-bR
-fp
-oO
-ah
-ah
-Jz
-bJ
-ah
-ah
-ah
-uH
-bJ
-bJ
-bJ
-bJ
-bJ
-ah
-fp
-ab
-ab
-ab
-ab
-at
-ph
-pR
-pR
-yO
-WA
-Eg
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-Ul
-Mp
-ED
-ED
-ED
-ED
-Zk
-EF
-Jn
-EF
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(87,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-Fw
-PO
-TX
-Ki
-Gz
-Ao
-Fw
-ac
-ac
-ac
-gs
-yV
-ZS
-NS
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-Sc
-ah
-ah
-ah
-cy
-bJ
-bJ
-bJ
-bY
-cc
-ch
-bJ
-cr
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-ah
-bJ
-bJ
-cz
-cC
-KP
-CI
-CI
-CI
-yO
-dd
-bJ
-bJ
-bJ
-dd
-cP
-bI
-bY
-ah
-ah
-gt
-ah
-ah
-ah
-hY
-cP
-dd
-bJ
-bJ
-bJ
-fp
-ah
-pG
-wS
-wS
-wS
-wS
-xp
-wS
-wS
-wS
-wS
-pG
-ah
-sy
-fp
-xZ
-ah
-Ih
-Md
-bJ
-ah
-uA
-ah
-ah
-bJ
-bJ
-bJ
-bJ
-bJ
-bZ
-fp
-wh
-ab
-ab
-ab
-ab
-ph
-pR
-wm
-yO
-WA
-Eg
-WA
-Kq
-aN
-aN
-YI
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-Mp
-Mp
-NR
-Mp
-Mp
-OW
-Vk
-EF
-EF
-EF
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-ZS
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(88,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-Fw
-GJ
-Fn
-Zb
-zp
-TX
-Fw
-ac
-ac
-ZS
-ZS
-ZS
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-ah
-ah
-ah
-ah
-fp
-bJ
-bJ
-bJ
-fp
-bJ
-cg
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-fp
-bJ
-bJ
-cy
-cD
-KS
-wk
-wk
-wk
-wn
-cy
-bJ
-bJ
-bJ
-dc
-en
-ah
-ah
-fA
-fZ
-ah
-bI
-hk
-ah
-ah
-dN
-cy
-bJ
-bJ
-bJ
-fp
-ah
-pG
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-pG
-ah
-ah
-fp
-ah
-ah
-bI
-Jz
-bJ
-bI
-ah
-ah
-ah
-bJ
-bJ
-VU
-bJ
-bJ
-ah
-fp
-ab
-ab
-ab
-ab
-at
-ph
-pR
-pR
-yO
-WA
-Eg
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-Ws
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-Mp
-Mp
-ED
-OR
-Mp
-Yi
-Vk
-EF
-EF
-EF
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ZS
-ZS
-gs
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(89,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-Fw
-Rm
-HF
-Zm
-Yh
-At
-Fw
-ac
-ac
-ac
-gs
-ZS
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-ah
-RP
-ah
-ah
-fp
-dU
-bJ
-dh
-fp
-bJ
-cg
-bJ
-VF
-LA
-ce
-cl
-ce
-cl
-ce
-cl
-ce
-cl
-fp
-fp
-fp
-fp
-cA
-ab
-ab
-ab
-pR
-aE
-fp
-bJ
-bJ
-bJ
-OJ
-ar
-eL
-fp
-OJ
-ar
-gu
-fp
-OJ
-ar
-hZ
-fp
-OJ
-jl
-bJ
-bJ
-fp
-Vh
-pG
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-pG
-ah
-Oh
-fp
-JM
-ah
-zG
-Jz
-AF
-bI
-Kd
-ah
-ah
-bJ
-bJ
-bJ
-bJ
-bJ
-ah
-cy
-zc
-wl
-wl
-wl
-zI
-pR
-pR
-pR
-yO
-WA
-Eg
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-YI
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-NH
-Zv
-Jc
-Ne
-Mp
-Qx
-Vk
-EF
-EF
-EF
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(90,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-Fw
-EX
-IJ
-FK
-Qz
-UK
-Fw
-ac
-gs
-yV
-ZS
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-bB
-ah
-ah
-ah
-fp
-fp
-fp
-fp
-fp
-bJ
-bJ
-bJ
-XH
-Hw
-cf
-cm
-La
-cm
-TF
-cm
-VF
-GS
-fp
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-ar
-bJ
-bJ
-bJ
-fp
-Of
-bJ
-fc
-fp
-Of
-bJ
-gP
-fp
-Gj
-bJ
-iC
-fp
-bJ
-bJ
-bJ
-fp
-bq
-pG
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-pG
-ah
-ah
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-kw
-ah
-RP
-ah
-bI
-ah
-ah
-ah
-ar
-zB
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-yO
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-ED
-ED
-ED
-EB
-Mp
-YV
-Vk
-EF
-EF
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(91,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-Fw
-Yb
-Wi
-QW
-FM
-TX
-Fw
-ac
-ZS
-ZS
-ac
-ac
-ac
-NF
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-bC
-Ma
-ah
-ah
-mk
-ah
-YZ
-bR
-ah
-bJ
-ce
-cl
-ce
-cl
-Lw
-cl
-VF
-cl
-ce
-cl
-ce
-cl
-fp
-ab
-ab
-ab
-ab
-ab
-aB
-ab
-pR
-ab
-ar
-bJ
-bJ
-bJ
-fp
-dg
-ei
-dU
-fp
-dg
-ei
-dU
-fp
-dg
-ei
-dU
-fp
-bJ
-bJ
-bJ
-fp
-ah
-pG
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-wS
-pG
-ah
-ah
-fp
-sx
-hL
-fp
-Bt
-fp
-Bt
-fp
-kW
-ah
-ah
-ah
-ah
-ah
-ah
-VJ
-cy
-wk
-wk
-wk
-zD
-wk
-pR
-pR
-pR
-yO
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-OO
-Mp
-ED
-ED
-NR
-ED
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(92,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-Fw
-Ur
-Gd
-EF
-Ki
-OC
-Fw
-Zk
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-Fz
-ah
-ah
-ah
-mk
-ah
-ah
-ah
-ah
-bJ
-cf
-cm
-cf
-VF
-cf
-cm
-cf
-cm
-cf
-cm
-cf
-cm
-fp
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-aD
-fp
-bJ
-bJ
-dS
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-bJ
-bJ
-jV
-fp
-ah
-pG
-pG
-pG
-pG
-pG
-pG
-pG
-pG
-pG
-pG
-pG
-ah
-ah
-fp
-sx
-hL
-fp
-qU
-fp
-qU
-fp
-Ig
-ah
-ah
-zw
-ah
-ah
-kw
-bZ
-fp
-wh
-ab
-ab
-ab
-at
-ph
-pR
-pR
-yO
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-QU
-Mp
-Mp
-Mp
-Mp
-TT
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(93,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-Fw
-XK
-Ka
-Gz
-OC
-EF
-EF
-EF
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-fp
-fp
-bk
-fp
-fp
-bL
-fp
-fp
-fp
-fp
-bL
-fp
-fp
-bE
-fp
-fp
-bj
-fp
-fp
-bk
-fp
-fp
-fp
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-ar
-bJ
-bJ
-bJ
-fp
-dg
-eh
-bJ
-fp
-dg
-eh
-bJ
-fp
-dg
-eh
-bJ
-fp
-bJ
-bJ
-dS
-fp
-ah
-ah
-ah
-ah
-ah
-ah
-ah
-ah
-ah
-ah
-ah
-ah
-ah
-ah
-fp
-sx
-ka
-fp
-hL
-rk
-hL
-fp
-TS
-ah
-ah
-ah
-ah
-zz
-kW
-mF
-ar
-ab
-ab
-ab
-ab
-ab
-ph
-pR
-pR
-yO
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-PC
-Ae
-MK
-BZ
-EH
-ED
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(94,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-gs
-Fw
-Fw
-EF
-EF
-Fw
-EF
-EF
-GJ
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-JV
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-ar
-bJ
-bJ
-bJ
-fp
-JN
-bJ
-fd
-fp
-NN
-bJ
-gQ
-fp
-NN
-bJ
-iD
-fp
-bJ
-bJ
-bJ
-cy
-ah
-ah
-ah
-ah
-ah
-ah
-ah
-ah
-ah
-ah
-ah
-ah
-BU
-ah
-fp
-sx
-hL
-to
-hL
-hL
-hL
-zH
-ah
-VJ
-ah
-ah
-ah
-ah
-kY
-ah
-fp
-ab
-ab
-ab
-ab
-ab
-ph
-pR
-pR
-yO
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-ED
-ED
-ED
-ED
-ED
-ED
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(95,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-XE
-gs
-gs
-gs
-BL
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-aE
-fp
-bJ
-bJ
-bJ
-OJ
-ar
-eM
-fp
-OJ
-ar
-gv
-fp
-OJ
-ar
-ia
-fp
-OJ
-bJ
-bJ
-bJ
-cy
-ah
-ah
-ah
-ah
-De
-ah
-ah
-ah
-bx
-bx
-bx
-bx
-bx
-bZ
-fp
-sx
-hL
-fp
-ON
-tJ
-Hh
-fp
-dd
-dd
-ah
-RP
-dd
-dd
-fp
-fp
-fp
-aN
-aN
-aN
-aN
-ab
-ph
-pR
-pR
-yO
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-Ws
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-Ws
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-Sl
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(96,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-LF
-gs
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-ar
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-eh
-bJ
-bJ
-bJ
-eh
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-fp
-bY
-ah
-ah
-ah
-ah
-kj
-EK
-fp
-sg
-VV
-QJ
-sg
-sg
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-ah
-ah
-ah
-ah
-ah
-ah
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-pR
-pR
-yO
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-YI
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(97,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-Ky
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-vF
-ac
-ac
-ZS
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-ar
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-fp
-bq
-ah
-ah
-ah
-ah
-ah
-or
-fp
-FX
-ah
-ah
-ah
-Vh
-wB
-fp
-Wu
-FC
-NX
-fp
-LC
-IS
-fp
-vo
-ah
-kw
-kw
-ah
-ya
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-pR
-wk
-wn
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(98,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-FV
-gs
-gs
-gs
-gs
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-fp
-Bp
-bJ
-bJ
-ei
-bJ
-bJ
-bJ
-bJ
-ga
-bJ
-gR
-bJ
-bJ
-bJ
-bJ
-ei
-bJ
-bJ
-Bp
-fp
-ah
-kj
-kW
-mF
-ah
-ah
-ah
-qD
-ah
-ah
-Ih
-ah
-ah
-wY
-fp
-Hb
-Tl
-Uc
-fp
-tK
-ah
-fp
-Kv
-ah
-vr
-vr
-ah
-Kv
-ar
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-LU
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(99,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-au
-fp
-fp
-dG
-fp
-OJ
-fp
-eO
-fp
-fp
-bR
-ah
-gS
-fp
-fp
-ib
-fp
-OJ
-fp
-jE
-fp
-fp
-gb
-ah
-ah
-ah
-ah
-ah
-ah
-fp
-xq
-py
-py
-xM
-py
-xN
-fp
-rK
-YK
-sz
-fp
-Jv
-Rk
-fp
-kY
-ah
-kY
-kY
-ah
-kY
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-LU
-gs
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ZS
-ZS
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(100,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-yV
-ZS
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-Sl
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-fp
-di
-bJ
-dT
-fp
-dh
-bJ
-fe
-fp
-ah
-ah
-bI
-fp
-dh
-bJ
-iE
-fp
-dh
-bJ
-jW
-fp
-kw
-ah
-ah
-kw
-Vh
-ah
-kw
-ar
-pW
-py
-FF
-FF
-py
-py
-hm
-YE
-HP
-sA
-fp
-tL
-ah
-rc
-ah
-ah
-ah
-ah
-VJ
-ah
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-LU
-ZS
-ZS
-ZS
-ZS
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ZS
-ZS
-ZS
-gs
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(101,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-yV
-ac
-ac
-ac
-ac
-ac
-NF
-gs
-gs
-gs
-gs
-gs
-gs
-BD
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-fp
-dg
-Tr
-dU
-fp
-dg
-Tr
-dU
-fp
-BU
-ah
-ah
-fp
-dg
-Tr
-dU
-fp
-dg
-Tr
-dU
-fp
-kX
-ah
-kj
-OU
-mF
-ah
-os
-ar
-pv
-py
-pW
-pW
-YP
-py
-rd
-py
-pI
-py
-rd
-ah
-Vh
-fp
-ah
-ah
-De
-ah
-ah
-ah
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-ZS
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(102,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-vE
-gs
-Eb
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-fp
-fp
-ar
-fp
-fp
-fp
-ar
-fp
-fp
-dc
-dd
-cy
-fp
-fp
-ar
-fp
-fp
-fp
-ar
-fp
-fp
-kY
-RP
-ah
-kY
-ah
-ah
-kY
-ar
-pw
-pI
-ps
-qd
-Kw
-qF
-fp
-rL
-YE
-sB
-fp
-tM
-ah
-fp
-kw
-ah
-kw
-kw
-ah
-kw
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-fp
-aN
-fp
-ac
-ac
-ac
-ac
-ZS
-ZS
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(103,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-ab
-ab
-ab
-ab
-bK
-ab
-ab
-ab
-cT
-HI
-wl
-wo
-eD
-eW
-ab
-ab
-gz
-ab
-ab
-aF
-fp
-ah
-ah
-ah
-ah
-ah
-ah
-ah
-fp
-px
-xr
-pX
-KR
-py
-qG
-fp
-fp
-rd
-fp
-fp
-ah
-ah
-fp
-vr
-ah
-zN
-zO
-ah
-vr
-ar
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-EN
-aN
-MR
-BE
-fp
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(104,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-WL
-gs
-gs
-ac
-ac
-ZS
-yV
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-ab
-ab
-ab
-ab
-bK
-ab
-ab
-ab
-ab
-KP
-pR
-yO
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-cy
-ah
-ah
-kj
-mG
-mF
-ah
-De
-oP
-py
-Nn
-py
-py
-SS
-py
-oP
-ah
-ah
-ah
-ah
-ah
-ah
-fp
-vs
-ah
-kY
-kY
-ah
-or
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-YA
-ah
-AU
-fp
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(105,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-ab
-ab
-ab
-Nw
-bK
-ab
-ab
-ab
-ab
-KP
-pR
-yO
-at
-ab
-ab
-aF
-pR
-ab
-au
-ab
-fp
-fp
-ar
-fp
-fp
-fp
-ar
-fp
-fp
-fp
-pJ
-fp
-qe
-oP
-fp
-fp
-bq
-JM
-ah
-fp
-bl
-cG
-fp
-ah
-JM
-ah
-ah
-ah
-VJ
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-bY
-ZB
-Sj
-Mc
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(106,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-ab
-ab
-ab
-Nw
-bK
-ab
-ab
-ab
-ab
-KP
-pR
-yO
-ab
-eX
-eX
-eX
-pR
-eX
-eX
-eX
-dd
-hL
-hL
-lR
-iI
-hL
-hL
-hL
-iI
-hL
-hL
-pY
-hL
-hL
-qH
-fp
-rM
-si
-qq
-fp
-fp
-fp
-fp
-ah
-ah
-ah
-ah
-ah
-ah
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-XX
-aN
-fZ
-bY
-BH
-fp
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(107,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-ab
-ab
-ab
-ab
-bK
-ab
-ab
-ab
-ab
-KP
-pR
-yO
-ab
-LU
-LU
-LU
-pR
-LU
-LU
-hE
-dd
-kZ
-lx
-lx
-lx
-hL
-lx
-lx
-lx
-hL
-lx
-lx
-lx
-hL
-qI
-fp
-ah
-ah
-bZ
-fp
-tN
-ut
-uI
-bx
-ah
-ah
-kw
-ah
-ah
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-EZ
-WR
-aN
-fp
-fp
-ac
-fp
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(108,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-at
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-ab
-ab
-ab
-ab
-bK
-ab
-ab
-ab
-at
-KP
-pR
-yO
-ab
-LU
-eX
-eX
-pR
-eX
-eX
-LU
-dd
-hL
-hL
-hL
-hL
-hL
-hL
-ot
-hL
-hL
-hL
-hL
-hL
-hL
-hL
-re
-ah
-De
-ah
-tq
-hL
-hL
-uI
-bx
-ah
-kj
-zR
-mF
-ah
-ar
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(109,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-CI
-CI
-CI
-CI
-CI
-CI
-CI
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-KP
-pR
-yO
-CI
-CI
-CI
-CI
-pR
-CI
-CI
-CI
-aS
-hL
-hL
-lS
-mH
-hL
-hL
-ou
-oQ
-hL
-pK
-pZ
-hL
-hL
-hL
-rf
-ah
-ah
-ah
-si
-hL
-hL
-Ve
-bx
-ah
-ah
-kY
-Ih
-ah
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(110,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-yV
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-aN
-ab
-ab
-pR
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-at
-pR
-ab
-ab
-ab
-ab
-ab
-bK
-ab
-ab
-ab
-at
-KP
-pR
-yO
-ab
-LU
-eX
-eX
-pR
-eX
-eX
-LU
-dd
-hL
-hL
-hL
-hL
-hL
-hL
-ot
-hL
-hL
-hL
-hL
-hL
-hL
-hL
-qq
-ah
-ah
-VJ
-tr
-hL
-uu
-uI
-bx
-ah
-ah
-ah
-ah
-ah
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(111,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-gs
-TO
-gs
-gs
-TO
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Nv
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-fp
-fp
-fp
-ar
-ar
-fp
-fp
-fp
-ab
-ab
-ab
-ab
-ab
-pR
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-pR
-ab
-ab
-ab
-ab
-ab
-bK
-ab
-ab
-ab
-ab
-KP
-pR
-yO
-aF
-LU
-LU
-LU
-pR
-LU
-LU
-hE
-dd
-kZ
-lx
-lx
-lx
-hL
-lx
-lx
-lx
-hL
-lx
-lx
-lx
-hL
-qI
-fp
-rN
-ah
-ah
-ts
-hL
-hL
-uI
-ZF
-ah
-ah
-kw
-ah
-bZ
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(112,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ZS
-ZS
-ac
-ac
-ac
-Nv
-Nv
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-fp
-bl
-fp
-ah
-ah
-ah
-bS
-ah
-fp
-fp
-fp
-ab
-ab
-ab
-pR
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-pR
-ab
-ab
-ab
-ab
-ab
-bK
-ab
-ab
-ab
-ab
-KP
-pR
-yO
-ab
-eX
-eX
-eX
-pR
-eX
-eX
-eX
-dd
-hL
-hL
-lT
-mI
-hL
-hL
-hL
-mI
-pz
-hL
-lT
-hL
-hL
-qJ
-fp
-fp
-sj
-fp
-fp
-tO
-hL
-zM
-bx
-ah
-kj
-zN
-mF
-ah
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(113,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-gs
-gs
-gs
-gs
-TO
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-gs
-ZS
-ZS
-ZS
-ZS
-ZS
-Nv
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-fp
-ar
-fp
-fp
-aZ
-ah
-aT
-ah
-RP
-ah
-ah
-ah
-ah
-BU
-fp
-ab
-ab
-at
-pR
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-ab
-ab
-ab
-ab
-bK
-ab
-ab
-ab
-ab
-KP
-pR
-yO
-at
-ab
-ab
-ab
-pR
-aD
-ab
-ab
-fp
-fp
-ar
-fp
-fp
-fp
-nm
-ov
-fp
-fp
-pA
-fp
-fp
-pA
-fp
-fp
-aI
-ah
-ak
-fp
-hL
-hL
-Qy
-bx
-ah
-ah
-kY
-ah
-ah
-ar
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(114,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-yV
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ZS
-ZS
-Nv
-LU
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-CL
-ah
-aI
-fp
-ba
-ah
-fp
-ah
-by
-by
-by
-by
-by
-ah
-ar
-HI
-wl
-wl
-wo
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-ab
-ab
-ab
-ab
-bK
-ab
-ab
-ab
-ab
-KP
-pR
-yO
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-ko
-la
-ly
-lU
-fp
-nk
-nm
-lz
-oR
-fp
-ah
-qa
-qf
-ah
-qK
-fp
-al
-Vh
-sC
-fp
-hL
-hL
-uI
-bx
-ah
-ah
-ah
-De
-ah
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(115,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-yV
-NS
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Nv
-LU
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-al
-ah
-Cv
-fp
-bb
-JM
-bp
-bx
-by
-by
-by
-by
-by
-ah
-aT
-KP
-CI
-CI
-yO
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-ab
-ab
-ab
-ab
-bK
-ab
-ab
-ab
-cU
-KS
-wk
-wn
-eE
-eZ
-ab
-ab
-gA
-aF
-ab
-ab
-fp
-lb
-lz
-lV
-fp
-nl
-nQ
-nQ
-lz
-pA
-ah
-ah
-ah
-qt
-qL
-fp
-aJ
-ah
-aK
-fp
-hL
-hL
-uI
-aw
-ah
-ah
-ah
-ah
-ah
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-yO
-WA
-WA
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(116,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-gs
-gs
-TO
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-LU
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-am
-VJ
-aK
-fp
-bc
-ah
-bf
-bx
-by
-by
-by
-by
-by
-ah
-ar
-KP
-CI
-CI
-yO
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-ab
-ab
-ab
-ab
-fp
-fp
-ar
-fp
-fp
-cy
-dd
-cy
-fp
-fp
-ar
-fp
-fp
-fp
-ar
-fp
-fp
-lb
-Xp
-lW
-mJ
-nm
-nQ
-nQ
-oS
-fp
-fp
-fp
-pA
-fp
-fp
-fp
-fp
-sj
-fp
-fp
-tP
-fp
-fp
-fp
-fp
-ah
-ah
-fp
-fp
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-pR
-wl
-wo
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(117,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-an
-aw
-ah
-aT
-ah
-ah
-bf
-bx
-RP
-ah
-ah
-ah
-ah
-ci
-fp
-KS
-wk
-wk
-wn
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-ab
-ab
-ab
-ab
-fp
-eo
-ah
-ff
-fp
-aO
-aO
-aO
-fp
-hB
-ic
-iF
-iT
-ic
-jF
-hB
-fp
-lb
-lz
-lV
-fp
-lz
-nQ
-nQ
-nm
-pB
-bJ
-qb
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ph
-pR
-pR
-yO
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(118,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-fp
-fp
-fp
-fp
-qr
-bf
-bm
-bf
-ah
-ah
-ah
-Vh
-ah
-De
-cj
-fp
-fp
-fp
-fp
-fp
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-ab
-ab
-ab
-ab
-ar
-ep
-ah
-fg
-fB
-aO
-aO
-aO
-hl
-hC
-ah
-ah
-ah
-ah
-ah
-jX
-kp
-lb
-lz
-lV
-fp
-nn
-nR
-lz
-lz
-fp
-pL
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-yQ
-wk
-wk
-wn
-WA
-WA
-WA
-Kq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(119,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-ag
-ao
-ay
-aL
-fp
-fp
-ah
-ah
-by
-by
-by
-by
-ah
-ah
-fp
-fp
-aL
-ay
-ao
-ag
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-ab
-ab
-ab
-ab
-fp
-GZ
-eP
-ah
-fC
-aO
-aO
-aO
-dn
-hD
-id
-ah
-iU
-ah
-jG
-jY
-dn
-lb
-lz
-lX
-fp
-fp
-fp
-fp
-fp
-fp
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-bJ
-fp
-fp
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-GM
-GM
-GM
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(120,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-af
-ah
-ah
-RP
-ah
-aU
-fp
-ah
-ah
-bz
-bM
-bN
-bT
-ah
-ah
-ck
-cn
-ah
-ah
-ah
-ah
-cx
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-HI
-wl
-wl
-wl
-wo
-fp
-er
-ah
-fh
-fp
-ah
-ah
-ah
-hn
-hF
-ah
-iG
-fp
-jm
-fp
-fp
-fp
-lb
-lz
-lV
-fp
-no
-nm
-nm
-oT
-fp
-bJ
-bJ
-bJ
-fp
-fp
-fp
-fp
-fp
-BY
-fp
-fp
-fp
-fp
-fp
-fp
-ah
-ah
-fp
-yb
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(121,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-af
-ah
-ah
-ah
-aO
-aO
-bg
-De
-ah
-bz
-bN
-bQ
-bT
-ah
-ah
-IK
-Ps
-cs
-ah
-Ih
-ah
-cx
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-KS
-wk
-pR
-pR
-yO
-fp
-fp
-ah
-fi
-fp
-De
-ah
-gT
-fp
-hB
-ic
-iH
-fp
-hL
-jH
-jZ
-kq
-lb
-lz
-lV
-fp
-no
-nS
-ow
-oU
-fp
-jl
-bJ
-bJ
-fp
-qM
-rg
-rg
-fp
-sD
-sE
-tQ
-ah
-ah
-vt
-fp
-ah
-JM
-ah
-bx
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(122,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-af
-ai
-ah
-ah
-aO
-aV
-Ld
-ah
-ah
-bz
-bO
-bN
-bT
-ah
-ah
-OJ
-cp
-ct
-ah
-ah
-ah
-cx
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-aF
-KP
-pR
-br
-fp
-es
-ah
-ah
-fp
-gb
-ah
-bZ
-fp
-fp
-fp
-fp
-fp
-hL
-hL
-hL
-hL
-lb
-lz
-lV
-fp
-np
-nT
-ox
-oV
-fp
-bJ
-bJ
-bJ
-fp
-qN
-qN
-qN
-fp
-sE
-sE
-fp
-oO
-De
-vu
-fp
-ah
-ah
-ah
-ah
-ar
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(123,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-ED
-ED
-ED
-ED
-ED
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-aj
-ah
-ah
-aP
-aW
-OJ
-ah
-ah
-bz
-bP
-bN
-bT
-VJ
-ah
-fp
-cq
-cs
-ah
-ai
-cu
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-ab
-KP
-pR
-br
-fp
-et
-VJ
-ah
-fp
-gc
-ah
-ah
-ho
-hG
-Av
-hG
-hG
-hG
-hG
-hG
-hG
-lc
-lz
-lV
-fp
-nq
-nT
-oy
-oW
-fp
-bJ
-bJ
-bJ
-qu
-qO
-qN
-qN
-fp
-fp
-fp
-fp
-ah
-ah
-bZ
-fp
-bq
-ah
-xB
-ah
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-ED
-ED
-ED
-ED
-ED
-ED
-ED
-ED
-ED
-ED
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(124,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-AP
-Mp
-Px
-AZ
-ED
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-fp
-fp
-az
-fp
-fp
-fp
-fp
-ah
-by
-by
-by
-by
-ah
-fp
-fp
-fp
-fp
-az
-fp
-fp
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-ab
-KP
-CI
-yO
-ar
-eu
-ah
-fj
-fp
-ah
-bI
-Ly
-hp
-hH
-hH
-hH
-iV
-hH
-hH
-hH
-kr
-ld
-Km
-lY
-mK
-lz
-nU
-oz
-oX
-fp
-bJ
-bJ
-bJ
-fp
-qN
-qN
-qN
-fp
-sF
-sG
-tR
-by
-by
-by
-fp
-ah
-ah
-ah
-FN
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-Cx
-Yy
-Yy
-Kg
-KZ
-WS
-Iz
-Mp
-Mp
-ED
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(125,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ED
-Mp
-Mp
-Mp
-Mp
-ED
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-cw
-aq
-fp
-aq
-bh
-fp
-bq
-ah
-ah
-Ih
-ah
-bZ
-fp
-bh
-aq
-fp
-aq
-cw
-fp
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-ab
-aM
-bd
-bt
-fp
-ev
-ah
-BU
-fD
-ah
-bI
-ah
-fp
-hI
-hL
-hL
-hL
-hL
-hL
-ka
-fp
-lb
-lz
-lV
-fp
-nr
-nW
-oA
-oZ
-fp
-bJ
-bJ
-dS
-fp
-qP
-qN
-qN
-fp
-sG
-sG
-fp
-uv
-by
-ee
-dc
-ah
-ah
-ah
-ah
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-Yy
-Yy
-TH
-ED
-LQ
-LQ
-ED
-Mp
-KY
-ED
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(126,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ac
-ac
-ac
-ac
-ac
-ED
-Mp
-Mp
-Qs
-Wo
-ED
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-aq
-aA
-fp
-aX
-aq
-fp
-cP
-ah
-ah
-ah
-ah
-cP
-fp
-aq
-aX
-fp
-aA
-aq
-fp
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-aD
-fp
-fp
-fp
-fp
-fp
-dt
-ah
-fh
-fp
-bI
-ah
-ah
-fp
-iW
-iW
-iW
-iW
-iW
-jI
-kb
-fp
-le
-lz
-lX
-fp
-fp
-fp
-fp
-fp
-fp
-bJ
-bJ
-bJ
-fp
-qQ
-qN
-qN
-fp
-fp
-fp
-fp
-by
-by
-ee
-dd
-Vh
-ah
-ah
-ah
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-Yy
-XU
-Yy
-ED
-ED
-ED
-Jc
-Mp
-UX
-ED
-XF
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-ZS
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(127,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ED
-ED
-ED
-ED
-Go
-ED
-ED
-ED
-ED
-ED
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-fp
-fp
-fp
-fp
-bi
-fp
-fp
-fp
-Vh
-ah
-fp
-fp
-fp
-bi
-fp
-fp
-fp
-fp
-fp
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-fp
-dj
-dH
-kn
-fp
-dt
-Ci
-dy
-fp
-ah
-bR
-bZ
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-lf
-lz
-PS
-fp
-ns
-nX
-oB
-pa
-fp
-bJ
-bJ
-bJ
-fp
-qR
-rh
-qN
-fp
-sH
-tp
-tS
-uw
-by
-by
-cy
-ah
-ah
-ah
-ah
-ar
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-ED
-ED
-ED
-ED
-Pc
-Px
-Mp
-Mp
-Mp
-Ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-Jx
-"}
-(128,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ED
-ER
-lw
-Mp
-VD
-ED
-QF
-Yy
-Cx
-ED
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-aQ
-ah
-ah
-bn
-bu
-OJ
-ah
-ah
-OJ
-ca
-cd
-ah
-ai
-cu
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-fp
-dk
-dI
-dV
-fp
-ey
-eQ
-XC
-fp
-ah
-mC
-ah
-fp
-hK
-ie
-iI
-iX
-fp
-jJ
-kc
-ks
-lb
-lz
-lV
-fp
-nt
-nZ
-ah
-pb
-fp
-bJ
-bJ
-bJ
-fp
-qN
-ri
-qN
-fp
-sI
-tt
-fp
-ux
-uJ
-vv
-fp
-ah
-cs
-cs
-cs
-fp
-ab
-ab
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-Qx
-Zj
-Zj
-Mp
-Mp
-Nb
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-Jx
-Jx
-"}
-(129,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ED
-NG
-lQ
-Mp
-Mp
-Go
-Yy
-Kc
-Yy
-ED
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aH
-ai
-ah
-JM
-bn
-bv
-VA
-ah
-De
-XW
-Hm
-cd
-De
-ah
-ah
-cv
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-fp
-fp
-fp
-BY
-fp
-fp
-fp
-fp
-fp
-ah
-Ih
-ah
-hq
-hL
-hL
-hL
-iY
-fp
-jJ
-kd
-hL
-lb
-lz
-lV
-mO
-nu
-oa
-oC
-ah
-fp
-jl
-bJ
-bJ
-qu
-qO
-ri
-rO
-fp
-fp
-fp
-fp
-ah
-uK
-vw
-fp
-bq
-cs
-cs
-co
-fp
-ab
-ab
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-Vr
-Qx
-Ng
-Mp
-Mp
-be
-XF
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-Jx
-Jx
-"}
-(130,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ED
-Ti
-rl
-CE
-Mp
-ED
-VR
-Yy
-Ok
-ED
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aH
-ah
-ah
-ah
-ah
-ah
-bA
-ah
-ah
-bU
-ah
-ah
-ah
-ah
-ah
-cv
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-ar
-dl
-bR
-ah
-ej
-bR
-bR
-ah
-ah
-bR
-ah
-ah
-fp
-hM
-hL
-iJ
-iZ
-fp
-jK
-ke
-kt
-lb
-lz
-El
-fp
-nC
-ah
-oD
-pc
-fp
-bJ
-bJ
-bJ
-fp
-qN
-ri
-qN
-fp
-sJ
-tu
-tR
-ah
-bR
-vx
-fp
-ah
-cs
-xC
-yc
-fp
-ab
-ab
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZS
-yV
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-Pc
-Mp
-Bw
-Mp
-KY
-ED
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-Jx
-Jx
-Jx
-Jx
-"}
-(131,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-BD
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ED
-FP
-Mp
-Mp
-IQ
-ED
-Yy
-Yy
-Yy
-ED
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aH
-ah
-ah
-ah
-ah
-bw
-fp
-ah
-ah
-fp
-cb
-ah
-ah
-VJ
-ah
-cv
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-ar
-dm
-ah
-dX
-ek
-ah
-eR
-bR
-ah
-ah
-ah
-ah
-fp
-hN
-if
-iK
-ja
-fp
-jL
-kf
-kf
-lb
-lz
-lW
-fp
-nD
-ob
-ah
-ah
-fp
-bJ
-bJ
-bJ
-fp
-qS
-rj
-qN
-fp
-sE
-tv
-fp
-uy
-ah
-vy
-fp
-ah
-cs
-cs
-yd
-fp
-ab
-ab
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ZS
-ZS
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-zy
-KB
-Mp
-Mp
-ZE
-ED
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-zQ
-zQ
-zQ
-zQ
-zQ
-"}
-(132,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-gs
-gs
-Fh
-Mp
-Mp
-CA
-Na
-ED
-Yy
-XU
-Yy
-ED
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-aR
-aY
-ay
-bo
-fp
-fp
-ah
-ah
-fp
-fp
-bo
-ay
-aY
-aR
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-fp
-ae
-dJ
-ae
-fp
-fp
-fp
-fp
-fp
-ah
-ah
-bI
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-lg
-lA
-lZ
-fp
-fp
-fp
-fp
-fp
-fp
-pM
-bJ
-bJ
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-RP
-cs
-cs
-cs
-fp
-ab
-ab
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-VE
-gs
-AL
-Kt
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ED
-ED
-ED
-ED
-ED
-ED
-ED
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-zQ
-Oz
-EO
-EO
-Uo
-zQ
-"}
-(133,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-CO
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-gs
-lv
-be
-ED
-ED
-ED
-ED
-ED
-ED
-ED
-ED
-ED
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-fp
-fp
-fp
-fp
-fp
-bB
-by
-by
-bV
-fp
-fp
-fp
-fp
-fp
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-fp
-do
-dK
-dY
-fp
-dy
-eS
-fk
-fp
-aO
-aO
-aO
-ah
-hO
-bR
-ZO
-bR
-ah
-ah
-ah
-hO
-aO
-aO
-aO
-ah
-ah
-ah
-Vh
-mE
-cy
-bJ
-bJ
-dS
-fp
-qT
-fp
-qT
-fp
-sK
-sK
-sK
-sK
-sK
-fp
-ah
-ah
-ah
-ah
-ah
-fp
-ab
-ab
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-XI
-gs
-gs
-Kt
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-Jx
-zQ
-NO
-EO
-EO
-Xa
-zQ
-"}
-(134,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ar
-bC
-by
-by
-bW
-ar
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-fp
-dp
-bR
-dZ
-fp
-bI
-ah
-fl
-fp
-aO
-aO
-aO
-ah
-bR
-Lv
-ah
-ah
-ah
-ah
-Ih
-ah
-aO
-aO
-aO
-ah
-VJ
-ah
-ah
-ah
-dd
-bJ
-bJ
-bJ
-fp
-qU
-fp
-qU
-fp
-hL
-tx
-hL
-hL
-hL
-fp
-ah
-cs
-cs
-cs
-Vh
-fp
-ab
-ab
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-Wz
-gs
-Sl
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-Qa
-ZL
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-zQ
-zQ
-TR
-EO
-EO
-Bg
-zQ
-"}
-(135,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ar
-bD
-by
-by
-wR
-ar
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-ar
-dq
-dL
-ea
-fp
-ez
-ah
-fm
-fp
-aO
-aO
-aO
-ah
-ah
-ah
-ah
-ah
-ah
-bR
-bR
-ah
-aO
-aO
-aO
-ah
-ah
-ah
-ah
-ah
-cy
-bJ
-bJ
-bJ
-hL
-hL
-rk
-hL
-fp
-fp
-fp
-to
-fp
-fp
-fp
-bq
-cs
-cs
-xC
-ye
-fp
-ab
-ab
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-FJ
-BA
-gs
-Eb
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-RO
-EG
-EG
-Ai
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-zQ
-EO
-EO
-GC
-CQ
-WK
-zQ
-"}
-(136,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-fp
-JM
-ah
-fp
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-fp
-dr
-dM
-eb
-fp
-eA
-ah
-fn
-fp
-gd
-gw
-gU
-fp
-fp
-fp
-cy
-fp
-fp
-fp
-cR
-cS
-eq
-fp
-fp
-fp
-nE
-fp
-fp
-fp
-fp
-pM
-bJ
-bJ
-fp
-hL
-lT
-lT
-fp
-sL
-rk
-hL
-hL
-hL
-hL
-ah
-cs
-cs
-xC
-yf
-ar
-ab
-ab
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-Wz
-Wz
-Ui
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-Bb
-EG
-Nq
-EG
-Ai
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-zQ
-BF
-EO
-EO
-Xh
-zQ
-zQ
-"}
-(137,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-Dj
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-ar
-ar
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-fp
-ds
-dN
-ec
-fp
-eB
-eT
-ah
-fp
-fp
-fp
-fp
-fp
-hP
-ig
-dV
-jb
-jn
-fp
-fp
-fp
-fp
-fp
-ma
-ah
-nF
-oc
-oc
-oc
-fp
-bJ
-bJ
-qg
-fp
-fp
-gK
-gK
-fp
-sM
-hL
-hL
-hL
-hL
-fp
-ah
-cs
-cs
-xC
-yg
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-DE
-XZ
-gs
-YY
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-gs
-gs
-ZS
-gs
-gs
-gs
-gs
-gs
-BR
-LL
-AN
-EG
-Ew
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-zQ
-EO
-EO
-EO
-Kl
-zQ
-Jx
-"}
-(138,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-ar
-du
-by
-ed
-fp
-eC
-ah
-dN
-fp
-ge
-ah
-ah
-ah
-ah
-ah
-ah
-bR
-bR
-bR
-fh
-ku
-lh
-fp
-mb
-eT
-dN
-eT
-bR
-pd
-fp
-bJ
-bJ
-bJ
-fp
-hL
-pY
-pY
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-De
-cs
-cs
-cs
-bZ
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-DH
-ac
-ac
-FY
-gs
-gs
-gs
-Wz
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ZS
-ZS
-gs
-gs
-gs
-gs
-RO
-EG
-Ux
-EG
-Un
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-zQ
-RQ
-Ar
-EO
-Kp
-zQ
-Jx
-"}
-(139,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-fp
-dv
-dO
-ee
-fp
-eF
-ah
-fo
-fE
-ah
-gx
-aO
-aO
-ah
-aO
-aO
-aO
-bI
-aO
-aO
-aO
-ah
-fp
-mc
-ah
-bR
-od
-oE
-pe
-fp
-jl
-bJ
-bJ
-hL
-hL
-rm
-hL
-fp
-sN
-ah
-fp
-sN
-ah
-fp
-ah
-ah
-ah
-ah
-ah
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-IV
-ZS
-gs
-gs
-BD
-DE
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-Bb
-EG
-EG
-Un
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-zQ
-PD
-EO
-EO
-JY
-zQ
-Jx
-"}
-(140,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-fp
-dw
-dP
-ef
-fp
-eG
-eU
-ew
-fp
-gf
-gy
-aO
-aO
-ah
-aO
-iL
-aO
-ah
-aO
-aO
-jc
-li
-fp
-md
-ah
-nG
-oe
-oe
-oe
-fp
-bJ
-bJ
-bJ
-fp
-qU
-fp
-qU
-fp
-sO
-ah
-fp
-bq
-ah
-fp
-ah
-ah
-VJ
-ah
-ah
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-IV
-yV
-yV
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-Qv
-Qk
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-zQ
-zQ
-zQ
-zQ
-zQ
-zQ
-Jx
-"}
-(141,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Hp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-pR
-ab
-fp
-fp
-ar
-fp
-fp
-fp
-fp
-fp
-fp
-gg
-aO
-aO
-hr
-hQ
-aO
-aO
-jc
-jo
-jc
-aO
-kv
-lj
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-cy
-dd
-cy
-fp
-qV
-fp
-qV
-fp
-sP
-ah
-fp
-uz
-ah
-fp
-ah
-ah
-ah
-ah
-ah
-ar
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-IV
-DH
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-gs
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-"}
-(142,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-gs
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-pR
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-gh
-gB
-ah
-hs
-hR
-ih
-iM
-jd
-jp
-jM
-ah
-fo
-lk
-fp
-ge
-RP
-ah
-mE
-ah
-ah
-ah
-bJ
-bJ
-bJ
-fp
-fp
-fp
-fp
-fp
-fp
-ty
-wr
-fp
-uL
-fp
-cy
-dd
-cy
-fp
-ah
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-"}
-(143,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-yV
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-pR
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-fp
-fp
-fp
-fp
-ar
-fp
-fp
-fp
-ar
-fp
-fp
-fp
-fp
-fp
-ah
-ah
-ah
-VJ
-ah
-ah
-ah
-bJ
-bJ
-bJ
-ah
-ah
-mE
-ah
-ah
-ah
-De
-mE
-ah
-ah
-ah
-ah
-ah
-ah
-fp
-ah
-fp
-aN
-aN
-aN
-aN
-aN
-YI
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ZS
-ZS
-ZS
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-"}
-(144,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-gs
-ac
-gs
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-pR
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-au
-ab
-ab
-eW
-ab
-ab
-ab
-ab
-ab
-au
-ab
-fp
-JM
-ah
-ah
-ah
-ah
-De
-ah
-bJ
-bJ
-bJ
-ah
-ah
-ah
-ah
-JM
-ah
-ah
-ah
-VJ
-ah
-ah
-BU
-ah
-bZ
-fp
-fp
-fp
-aN
-aN
-aN
-aN
-YI
-YI
-YI
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-Jx
-Jx
-Jx
-"}
-(145,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-gs
-gs
-gs
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aC
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-pR
-cy
-ah
-ah
-ah
-of
-ah
-ah
-ah
-bJ
-bJ
-bJ
-ah
-Vh
-ah
-ah
-ah
-ah
-ah
-VJ
-ah
-ah
-ah
-ah
-ah
-ah
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-YI
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-Jx
-Jx
-"}
-(146,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Gn
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ZS
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-fp
-ar
-fp
-fp
-ar
-fp
-fp
-cy
-dd
-cy
-fp
-fp
-ar
-fp
-fp
-ar
-fp
-fp
-ar
-fp
-fp
-ar
-fp
-fp
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-Jx
-Jx
-"}
-(147,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-mL
-HI
-wl
-wo
-Wy
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-Jx
-"}
-(148,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-gs
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-YI
-aN
-aN
-aN
-aN
-Ws
-aN
-aN
-aN
-aN
-aN
-aN
-Rv
-aN
-zK
-aN
-aN
-zK
-aN
-aN
-AD
-ab
-ab
-ab
-Vt
-aN
-Vt
-aN
-Rv
-KP
-na
-yO
-aD
-ab
-zK
-aN
-aN
-zK
-aN
-aN
-Rv
-aN
-zK
-aN
-aN
-zK
-aN
-aN
-AD
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(149,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-Fc
-aN
-aN
-YI
-aN
-aN
-aN
-aN
-aN
-aN
-Ws
-aN
-ZM
-Gr
-aN
-aN
-zK
-aN
-Ws
-aN
-aN
-ab
-ab
-ab
-aN
-aN
-aN
-AD
-mM
-KP
-pR
-yO
-fq
-fK
-aN
-aN
-zK
-aN
-aN
-aN
-ZM
-Gr
-aN
-Ws
-zK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(150,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-gs
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-YI
-YI
-YI
-aN
-aN
-aN
-aN
-aN
-aN
-Rv
-aN
-aN
-HD
-zK
-aN
-Vt
-Gr
-HD
-AD
-aN
-YI
-YI
-Ws
-zK
-zE
-aN
-Rr
-pR
-Pr
-aD
-ab
-aN
-HD
-zK
-aN
-Vt
-Gr
-Rv
-Fc
-aN
-HD
-zK
-aN
-Vt
-Gr
-HD
-AD
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(151,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-YI
-aN
-aN
-YI
-aN
-aN
-aN
-aN
-aN
-Fc
-aN
-aN
-aN
-aN
-Rv
-AD
-zK
-Vt
-aN
-aN
-Vt
-aN
-aN
-aN
-aN
-YI
-aN
-aN
-Gr
-aN
-Rv
-KP
-pR
-yO
-aD
-fs
-zK
-Vt
-aN
-aN
-Vt
-aN
-Rv
-AD
-zK
-Vt
-aN
-aN
-Vt
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(152,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-YI
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-zE
-YI
-YI
-aN
-zK
-aN
-aN
-aN
-aN
-aN
-aN
-Vt
-aN
-aN
-ml
-aN
-KP
-na
-yO
-mm
-fL
-aN
-aN
-Ws
-zK
-aN
-aN
-aN
-zE
-aN
-aN
-aN
-zK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(153,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Lh
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-Fc
-aN
-aN
-aN
-aN
-aN
-YI
-aN
-aN
-aN
-aN
-aN
-aN
-zK
-zK
-aN
-aN
-aN
-YI
-aN
-aN
-Fc
-aN
-aN
-aN
-aN
-zK
-aN
-Rr
-na
-Pr
-ab
-ab
-zK
-zK
-aN
-aN
-aN
-aN
-aN
-aN
-zK
-zK
-Fc
-aN
-aN
-aN
-Ws
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(154,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-zv
-aN
-Vt
-aN
-aN
-YI
-aN
-zK
-aN
-aN
-YI
-aN
-HD
-YI
-aN
-HD
-Gg
-Ws
-zK
-Rr
-nw
-yO
-fr
-ab
-aN
-aN
-aN
-zK
-aN
-YI
-Vt
-aN
-aN
-YI
-aN
-zK
-aN
-aN
-aN
-aN
-HD
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(155,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-Ws
-aN
-aN
-aN
-aN
-Ws
-aN
-aN
-aN
-aN
-aN
-AD
-aN
-aN
-aN
-HD
-aN
-Fc
-HD
-aN
-Gr
-aN
-aN
-YI
-Vt
-aN
-aN
-aN
-nb
-nx
-Pr
-fs
-ab
-aN
-Fc
-HD
-aN
-YI
-Uf
-AD
-aN
-aN
-Fc
-HD
-YI
-aN
-HD
-YI
-Gr
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(156,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-HD
-aN
-Gr
-aN
-aN
-aN
-YI
-aN
-aN
-aN
-AD
-aN
-aN
-aN
-aN
-Pm
-zK
-nc
-nb
-Pr
-ft
-ab
-Gr
-aN
-aN
-aN
-aN
-aN
-HD
-aN
-Gr
-aN
-aN
-aN
-aN
-YI
-YI
-aN
-AD
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(157,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-Fc
-aN
-aN
-aN
-Vt
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-YI
-aN
-aN
-HD
-aN
-aN
-fs
-ab
-TG
-na
-na
-ab
-fr
-aN
-aN
-aN
-YI
-aN
-Ws
-aN
-Vt
-aN
-aN
-Fc
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(158,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-Qd
-gs
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-Fc
-aN
-YI
-aN
-aN
-YI
-YI
-aN
-aN
-Ws
-aN
-aN
-aN
-aN
-aN
-aN
-Gr
-aN
-aN
-YI
-aN
-Vt
-Ws
-AD
-fK
-ab
-ab
-aN
-na
-ab
-ab
-Ws
-aN
-aN
-aN
-aN
-Gr
-aN
-aN
-aN
-aN
-aN
-aN
-Ws
-Gr
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(159,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-YI
-YI
-aN
-aN
-aN
-aN
-aN
-Vt
-aN
-Ws
-aN
-aN
-aN
-HD
-aN
-aN
-aN
-aN
-lL
-ab
-GD
-ab
-gr
-MM
-ab
-ab
-aN
-Vt
-aN
-aN
-Fc
-aN
-aN
-YI
-aN
-Vt
-aN
-aN
-aN
-aN
-aN
-HD
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(160,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-YI
-aN
-aN
-aN
-aN
-aN
-aN
-Gr
-aN
-aN
-aN
-aN
-aN
-HD
-aN
-aN
-aN
-aN
-CU
-aN
-ab
-ft
-ab
-ft
-na
-ab
-ab
-oY
-aN
-aN
-aN
-aN
-aN
-aN
-Ws
-Gr
-aN
-aN
-aN
-aN
-aN
-HD
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(161,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-yV
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-Ws
-aN
-aN
-aN
-aN
-aN
-Ws
-aN
-ab
-fr
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-Gr
-aN
-aN
-aN
-aN
-aN
-fr
-ab
-fs
-ab
-nH
-mm
-fr
-aN
-YI
-aN
-aN
-aN
-aN
-aN
-Vt
-aN
-aN
-aN
-YI
-YI
-aN
-aN
-Gr
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(162,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-aN
-aN
-aN
-aN
-Gr
-aN
-aN
-aN
-aN
-YI
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-aN
-aN
-aN
-aN
-aN
-Gr
-aN
-aN
-aN
-aN
-aN
-aN
-YI
-Gr
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(163,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-Gr
-AD
-aN
-aN
-aN
-AD
-aN
-HD
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-ab
-aN
-Gr
-AD
-aN
-aN
-aN
-aN
-aN
-aN
-Gr
-AD
-aN
-aN
-aN
-AD
-aN
-HD
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(164,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ab
-ab
-ab
-ab
-ab
-fs
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-mm
-ab
-ab
-ab
-mm
-ab
-fs
-ab
-ab
-ab
-GD
-ab
-ab
-ab
-fs
-ab
-ab
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(165,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-vq
-vq
-vq
-vq
-vq
-eN
-cN
-eN
-vq
-cN
-cN
-cN
-cN
-vq
-vq
-vq
-vq
-eN
-vq
-vq
-cN
-vq
-vq
-nd
-ny
-Jm
-vq
-eN
-vq
-cN
-vq
-eN
-vq
-cN
-cN
-vq
-vq
-eN
-vq
-vq
-vq
-vq
-eN
-vq
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(166,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-QK
-aN
-aN
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-cI
-cZ
-au
-da
-aF
-dD
-ab
-au
-ab
-au
-da
-aF
-dD
-ab
-au
-ab
-da
-aF
-dD
-ab
-au
-ab
-mN
-Rr
-nz
-nI
-nY
-dD
-cZ
-au
-da
-aF
-dD
-dD
-cZ
-dD
-cZ
-au
-da
-aF
-dD
-ab
-au
-cK
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(167,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-cJ
-ab
-aF
-ab
-au
-ab
-eW
-cZ
-ab
-aF
-ab
-au
-ab
-eW
-cZ
-ab
-ab
-au
-ab
-eW
-cZ
-ab
-mN
-ne
-nA
-nI
-mm
-aF
-ab
-aF
-ab
-au
-ab
-aF
-ab
-aF
-ab
-aF
-ab
-au
-ab
-eW
-cZ
-cK
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(168,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-cK
-da
-dD
-cZ
-aF
-aF
-au
-ab
-eW
-dD
-cZ
-aF
-aF
-au
-ab
-eW
-cZ
-aF
-aF
-au
-ab
-mn
-mm
-nf
-nB
-In
-mN
-ab
-Uz
-dD
-cZ
-aF
-aF
-ab
-da
-ab
-da
-dD
-cZ
-aF
-aF
-au
-ab
-wg
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(169,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-QK
-QK
-QK
-QK
-WZ
-KQ
-KQ
-KQ
-KQ
-JK
-QK
-QK
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-fp
-fp
-fp
-lB
-ht
-ht
-gV
-ht
-fp
-fp
-fp
-jy
-jy
-fp
-sk
-sk
-sk
-sk
-jy
-fp
-fp
-jy
-pN
-pN
-qh
-fp
-jy
-jy
-fp
-zV
-sk
-sk
-zV
-fp
-fp
-vz
-fp
-zV
-sk
-zV
-sk
-jy
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(170,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-LU
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-QK
-QK
-QK
-WZ
-Cs
-Oy
-Hk
-Hk
-YQ
-zU
-JK
-QK
-QK
-QK
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-fF
-cs
-gj
-cs
-cs
-cs
-ii
-dN
-ah
-jq
-fp
-kg
-kw
-ah
-jr
-ah
-dN
-nJ
-og
-oF
-pf
-fp
-hg
-hg
-hg
-fp
-oF
-rn
-rP
-sl
-sQ
-sm
-tT
-fp
-uM
-vA
-vT
-wD
-wZ
-wZ
-wZ
-uU
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(171,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-LU
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-QK
-QK
-QK
-WZ
-Cs
-Oy
-Tw
-Tw
-Tw
-Tw
-YQ
-zU
-JK
-QK
-QK
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-fG
-cs
-gC
-gC
-gC
-cs
-ij
-iN
-ah
-bW
-fp
-kh
-kx
-ll
-kz
-kz
-kz
-bI
-fp
-fp
-fp
-fp
-pO
-pO
-pO
-fp
-fp
-fp
-fp
-sm
-sR
-sm
-tU
-fp
-uN
-hL
-hL
-hL
-hL
-xD
-hL
-yq
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(172,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-LU
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-QK
-QK
-QK
-QK
-WZ
-Cs
-Oy
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-YQ
-zU
-JK
-QK
-QK
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-cs
-cs
-gD
-gW
-hu
-hS
-cs
-ah
-bI
-bX
-fp
-ah
-ky
-kD
-kz
-me
-me
-cj
-fp
-oG
-oI
-bI
-pP
-hg
-hg
-ah
-oI
-fh
-fp
-sm
-sS
-sm
-tV
-fp
-uO
-hL
-vU
-hL
-xa
-hL
-yh
-yr
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(173,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-yV
-ZS
-gs
-LU
-LU
-LU
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-QK
-QK
-WZ
-KQ
-KQ
-Cs
-Oy
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-YQ
-zU
-KQ
-JK
-QK
-QK
-QK
-aN
-aN
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-fH
-gi
-gE
-gX
-hv
-hS
-cs
-ah
-gt
-jr
-fp
-ki
-kz
-kz
-kz
-mf
-mf
-mA
-fp
-ah
-oI
-ah
-vp
-zS
-vp
-bY
-oI
-ah
-fp
-sm
-sT
-sm
-tW
-fp
-uP
-hL
-vV
-hL
-xb
-hL
-hL
-ys
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(174,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-hJ
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-gs
-gs
-gs
-gs
-LU
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-QK
-QK
-WZ
-Cs
-Oy
-Hk
-Hk
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Tw
-Hk
-YQ
-FE
-QK
-QK
-QK
-QK
-aN
-aN
-aN
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-cs
-cs
-gF
-gY
-hw
-hS
-cs
-ah
-ah
-js
-jy
-ah
-kz
-lm
-lC
-kz
-kz
-fl
-fp
-ah
-nV
-ah
-hg
-hg
-hg
-ah
-pi
-ah
-fp
-sm
-sU
-sm
-tX
-fp
-uQ
-hL
-hL
-wE
-xc
-xE
-hL
-yt
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(175,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-yV
-gs
-WU
-gs
-gs
-gs
-LU
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-QK
-QK
-WZ
-Cs
-Oy
-Tw
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Tw
-Ya
-zU
-KQ
-JK
-QK
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fu
-cs
-gj
-gG
-gZ
-gG
-cs
-cs
-ah
-ah
-ju
-jy
-ah
-kB
-kD
-kz
-mg
-mP
-nK
-fp
-ah
-pg
-ah
-hg
-hg
-hg
-ah
-pi
-ah
-fp
-sm
-sV
-sm
-tY
-fp
-uR
-vB
-vW
-wF
-xd
-xF
-hL
-yu
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(176,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-LU
-LU
-aN
-aN
-aN
-aN
-QK
-QK
-QK
-WZ
-Cs
-Oy
-Tw
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Tw
-Hk
-YQ
-FE
-QK
-QK
-QK
-QK
-aN
-aN
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-fI
-cs
-cs
-cs
-cs
-cs
-cs
-iO
-je
-jv
-fp
-kj
-kC
-kD
-lD
-mh
-mh
-kS
-fp
-ah
-nV
-ah
-hg
-hg
-hg
-ah
-qW
-ah
-fp
-sm
-sW
-sm
-tZ
-fp
-uS
-hL
-hL
-hL
-xe
-hL
-hL
-yv
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ZS
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(177,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-LU
-aN
-aN
-aN
-QK
-QK
-WZ
-WQ
-Cs
-Oy
-Tw
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Ya
-zU
-JK
-QK
-QK
-QK
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-fJ
-ah
-ah
-fh
-hx
-ah
-bI
-ah
-ah
-jw
-fp
-je
-kD
-kD
-kz
-kz
-kz
-ah
-fp
-ah
-nV
-ah
-hg
-hg
-hg
-ah
-pi
-hx
-fp
-sm
-sX
-sm
-sQ
-jy
-uT
-hL
-hL
-hL
-vU
-hL
-xD
-yw
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-gs
-gs
-ZS
-ZS
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(178,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-EJ
-gs
-ZS
-ZS
-gs
-LU
-aN
-aN
-aN
-QK
-QK
-XS
-Oy
-Hk
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-YQ
-zU
-KQ
-JK
-QK
-QK
-QK
-QK
-aN
-QK
-aN
-aN
-aN
-aN
-QK
-aN
-aN
-aN
-aN
-aN
-QK
-aN
-aN
-QK
-aN
-QK
-aN
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-ik
-ah
-bI
-fZ
-fp
-kj
-kD
-ln
-lD
-mi
-mi
-mz
-fp
-ah
-pj
-ah
-hg
-hg
-hg
-ah
-zT
-ah
-fp
-sm
-sY
-sm
-ua
-jy
-uU
-vC
-vC
-lz
-lz
-vC
-vC
-yx
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-LU
-LU
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(179,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ZS
-ac
-yV
-gs
-LU
-aN
-aN
-QK
-QK
-QK
-Ic
-RV
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Hk
-YQ
-zU
-JK
-QK
-QK
-QK
-QK
-aN
-aN
-aN
-QK
-aN
-aN
-aN
-aN
-QK
-aN
-aN
-aN
-aN
-QK
-aN
-QK
-QK
-QK
-aN
-aN
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fv
-fM
-fp
-gH
-fp
-gH
-fp
-il
-ah
-ah
-ah
-jy
-ah
-kD
-kD
-lE
-mj
-mR
-lN
-fp
-ah
-oI
-ah
-hg
-hg
-hg
-ah
-oI
-ah
-fp
-sm
-sT
-sm
-ub
-jy
-uV
-uV
-vX
-lz
-oX
-wd
-wd
-wd
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-Nv
-ZS
-ZS
-ZS
-ZS
-ZS
-ZS
-gs
-gs
-gs
-ac
-gs
-gs
-gs
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(180,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-Sl
-gs
-gs
-gs
-ZS
-ZS
-ac
-ac
-ac
-ZS
-nv
-aN
-aN
-QK
-Ry
-QK
-GT
-RV
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Tw
-YQ
-zU
-JK
-QK
-QK
-QK
-QK
-QK
-aN
-aN
-aN
-QK
-aN
-aN
-aN
-aN
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fv
-fN
-fp
-fN
-fp
-fN
-fp
-im
-ah
-ah
-ah
-jy
-kk
-kE
-lo
-lD
-kz
-mS
-ah
-fp
-oH
-pk
-ah
-hg
-hg
-hg
-ah
-oI
-ro
-fp
-sm
-sZ
-sm
-uc
-jy
-uW
-uX
-vY
-lz
-lz
-xG
-yi
-yy
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-LU
-LU
-Nv
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(181,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ZS
-ZS
-ac
-ac
-ac
-ac
-PI
-QK
-QK
-QK
-QK
-WZ
-Cs
-RV
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Tw
-YQ
-zU
-KQ
-JK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-aN
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fv
-aO
-gk
-aO
-aO
-aO
-fp
-in
-fl
-ah
-ah
-jy
-ah
-kD
-kD
-kz
-me
-me
-cj
-fp
-oH
-ah
-ah
-pQ
-hg
-hg
-fZ
-ah
-ro
-fp
-sm
-ta
-sm
-ud
-jy
-uX
-uX
-vZ
-lz
-lz
-Vi
-yi
-yz
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-Nv
-Nv
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(182,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-VY
-VY
-KQ
-JK
-WZ
-Cs
-Oy
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Tw
-Tw
-Hk
-YQ
-FE
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-WZ
-KQ
-KQ
-KQ
-JK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fw
-fO
-aO
-aO
-gk
-gl
-fp
-io
-ah
-fZ
-ah
-fp
-bI
-kz
-kz
-kz
-me
-me
-nL
-fp
-oH
-bI
-ah
-hg
-hg
-qi
-ah
-ah
-ro
-fp
-sm
-tb
-sm
-ue
-jy
-uX
-uX
-vZ
-lz
-lz
-Vi
-yi
-yi
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-LU
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(183,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Hk
-Hk
-YQ
-RL
-Cs
-Oy
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Tw
-Tw
-Ya
-zU
-JK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-WZ
-Cs
-Oy
-Hk
-YQ
-FE
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fw
-fP
-aO
-gI
-aO
-gk
-fp
-ip
-ah
-bI
-jx
-fp
-fh
-ah
-ah
-ah
-bI
-ah
-je
-fp
-oH
-bY
-ah
-hg
-hg
-hg
-ah
-ah
-ro
-fp
-sm
-tc
-sm
-sR
-jy
-uY
-uX
-vZ
-lz
-lz
-Vi
-yj
-tw
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(184,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Tw
-Tw
-Tw
-Hk
-Hk
-Tw
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Tw
-Tw
-YQ
-zU
-JK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-zW
-QK
-QK
-WZ
-Cs
-Oy
-Tw
-Tw
-Ya
-FE
-QK
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fw
-fQ
-aO
-aO
-aO
-gl
-fp
-fp
-cy
-cy
-jy
-fp
-fp
-cy
-cy
-fp
-fp
-fp
-fp
-fp
-oI
-ah
-ah
-hg
-hg
-hg
-qv
-ah
-oI
-fp
-fh
-ta
-ah
-ls
-jy
-uV
-uV
-vX
-lz
-lz
-wd
-wd
-wd
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-OJ
-fp
-fp
-fp
-fp
-fp
-fp
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(185,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Tw
-YQ
-zU
-KQ
-KQ
-JK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-XS
-Oy
-Tw
-Uy
-Tw
-Ya
-zU
-KQ
-JK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fv
-fR
-gl
-gJ
-ha
-aO
-cy
-iq
-iq
-iq
-iq
-jN
-iq
-iq
-iq
-iq
-cB
-cB
-cB
-cB
-iq
-iq
-iq
-hg
-hg
-hg
-ah
-ah
-rp
-fp
-fp
-cy
-cy
-fp
-jy
-fp
-fp
-fp
-cy
-cy
-fp
-fp
-fp
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-Tp
-KC
-ah
-bI
-ah
-fp
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(186,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-yV
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Tw
-Hk
-Hk
-YQ
-zU
-KQ
-KQ
-KQ
-KQ
-KQ
-KQ
-JK
-QK
-QK
-WZ
-Cs
-RV
-Tw
-Uy
-Tw
-Tw
-Hk
-YQ
-FE
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-fp
-fp
-gK
-hb
-fp
-fp
-ir
-iq
-iq
-iq
-iq
-iq
-iq
-lp
-iq
-mk
-mk
-mk
-mk
-iq
-iq
-iq
-hg
-qc
-hg
-qw
-qw
-qw
-qw
-qw
-qw
-qw
-qw
-rq
-qw
-qw
-qw
-qw
-qw
-qw
-qw
-yB
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-OL
-Nt
-bI
-Fa
-gS
-ag
-fp
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(187,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Tw
-Tw
-Hk
-Hk
-Hk
-Hk
-Hk
-Hk
-YQ
-zU
-KQ
-KQ
-Cs
-Oy
-Tw
-Uy
-Uy
-Uy
-Uy
-Tw
-Ya
-zU
-JK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fv
-fS
-gl
-gL
-gL
-aO
-cy
-iq
-iq
-iq
-iq
-jO
-iq
-iq
-iq
-iq
-cD
-cD
-cD
-cD
-iq
-iq
-iq
-hg
-hg
-hg
-qx
-qw
-rq
-qw
-qw
-qw
-rq
-qw
-qw
-qw
-qw
-qw
-qw
-qw
-rq
-qw
-yC
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-Ra
-aN
-aN
-aN
-aN
-Ra
-aN
-aN
-aN
-OL
-Ix
-ah
-bY
-Sj
-ah
-fp
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(188,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-yV
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Hk
-Hk
-Hk
-Hk
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-YQ
-FE
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fw
-fR
-aO
-gk
-aO
-gl
-fp
-fp
-cy
-fp
-fp
-fp
-cy
-fp
-fp
-cy
-fp
-fp
-fp
-fp
-oI
-dr
-ah
-op
-op
-op
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-wG
-xf
-fp
-fp
-fp
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-Ra
-aN
-aN
-aN
-Ra
-aN
-aN
-aN
-aN
-aN
-OJ
-ay
-ah
-ah
-ah
-bI
-fp
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(189,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Ya
-FE
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fv
-fO
-aO
-gI
-aO
-aO
-fp
-is
-ah
-jf
-fp
-jP
-ah
-kF
-fp
-ah
-gS
-mT
-fp
-fp
-jx
-ah
-oI
-op
-op
-op
-fp
-qX
-rr
-bI
-ah
-dN
-tz
-uf
-fp
-uZ
-vD
-wa
-wH
-xg
-xi
-yk
-yD
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-Ra
-aN
-aN
-aN
-aN
-fp
-he
-Sj
-ah
-dN
-ah
-fp
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(190,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Lh
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-VG
-VG
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Ya
-FE
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fw
-fP
-gl
-aO
-gk
-gl
-fp
-it
-iv
-jg
-fp
-jQ
-by
-kG
-fp
-lF
-kz
-mU
-fp
-fp
-fp
-fp
-fp
-op
-op
-op
-fp
-qY
-gj
-cs
-sn
-cs
-cs
-tz
-fp
-va
-qN
-wb
-qN
-qN
-xI
-qN
-yE
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-fp
-SH
-ah
-ah
-Vy
-ah
-fp
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(191,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-Dk
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-VG
-VG
-VG
-VG
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Ya
-zU
-JK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fv
-fv
-fv
-aO
-aO
-aO
-fp
-iu
-iv
-iv
-jz
-by
-by
-kH
-lq
-kz
-mo
-mV
-fp
-ol
-oJ
-pl
-fp
-op
-op
-op
-fp
-bI
-rs
-rQ
-rQ
-rQ
-hS
-hx
-fp
-vb
-qN
-qN
-wI
-xh
-qN
-yl
-yF
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ab
-ZQ
-fZ
-ah
-ZB
-ah
-ah
-fp
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(192,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-Zg
-ac
-ac
-gs
-QK
-QK
-ac
-PI
-PI
-ac
-ac
-gs
-Dk
-gs
-ac
-ac
-ac
-ac
-ac
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-YQ
-FE
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fx
-aO
-aO
-aO
-fp
-fN
-fp
-iv
-iv
-iv
-fp
-by
-by
-by
-fp
-lG
-kz
-kz
-fp
-om
-ah
-pm
-fp
-op
-pS
-op
-fp
-ah
-rt
-rQ
-so
-rQ
-tA
-fh
-fp
-vc
-qO
-wc
-wd
-wd
-xJ
-qN
-yG
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-OL
-IU
-HN
-LR
-Rp
-ZU
-fp
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(193,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ED
-ED
-ED
-ED
-Dy
-be
-ac
-ac
-ZS
-gs
-QK
-QK
-QK
-QK
-PI
-QK
-QK
-gs
-ac
-ac
-ac
-ac
-ac
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Ya
-FE
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fy
-aO
-gk
-aO
-fp
-hy
-fp
-iw
-iP
-jh
-fp
-jR
-kl
-kI
-fp
-lH
-ap
-mW
-fp
-on
-oK
-ah
-fp
-op
-op
-op
-qy
-cs
-rs
-rQ
-sp
-rQ
-hS
-ah
-fp
-vd
-vG
-wd
-wd
-wd
-wd
-ym
-yH
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-OJ
-fp
-fp
-OL
-OL
-fp
-OJ
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(194,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ED
-ER
-Jw
-Mp
-Er
-ED
-ac
-ac
-ac
-ZS
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-ac
-ac
-ac
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Ya
-zU
-JK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-fp
-fp
-fp
-hc
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-oo
-gS
-ah
-fp
-op
-pS
-op
-qy
-gj
-rt
-rQ
-so
-rQ
-tB
-fh
-fp
-vc
-vH
-wd
-wd
-wd
-wd
-yn
-yG
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(195,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ED
-NG
-Mp
-Mp
-Yw
-ED
-ac
-ac
-ac
-PI
-LW
-KQ
-KQ
-KQ
-KQ
-KQ
-KQ
-KQ
-ac
-LM
-LM
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Tw
-YQ
-FE
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-fT
-fW
-fp
-hd
-hz
-hT
-hT
-hT
-hT
-jA
-ah
-fp
-kJ
-lr
-lI
-lO
-mX
-fp
-fp
-fp
-cy
-fp
-op
-op
-op
-qy
-cs
-rs
-rQ
-sp
-rQ
-hS
-ah
-fp
-ve
-vI
-wd
-wd
-wd
-wd
-ym
-yI
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(196,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ED
-Ti
-XQ
-CE
-Mp
-ED
-ac
-ac
-ac
-PI
-XS
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-LM
-LM
-VG
-VG
-VG
-VG
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-VG
-VG
-VG
-VG
-VG
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Ya
-FE
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-fU
-fV
-fp
-fh
-ah
-aO
-aO
-aO
-aO
-ah
-fh
-fp
-kK
-dr
-lJ
-fZ
-ah
-cy
-op
-op
-op
-op
-pS
-op
-pS
-fp
-ah
-ru
-rQ
-so
-rQ
-tB
-fh
-fp
-vc
-qN
-we
-wd
-wd
-xK
-qO
-yG
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(197,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ED
-CF
-Mp
-Mp
-Mp
-ED
-ac
-ac
-ac
-VY
-Cs
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-VG
-VG
-UL
-LM
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-VG
-VG
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Ya
-FE
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-cS
-gm
-fp
-ah
-aO
-by
-aO
-hU
-aO
-aO
-ah
-fp
-cX
-ls
-lK
-mq
-mY
-fp
-oq
-op
-op
-op
-op
-op
-qj
-fp
-je
-rs
-rQ
-sp
-rQ
-hS
-ah
-fp
-vf
-vJ
-qN
-wJ
-wL
-qN
-qO
-yJ
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(198,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ED
-zy
-Mp
-CA
-Gq
-ED
-ac
-ac
-ac
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-LM
-LM
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Tw
-Tw
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Ya
-FE
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-cP
-fV
-fp
-he
-aO
-hU
-aO
-aO
-by
-aO
-jS
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-cy
-cy
-fp
-fp
-ah
-rt
-rQ
-sq
-rQ
-tB
-fh
-fp
-vc
-qN
-qN
-wK
-qN
-qN
-qN
-yG
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(199,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ED
-ED
-ED
-ED
-ED
-ED
-ac
-ac
-VG
-Tw
-Tw
-Tw
-Tw
-Tw
-Wd
-zP
-zP
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Tw
-Tw
-Tw
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Ya
-FE
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-fV
-fW
-fp
-hf
-aO
-aO
-aO
-aO
-by
-aO
-gS
-cy
-ah
-kw
-kw
-mr
-mZ
-kw
-kw
-kw
-pn
-kw
-ah
-ah
-fp
-fp
-gS
-cs
-cs
-gj
-gj
-cs
-bI
-fp
-vg
-vK
-wf
-vK
-xj
-xH
-xL
-yK
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(200,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-VG
-Tw
-Tw
-Tw
-Wd
-zP
-zP
-JU
-QK
-QK
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Ya
-FE
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-fW
-gn
-gM
-hg
-aO
-aO
-aO
-iQ
-aO
-aO
-ah
-cy
-ah
-by
-by
-by
-by
-by
-by
-by
-ee
-by
-pT
-ah
-qk
-fp
-ah
-ah
-ah
-ah
-ah
-ah
-fl
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(201,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-VG
-VG
-VG
-LM
-Tw
-Wd
-JU
-QK
-QK
-QK
-QK
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-Dz
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-BN
-BN
-BN
-BN
-BN
-BN
-BN
-BN
-BN
-BN
-BN
-BN
-BN
-BN
-BN
-BN
-BN
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Ya
-FE
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-fV
-fW
-fp
-hf
-aO
-aO
-aO
-aO
-by
-aO
-ah
-cy
-gS
-ee
-by
-ms
-by
-by
-by
-by
-by
-by
-by
-ah
-ql
-fp
-qZ
-rv
-rR
-sr
-td
-tC
-ug
-fp
-vh
-vi
-vj
-vi
-vj
-vi
-vj
-vi
-vh
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(202,1,1) = {"
-yN
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-LM
-ac
-zP
-JU
-eY
-QK
-Tm
-QK
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-PA
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-zP
-zP
-zP
-zP
-zP
-zP
-zP
-zP
-zP
-zP
-zP
-zP
-zP
-zP
-zP
-zP
-Ip
-RV
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Ya
-zU
-JK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-fU
-fV
-fp
-ah
-aO
-hU
-aO
-aO
-by
-aO
-jT
-fp
-kL
-by
-by
-by
-by
-nM
-by
-oL
-by
-pC
-by
-fh
-fp
-qz
-py
-py
-py
-py
-py
-py
-qA
-fp
-vi
-vL
-vM
-vM
-xk
-vM
-vM
-yL
-vi
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(203,1,1) = {"
-yN
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-ac
-ac
-ac
-ac
-Ez
-QK
-QK
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-XS
-AJ
-BN
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-YQ
-FE
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-cS
-fW
-fp
-ah
-aO
-by
-aO
-hU
-aO
-aO
-ah
-fp
-kM
-by
-by
-mt
-ee
-by
-by
-by
-by
-by
-by
-ah
-qm
-qA
-py
-py
-rS
-ss
-ss
-ss
-uh
-fp
-vj
-vM
-wp
-vM
-vM
-vM
-wp
-vM
-vj
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(204,1,1) = {"
-yN
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-VG
-ac
-ac
-ac
-ac
-ac
-QK
-gs
-Dk
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-QK
-aN
-QK
-QK
-QK
-QK
-Fi
-zP
-Ip
-AJ
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Ya
-FE
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-cP
-fV
-fp
-fh
-ah
-aO
-aO
-aO
-aO
-ah
-fh
-fp
-kN
-lt
-by
-by
-by
-by
-by
-by
-by
-by
-by
-ah
-qn
-qA
-ra
-py
-rT
-fp
-fp
-fp
-fp
-tk
-vh
-vM
-vM
-wM
-xl
-vM
-vM
-vM
-vi
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(205,1,1) = {"
-yN
-VG
-VG
-VG
-VG
-VG
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-gs
-Dk
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-Sl
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-QK
-QK
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-QK
-QK
-QK
-Fi
-Ip
-AJ
-BN
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Ya
-FE
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-fT
-go
-fp
-hh
-hA
-hT
-hT
-hT
-hT
-jB
-ah
-fp
-kO
-by
-by
-by
-by
-nN
-by
-by
-po
-by
-pU
-ah
-qo
-qA
-py
-py
-rU
-fp
-te
-tD
-ui
-uB
-vk
-vM
-vM
-wN
-xm
-vM
-yp
-vM
-vj
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(206,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-QK
-aN
-aN
-aN
-SN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-QK
-QK
-Fi
-zP
-Ip
-AJ
-BN
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Ya
-FE
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-kP
-by
-by
-mu
-by
-by
-ee
-by
-by
-by
-by
-ah
-qp
-qA
-py
-py
-rV
-fp
-tf
-rJ
-uj
-tk
-vh
-vM
-vM
-wO
-xn
-vM
-vM
-vM
-vi
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(207,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-QK
-QK
-QK
-Fi
-zP
-Ip
-RV
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Ya
-Tx
-QK
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-fX
-ah
-ah
-ah
-fX
-fp
-ix
-gS
-ah
-bI
-ix
-fp
-kQ
-lu
-by
-by
-by
-by
-by
-oM
-by
-by
-by
-ah
-qq
-qB
-py
-ra
-rW
-fp
-tg
-tE
-uk
-tk
-vi
-vM
-vM
-vM
-vM
-vM
-vM
-vM
-vj
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(208,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-fp
-fp
-Hf
-Hf
-Hf
-fp
-OJ
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-QK
-QK
-QK
-QK
-XS
-RV
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Ya
-zU
-JK
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-vq
-fp
-ah
-aO
-aO
-hi
-ah
-BY
-iy
-iR
-ji
-hf
-ah
-jy
-fh
-by
-by
-by
-by
-nO
-by
-by
-by
-by
-by
-ah
-qr
-qz
-py
-py
-rX
-fp
-tf
-rJ
-ul
-tk
-vj
-vM
-wp
-vM
-xo
-vM
-xo
-vM
-vi
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(209,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-NF
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-fp
-Jy
-Cc
-XM
-SF
-Wq
-Hf
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-QK
-QK
-XS
-AJ
-BN
-BN
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Tw
-YQ
-zU
-JK
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-vq
-fp
-mp
-aO
-aO
-aO
-ah
-BY
-iy
-iS
-jj
-jC
-ah
-km
-ah
-by
-ee
-mv
-by
-by
-by
-oN
-by
-pD
-by
-fh
-fp
-qC
-py
-py
-rY
-fp
-th
-rJ
-um
-tk
-vi
-vM
-vM
-wP
-vM
-vM
-vM
-vM
-vj
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(210,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-fp
-ah
-Ih
-RP
-Vy
-ah
-ws
-ab
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-QK
-Fi
-zP
-zP
-Ip
-RV
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Tw
-YQ
-zU
-JK
-QK
-QK
-aN
-aN
-aN
-aN
-vq
-fp
-ah
-aO
-aO
-aO
-ah
-BY
-iy
-iR
-jk
-hf
-ah
-jy
-fh
-by
-by
-by
-by
-by
-by
-by
-ee
-by
-by
-ah
-cy
-qA
-py
-py
-rZ
-fp
-ti
-rJ
-um
-tk
-vj
-vM
-vM
-vM
-xo
-wp
-xo
-vM
-vi
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(211,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-fp
-RX
-bJ
-bJ
-bJ
-pH
-fp
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-QK
-QK
-QK
-QK
-XS
-RV
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Tw
-YQ
-FE
-QK
-QK
-aN
-aN
-aN
-aN
-vq
-fp
-fX
-ah
-ah
-ah
-fX
-fp
-ix
-ah
-ah
-bY
-ix
-fp
-kR
-kY
-lM
-mw
-kY
-kY
-lM
-kY
-pp
-kY
-ah
-ah
-cy
-qA
-qA
-qA
-qA
-st
-tj
-tF
-un
-tk
-vi
-vN
-vM
-vM
-vM
-vM
-vM
-yM
-vj
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(212,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-NF
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-NF
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-fp
-cu
-bJ
-BT
-bJ
-BK
-Hf
-aN
-aN
-aN
-aN
-aN
-aN
-SN
-aN
-aN
-aN
-aN
-QK
-QK
-QK
-XS
-AJ
-BN
-BN
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Ya
-FE
-QK
-QK
-aN
-aN
-aN
-aN
-vq
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-tk
-tk
-tk
-tk
-vh
-vi
-vj
-vi
-vj
-vi
-vj
-vi
-vh
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(213,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-fp
-ah
-bJ
-bJ
-bJ
-Jo
-Hf
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-QK
-QK
-QK
-zP
-zP
-Ip
-RV
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Ya
-FE
-QK
-QK
-aN
-aN
-aN
-aN
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-vq
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(214,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-fp
-he
-ah
-Sb
-ah
-Vh
-fp
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-DB
-aN
-aN
-QK
-QK
-QK
-QK
-XS
-RV
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Ya
-FE
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(215,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-fp
-ay
-JM
-ah
-Tu
-gd
-fp
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-QK
-QK
-QK
-QK
-XS
-RV
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Ya
-FE
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(216,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-NF
-ZS
-gs
-ZS
-gs
-ac
-ac
-fp
-fp
-fp
-fp
-fp
-fp
-fp
-ac
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-aN
-aN
-aN
-ac
-ac
-ac
-QK
-QK
-QK
-XS
-RV
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Ya
-FE
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(217,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ZS
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-QK
-XS
-RV
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Ya
-FE
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(218,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-yV
-yV
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-QK
-XS
-RV
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Tw
-Ya
-FE
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-PT
-PT
-PT
-Fw
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-LU
-LU
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(219,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-gs
-gs
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-yV
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-LU
-aN
-aN
-aN
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Tw
-Ya
-FE
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-PT
-YJ
-DZ
-Gy
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Nv
-LU
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(220,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-yV
-yV
-ZS
-ZS
-yV
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Tw
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Tw
-Mh
-FE
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-PT
-Vj
-Lx
-Ap
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Nv
-Nv
-LU
-LU
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(221,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-yV
-yV
-yV
-ZS
-yV
-ZS
-ac
-ZS
-gs
-ZS
-gs
-gs
-gs
-gs
-yV
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Ya
-Wd
-JU
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-LV
-Ut
-WY
-Ab
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-yV
-LU
-LU
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(222,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-yV
-yV
-gs
-yV
-gs
-gs
-gs
-gs
-gs
-ZS
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Ya
-FE
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-Xw
-Fw
-Fw
-Ab
-Fw
-Ab
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ZS
-Nv
-Nv
-LU
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(223,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-yV
-gs
-gs
-ZS
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Tw
-Tw
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Ya
-FE
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-Zk
-Ab
-TN
-PO
-OD
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-ZS
-ZS
-LU
-LU
-LU
-LU
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-Jx
-"}
-(224,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-gs
-yV
-gs
-gs
-yV
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Ya
-FE
-QK
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-PT
-Ki
-OC
-Ki
-EF
-Iv
-Ab
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-yV
-ZS
-ZS
-ac
-LU
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-Jx
-"}
-(225,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ZS
-gs
-gs
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Mh
-FE
-QK
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-Ab
-DD
-Ki
-EF
-St
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-Jx
-"}
-(226,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-yV
-ZS
-yV
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Tw
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Mh
-Wd
-JU
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-Fw
-Gz
-EF
-Fw
-EF
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-Jx
-"}
-(227,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ZS
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-MB
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-NS
-ZS
-yV
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Tw
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Ya
-Wd
-JU
-QK
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-XP
-gs
-gs
-gs
-YO
-Jr
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-Jx
-"}
-(228,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-RE
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-ZS
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-MB
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Tw
-Uy
-Uy
-Uy
-Uy
-Uy
-Tw
-Tw
-Ya
-FE
-aa
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Nl
-gs
-gs
-XJ
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Hv
-gs
-gs
-gs
-SR
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-Jx
-"}
-(229,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-SW
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-gs
-gs
-MB
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Tw
-Ya
-FE
-QK
-QK
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-NF
-YO
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-Rc
-gs
-gs
-LF
-CN
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-Jx
-"}
-(230,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-NF
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-Dz
-gs
-gs
-MB
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Tw
-Tw
-Tw
-Tw
-Ya
-FE
-QK
-QK
-aN
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-Dh
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-Jx
-"}
-(231,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Wf
-Ya
-Wt
-PI
-QK
-QK
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-LF
-Dz
-gs
-gs
-Sl
-gs
-SR
-LF
-Vm
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(232,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-Dz
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-PI
-IV
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-Ah
-gs
-gs
-gs
-UE
-gs
-BW
-Dz
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-Fw
-Fw
-PT
-Fw
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(233,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-Eb
-IH
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-Fw
-PT
-PT
-QV
-ZA
-Kj
-Gx
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(234,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-YH
-gs
-gs
-gs
-gs
-YU
-gs
-gs
-Mu
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-PT
-Oj
-Iq
-PT
-Ge
-ZA
-ZA
-ZA
-PT
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(235,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ZS
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-Dh
-gs
-LF
-gs
-PY
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-Mb
-Iq
-Kx
-ZA
-ZA
-ZI
-Qe
-PT
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(236,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-ZS
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ZS
-ZS
-ZS
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-FR
-TM
-Fw
-ZA
-ZA
-Qe
-Qe
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(237,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-NF
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-NF
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-Dz
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-NF
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-yV
-ZS
-ZS
-YG
-yV
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-Zz
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-PT
-Lr
-Te
-Fw
-zh
-ZA
-NI
-Wj
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(238,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ZS
-ZS
-NS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-Fw
-Fw
-PT
-Fw
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Zz
-gs
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-Fw
-Fw
-Fw
-Fw
-Gk
-Fw
-Fw
-Fw
-Ab
-PO
-Fw
-Ab
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(239,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-yV
-NS
-NS
-yV
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-FR
-Iq
-Iq
-Oj
-PT
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-Fw
-QI
-ZA
-ZC
-ZA
-Fw
-PO
-SK
-Ab
-Yz
-EF
-Ab
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-NF
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(240,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-Dz
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fb
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ZS
-ZS
-yV
-yV
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-PT
-Mb
-Iq
-PJ
-Iq
-PT
-PT
-PT
-PT
-Fw
-Fw
-PT
-Fw
-Fw
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-gs
-ZS
-ZS
-ZS
-ZS
-gs
-gs
-gs
-ac
-ac
-ac
-PT
-zt
-ME
-ME
-ZA
-Fw
-ID
-RS
-Ur
-EF
-Ab
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(241,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ZS
-ZS
-ZS
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-yV
-ZS
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-WO
-Te
-Iq
-Iq
-Fw
-PT
-QI
-ZA
-Ml
-SP
-ZA
-zt
-Fw
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ZS
-gs
-gs
-gs
-gs
-ac
-ac
-PT
-Ob
-ME
-ME
-RB
-TX
-TX
-TX
-GL
-Gz
-TX
-EF
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(242,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ZS
-yV
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-Fw
-Fw
-Kx
-Fw
-Fw
-Fw
-QI
-ME
-Yr
-ME
-Re
-ZA
-Ll
-EF
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ZS
-gs
-gs
-gs
-gs
-ac
-ac
-Fw
-JS
-ZA
-QS
-MS
-Fw
-Ab
-Ab
-IP
-MX
-Ab
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(243,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-NF
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-aN
-aN
-aN
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-Vf
-ZA
-Gx
-IT
-Fw
-ZA
-ME
-Yp
-ME
-ME
-ZA
-Rz
-EF
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-Ll
-GP
-Fw
-Fw
-Fw
-Fw
-Fw
-Fw
-Ab
-Fw
-Fw
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(244,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-NF
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-aN
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-PT
-QV
-ZA
-ZA
-ZA
-Gk
-ZA
-ME
-ME
-ME
-ME
-QX
-Fw
-Zk
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-NF
-gs
-gs
-gs
-gs
-Mn
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(245,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-Ge
-ZA
-AG
-Bz
-Fw
-JF
-Pj
-Yf
-UD
-MS
-Vv
-Fw
-Lt
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(246,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-PT
-Ys
-ZA
-Bz
-Bz
-Fw
-Fw
-PT
-Fw
-PT
-Fw
-Fw
-Fw
-ac
-Il
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-Sl
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(247,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-ZS
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-PT
-Kh
-FT
-Bz
-Pb
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ZS
-ZS
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(248,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ZS
-ZS
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Fw
-Fw
-PT
-PT
-Fw
-Fw
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ZS
-ZS
-ZS
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-ZS
-ZS
-gs
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(249,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-gs
-gs
-gs
-ZS
-ZS
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-gs
-gs
-ZS
-ZS
-ZS
-ac
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-ac
-ac
-ac
-NF
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(250,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-ZS
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-NF
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-gs
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(251,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-ac
-gs
-gs
-gs
-gs
-ZS
-ZS
-gs
-gs
-gs
-gs
-gs
-gs
-ZS
-ZS
-ZS
-gs
-gs
-gs
-gs
-gs
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(252,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-gs
-gs
-gs
-gs
-ac
-gs
-gs
-ac
-ac
-ac
-gs
-gs
-gs
-ZS
-ZS
-ZS
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(253,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(254,1,1) = {"
-Jx
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-ac
-Jx
-"}
-(255,1,1) = {"
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-Jx
-"}