From 24b3e10d7c9ed1e920f22debdc61f2ef4c9cd7e7 Mon Sep 17 00:00:00 2001 From: TalkingCactus Date: Thu, 1 Sep 2016 17:35:47 -0400 Subject: [PATCH] second batch of AT fixes --- .../lavaland_biodome_clown_planet.dmm | 2135 +--- .../lavaland_surface_biodome_winter.dmm | 26 +- .../lavaland_surface_prisoner_crash.dmm | 633 +- .../LavaRuins/lavaland_surface_tomb.dmm | 902 +- .../LavaRuins/lavaland_surface_ww_vault.dmm | 10117 +--------------- _maps/RandomRuins/SpaceRuins/deepstorage.dmm | 52 +- _maps/RandomRuins/SpaceRuins/emptyshell.dmm | 16 +- _maps/RandomRuins/SpaceRuins/onehalf.dmm | 318 +- .../SpaceRuins/turretedoutpost.dmm | 36 +- 9 files changed, 571 insertions(+), 13664 deletions(-) diff --git a/_maps/RandomRuins/LavaRuins/lavaland_biodome_clown_planet.dmm b/_maps/RandomRuins/LavaRuins/lavaland_biodome_clown_planet.dmm index 51677132c2..f5710584a5 100644 --- a/_maps/RandomRuins/LavaRuins/lavaland_biodome_clown_planet.dmm +++ b/_maps/RandomRuins/LavaRuins/lavaland_biodome_clown_planet.dmm @@ -1,2003 +1,138 @@ -//MAP CONVERTED BY dmm2tgm.py THIS HEADER COMMENT PREVENTS RECONVERSION, DO NOT REMOVE -"aa" = ( -/turf/template_noop, -/area/template_noop) -"ab" = ( -/turf/open/floor/plating/asteroid/basalt/lava_land_surface, -/area/ruin/powered) -"ac" = ( -/turf/open/floor/noslip{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"ad" = ( -/mob/living/simple_animal/hostile/retaliate/clown, -/turf/open/floor/plating/asteroid/basalt/lava_land_surface, -/area/ruin/powered) -"ae" = ( -/obj/machinery/light, -/turf/open/floor/plating/asteroid/basalt/lava_land_surface, -/area/ruin/powered) -"af" = ( -/obj/item/clothing/head/cone, -/turf/open/floor/noslip{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"ag" = ( -/obj/item/weapon/paper/crumpled/bloody{ - info = "Abandon hope, all ye who enter here." - }, -/obj/effect/decal/cleanable/blood/old, -/turf/open/floor/noslip{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"ah" = ( -/turf/closed/wall/r_wall{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"ai" = ( -/obj/machinery/disposal/deliveryChute{ - desc = "The following is engraved upon the chute: A FATE WORSE THAN DEATH LIES WITHIN"; - dir = 1; - name = "THE TRIAL OF HONKITUDE" - }, -/obj/structure/disposalpipe/trunk, -/turf/open/floor/noslip{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"aj" = ( -/obj/structure/disposalpipe/trunk, -/obj/structure/disposaloutlet{ - dir = 1 - }, -/turf/open/floor/noslip{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"ak" = ( -/turf/open/floor/plating/lava/smooth/lava_land_surface, -/area/ruin/powered) -"al" = ( -/obj/structure/disposalpipe/segment{ - invisibility = 101 - }, -/turf/closed/wall/r_wall{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"am" = ( -/obj/structure/disposalpipe/segment{ - dir = 4; - icon_state = "pipe-c"; - invisibility = 101 - }, -/turf/closed/wall/r_wall{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"an" = ( -/obj/structure/disposalpipe/segment{ - dir = 2; - icon_state = "pipe-c"; - invisibility = 101 - }, -/turf/closed/wall/r_wall{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"ao" = ( -/obj/structure/disposalpipe/segment{ - dir = 4; - icon_state = "pipe-c"; - invisibility = 101 - }, -/turf/open/floor/plating{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"ap" = ( -/obj/structure/disposalpipe/segment{ - dir = 2; - icon_state = "pipe-c"; - invisibility = 101 - }, -/turf/open/floor/plating{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"aq" = ( -/obj/structure/disposalpipe/trunk, -/obj/structure/disposaloutlet{ - dir = 1 - }, -/turf/open/floor/plating{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"ar" = ( -/obj/structure/disposalpipe/segment{ - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"as" = ( -/obj/effect/mob_spawn/human/corpse/damaged, -/obj/effect/decal/cleanable/blood/old, -/obj/structure/disposalpipe/segment{ - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"at" = ( -/obj/structure/disposalpipe/segment{ - dir = 4; - icon_state = "pipe-c"; - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"au" = ( -/obj/structure/disposalpipe/segment{ - invisibility = 101 - }, -/turf/open/floor/plating{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"av" = ( -/obj/structure/disposalpipe/sortjunction{ - dir = 1; - icon_state = "pipe-j2s"; - invisibility = 101; - sortType = 3 - }, -/turf/closed/wall/r_wall{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"aw" = ( -/obj/structure/window/reinforced, -/obj/structure/disposalpipe/segment{ - invisibility = 101 - }, -/turf/open/floor/plating{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"ax" = ( -/obj/effect/decal/cleanable/pie_smudge, -/obj/structure/disposalpipe/segment{ - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"ay" = ( -/obj/structure/disposalpipe/segment{ - dir = 1; - icon_state = "pipe-c"; - invisibility = 101 - }, -/obj/effect/decal/cleanable/dirt, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"az" = ( -/obj/structure/disposalpipe/segment{ - dir = 4; - invisibility = 101 - }, -/obj/effect/decal/cleanable/dirt, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"aA" = ( -/obj/structure/disposalpipe/segment{ - dir = 4; - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"aB" = ( -/obj/structure/disposalpipe/segment{ - dir = 8; - icon_state = "pipe-c"; - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"aC" = ( -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"aD" = ( -/obj/effect/decal/cleanable/dirt, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"aE" = ( -/obj/effect/decal/cleanable/cobweb{ - icon_state = "cobweb2" - }, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"aF" = ( -/obj/structure/disposalpipe/segment{ - dir = 4; - invisibility = 101 - }, -/obj/effect/decal/cleanable/cobweb, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"aG" = ( -/obj/structure/disposalpipe/segment{ - dir = 1; - icon_state = "pipe-c"; - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"aH" = ( -/obj/structure/disposalpipe/segment{ - dir = 8; - icon_state = "pipe-c"; - invisibility = 101 - }, -/obj/effect/decal/cleanable/dirt, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"aI" = ( -/obj/structure/disposalpipe/segment{ - dir = 1; - icon_state = "pipe-c"; - invisibility = 101 - }, -/obj/item/weapon/bikehorn, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"aJ" = ( -/obj/structure/disposalpipe/segment{ - dir = 1; - icon_state = "pipe-c"; - invisibility = 101 - }, -/turf/closed/wall/r_wall{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"aK" = ( -/obj/structure/disposalpipe/segment{ - dir = 4; - invisibility = 101 - }, -/obj/effect/decal/cleanable/pie_smudge, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"aL" = ( -/obj/structure/disposalpipe/segment{ - dir = 4; - invisibility = 101 - }, -/turf/closed/wall/r_wall{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"aM" = ( -/obj/structure/disposalpipe/segment{ - dir = 2; - icon_state = "pipe-c"; - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"aN" = ( -/obj/structure/disposalpipe/segment{ - invisibility = 101 - }, -/turf/open/floor/plating, -/area/ruin/powered) -"aO" = ( -/obj/item/weapon/bikehorn, -/obj/structure/disposalpipe/segment{ - dir = 4; - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"aP" = ( -/obj/structure/disposalpipe/segment{ - dir = 4; - invisibility = 101 - }, -/turf/open/floor/plating{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"aQ" = ( -/turf/open/floor/plating{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"aR" = ( -/obj/structure/disposalpipe/segment{ - dir = 4; - icon_state = "pipe-c"; - invisibility = 101 - }, -/turf/open/floor/plating, -/area/ruin/powered) -"aS" = ( -/obj/structure/disposalpipe/segment{ - dir = 8; - icon_state = "pipe-c"; - invisibility = 101 - }, -/turf/open/floor/plating{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"aT" = ( -/obj/effect/decal/cleanable/dirt, -/obj/structure/disposalpipe/segment{ - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"aU" = ( -/obj/structure/grille, -/obj/structure/window/reinforced/fulltile, -/turf/open/floor/plating{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"aV" = ( -/obj/structure/disposalpipe/segment{ - dir = 2; - icon_state = "pipe-c"; - invisibility = 101 - }, -/obj/effect/decal/cleanable/dirt, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"aW" = ( -/obj/item/weapon/bikehorn, -/obj/effect/decal/cleanable/dirt, -/obj/structure/disposalpipe/segment{ - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"aX" = ( -/obj/structure/disposalpipe/trunk{ - dir = 4 - }, -/obj/structure/disposaloutlet{ - dir = 8 - }, -/turf/open/floor/plating{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"aY" = ( -/obj/item/weapon/bikehorn, -/obj/structure/disposalpipe/segment{ - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"aZ" = ( -/obj/structure/disposalpipe/segment{ - dir = 4; - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "darkredfull" - }, -/area/ruin/powered) -"ba" = ( -/obj/effect/decal/cleanable/pie_smudge, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"bb" = ( -/obj/structure/disposalpipe/segment{ - dir = 4; - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "white" - }, -/area/ruin/powered) -"bc" = ( -/obj/structure/disposalpipe/segment{ - dir = 4; - icon_state = "pipe-c"; - invisibility = 101 - }, -/obj/effect/decal/cleanable/dirt, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"bd" = ( -/obj/structure/disposalpipe/segment{ - dir = 4; - invisibility = 101 - }, -/obj/structure/table, -/obj/item/weapon/paper/crumpled/bloody{ - info = "If you dare not continue down this path of madness, escape can be found through the chute in this room. " - }, -/obj/item/weapon/pen/fourcolor, -/turf/open/indestructible{ - icon_state = "white" - }, -/area/ruin/powered) -"be" = ( -/obj/structure/disposalpipe/segment{ - dir = 4; - invisibility = 101 - }, -/obj/structure/table, -/obj/item/device/flashlight/lamp/bananalamp, -/turf/open/indestructible{ - icon_state = "white" - }, -/area/ruin/powered) -"bf" = ( -/obj/structure/disposalpipe/segment{ - dir = 2; - icon_state = "pipe-c"; - invisibility = 101 - }, -/obj/effect/decal/cleanable/pie_smudge, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"bg" = ( -/obj/structure/disposalpipe/segment{ - dir = 4; - invisibility = 101 - }, -/obj/item/weapon/pickaxe, -/turf/open/indestructible{ - icon_state = "white" - }, -/area/ruin/powered) -"bh" = ( -/obj/structure/disposalpipe/segment{ - dir = 4; - icon_state = "pipe-c"; - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "white" - }, -/area/ruin/powered) -"bi" = ( -/obj/structure/disposalpipe/segment{ - dir = 2; - icon_state = "pipe-c"; - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "white" - }, -/area/ruin/powered) -"bj" = ( -/obj/structure/disposalpipe/segment{ - dir = 4; - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "light_on" - }, -/area/ruin/powered) -"bk" = ( -/obj/structure/disposalpipe/segment{ - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "white" - }, -/area/ruin/powered) -"bl" = ( -/turf/open/indestructible{ - icon_state = "light_on" - }, -/area/ruin/powered) -"bm" = ( -/obj/structure/disposalpipe/segment{ - dir = 1; - icon_state = "pipe-c"; - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "white" - }, -/area/ruin/powered) -"bn" = ( -/obj/structure/disposalpipe/segment{ - dir = 8; - icon_state = "pipe-c"; - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "white" - }, -/area/ruin/powered) -"bo" = ( -/obj/machinery/light{ - icon_state = "tube1"; - dir = 4 - }, -/turf/open/floor/plating/asteroid/basalt/lava_land_surface, -/area/ruin/powered) -"bp" = ( -/turf/closed/mineral/clown, -/area/ruin/powered) -"bq" = ( -/obj/item/weapon/pickaxe, -/turf/open/indestructible{ - icon_state = "white" - }, -/area/ruin/powered) -"br" = ( -/turf/open/indestructible{ - icon_state = "white" - }, -/area/ruin/powered) -"bs" = ( -/obj/structure/disposalpipe/segment{ - dir = 4; - icon_state = "pipe-c"; - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "darkredfull" - }, -/area/ruin/powered) -"bt" = ( -/obj/structure/disposalpipe/segment{ - dir = 1; - icon_state = "pipe-c"; - invisibility = 101 - }, -/turf/open/floor/plating{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"bu" = ( -/obj/item/weapon/bikehorn, -/obj/structure/disposalpipe/segment{ - dir = 2; - icon_state = "pipe-c"; - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"bv" = ( -/obj/machinery/light{ - dir = 8 - }, -/turf/open/floor/plating/asteroid/basalt/lava_land_surface, -/area/ruin/powered) -"bw" = ( -/turf/open/chasm/straight_down/lava_land_surface, -/area/ruin/powered) -"bx" = ( -/obj/effect/decal/cleanable/cobweb, -/turf/open/indestructible{ - icon_state = "darkredfull"; - wet = 5 - }, -/area/ruin/powered) -"by" = ( -/obj/structure/disposalpipe/segment, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"bz" = ( -/obj/machinery/disposal/deliveryChute{ - dir = 1 - }, -/obj/structure/disposalpipe/trunk, -/turf/open/indestructible{ - icon_state = "white" - }, -/area/ruin/powered) -"bA" = ( -/turf/open/indestructible{ - icon_state = "darkredfull"; - wet = 5 - }, -/area/ruin/powered) -"bB" = ( -/turf/open/indestructible/sound{ - icon_state = "bananium"; - name = "bananium floor"; - sound = 'sound/effects/clownstep1.ogg'; - wet = 5 - }, -/area/ruin/powered) -"bC" = ( -/obj/structure/disposalpipe/junction{ - dir = 1; - icon_state = "pipe-y"; - invisibility = 101 - }, -/obj/effect/decal/cleanable/dirt, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"bD" = ( -/obj/structure/mecha_wreckage/honker, -/obj/structure/disposalpipe/segment{ - dir = 4; - invisibility = 101 - }, -/turf/open/floor/plating{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"bE" = ( -/obj/effect/decal/cleanable/oil, -/obj/structure/disposalpipe/segment{ - dir = 2; - icon_state = "pipe-c"; - invisibility = 101 - }, -/turf/open/floor/plating{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"bF" = ( -/obj/effect/decal/cleanable/cobweb{ - icon_state = "cobweb2" - }, -/turf/open/indestructible/sound{ - icon_state = "bananium"; - name = "bananium floor"; - sound = 'sound/effects/clownstep1.ogg'; - wet = 5 - }, -/area/ruin/powered) -"bG" = ( -/obj/item/weapon/grown/bananapeel{ - color = "#2F3000"; - name = "stealth banana peel" - }, -/turf/open/floor/plating/asteroid/basalt/lava_land_surface, -/area/ruin/powered) -"bH" = ( -/obj/effect/decal/cleanable/dirt, -/turf/open/indestructible/sound{ - icon_state = "bananium"; - name = "bananium floor"; - sound = 'sound/effects/clownstep1.ogg'; - wet = 5 - }, -/area/ruin/powered) -"bI" = ( -/obj/effect/mob_spawn/human/corpse/damaged, -/obj/effect/decal/cleanable/blood/old, -/turf/open/indestructible{ - icon_state = "darkyellowfull"; - wet = 5 - }, -/area/ruin/powered) -"bJ" = ( -/obj/structure/disposalpipe/segment{ - dir = 4; - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "darkredfull"; - wet = 5 - }, -/area/ruin/powered) -"bK" = ( -/obj/structure/disposalpipe/segment{ - dir = 8; - icon_state = "pipe-c"; - invisibility = 101 - }, -/turf/open/indestructible{ - icon_state = "darkredfull"; - wet = 5 - }, -/area/ruin/powered) -"bL" = ( -/obj/item/weapon/reagent_containers/food/drinks/trophy/gold_cup, -/obj/structure/table/glass, -/turf/open/floor/carpet{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"bM" = ( -/turf/open/floor/carpet{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"bN" = ( -/obj/machinery/disposal/deliveryChute, -/obj/structure/disposalpipe/trunk{ - dir = 1 - }, -/turf/open/floor/carpet{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"bO" = ( -/obj/effect/decal/cleanable/cobweb, -/turf/open/indestructible/sound{ - icon_state = "bananium"; - name = "bananium floor"; - sound = 'sound/effects/clownstep1.ogg'; - wet = 5 - }, -/area/ruin/powered) -"bP" = ( -/obj/structure/statue/bananium/clown, -/turf/open/floor/carpet{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"bQ" = ( -/obj/structure/table/glass, -/obj/item/weapon/grown/bananapeel/bluespace, -/turf/open/floor/carpet{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"bR" = ( -/obj/structure/table/glass, -/obj/item/clothing/shoes/clown_shoes/banana_shoes, -/turf/open/floor/carpet{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"bS" = ( -/obj/item/weapon/coin/clown, -/obj/item/weapon/coin/clown, -/obj/item/weapon/coin/clown, -/obj/item/weapon/coin/clown, -/turf/open/floor/carpet{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"bT" = ( -/obj/item/slime_extract/rainbow, -/obj/structure/table/glass, -/turf/open/floor/carpet{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"bU" = ( -/obj/item/weapon/bikehorn/airhorn, -/turf/open/floor/carpet{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"bV" = ( -/obj/structure/table/glass, -/obj/item/weapon/gun/magic/staff/honk, -/turf/open/floor/carpet{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"bW" = ( -/obj/item/weapon/bikehorn, -/turf/open/indestructible/sound{ - icon_state = "bananium"; - name = "bananium floor"; - sound = 'sound/effects/clownstep1.ogg'; - wet = 5 - }, -/area/ruin/powered) -"bX" = ( -/obj/structure/grille, -/obj/structure/window/reinforced/fulltile, -/turf/open/floor/plating, -/area/ruin/powered) -"bY" = ( -/obj/effect/mob_spawn/human/corpse/damaged, -/obj/effect/decal/cleanable/blood/old, -/turf/open/indestructible/sound{ - icon_state = "bananium"; - name = "bananium floor"; - sound = 'sound/effects/clownstep1.ogg'; - wet = 5 - }, -/area/ruin/powered) -"bZ" = ( -/obj/machinery/door/airlock/clown, -/turf/open/indestructible/sound{ - icon_state = "bananium"; - name = "bananium floor"; - sound = 'sound/effects/clownstep1.ogg'; - wet = 5 - }, -/area/ruin/powered) -"ca" = ( -/obj/item/weapon/bikehorn, -/obj/effect/decal/cleanable/dirt, -/turf/open/indestructible/sound{ - icon_state = "bananium"; - name = "bananium floor"; - sound = 'sound/effects/clownstep1.ogg'; - wet = 5 - }, -/area/ruin/powered) -"cb" = ( -/obj/machinery/light{ - dir = 1 - }, -/turf/open/floor/plating/asteroid/basalt/lava_land_surface, -/area/ruin/powered) +"aa" = (/turf/template_noop,/area/template_noop) +"ab" = (/turf/open/floor/plating/asteroid/basalt/lava_land_surface,/area/ruin/powered) +"ac" = (/turf/open/floor/noslip{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"ad" = (/mob/living/simple_animal/hostile/retaliate/clown,/turf/open/floor/plating/asteroid/basalt/lava_land_surface,/area/ruin/powered) +"ae" = (/obj/machinery/light,/turf/open/floor/plating/asteroid/basalt/lava_land_surface,/area/ruin/powered) +"af" = (/obj/item/clothing/head/cone,/turf/open/floor/noslip{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"ag" = (/obj/item/weapon/paper/crumpled/bloody{info = "Abandon hope, all ye who enter here."},/obj/effect/decal/cleanable/blood/old,/turf/open/floor/noslip{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"ah" = (/turf/closed/wall/r_wall{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"ai" = (/obj/machinery/disposal/deliveryChute{desc = "The following is engraved upon the chute: A FATE WORSE THAN DEATH LIES WITHIN"; dir = 1; name = "THE TRIAL OF HONKITUDE"},/obj/structure/disposalpipe/trunk,/turf/open/floor/noslip{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"aj" = (/obj/structure/disposalpipe/trunk,/obj/structure/disposaloutlet{dir = 1},/turf/open/floor/noslip{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"ak" = (/turf/open/floor/plating/lava/smooth/lava_land_surface,/area/ruin/powered) +"al" = (/obj/structure/disposalpipe/segment{invisibility = 101},/turf/closed/wall/r_wall{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"am" = (/obj/structure/disposalpipe/segment{dir = 4; icon_state = "pipe-c"; invisibility = 101},/turf/closed/wall/r_wall{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"an" = (/obj/structure/disposalpipe/segment{dir = 2; icon_state = "pipe-c"; invisibility = 101},/turf/closed/wall/r_wall{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"ao" = (/obj/structure/disposalpipe/trunk,/obj/structure/disposaloutlet{dir = 1},/turf/closed/wall/r_wall{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"ap" = (/obj/structure/disposalpipe/segment{invisibility = 101},/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"aq" = (/obj/effect/mob_spawn/human/corpse/damaged,/obj/effect/decal/cleanable/blood/old,/obj/structure/disposalpipe/segment{invisibility = 101},/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"ar" = (/obj/structure/disposalpipe/segment{dir = 4; icon_state = "pipe-c"; invisibility = 101},/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"as" = (/obj/structure/disposalpipe/sortjunction{dir = 1; icon_state = "pipe-j2s"; invisibility = 101; sortType = 3},/turf/closed/wall/r_wall{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"at" = (/obj/effect/decal/cleanable/pie_smudge,/obj/structure/disposalpipe/segment{invisibility = 101},/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"au" = (/obj/structure/disposalpipe/segment{dir = 1; icon_state = "pipe-c"; invisibility = 101},/obj/effect/decal/cleanable/dirt,/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"av" = (/obj/structure/disposalpipe/segment{dir = 4; invisibility = 101},/obj/effect/decal/cleanable/dirt,/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"aw" = (/obj/structure/disposalpipe/segment{dir = 4; invisibility = 101},/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"ax" = (/obj/structure/disposalpipe/segment{dir = 8; icon_state = "pipe-c"; invisibility = 101},/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"ay" = (/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"az" = (/obj/effect/decal/cleanable/dirt,/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"aA" = (/obj/effect/decal/cleanable/cobweb{icon_state = "cobweb2"},/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"aB" = (/obj/structure/disposalpipe/segment{dir = 4; invisibility = 101},/obj/effect/decal/cleanable/cobweb,/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"aC" = (/obj/structure/disposalpipe/segment{dir = 1; icon_state = "pipe-c"; invisibility = 101},/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"aD" = (/obj/structure/disposalpipe/segment{dir = 8; icon_state = "pipe-c"; invisibility = 101},/obj/effect/decal/cleanable/dirt,/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"aE" = (/obj/structure/disposalpipe/segment{dir = 1; icon_state = "pipe-c"; invisibility = 101},/obj/item/weapon/bikehorn,/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"aF" = (/obj/structure/disposalpipe/segment{dir = 1; icon_state = "pipe-c"; invisibility = 101},/turf/closed/wall/r_wall{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"aG" = (/obj/structure/disposalpipe/segment{dir = 4; invisibility = 101},/obj/effect/decal/cleanable/pie_smudge,/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"aH" = (/obj/structure/disposalpipe/segment{dir = 4; invisibility = 101},/turf/closed/wall/r_wall{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"aI" = (/obj/structure/disposalpipe/segment{dir = 2; icon_state = "pipe-c"; invisibility = 101},/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"aJ" = (/obj/item/weapon/bikehorn,/obj/structure/disposalpipe/segment{dir = 4; invisibility = 101},/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"aK" = (/obj/structure/disposalpipe/segment{dir = 4; invisibility = 101},/turf/open/floor/plating{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"aL" = (/obj/structure/disposalpipe/segment{dir = 8; icon_state = "pipe-c"; invisibility = 101},/turf/closed/wall/r_wall{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"aM" = (/obj/effect/decal/cleanable/dirt,/obj/structure/disposalpipe/segment{invisibility = 101},/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"aN" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/turf/open/floor/plating{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"aO" = (/obj/structure/disposalpipe/segment{dir = 2; icon_state = "pipe-c"; invisibility = 101},/obj/effect/decal/cleanable/dirt,/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"aP" = (/obj/item/weapon/bikehorn,/obj/effect/decal/cleanable/dirt,/obj/structure/disposalpipe/segment{invisibility = 101},/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"aQ" = (/obj/structure/disposalpipe/trunk{dir = 4},/obj/structure/disposaloutlet{dir = 8},/turf/open/floor/plating{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"aR" = (/obj/item/weapon/bikehorn,/obj/structure/disposalpipe/segment{invisibility = 101},/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"aS" = (/obj/structure/disposalpipe/segment{dir = 4; invisibility = 101},/turf/open/indestructible{icon_state = "darkredfull"},/area/ruin/powered) +"aT" = (/obj/effect/decal/cleanable/pie_smudge,/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"aU" = (/obj/structure/disposalpipe/segment{dir = 4; invisibility = 101},/turf/open/indestructible{icon_state = "white"},/area/ruin/powered) +"aV" = (/obj/structure/disposalpipe/segment{dir = 4; icon_state = "pipe-c"; invisibility = 101},/obj/effect/decal/cleanable/dirt,/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"aW" = (/obj/structure/disposalpipe/segment{dir = 4; invisibility = 101},/obj/structure/table,/obj/item/weapon/paper/crumpled/bloody{info = "If you dare not continue down this path of madness, escape can be found through the chute in this room. "},/obj/item/weapon/pen/fourcolor,/turf/open/indestructible{icon_state = "white"},/area/ruin/powered) +"aX" = (/obj/structure/disposalpipe/segment{dir = 4; invisibility = 101},/obj/structure/table,/obj/item/device/flashlight/lamp/bananalamp,/turf/open/indestructible{icon_state = "white"},/area/ruin/powered) +"aY" = (/obj/structure/disposalpipe/segment{dir = 2; icon_state = "pipe-c"; invisibility = 101},/obj/effect/decal/cleanable/pie_smudge,/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"aZ" = (/obj/structure/disposalpipe/segment{dir = 4; invisibility = 101},/obj/item/weapon/pickaxe,/turf/open/indestructible{icon_state = "white"},/area/ruin/powered) +"ba" = (/obj/structure/disposalpipe/segment{dir = 4; icon_state = "pipe-c"; invisibility = 101},/turf/open/indestructible{icon_state = "white"},/area/ruin/powered) +"bb" = (/obj/structure/disposalpipe/segment{dir = 2; icon_state = "pipe-c"; invisibility = 101},/turf/open/indestructible{icon_state = "white"},/area/ruin/powered) +"bc" = (/obj/structure/disposalpipe/segment{dir = 4; invisibility = 101},/turf/open/indestructible{icon_state = "light_on"},/area/ruin/powered) +"bd" = (/obj/structure/disposalpipe/segment{invisibility = 101},/turf/open/floor/plating{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"be" = (/obj/structure/disposalpipe/segment{invisibility = 101},/turf/open/indestructible{icon_state = "white"},/area/ruin/powered) +"bf" = (/turf/open/indestructible{icon_state = "light_on"},/area/ruin/powered) +"bg" = (/obj/structure/disposalpipe/segment{dir = 1; icon_state = "pipe-c"; invisibility = 101},/turf/open/indestructible{icon_state = "white"},/area/ruin/powered) +"bh" = (/obj/structure/disposalpipe/segment{dir = 8; icon_state = "pipe-c"; invisibility = 101},/turf/open/indestructible{icon_state = "white"},/area/ruin/powered) +"bi" = (/obj/machinery/light{icon_state = "tube1"; dir = 4},/turf/open/floor/plating/asteroid/basalt/lava_land_surface,/area/ruin/powered) +"bj" = (/turf/closed/mineral/clown,/area/ruin/powered) +"bk" = (/obj/item/weapon/pickaxe,/turf/open/indestructible{icon_state = "white"},/area/ruin/powered) +"bl" = (/turf/open/indestructible{icon_state = "white"},/area/ruin/powered) +"bm" = (/obj/structure/disposalpipe/segment{dir = 4; icon_state = "pipe-c"; invisibility = 101},/turf/open/indestructible{icon_state = "darkredfull"},/area/ruin/powered) +"bn" = (/obj/structure/disposalpipe/segment{dir = 1; icon_state = "pipe-c"; invisibility = 101},/turf/open/floor/plating{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"bo" = (/obj/item/weapon/bikehorn,/obj/structure/disposalpipe/segment{dir = 2; icon_state = "pipe-c"; invisibility = 101},/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"bp" = (/obj/machinery/light{dir = 8},/turf/open/floor/plating/asteroid/basalt/lava_land_surface,/area/ruin/powered) +"bq" = (/turf/open/chasm/straight_down/lava_land_surface,/area/ruin/powered) +"br" = (/obj/effect/decal/cleanable/cobweb,/turf/open/indestructible{icon_state = "darkredfull"; wet = 5},/area/ruin/powered) +"bs" = (/obj/structure/disposalpipe/segment,/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"bt" = (/obj/machinery/disposal/deliveryChute{dir = 1},/obj/structure/disposalpipe/trunk,/turf/open/indestructible{icon_state = "white"},/area/ruin/powered) +"bu" = (/turf/open/indestructible{icon_state = "darkredfull"; wet = 5},/area/ruin/powered) +"bv" = (/turf/open/indestructible/sound{icon_state = "bananium"; name = "bananium floor"; sound = 'sound/effects/clownstep1.ogg'; wet = 5},/area/ruin/powered) +"bw" = (/obj/structure/disposalpipe/junction{dir = 1; icon_state = "pipe-y"; invisibility = 101},/obj/effect/decal/cleanable/dirt,/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"bx" = (/obj/structure/mecha_wreckage/honker,/obj/structure/disposalpipe/segment{dir = 4; invisibility = 101},/turf/open/floor/plating{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"by" = (/obj/effect/decal/cleanable/oil,/obj/structure/disposalpipe/segment{dir = 2; icon_state = "pipe-c"; invisibility = 101},/turf/open/floor/plating{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"bz" = (/obj/effect/decal/cleanable/cobweb{icon_state = "cobweb2"},/turf/open/indestructible/sound{icon_state = "bananium"; name = "bananium floor"; sound = 'sound/effects/clownstep1.ogg'; wet = 5},/area/ruin/powered) +"bA" = (/obj/item/weapon/grown/bananapeel{color = "#2F3000"; name = "stealth banana peel"},/turf/open/floor/plating/asteroid/basalt/lava_land_surface,/area/ruin/powered) +"bB" = (/obj/effect/decal/cleanable/dirt,/turf/open/indestructible/sound{icon_state = "bananium"; name = "bananium floor"; sound = 'sound/effects/clownstep1.ogg'; wet = 5},/area/ruin/powered) +"bC" = (/obj/effect/mob_spawn/human/corpse/damaged,/obj/effect/decal/cleanable/blood/old,/turf/open/indestructible{icon_state = "darkyellowfull"; wet = 5},/area/ruin/powered) +"bD" = (/obj/structure/disposalpipe/segment{dir = 4; invisibility = 101},/turf/open/indestructible{icon_state = "darkredfull"; wet = 5},/area/ruin/powered) +"bE" = (/obj/structure/disposalpipe/segment{dir = 8; icon_state = "pipe-c"; invisibility = 101},/turf/open/indestructible{icon_state = "darkredfull"; wet = 5},/area/ruin/powered) +"bF" = (/turf/open/floor/plating/lava/smooth/lava_land_surface{initial_gas_mix = "o2=22;n2=82;TEMP=293.15"},/area/ruin/powered) +"bG" = (/obj/item/weapon/reagent_containers/food/drinks/trophy/gold_cup,/obj/structure/table/glass,/turf/open/floor/carpet{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"bH" = (/turf/open/floor/carpet{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"bI" = (/obj/machinery/disposal/deliveryChute,/obj/structure/disposalpipe/trunk{dir = 1},/turf/open/floor/carpet{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"bJ" = (/obj/effect/decal/cleanable/cobweb,/turf/open/floor/plating/lava/smooth/lava_land_surface{initial_gas_mix = "o2=22;n2=82;TEMP=293.15"},/area/ruin/powered) +"bK" = (/obj/structure/statue/bananium/clown,/turf/open/floor/carpet{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"bL" = (/obj/structure/table/glass,/obj/item/weapon/grown/bananapeel/bluespace,/turf/open/floor/carpet{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"bM" = (/obj/structure/table/glass,/obj/item/clothing/shoes/clown_shoes/banana_shoes,/turf/open/floor/carpet{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"bN" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/turf/open/floor/plating,/area/ruin/powered) +"bO" = (/obj/effect/decal/cleanable/dirt,/turf/open/floor/plating/lava/smooth/lava_land_surface{initial_gas_mix = "o2=22;n2=82;TEMP=293.15"},/area/ruin/powered) +"bP" = (/obj/item/weapon/coin/clown,/obj/item/weapon/coin/clown,/obj/item/weapon/coin/clown,/obj/item/weapon/coin/clown,/turf/open/floor/carpet{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"bQ" = (/obj/item/slime_extract/rainbow,/obj/structure/table/glass,/turf/open/floor/carpet{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"bR" = (/obj/item/weapon/bikehorn/airhorn,/turf/open/floor/carpet{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"bS" = (/obj/structure/table/glass,/obj/item/weapon/gun/magic/staff/honk,/turf/open/floor/carpet{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"bT" = (/obj/item/weapon/bikehorn,/turf/open/indestructible/sound{icon_state = "bananium"; name = "bananium floor"; sound = 'sound/effects/clownstep1.ogg'; wet = 5},/area/ruin/powered) +"bU" = (/obj/effect/mob_spawn/human/corpse/damaged,/obj/effect/decal/cleanable/blood/old,/turf/open/floor/plating/lava/smooth/lava_land_surface{initial_gas_mix = "o2=22;n2=82;TEMP=293.15"},/area/ruin/powered) +"bV" = (/obj/effect/mob_spawn/human/corpse/damaged,/obj/effect/decal/cleanable/blood/old,/turf/open/indestructible/sound{icon_state = "bananium"; name = "bananium floor"; sound = 'sound/effects/clownstep1.ogg'; wet = 5},/area/ruin/powered) +"bW" = (/obj/machinery/door/airlock/clown,/turf/open/indestructible/sound{icon_state = "bananium"; name = "bananium floor"; sound = 'sound/effects/clownstep1.ogg'; wet = 5},/area/ruin/powered) +"bX" = (/obj/item/weapon/bikehorn,/obj/effect/decal/cleanable/dirt,/turf/open/indestructible/sound{icon_state = "bananium"; name = "bananium floor"; sound = 'sound/effects/clownstep1.ogg'; wet = 5},/area/ruin/powered) +"bY" = (/obj/machinery/light{dir = 1},/turf/open/floor/plating/asteroid/basalt/lava_land_surface,/area/ruin/powered) (1,1,1) = {" -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -ab -ab -ab -ab -ab -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -"} -(2,1,1) = {" -aa -aa -aa -aa -aa -aa -aa -ah -ah -ah -ah -ah -ah -ah -bo -ab -bw -ab -ab -bw -bo -ah -ah -ah -ah -ah -aa -aa -aa -aa -aa -aa -"} -(3,1,1) = {" -aa -aa -aa -aa -aa -ah -ah -ah -ak -ak -ak -ak -ak -ah -ah -bw -bw -bG -bw -bw -ah -ah -ak -ak -ak -ah -ah -ah -aa -aa -aa -aa -"} -(4,1,1) = {" -aa -aa -aa -aa -ah -ah -ak -ak -ak -aR -aJ -ao -aJ -ak -ah -ah -bw -bw -bw -ah -ah -ak -ak -bX -aQ -ak -ak -ah -ah -aa -aa -aa -"} -(5,1,1) = {" -aa -aa -aa -ah -ah -ak -ak -am -aN -aS -aV -aH -bf -aJ -ak -ah -ah -ah -ah -ah -bO -bB -bX -ak -ak -ak -ak -ak -ah -ah -aa -aa -"} -(6,1,1) = {" -aa -aa -aa -ah -ak -ak -ah -aF -at -ar -aW -ar -aG -aL -ak -ah -bB -bH -bB -ah -bB -bH -bY -bB -bX -ak -bX -ak -ak -ah -cb -aa -"} -(7,1,1) = {" -aa -aa -ah -ah -ak -am -ax -aB -az -am -ar -aJ -aL -aL -ah -bx -bA -bB -bH -bH -bB -bH -bB -bB -bB -ah -ak -aQ -ak -ah -ah -aa -"} -(8,1,1) = {" -aa -aa -ah -ak -ak -ap -ar -aG -az -aL -aX -aL -bb -bb -bp -ah -bA -bA -bB -ah -ah -bH -ah -bB -bB -bB -bX -ak -ak -ak -ah -aa -"} -(9,1,1) = {" -aa -aa -ah -ak -am -ar -ar -aH -aA -aA -aL -bb -bb -bb -bq -bp -ah -ah -bA -bB -bB -bH -bB -bB -ca -bH -bB -ah -ak -ak -ah -aa -"} -(10,1,1) = {" -aa -ad -ah -ak -an -as -ar -aG -aL -az -aL -bb -bb -bj -bl -br -bA -bA -bA -bB -ah -bB -bB -bH -bH -bB -bB -ak -bX -ak -ah -ah -"} -(11,1,1) = {" -aa -ae -ah -ak -ao -al -ar -aH -az -az -aL -bb -bg -bj -bl -bp -ah -bA -bA -bB -bB -ah -bB -bB -bB -bB -bH -ak -bX -ak -ak -ah -"} -(12,1,1) = {" -aa -ad -ah -ak -ap -ar -ar -aI -az -an -aB -aL -bb -bb -br -ah -ah -bA -bB -bB -ah -ah -bB -bB -ah -bB -bH -ak -aQ -bX -ak -ah -"} -(13,1,1) = {" -ab -ad -ah -ak -ah -at -ar -aB -aM -ax -ar -aB -aL -aL -bs -al -aJ -ah -ah -ah -bP -bS -ah -bB -bB -bH -ca -bB -ak -bX -ak -ah -"} -(14,1,1) = {" -ab -af -ah -ah -ak -an -ar -ar -ar -ar -aY -ar -aH -aA -aV -ay -az -ah -ah -bL -bM -bM -bM -ah -bB -bH -bH -bB -ak -bX -ak -ah -"} -(15,1,1) = {" -ac -ac -ai -al -al -au -ar -al -ar -aT -al -ax -ar -aH -aD -aA -aM -aG -ah -bM -bQ -bT -bM -ah -ah -bH -bB -bB -ak -bX -ak -ah -"} -(16,1,1) = {" -ac -ag -ac -ah -ak -ao -ar -aJ -at -aG -at -ar -ar -au -bt -aM -aG -aV -al -bN -bM -bU -bM -bZ -bB -bH -bB -ah -ak -bX -ak -ah -"} -(17,1,1) = {" -ac -ac -aj -al -al -av -ay -aA -aA -aL -aA -bc -ar -aG -bu -by -bC -aD -ah -bM -bR -bV -bM -ah -bB -bB -bB -bB -ak -bX -ak -ah -"} -(18,1,1) = {" -ab -ac -ah -ah -ak -ah -az -az -az -aA -aA -aA -aC -aM -aG -ba -aL -bI -ah -bL -bM -bM -bM -ah -bB -bB -bB -bB -ak -bX -ak -ah -"} -(19,1,1) = {" -ab -ad -ah -ak -ak -ah -az -az -aO -aA -aA -aL -ah -ah -aZ -ah -bD -ah -bB -ah -bP -bS -ah -bB -bB -bH -bH -bB -ak -bX -ak -ah -"} -(20,1,1) = {" -aa -ad -ah -ak -ah -ah -aA -aA -aA -az -aA -aL -bh -bk -bn -ah -bE -aJ -bB -bB -ah -ah -bY -bB -bB -bH -bB -ak -bX -aQ -ak -ah -"} -(21,1,1) = {" -aa -ae -ah -ak -ah -ah -aA -aK -aL -az -aL -bd -bb -bl -bl -bp -ah -bJ -bA -bB -bB -ah -bB -bH -bB -bB -bB -ak -bX -ak -ak -ah -"} -(22,1,1) = {" -aa -ad -ah -ak -aq -aw -aB -aL -aP -az -aL -be -bb -bl -bl -bz -al -bK -ah -bB -bB -bH -bH -bH -bB -bW -bB -ah -bX -ak -ah -ah -"} -(23,1,1) = {" -aa -aa -ah -ak -ah -ah -aC -aA -aA -aO -aZ -bb -bi -bm -br -bp -ah -bA -bA -bB -bB -bH -bH -bB -bB -ah -ah -ak -aQ -ak -ah -aa -"} -(24,1,1) = {" -aa -aa -ah -ak -ah -ah -aD -aA -aL -aA -aL -aL -bh -bn -bp -ah -bA -bA -bB -bB -bB -bB -bB -ah -bB -bB -ak -aQ -ak -ak -ah -aa -"} -(25,1,1) = {" -aa -aa -ah -ak -ak -ah -aE -aA -aA -aA -aM -aB -aL -ah -ah -bA -bA -bB -bB -bB -bH -bW -bB -bB -bB -ah -ak -bX -ak -ah -ah -aa -"} -(26,1,1) = {" -aa -aa -ah -ah -ak -ah -ah -aM -aB -aM -ar -ar -aS -ah -ak -ah -bF -bB -bB -ah -bB -bB -ah -bB -bB -ak -aQ -ak -ak -ah -cb -aa -"} -(27,1,1) = {" -aa -aa -aa -ah -ah -ak -ak -ah -aQ -ah -ba -aC -aQ -ah -ak -ah -ah -ah -ah -ah -bB -bB -bB -ak -ak -ak -ak -ak -ah -ah -aa -aa -"} -(28,1,1) = {" -aa -aa -aa -aa -ah -ah -ak -ak -ak -aU -aU -aU -ah -ak -ah -ah -bw -bw -bw -ah -ah -ak -ak -aQ -bX -ak -ak -ah -ah -aa -aa -aa -"} -(29,1,1) = {" -aa -aa -aa -aa -aa -ah -ah -ah -ak -ak -ak -ak -ak -ah -ah -bw -bw -bG -bw -bw -ah -ah -ak -ak -ak -ah -ah -ah -aa -aa -aa -aa -"} -(30,1,1) = {" -aa -aa -aa -aa -aa -aa -aa -ah -ah -ah -ah -ah -ah -ah -bv -ab -ab -ab -ab -bw -bv -ah -ah -ah -ah -ah -aa -aa -aa -aa -aa -aa -"} -(31,1,1) = {" -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -ab -bw -ab -ab -ab -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -"} -(32,1,1) = {" -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa -aa +aaaaaaaaaaaaaaaaaaaaaaaaababacacacababaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaadaeadadafacagacacadadaeadaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaahahahahahahahahaiacajahahahahahahahahahaaaaaaaaaaaa +aaaaaaaaahahahakakakakakakahalahalahakakakakakakakahahaaaaaaaaaa +aaaaaaahahakakakamanamanahakalakalakakahahaoahahakakahahaaaaaaaa +aaaaahahakakamanapaqalaparanalamasahahahahalahahahahakahahaaaaaa +aaaaahakakahatapapapapapapapapapauavavawawaxayazaAahakakahaaaaaa +aaahahakamaBaxaCaDaCaDaEaxapalaFawavavawaGaHawawawaIahakahahaaaa +aaahakakalaravavawaHavavaIapaparawavaJawaHaKawaHawaxahakakahaaaa +aaahakamaLapamaHawavavanatapaMaCaHawawavavavaJawawaIahaNakahaaaa +aaahakaFaOaPapaQaHaHaHaxapaRalarawawawawaHaHaSaHaIapaTaNakahaaaa +aaahakamaDapaFaHaUaUaUaHaxapatapaVawaHaHaWaXaUaHaxapayaNakahaaaa +aaahakaFaYaCaHaUaUaUaZaUaHaDapapapayahbaaUaUbbbaaHaLahahakahaaaa +aaahahakaFaHaHaUaUbcbcaUaHawaDbdaCaIahbebfbfbgbhahahahakahahaaaa +aabiahahakakahbjbkbfbfblbmaOazbnboaCaSbhbfbfblbjahakakahahbpaaaa +ababbqahahahbrahbjblbjahalauawaIbsaTahahbjbtbjahbuahahahbqababaa +abbqbqbqahbvbubuahbjahahaFavaIaCbwaHbxbyahalahbububzahbqbqabbqaa +ababbAbqahbBbvbububububuahahaCaOazbCahaFbDbEbububvbvahbqbAababaa +ababbqbqahbvbBbvbubububvahahahalahahbvbvbuahbubvbvbvahbqbqababaa +abbqbqahahbFbBbvbvbvbvbvahbGbHbIbHbGahbvbvbvbvbvbvahahahbqbqabaa +aabiahahbJbFbvbvbvbvbvahbKbHbLbHbMbHbKahbvbvbvbvbBbFbFahahbpaaaa +aaahahbNbFbObBbBbBbvbvahbPbHbQbRbSbHbPahbvbBbBbvbTbFbFbNahahaaaa +aaahakakbNbUbFbvbvbvbvbvahbHbHbHbHbHahbVbvbBbBbvbvbFbFbNakahaaaa +aaahakakbNbFbFbvbvbBbvbvbvahahbWahahbvbvbBbBbvbvbvbFbFbNakahaaaa +aaahakakakbNbFbFbXbBbvbBbvbvbBbvbvbvbvbvbvbvbvbvbFbFbFbNakahaaaa +aaahahakakakahbFbObvbvbvbBbBbBbBbvbvbBbBbvbTbvbFbFbFbNakahahaaaa +aaaaahakakakakbNbFbFbObBbXbBbvbvbvbvbBbFbFbFbFbFbFbNakakahaaaaaa +aaaaahahakakakakahbFbFbFbFbFbFbFbFbFbFbFbFbFbFbNbNakakahahaaaaaa +aaaaaaahahakakakakbNbNbFbFbFbFbFbFbFbFbNbNbNbNakakakahahaaaaaaaa +aaaaaaaaahahahakakakakbNbNbNbNbNbNbNbNbNakakakakahahahaaaaaaaaaa +aaaaaaaaaabYahahahahakakakakakakakakakakakahahahahbYaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaahahahahahahahahahahahahahaaaaaaaaaaaaaaaaaaaa "} diff --git a/_maps/RandomRuins/LavaRuins/lavaland_surface_biodome_winter.dmm b/_maps/RandomRuins/LavaRuins/lavaland_surface_biodome_winter.dmm index 088755d949..a2728a400b 100644 --- a/_maps/RandomRuins/LavaRuins/lavaland_surface_biodome_winter.dmm +++ b/_maps/RandomRuins/LavaRuins/lavaland_surface_biodome_winter.dmm @@ -16,12 +16,12 @@ "ap" = (/obj/structure/flora/rock/icy,/turf/open/floor/plating/asteroid/snow{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered/snow_biodome) "aq" = (/turf/closed/wall/mineral/wood,/area/ruin/powered/snow_biodome) "ar" = (/obj/machinery/door/airlock/wood,/turf/open/floor/plating{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered/snow_biodome) -"as" = (/obj/structure/fans,/turf/closed/wall/mineral/wood,/area/ruin/powered/snow_biodome) -"at" = (/turf/open/floor/wood{baseturf = /turf/open/floor/plating/lava/smooth; name = "floor"},/area/ruin/powered/snow_biodome) -"au" = (/obj/structure/bed,/obj/item/weapon/bedsheet/blue,/turf/open/floor/wood{baseturf = /turf/open/floor/plating/lava/smooth; name = "floor"},/area/ruin/powered/snow_biodome) -"av" = (/obj/structure/bookcase/random,/turf/open/floor/wood{baseturf = /turf/open/floor/plating/lava/smooth; name = "floor"},/area/ruin/powered/snow_biodome) -"aw" = (/obj/structure/table/wood,/turf/open/floor/wood{baseturf = /turf/open/floor/plating/lava/smooth; name = "floor"},/area/ruin/powered/snow_biodome) -"ax" = (/obj/structure/table/wood,/obj/item/weapon/reagent_containers/food/snacks/beans,/turf/open/floor/wood{baseturf = /turf/open/floor/plating/lava/smooth; name = "floor"},/area/ruin/powered/snow_biodome) +"as" = (/turf/open/floor/wood{baseturf = /turf/open/floor/plating/lava/smooth; name = "floor"},/area/ruin/powered/snow_biodome) +"at" = (/obj/structure/bed,/obj/item/weapon/bedsheet/blue,/turf/open/floor/wood{baseturf = /turf/open/floor/plating/lava/smooth; name = "floor"},/area/ruin/powered/snow_biodome) +"au" = (/obj/structure/bookcase/random,/turf/open/floor/wood{baseturf = /turf/open/floor/plating/lava/smooth; name = "floor"},/area/ruin/powered/snow_biodome) +"av" = (/obj/structure/table/wood,/turf/open/floor/wood{baseturf = /turf/open/floor/plating/lava/smooth; name = "floor"},/area/ruin/powered/snow_biodome) +"aw" = (/obj/structure/table/wood,/obj/item/weapon/reagent_containers/food/snacks/beans,/turf/open/floor/wood{baseturf = /turf/open/floor/plating/lava/smooth; name = "floor"},/area/ruin/powered/snow_biodome) +"ax" = (/obj/structure/fans,/turf/open/floor/wood{baseturf = /turf/open/floor/plating/lava/smooth; name = "floor"},/area/ruin/powered/snow_biodome) "ay" = (/obj/structure/closet/crate/trashcart,/obj/item/trash/semki,/obj/item/trash/candy,/turf/open/floor/plating/asteroid/snow{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered/snow_biodome) "az" = (/obj/structure/flora/tree/pine,/turf/open/floor/plating/asteroid/snow{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered/snow_biodome) "aA" = (/obj/structure/chair/comfy/brown{tag = "icon-comfychair (EAST)"; icon_state = "comfychair"; dir = 4},/turf/open/floor/wood{baseturf = /turf/open/floor/plating/lava/smooth; name = "floor"},/area/ruin/powered/snow_biodome) @@ -61,7 +61,7 @@ "bi" = (/obj/machinery/computer/monitor,/turf/open/floor/pod/dark,/area/ruin/powered/snow_biodome) "bj" = (/obj/item/weapon/storage/toolbox/mechanical,/turf/open/floor/pod/dark,/area/ruin/powered/snow_biodome) "bk" = (/obj/structure/reagent_dispensers/fueltank,/turf/open/floor/pod/dark,/area/ruin/powered/snow_biodome) -"bl" = (/turf/open/floor/wood{baseturf = /turf/open/floor/plating/lava/smooth; name = "bridge"},/area/ruin/powered/snow_biodome) +"bl" = (/turf/open/floor/wood{baseturf = /turf/open/floor/plating/lava/smooth; initial_gas_mix = "TEMP=180"; name = "bridge"},/area/ruin/powered/snow_biodome) "bm" = (/turf/open/floor/plating/asteroid/basalt/lava_land_surface,/area/ruin/powered/snow_biodome) "bn" = (/obj/item/clothing/mask/balaclava,/turf/open/floor/pod/dark,/area/ruin/powered/snow_biodome) "bo" = (/obj/structure/table,/obj/item/weapon/storage/fancy/cigarettes/cigpack_carp,/turf/open/floor/pod/dark,/area/ruin/powered/snow_biodome) @@ -73,12 +73,12 @@ aaaaaaaaaaaaaaaaaaababababababababababababaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaababababacadaeafaeagahabaiajababababaaaaaaaaaaaa aaaaaaaaabababakabafafafafalafahafamafafanabakabababaaaaaaaa -aaaaaaababaoapakababaqaraqaqaqasaqaqaqaqababakakapababaaaaaa -aaaaababaoaoakakakakaqatauaqavawaxavavaqayakazakakakababaaaa -aaaaabakaoaoaoakazakaqatauaqataAawatataqakakakaBakakakabaaaa -aaababaCakaoaoakakakaqaDaqaEataAaFaGaHaqakaIaJakakazakababaa -aaabakakaIaoaoaoakakaqatatataHatatatataqakakakakakakakakabaa -aaabakakakakaoaoaoakaKaLatataMaMatataNaqakapakaCakakakakabaa +aaaaaaababaoapakababaqaraqaqaqaqaqaqaqaqababakakapababaaaaaa +aaaaababaoaoakakakakaqasataqauavawauaxaqayakazakakakababaaaa +aaaaabakaoaoaoakazakaqasataqasaAavasasaqakakakaBakakakabaaaa +aaababaCakaoaoakakakaqaDaqaEasaAaFaGaHaqakaIaJakakazakababaa +aaabakakaIaoaoaoakakaqasasasaHasasasasaqakakakakakakakakabaa +aaabakakakakaoaoaoakaKaLasasaMaMasasaNaqakapakaCakakakakabaa aaabakakakaIakaoaoakaqaqaqaqaOaPaqaqaqaqakakakakaQakakakabaa ababababakakakaoaoakakakakakapakakaRakakakakakakakakabababab abaSaSaTazakakakaoaoaoazakakakakaIakakakakakakakakakaTaUaVab diff --git a/_maps/RandomRuins/LavaRuins/lavaland_surface_prisoner_crash.dmm b/_maps/RandomRuins/LavaRuins/lavaland_surface_prisoner_crash.dmm index 8335d37692..4cb1602a28 100644 --- a/_maps/RandomRuins/LavaRuins/lavaland_surface_prisoner_crash.dmm +++ b/_maps/RandomRuins/LavaRuins/lavaland_surface_prisoner_crash.dmm @@ -1,591 +1,48 @@ -//MAP CONVERTED BY dmm2tgm.py THIS HEADER COMMENT PREVENTS RECONVERSION, DO NOT REMOVE -"a" = ( -/turf/closed/mineral/volcanic/lava_land_surface, -/area/lavaland/surface/outdoors) -"b" = ( -/turf/open/floor/plating/asteroid/basalt/lava_land_surface, -/area/lavaland/surface/outdoors) -"c" = ( -/obj/item/weapon/shard, -/turf/open/floor/plating/asteroid/basalt/lava_land_surface, -/area/lavaland/surface/outdoors) -"d" = ( -/obj/item/weapon/shard{ - icon_state = "medium" - }, -/turf/open/floor/plating/asteroid/basalt/lava_land_surface, -/area/lavaland/surface/outdoors) -"e" = ( -/turf/closed/indestructible/opshuttle, -/area/lavaland/surface/outdoors) -"f" = ( -/obj/structure/shuttle/engine/propulsion{ - icon_state = "propulsion"; - dir = 4 - }, -/turf/open/floor/plating/asteroid/basalt/lava_land_surface, -/area/lavaland/surface/outdoors) -"g" = ( -/obj/structure/shuttle/engine/propulsion{ - icon_state = "propulsion"; - dir = 4 - }, -/turf/open/floor/plating/asteroid/basalt/lava_land_surface, -/area/ruin/unpowered) -"h" = ( -/turf/closed/indestructible/opshuttle, -/area/ruin/unpowered) -"i" = ( -/turf/open/floor/plasteel/shuttle/red{ - baseturf = /turf/open/floor/plating/lava/smooth; - initial_gas_mix = "o2=16;n2=23" - }, -/area/lavaland/surface/outdoors) -"j" = ( -/obj/item/weapon/pickaxe, -/obj/item/weapon/pickaxe, -/obj/item/weapon/pickaxe, -/obj/item/weapon/pickaxe, -/obj/item/device/flashlight/lantern, -/turf/open/floor/plasteel/shuttle/red{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/unpowered) -"k" = ( -/obj/effect/mob_spawn/human/prisoner_transport, -/turf/open/floor/plasteel/shuttle/red{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/unpowered) -"l" = ( -/obj/item/weapon/shard, -/turf/open/floor/plasteel/shuttle/red{ - baseturf = /turf/open/floor/plating/lava/smooth; - initial_gas_mix = "o2=16;n2=23" - }, -/area/ruin/unpowered) -"m" = ( -/obj/effect/mob_spawn/human/nanotrasensoldier, -/obj/effect/decal/cleanable/blood, -/obj/item/device/flashlight/seclite, -/obj/effect/light_emitter, -/turf/open/floor/plasteel/shuttle/red{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/unpowered) -"n" = ( -/obj/item/weapon/gun/projectile/automatic/pistol/m1911, -/turf/open/floor/plasteel/shuttle/red{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/unpowered) -"o" = ( -/turf/open/floor/plasteel/shuttle/red{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/unpowered) -"p" = ( -/obj/machinery/door/airlock/shuttle, -/turf/open/floor/plasteel/shuttle/red{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/unpowered) -"q" = ( -/obj/item/weapon/shard, -/turf/open/floor/plasteel/shuttle/red{ - baseturf = /turf/open/floor/plating/lava/smooth; - initial_gas_mix = "o2=16;n2=23" - }, -/area/lavaland/surface/outdoors) -"r" = ( -/obj/machinery/door/airlock/shuttle, -/turf/open/floor/plasteel/shuttle/red{ - baseturf = /turf/open/floor/plating/lava/smooth; - initial_gas_mix = "o2=16;n2=23" - }, -/area/ruin/unpowered) -"s" = ( -/obj/effect/mob_spawn/human/nanotrasensoldier, -/obj/item/weapon/gun/projectile/automatic/pistol/m1911, -/obj/effect/decal/cleanable/blood, -/turf/open/floor/plasteel/shuttle/red{ - baseturf = /turf/open/floor/plating/lava/smooth; - initial_gas_mix = "o2=16;n2=23" - }, -/area/ruin/unpowered) -"t" = ( -/obj/structure/closet/crate/internals, -/obj/item/weapon/crowbar/large, -/turf/open/floor/plasteel/shuttle/red{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/unpowered) -"u" = ( -/obj/structure/lattice, -/turf/open/floor/plating/asteroid/basalt/lava_land_surface, -/area/lavaland/surface/outdoors) -"v" = ( -/obj/effect/decal/cleanable/blood, -/turf/open/floor/plating/asteroid/basalt/lava_land_surface, -/area/lavaland/surface/outdoors) -"w" = ( -/obj/item/weapon/shard{ - icon_state = "small" - }, -/turf/open/floor/plating/asteroid/basalt/lava_land_surface, -/area/lavaland/surface/outdoors) -"x" = ( -/obj/item/weapon/gun/projectile/automatic/pistol/m1911, -/turf/open/floor/plating/asteroid/basalt/lava_land_surface, -/area/lavaland/surface/outdoors) -"y" = ( -/obj/effect/mob_spawn/human/nanotrasensoldier, -/obj/effect/decal/cleanable/blood, -/turf/open/floor/plating/asteroid/basalt/lava_land_surface, -/area/lavaland/surface/outdoors) -"z" = ( -/obj/effect/decal/cleanable/blood, -/obj/item/device/flashlight/seclite, -/turf/open/floor/plating/asteroid/basalt/lava_land_surface, -/area/lavaland/surface/outdoors) +"a" = (/turf/closed/mineral/volcanic/lava_land_surface,/area/lavaland/surface/outdoors) +"b" = (/turf/open/floor/plating/asteroid/basalt/lava_land_surface,/area/lavaland/surface/outdoors) +"c" = (/obj/item/weapon/shard,/turf/open/floor/plating/asteroid/basalt/lava_land_surface,/area/lavaland/surface/outdoors) +"d" = (/obj/item/weapon/shard{icon_state = "medium"},/turf/open/floor/plating/asteroid/basalt/lava_land_surface,/area/lavaland/surface/outdoors) +"e" = (/turf/closed/indestructible/opshuttle,/area/lavaland/surface/outdoors) +"f" = (/obj/structure/shuttle/engine/propulsion{icon_state = "propulsion"; dir = 4},/turf/open/floor/plating/asteroid/basalt/lava_land_surface,/area/lavaland/surface/outdoors) +"g" = (/obj/structure/shuttle/engine/propulsion{icon_state = "propulsion"; dir = 4},/turf/open/floor/plating/asteroid/basalt/lava_land_surface,/area/ruin/unpowered) +"h" = (/turf/closed/indestructible/opshuttle,/area/ruin/unpowered) +"i" = (/turf/open/floor/plasteel/shuttle/red{baseturf = /turf/open/floor/plating/lava/smooth; initial_gas_mix = "o2=14;n2=23;TEMP=300"},/area/lavaland/surface/outdoors) +"j" = (/obj/item/weapon/pickaxe,/obj/item/weapon/pickaxe,/obj/item/weapon/pickaxe,/obj/item/weapon/pickaxe,/obj/item/device/flashlight/lantern,/turf/open/floor/plasteel/shuttle/red{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/unpowered) +"k" = (/obj/effect/mob_spawn/human/prisoner_transport,/turf/open/floor/plasteel/shuttle/red{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/unpowered) +"l" = (/obj/item/weapon/shard,/turf/open/floor/plasteel/shuttle/red{baseturf = /turf/open/floor/plating/lava/smooth; initial_gas_mix = "o2=14;n2=23;TEMP=300"},/area/ruin/unpowered) +"m" = (/obj/effect/mob_spawn/human/nanotrasensoldier,/obj/effect/decal/cleanable/blood,/obj/item/device/flashlight/seclite,/obj/effect/light_emitter,/turf/open/floor/plasteel/shuttle/red{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/unpowered) +"n" = (/obj/item/weapon/gun/projectile/automatic/pistol/m1911,/turf/open/floor/plasteel/shuttle/red{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/unpowered) +"o" = (/turf/open/floor/plasteel/shuttle/red{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/unpowered) +"p" = (/obj/machinery/door/airlock/shuttle,/turf/open/floor/plasteel/shuttle/red{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/unpowered) +"q" = (/obj/item/weapon/shard,/turf/open/floor/plasteel/shuttle/red{baseturf = /turf/open/floor/plating/lava/smooth; initial_gas_mix = "o2=14;n2=23;TEMP=300"},/area/lavaland/surface/outdoors) +"r" = (/obj/machinery/door/airlock/shuttle,/turf/open/floor/plasteel/shuttle/red{baseturf = /turf/open/floor/plating/lava/smooth; initial_gas_mix = "o2=14;n2=23;TEMP=300"},/area/ruin/unpowered) +"s" = (/obj/effect/mob_spawn/human/nanotrasensoldier,/obj/item/weapon/gun/projectile/automatic/pistol/m1911,/obj/effect/decal/cleanable/blood,/turf/open/floor/plasteel/shuttle/red{baseturf = /turf/open/floor/plating/lava/smooth; initial_gas_mix = "o2=14;n2=23;TEMP=300"},/area/ruin/unpowered) +"t" = (/obj/structure/closet/crate/internals,/obj/item/weapon/crowbar/large,/turf/open/floor/plasteel/shuttle/red{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/unpowered) +"u" = (/obj/effect/decal/cleanable/blood,/turf/open/floor/plating/asteroid/basalt/lava_land_surface,/area/lavaland/surface/outdoors) +"v" = (/obj/item/weapon/shard{icon_state = "small"},/turf/open/floor/plating/asteroid/basalt/lava_land_surface,/area/lavaland/surface/outdoors) +"w" = (/obj/item/weapon/gun/projectile/automatic/pistol/m1911,/turf/open/floor/plating/asteroid/basalt/lava_land_surface,/area/lavaland/surface/outdoors) +"x" = (/obj/effect/mob_spawn/human/nanotrasensoldier,/obj/effect/decal/cleanable/blood,/turf/open/floor/plating/asteroid/basalt/lava_land_surface,/area/lavaland/surface/outdoors) +"y" = (/obj/effect/decal/cleanable/blood,/obj/item/device/flashlight/seclite,/turf/open/floor/plating/asteroid/basalt/lava_land_surface,/area/lavaland/surface/outdoors) (1,1,1) = {" -a -a -b -b -b -b -b -b -b -b -b -b -b -b -b -b -b -b -b -b -"} -(2,1,1) = {" -b -a -b -b -b -a -a -b -b -b -b -b -b -b -b -b -b -b -a -b -"} -(3,1,1) = {" -b -b -c -b -b -a -a -b -b -b -b -b -b -b -b -b -b -b -b -a -"} -(4,1,1) = {" -b -b -b -b -b -b -a -b -b -g -h -g -h -g -b -b -b -w -b -b -"} -(5,1,1) = {" -b -b -a -a -a -b -b -b -b -h -h -h -h -h -b -b -b -x -b -b -"} -(6,1,1) = {" -b -b -a -a -a -b -b -e -f -h -j -m -t -h -f -e -b -b -y -b -"} -(7,1,1) = {" -b -b -b -b -b -b -b -b -e -h -k -n -k -h -e -b -b -v -z -b -"} -(8,1,1) = {" -a -b -b -b -b -b -b -a -a -h -k -o -k -h -b -b -v -v -b -b -"} -(9,1,1) = {" -b -b -b -d -b -b -b -a -a -h -k -o -k -h -b -b -v -v -b -b -"} -(10,1,1) = {" -b -b -b -b -b -b -b -a -a -h -k -o -k -h -b -b -b -b -a -a -"} -(11,1,1) = {" -a -b -b -b -b -b -b -a -a -h -h -p -h -h -b -b -b -b -a -a -"} -(12,1,1) = {" -a -b -b -b -b -b -b -b -b -e -i -i -i -u -b -b -b -b -a -a -"} -(13,1,1) = {" -b -b -b -a -b -b -b -a -b -i -i -q -i -u -b -b -b -c -a -a -"} -(14,1,1) = {" -b -a -a -b -b -a -a -a -a -i -i -i -i -i -b -b -b -b -a -a -"} -(15,1,1) = {" -b -b -b -a -a -a -a -a -a -h -h -r -e -e -b -b -b -b -a -a -"} -(16,1,1) = {" -b -b -b -a -a -a -a -a -a -h -l -s -a -e -b -b -b -b -a -a -"} -(17,1,1) = {" -b -b -b -a -a -a -a -a -a -e -a -a -a -e -b -b -b -b -a -a -"} -(18,1,1) = {" -b -b -b -b -b -a -a -a -a -a -a -a -e -a -a -b -a -a -a -a -"} -(19,1,1) = {" -b -b -b -b -b -a -a -a -a -a -a -a -a -b -b -b -a -a -a -a -"} -(20,1,1) = {" -b -b -b -b -b -a -a -a -a -a -a -a -a -b -b -b -b -b -a -a +abbbbbbabbaabbbbbbbb +aabbbbbbbbbbbabbbbbb +bbcbaabbbbbbbabbbbbb +bbbbaabbdbbbabaaabbb +bbbbaabbbbbbbbaaabbb +baabbbbbbbbbbaaaaaaa +baaabbbbbbbbbaaaaaaa +bbbbbebaaaabaaaaaaaa +bbbbbfeaaaabbaaaaaaa +bbbghhhhhhheiihheaaa +bbbhhjkkkkhiiihlaaaa +bbbghmnooopiqirsaaaa +bbbhhtkkkkhiiieaaeaa +bbbghhhhhhhbbieeeabb +bbbbbfebbbbbbbbbbabb +bbbbbebbbbbbbbbbbbbb +bbbbbbbuubbbbbbbbaab +bbbvwbuuubbbcbbbbaab +babbbxybbaaaaaaaaaaa +bbabbbbbbaaaaaaaaaaa "} diff --git a/_maps/RandomRuins/LavaRuins/lavaland_surface_tomb.dmm b/_maps/RandomRuins/LavaRuins/lavaland_surface_tomb.dmm index c4f10ea608..f10d1062cd 100644 --- a/_maps/RandomRuins/LavaRuins/lavaland_surface_tomb.dmm +++ b/_maps/RandomRuins/LavaRuins/lavaland_surface_tomb.dmm @@ -1,852 +1,56 @@ -//MAP CONVERTED BY dmm2tgm.py THIS HEADER COMMENT PREVENTS RECONVERSION, DO NOT REMOVE -"a" = ( -/turf/template_noop, -/area/template_noop) -"b" = ( -/turf/closed/mineral/volcanic/lava_land_surface, -/area/lavaland/underground) -"c" = ( -/turf/template_noop, -/area/lavaland/underground) -"d" = ( -/turf/open/floor/plating/asteroid/basalt/lava_land_surface, -/area/lavaland/underground) -"e" = ( -/obj/effect/decal/remains/human, -/turf/open/floor/plating/asteroid/basalt/lava_land_surface, -/area/lavaland/underground) -"f" = ( -/turf/open/floor/plating/lava/smooth/lava_land_surface, -/area/lavaland/underground) -"g" = ( -/turf/closed/indestructible/riveted{ - icon = 'icons/turf/walls/iron_wall.dmi'; - icon_state = "iron"; - name = "dense wall" - }, -/area/ruin/powered) -"h" = ( -/obj/structure/table, -/turf/open/floor/plasteel/black{ - baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface - }, -/area/ruin/powered) -"i" = ( -/turf/open/floor/plasteel/black{ - baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface - }, -/area/ruin/powered) -"j" = ( -/mob/living/simple_animal/hostile/skeleton, -/turf/open/floor/plasteel/black{ - baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface - }, -/area/ruin/powered) -"k" = ( -/obj/structure/bodycontainer/morgue{ - desc = "An oddly modernized tomb, at least compared to where it currently is."; - name = "tomb" - }, -/obj/effect/mob_spawn/human/skeleton, -/turf/open/floor/plasteel/black{ - baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface - }, -/area/ruin/powered) -"l" = ( -/obj/item/weapon/grown/bananapeel, -/obj/structure/mineral_door/transparent/diamond, -/turf/open/floor/vault{ - baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface - }, -/area/ruin/powered) -"m" = ( -/obj/item/weapon/ore/diamond, -/turf/open/floor/plasteel/black{ - baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface - }, -/area/ruin/powered) -"n" = ( -/turf/open/floor/vault{ - baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface - }, -/area/ruin/powered) -"o" = ( -/obj/item/weapon/ore/gold, -/turf/open/floor/plasteel/black{ - baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface - }, -/area/ruin/powered) -"p" = ( -/turf/open/floor/plating/lava/smooth/lava_land_surface, -/area/ruin/powered) -"q" = ( -/obj/structure/table, -/obj/item/weapon/tome, -/turf/open/floor/plasteel/black{ - baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface - }, -/area/ruin/powered) -"r" = ( -/obj/item/weapon/grown/bananapeel, -/obj/structure/mineral_door/silver, -/turf/open/floor/vault{ - baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface - }, -/area/ruin/powered) -"s" = ( -/obj/item/weapon/ore/bananium, -/turf/open/floor/plasteel/black{ - baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface - }, -/area/ruin/powered) -"t" = ( -/obj/item/weapon/grown/bananapeel, -/obj/structure/mineral_door/gold, -/turf/open/floor/vault{ - baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface - }, -/area/ruin/powered) -"u" = ( -/obj/structure/table/optable/abductor{ - desc = "A strange, alien-like table for cutting up things, like people."; - name = "strange alien slab" - }, -/obj/effect/gibspawner/human, -/obj/effect/mob_spawn/human/skeleton, -/obj/item/weapon/veilrender/honkrender, -/obj/item/clothing/mask/gas/clown_hat, -/turf/open/floor/vault{ - baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface - }, -/area/ruin/powered) -"v" = ( -/obj/structure/table, -/obj/item/weapon/spellbook/oneuse/charge, -/turf/open/floor/plasteel/black{ - baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface - }, -/area/ruin/powered) -"w" = ( -/obj/structure/bodycontainer/morgue{ - desc = "An oddly modernized tomb, at least compared to where it currently is."; - name = "tomb" - }, -/obj/effect/mob_spawn/human/skeleton{ - helmet = /obj/item/clothing/head/ushanka; - name = "russian remains"; - uniform = /obj/item/clothing/under/soviet - }, -/turf/open/floor/plasteel/black{ - baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface - }, -/area/ruin/powered) -"x" = ( -/obj/item/weapon/ore/uranium, -/turf/open/floor/plasteel/black{ - baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface - }, -/area/ruin/powered) -"y" = ( -/obj/item/weapon/ore/plasma, -/turf/open/floor/plasteel/black{ - baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface - }, -/area/ruin/powered) -"z" = ( -/obj/item/weapon/grown/bananapeel, -/obj/structure/mineral_door/iron, -/turf/open/floor/vault{ - baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface - }, -/area/ruin/powered) -"A" = ( -/obj/structure/table, -/obj/item/weapon/twohanded/spear, -/obj/item/weapon/shield/riot/buckler, -/turf/open/floor/plasteel/black{ - baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface - }, -/area/ruin/powered) -"B" = ( -/obj/item/weapon/grown/bananapeel, -/obj/structure/mineral_door/iron, -/turf/open/floor/plasteel/black{ - baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface - }, -/area/ruin/powered) +"a" = (/turf/template_noop,/area/template_noop) +"b" = (/turf/closed/mineral/volcanic/lava_land_surface,/area/lavaland/underground) +"c" = (/turf/template_noop,/area/lavaland/underground) +"d" = (/turf/open/floor/plating/asteroid/basalt/lava_land_surface,/area/lavaland/underground) +"e" = (/obj/effect/decal/remains/human,/turf/open/floor/plating/asteroid/basalt/lava_land_surface,/area/lavaland/underground) +"f" = (/turf/open/floor/plating/lava/smooth/lava_land_surface,/area/lavaland/underground) +"g" = (/turf/closed/indestructible/riveted{icon = 'icons/turf/walls/iron_wall.dmi'; icon_state = "iron"; name = "dense wall"},/area/ruin/powered) +"h" = (/obj/structure/table,/turf/open/floor/plasteel/black{baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface},/area/ruin/powered) +"i" = (/turf/open/floor/plasteel/black{baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface},/area/ruin/powered) +"j" = (/mob/living/simple_animal/hostile/skeleton,/turf/open/floor/plasteel/black{baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface},/area/ruin/powered) +"k" = (/obj/structure/bodycontainer/morgue{desc = "An oddly modernized tomb, at least compared to where it currently is."; name = "tomb"},/obj/effect/mob_spawn/human/skeleton,/turf/open/floor/plasteel/black{baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface},/area/ruin/powered) +"l" = (/obj/item/weapon/grown/bananapeel,/obj/structure/mineral_door/transparent/diamond,/turf/open/floor/vault{baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface},/area/ruin/powered) +"m" = (/obj/item/weapon/ore/diamond,/turf/open/floor/plasteel/black{baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface},/area/ruin/powered) +"n" = (/turf/open/floor/vault{baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface},/area/ruin/powered) +"o" = (/obj/item/weapon/ore/gold,/turf/open/floor/plasteel/black{baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface},/area/ruin/powered) +"p" = (/turf/open/floor/plating/lava/smooth/lava_land_surface{initial_gas_mix = "o2=22;n2=82;TEMP=293.15"},/area/ruin/powered) +"q" = (/obj/structure/table,/obj/item/weapon/tome,/turf/open/floor/plasteel/black{baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface},/area/ruin/powered) +"r" = (/obj/item/weapon/grown/bananapeel,/obj/structure/mineral_door/silver,/turf/open/floor/vault{baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface},/area/ruin/powered) +"s" = (/obj/item/weapon/ore/bananium,/turf/open/floor/plasteel/black{baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface},/area/ruin/powered) +"t" = (/obj/item/weapon/grown/bananapeel,/obj/structure/mineral_door/gold,/turf/open/floor/vault{baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface},/area/ruin/powered) +"u" = (/obj/structure/table/optable/abductor{desc = "A strange, alien-like table for cutting up things, like people."; name = "strange alien slab"},/obj/effect/gibspawner/human,/obj/effect/mob_spawn/human/skeleton,/obj/item/weapon/veilrender/honkrender,/obj/item/clothing/mask/gas/clown_hat,/turf/open/floor/vault{baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface},/area/ruin/powered) +"v" = (/obj/structure/table,/obj/item/weapon/spellbook/oneuse/charge,/turf/open/floor/plasteel/black{baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface},/area/ruin/powered) +"w" = (/obj/structure/bodycontainer/morgue{desc = "An oddly modernized tomb, at least compared to where it currently is."; name = "tomb"},/obj/effect/mob_spawn/human/skeleton{helmet = /obj/item/clothing/head/ushanka; name = "russian remains"; uniform = /obj/item/clothing/under/soviet},/turf/open/floor/plasteel/black{baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface},/area/ruin/powered) +"x" = (/obj/item/weapon/ore/uranium,/turf/open/floor/plasteel/black{baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface},/area/ruin/powered) +"y" = (/obj/item/weapon/ore/plasma,/turf/open/floor/plasteel/black{baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface},/area/ruin/powered) +"z" = (/obj/item/weapon/grown/bananapeel,/obj/structure/mineral_door/iron,/turf/open/floor/vault{baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface},/area/ruin/powered) +"A" = (/obj/structure/table,/obj/item/weapon/twohanded/spear,/obj/item/weapon/shield/riot/buckler,/turf/open/floor/plasteel/black{baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface},/area/ruin/powered) +"B" = (/obj/item/weapon/grown/bananapeel,/obj/structure/mineral_door/iron,/turf/open/floor/plasteel/black{baseturf = /turf/open/floor/plating/lava/smooth/lava_land_surface},/area/ruin/powered) (1,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -b -b -b -a -a -a -a -a -a -a -a -a -a -a -"} -(2,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -b -d -d -e -d -b -b -d -a -a -a -a -a -a -"} -(3,1,1) = {" -a -a -a -a -a -a -a -a -d -b -b -b -e -b -b -b -b -b -e -d -d -a -a -a -a -"} -(4,1,1) = {" -a -a -a -b -a -e -d -d -b -g -g -g -g -g -g -g -g -g -b -f -f -d -a -a -a -"} -(5,1,1) = {" -a -a -a -b -b -d -d -e -b -g -k -h -j -k -j -v -w -g -b -b -f -d -a -a -a -"} -(6,1,1) = {" -a -a -b -b -b -d -f -b -g -g -j -i -i -i -i -i -j -g -b -f -f -e -d -a -a -"} -(7,1,1) = {" -a -a -b -b -b -e -b -g -g -g -g -g -r -g -r -g -g -g -g -e -b -b -b -a -a -"} -(8,1,1) = {" -a -b -b -b -g -g -g -g -g -m -n -n -n -i -n -n -n -x -g -g -b -b -b -b -b -"} -(9,1,1) = {" -a -b -b -b -g -h -i -j -g -n -m -n -n -i -n -n -x -n -g -g -g -g -g -b -b -"} -(10,1,1) = {" -a -a -b -b -g -i -k -i -g -n -i -p -p -i -p -p -i -n -g -A -A -A -g -b -b -"} -(11,1,1) = {" -a -a -c -d -g -i -i -i -g -n -p -i -p -i -p -i -p -n -g -i -i -i -g -b -b -"} -(12,1,1) = {" -a -a -b -e -g -j -i -i -l -n -p -p -n -s -n -p -p -n -z -i -j -i -B -b -b -"} -(13,1,1) = {" -a -a -b -b -g -i -k -i -g -i -i -i -s -u -s -i -i -i -g -i -i -i -g -d -d -"} -(14,1,1) = {" -a -a -b -b -g -j -i -i -l -n -p -p -n -s -n -p -p -n -z -i -j -i -B -b -b -"} -(15,1,1) = {" -a -a -b -b -g -i -i -i -g -n -p -i -p -i -p -i -p -n -g -i -i -i -g -b -b -"} -(16,1,1) = {" -a -a -b -e -g -i -k -i -g -n -i -p -p -i -p -p -i -n -g -A -A -A -g -b -b -"} -(17,1,1) = {" -a -a -b -d -g -h -i -j -g -n -o -n -n -i -n -n -y -n -g -g -g -g -g -b -b -"} -(18,1,1) = {" -a -a -b -f -g -g -g -g -g -o -n -n -n -i -n -n -n -y -g -g -b -e -b -b -b -"} -(19,1,1) = {" -a -a -b -d -b -b -d -g -g -g -g -g -t -g -t -g -g -g -g -b -e -d -d -d -d -"} -(20,1,1) = {" -a -a -a -a -b -b -e -d -g -g -k -q -i -k -i -h -k -g -b -b -d -f -d -a -a -"} -(21,1,1) = {" -a -a -a -a -a -b -b -e -d -g -j -i -j -i -j -i -j -g -b -e -d -a -a -a -a -"} -(22,1,1) = {" -a -a -a -a -a -b -b -b -d -g -g -g -g -g -g -g -g -g -b -b -b -a -a -a -a -"} -(23,1,1) = {" -a -a -a -a -a -d -b -b -f -b -b -b -b -b -e -f -b -b -b -b -b -a -a -a -a -"} -(24,1,1) = {" -a -a -a -a -a -a -a -a -a -b -b -d -e -b -b -d -d -b -b -a -a -a -a -a -a -"} -(25,1,1) = {" -a -a -a -a -a -a -a -a -a -a -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a +aaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaabbaaaaaaaaaaaaaaaa +aaaaabbbbbcbbbbbbbbaaaaaa +aaabbbbbbbdebbbedfdaaaaaa +aaaabbbgggggggggggbbaaaaa +aaaeddeghiijijiihgbbbbdaa +aaaddfbgikiikiikigdebbbaa +aaadebggjiiiiiiijggdebbaa +aadbbgggggglglggggggddfaa +aabggggmnnnninnnnoggggbba +aabgkjgnmippippiongkjgbbb +bbbghignnpipipipnngqigbda +bdegjirnnppnsnppnntijgbea +bdbgkigiiiisusiiiigkigbba +aebgjirnnppnsnppnntijgeba +adbgvignnpipipipnnghigfda +abbgwjgnxippippiyngkjgbda +abbggggxnnnninnnnyggggbba +adebbbgggggzgzgggggbbbbba +aadfbfeggAiiiiiAggbbebbaa +aadfffbbgAijijiAgbeddbbaa +aaaddebbgAiiiiiAgedfaaaaa +aaaaadbbgggBgBgggbddaaaaa +aaaaaaabbbbbdbbbbbdaaaaaa +aaaaaaabbbbbdbbbbbdaaaaaa "} diff --git a/_maps/RandomRuins/LavaRuins/lavaland_surface_ww_vault.dmm b/_maps/RandomRuins/LavaRuins/lavaland_surface_ww_vault.dmm index 5b72242656..f0bf959447 100644 --- a/_maps/RandomRuins/LavaRuins/lavaland_surface_ww_vault.dmm +++ b/_maps/RandomRuins/LavaRuins/lavaland_surface_ww_vault.dmm @@ -1,10005 +1,118 @@ -//MAP CONVERTED BY dmm2tgm.py THIS HEADER COMMENT PREVENTS RECONVERSION, DO NOT REMOVE -"a" = ( -/turf/template_noop, -/area/template_noop) -"b" = ( -/turf/closed/indestructible, -/area/ruin/powered) -"c" = ( -/turf/open/floor/engine/cult, -/area/ruin/powered) -"d" = ( -/obj/structure/cult/pylon, -/turf/open/floor/engine/cult, -/area/ruin/powered) -"e" = ( -/turf/open/floor/plating{ - icon_state = "cultdamage5" - }, -/area/ruin/powered) -"f" = ( -/mob/living/simple_animal/hostile/faithless, -/turf/open/floor/engine/cult, -/area/ruin/powered) -"g" = ( -/turf/open/floor/plasteel/circuit/off, -/area/ruin/powered) -"h" = ( -/turf/closed/indestructible{ - desc = "The patterns engraved on the wall seem to shift as you try to focus on them. You feel sick."; - icon = 'icons/turf/walls/cult_wall.dmi'; - icon_state = "cult" - }, -/area/ruin/powered) -"i" = ( -/turf/open/floor/plating{ - icon_state = "cultdamage3" - }, -/area/ruin/powered) -"j" = ( -/turf/open/floor/plating{ - icon_state = "cultdamage6" - }, -/area/ruin/powered) -"k" = ( -/obj/effect/gateway, -/turf/open/floor/engine/cult, -/area/ruin/powered) -"l" = ( -/mob/living/simple_animal/hostile/faithless, -/turf/open/floor/plasteel/circuit/off, -/area/ruin/powered) -"m" = ( -/obj/machinery/wish_granter_dark, -/turf/open/floor/plasteel/circuit/gcircuit/off, -/area/ruin/powered) -"n" = ( -/turf/open/floor/plasteel/circuit/gcircuit/off, -/area/ruin/powered) -"o" = ( -/obj/structure/cult/pylon, -/turf/open/floor/plasteel/circuit/gcircuit/off, -/area/ruin/powered) -"p" = ( -/obj/structure/signpost, -/turf/open/floor/plasteel/circuit/gcircuit/off, -/area/ruin/powered) -"q" = ( -/obj/effect/meatgrinder, -/turf/open/floor/plasteel/circuit/gcircuit/off, -/area/ruin/powered) -"r" = ( -/obj/structure/cult/pylon, -/turf/open/floor/plasteel/circuit/off, -/area/ruin/powered) -"s" = ( -/turf/open/floor/engine/cult{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"t" = ( -/turf/open/floor/plating{ - icon_state = "cultdamage2" - }, -/area/ruin/powered) -"u" = ( -/turf/open/floor/carpet, -/area/ruin/powered) -"v" = ( -/mob/living/simple_animal/hostile/faithless, -/turf/open/floor/carpet, -/area/ruin/powered) -"w" = ( -/obj/machinery/door/airlock/vault{ - locked = 1 - }, -/turf/open/floor/engine/cult, -/area/ruin/powered) -"x" = ( -/obj/structure/cult/pylon, -/turf/open/floor/engine/cult{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"y" = ( -/mob/living/simple_animal/hostile/faithless, -/turf/open/floor/engine/cult{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"z" = ( -/turf/template_noop, -/turf/closed/indestructible{ - desc = "The patterns engraved on the wall seem to shift as you try to focus on them. You feel sick."; - icon = 'icons/turf/walls/cult_wall.dmi'; - icon_state = "cult" - }, -/area/ruin/powered) -"A" = ( -/mob/living/simple_animal/hostile/faithless, -/turf/template_noop, -/area/template_noop) -"B" = ( -/obj/effect/mob_spawn/human/miner/rig, -/turf/open/floor/engine/cult{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/ruin/powered) -"C" = ( -/obj/machinery/door/airlock/vault{ - locked = 1 - }, -/turf/open/floor/engine/cult{ - baseturf = /turf/open/floor/plating/lava/smooth; - blocks_air = 1 - }, -/area/ruin/powered) -"D" = ( -/turf/open/floor/engine/cult{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/template_noop) -"E" = ( -/turf/closed/indestructible, -/area/template_noop) -"F" = ( -/obj/item/weapon/paper{ - info = "meat grinder requires sacri" - }, -/turf/open/floor/engine/cult{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/template_noop) -"G" = ( -/obj/effect/mob_spawn/human/syndicatecommando, -/turf/open/floor/engine/cult{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/template_noop) -"H" = ( -/mob/living/simple_animal/hostile/faithless, -/turf/open/floor/engine/cult{ - baseturf = /turf/open/floor/plating/lava/smooth - }, -/area/template_noop) +"a" = (/turf/template_noop,/area/template_noop) +"b" = (/turf/closed/indestructible,/area/ruin/powered) +"c" = (/turf/open/floor/engine/cult,/area/ruin/powered) +"d" = (/obj/structure/cult/pylon,/turf/open/floor/engine/cult,/area/ruin/powered) +"e" = (/turf/open/floor/plating{icon_state = "cultdamage5"},/area/ruin/powered) +"f" = (/mob/living/simple_animal/hostile/faithless,/turf/open/floor/engine/cult,/area/ruin/powered) +"g" = (/turf/open/floor/plasteel/circuit/off,/area/ruin/powered) +"h" = (/turf/closed/indestructible{desc = "The patterns engraved on the wall seem to shift as you try to focus on them. You feel sick."; icon = 'icons/turf/walls/cult_wall.dmi'; icon_state = "cult"},/area/ruin/powered) +"i" = (/turf/open/floor/plating{icon_state = "cultdamage3"},/area/ruin/powered) +"j" = (/turf/open/floor/plating{icon_state = "cultdamage6"},/area/ruin/powered) +"k" = (/obj/effect/gateway,/turf/open/floor/engine/cult,/area/ruin/powered) +"l" = (/mob/living/simple_animal/hostile/faithless,/turf/open/floor/plasteel/circuit/off,/area/ruin/powered) +"m" = (/obj/machinery/wish_granter_dark,/turf/open/floor/plasteel/circuit/gcircuit/off,/area/ruin/powered) +"n" = (/turf/open/floor/plasteel/circuit/gcircuit/off,/area/ruin/powered) +"o" = (/obj/structure/cult/pylon,/turf/open/floor/plasteel/circuit/gcircuit/off,/area/ruin/powered) +"p" = (/obj/structure/signpost,/turf/open/floor/plasteel/circuit/gcircuit/off,/area/ruin/powered) +"q" = (/obj/effect/meatgrinder,/turf/open/floor/plasteel/circuit/gcircuit/off,/area/ruin/powered) +"r" = (/obj/structure/cult/pylon,/turf/open/floor/plasteel/circuit/off,/area/ruin/powered) +"s" = (/turf/open/floor/engine/cult{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"t" = (/turf/open/floor/plating{icon_state = "cultdamage2"},/area/ruin/powered) +"u" = (/turf/open/floor/carpet,/area/ruin/powered) +"v" = (/mob/living/simple_animal/hostile/faithless,/turf/open/floor/carpet,/area/ruin/powered) +"w" = (/obj/machinery/door/airlock/vault{locked = 1},/turf/open/floor/engine/cult,/area/ruin/powered) +"x" = (/obj/structure/cult/pylon,/turf/open/floor/engine/cult{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"y" = (/mob/living/simple_animal/hostile/faithless,/turf/open/floor/engine/cult{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"z" = (/turf/template_noop,/turf/closed/indestructible{desc = "The patterns engraved on the wall seem to shift as you try to focus on them. You feel sick."; icon = 'icons/turf/walls/cult_wall.dmi'; icon_state = "cult"},/area/ruin/powered) +"A" = (/mob/living/simple_animal/hostile/faithless,/turf/template_noop,/area/template_noop) +"B" = (/obj/effect/mob_spawn/human/miner/rig,/turf/open/floor/engine/cult{baseturf = /turf/open/floor/plating/lava/smooth},/area/ruin/powered) +"C" = (/obj/machinery/door/airlock/vault{locked = 1},/turf/open/floor/engine/cult{baseturf = /turf/open/floor/plating/lava/smooth; blocks_air = 1},/area/ruin/powered) +"D" = (/turf/closed/indestructible,/area/template_noop) +"E" = (/obj/item/weapon/paper{info = "meat grinder requires sacri"},/turf/open/floor/engine/cult{baseturf = /turf/open/floor/plating/lava/smooth},/area/template_noop) +"F" = (/turf/open/floor/engine/cult{baseturf = /turf/open/floor/plating/lava/smooth},/area/template_noop) +"G" = (/obj/effect/mob_spawn/human/syndicatecommando,/turf/open/floor/engine/cult{baseturf = /turf/open/floor/plating/lava/smooth},/area/template_noop) +"H" = (/mob/living/simple_animal/hostile/faithless,/turf/open/floor/engine/cult{baseturf = /turf/open/floor/plating/lava/smooth},/area/template_noop) +"I" = (/obj/machinery/door/airlock/vault,/obj/structure/fans/tiny/invisible,/turf/open/floor/engine/cult{baseturf = /turf/open/floor/plating/lava/smooth},/area/template_noop) (1,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(2,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(3,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -b -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(4,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -b -b -a -a -a -a -a -a -a -a -a -b -b -s -s -s -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(5,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -b -c -c -b -b -a -a -a -a -a -a -a -a -b -s -s -h -s -s -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(6,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -c -c -c -c -c -b -b -a -a -a -a -a -a -a -b -s -h -h -h -s -b -b -b -b -b -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(7,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -c -c -c -c -c -c -b -b -a -a -a -a -a -a -b -s -s -h -h -s -s -s -s -s -s -h -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(8,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -c -c -h -h -c -c -b -b -a -a -a -a -a -b -b -s -s -h -h -h -h -h -h -c -h -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(9,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -f -c -h -c -c -c -b -b -b -b -b -b -b -b -h -s -h -z -s -s -s -s -s -h -s -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(10,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -h -h -c -c -c -c -h -s -s -s -s -h -s -y -h -s -y -h -h -h -h -h -s -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(11,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -b -c -f -c -d -h -c -c -f -c -h -s -s -h -s -h -y -s -h -y -h -h -s -s -s -h -s -s -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(12,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -b -b -b -c -h -c -c -c -h -h -c -f -f -c -h -s -s -h -s -h -s -y -h -s -s -s -s -s -s -h -s -s -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(13,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -b -c -c -c -c -c -h -c -c -h -h -h -h -c -c -f -h -s -s -h -s -s -s -x -h -s -x -s -s -s -s -h -s -s -b -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(14,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -c -c -c -c -c -c -h -h -c -h -c -c -h -c -c -c -h -h -s -h -s -s -s -s -h -s -s -s -h -s -s -h -s -s -b -s -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(15,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -h -c -c -c -c -c -c -c -h -c -h -c -f -h -h -c -c -c -h -s -h -h -h -h -h -h -s -s -s -h -s -s -h -s -s -s -s -s -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(16,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -c -h -c -c -c -h -h -c -c -h -c -h -c -c -c -h -d -c -c -h -s -c -c -c -c -c -h -h -h -h -h -s -s -h -s -x -s -s -s -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(17,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -b -c -c -h -h -c -c -c -h -c -c -h -c -h -h -c -c -h -h -c -h -h -s -h -c -c -c -c -c -d -c -h -s -s -s -h -s -s -s -s -s -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(18,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -b -c -c -c -c -c -h -c -c -c -h -d -c -h -c -c -h -c -c -c -c -c -h -s -s -h -h -h -f -f -c -c -c -h -s -s -s -h -s -s -s -s -s -s -b -a -a -a -a -a -a -D -a -a -a -a -a -a -a -"} -(19,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -c -c -h -h -c -c -h -c -c -h -c -c -h -h -h -c -c -c -h -s -s -s -s -h -h -h -c -c -c -h -s -s -y -h -s -x -s -s -s -s -b -D -D -D -a -a -a -D -a -a -a -a -a -a -a -"} -(20,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -c -c -c -h -d -c -c -c -h -c -c -h -c -c -h -c -c -c -c -h -h -c -c -h -h -s -s -s -s -s -h -h -c -c -h -s -y -s -w -s -s -s -s -s -s -b -a -a -D -D -D -D -a -a -a -a -a -a -a -a -"} -(21,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -h -c -c -c -h -h -c -f -c -h -c -c -h -c -c -h -d -c -c -c -c -h -h -c -c -h -h -s -s -s -s -s -h -c -c -h -s -s -s -w -s -s -s -s -s -s -b -a -a -a -D -a -a -a -a -a -a -a -a -a -a -"} -(22,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -h -h -h -c -c -h -c -c -c -h -f -c -h -c -c -h -h -c -c -h -c -c -h -c -c -c -h -h -h -x -s -s -h -c -c -h -s -s -s -h -s -x -s -s -s -s -b -D -D -a -a -a -a -a -a -a -a -a -a -a -a -"} -(23,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -h -h -c -c -h -f -c -c -h -c -c -h -c -c -c -h -c -c -h -c -c -h -h -c -c -c -f -h -h -s -s -h -c -c -h -h -h -h -h -s -s -s -s -s -s -b -a -D -D -a -a -a -a -a -a -a -a -a -a -a -"} -(24,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -h -h -c -c -h -c -c -c -h -f -c -h -c -c -c -h -c -c -h -f -c -c -h -h -c -f -c -c -h -h -s -h -c -c -c -c -s -s -h -s -s -s -s -s -s -b -D -D -D -D -a -A -a -a -a -a -a -a -a -a -"} -(25,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -h -c -c -h -c -c -c -h -c -c -h -h -c -c -h -c -c -h -h -c -c -c -h -c -s -s -s -s -h -s -h -h -c -c -c -s -s -h -s -x -B -s -s -s -b -a -D -D -D -a -a -a -a -a -a -a -a -a -a -"} -(26,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -h -c -h -c -f -h -c -c -c -h -c -c -c -h -c -c -h -c -c -c -h -c -f -c -h -h -s -s -s -s -c -s -s -h -c -c -c -s -s -h -s -s -s -s -s -s -b -D -D -D -D -D -D -D -D -a -a -a -a -a -a -"} -(27,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -h -c -f -c -c -h -c -c -h -h -c -c -c -h -c -c -h -h -c -c -h -h -h -h -h -h -s -s -s -s -c -s -h -h -h -h -h -s -s -h -s -s -y -s -s -s -b -a -a -a -a -a -a -a -a -D -D -a -a -a -a -"} -(28,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -h -h -c -c -f -h -c -c -h -d -c -c -c -h -c -c -c -h -h -c -c -c -c -c -c -h -h -s -s -s -h -h -h -s -s -s -s -s -s -h -s -x -s -s -s -s -b -a -a -a -a -a -a -a -a -D -a -a -a -a -a -"} -(29,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -h -d -c -c -h -c -c -h -c -c -c -c -h -h -d -c -c -h -h -h -h -c -c -c -c -h -h -h -h -h -s -s -s -s -s -s -s -s -h -s -s -s -s -s -s -b -E -E -E -E -a -a -a -a -a -a -a -a -a -a -"} -(30,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -h -h -h -h -h -h -c -c -c -c -c -c -c -c -h -h -c -c -c -c -c -h -h -h -c -c -c -h -s -s -s -s -s -s -s -s -x -s -s -h -s -s -s -s -s -s -C -F -G -D -D -D -D -D -a -a -a -a -a -a -a -"} -(31,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -c -h -c -c -c -c -c -c -h -h -h -h -c -f -c -c -c -c -d -h -c -f -c -h -s -s -s -s -s -s -h -h -h -s -s -h -s -x -s -s -s -s -C -D -D -D -H -D -D -a -a -a -a -a -a -a -a -"} -(32,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -h -h -h -c -c -h -h -h -c -c -c -h -h -c -c -c -c -c -c -c -c -c -c -h -c -c -h -h -s -s -s -s -h -h -h -s -h -s -s -h -s -s -s -s -s -s -b -E -E -E -E -a -a -D -a -a -a -a -a -a -a -"} -(33,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -c -h -h -c -c -c -h -h -h -c -h -c -c -h -h -h -h -h -h -h -c -c -h -c -c -h -s -s -s -s -h -h -x -s -s -h -s -s -h -s -s -s -s -s -s -b -a -a -a -a -a -a -D -D -a -a -a -a -a -a -"} -(34,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -h -c -c -c -c -d -h -h -h -c -c -h -c -f -f -c -c -h -c -c -c -c -c -h -h -s -s -s -h -s -s -y -s -h -s -s -h -s -x -s -s -s -s -b -a -a -a -a -a -a -D -D -a -a -a -a -a -a -"} -(35,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -h -h -c -c -c -c -c -c -h -c -c -h -f -c -f -f -c -h -h -c -c -c -c -c -h -s -s -s -s -s -s -s -s -h -s -s -h -s -s -s -s -s -s -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(36,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -h -c -c -c -c -c -c -h -c -c -h -h -h -h -c -f -c -h -c -c -c -c -c -h -s -s -s -s -s -s -h -h -h -s -s -h -s -s -s -s -s -s -b -D -D -a -a -a -a -a -a -a -D -a -a -a -a -"} -(37,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -h -c -c -c -c -c -c -h -c -c -c -c -d -h -c -c -c -h -h -h -h -h -h -h -h -s -s -c -s -h -h -s -s -s -s -h -s -x -s -s -s -b -b -a -D -a -a -a -a -a -a -a -a -a -a -a -a -"} -(38,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -h -h -c -c -c -c -c -h -c -c -c -c -c -h -h -c -c -c -c -c -c -c -c -c -h -h -s -h -h -h -s -s -s -s -y -h -s -s -s -b -b -b -a -a -D -a -a -a -a -a -a -a -a -a -a -a -a -"} -(39,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -c -c -c -c -h -h -c -c -c -c -h -h -c -c -c -c -c -h -h -c -c -c -c -c -c -c -c -c -h -h -h -s -s -s -s -s -s -s -h -s -s -b -a -a -a -a -a -D -a -a -a -a -a -a -a -a -a -a -a -a -"} -(40,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -c -c -f -f -c -c -h -h -c -c -c -c -h -c -c -c -c -c -c -h -h -h -h -h -h -d -c -c -c -c -c -c -s -s -s -s -s -s -s -b -b -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(41,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -h -h -c -c -c -c -c -c -c -h -c -c -c -c -h -h -h -h -h -c -f -c -c -c -h -c -c -c -c -c -c -c -c -c -s -s -s -s -s -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(42,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -h -c -c -c -d -h -h -c -c -h -h -c -f -c -c -c -c -h -c -c -c -c -f -h -h -c -c -c -h -h -h -h -h -c -s -s -s -s -s -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(43,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -c -h -h -c -c -c -h -h -c -c -c -h -h -h -c -c -f -c -h -c -c -h -h -h -h -c -c -c -c -h -f -c -c -h -h -h -h -h -h -h -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(44,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -c -c -c -h -h -c -c -h -h -c -c -c -c -d -h -c -c -c -c -h -c -c -h -c -c -c -c -c -c -c -h -c -f -c -c -c -h -h -c -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(45,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -h -h -c -c -h -h -h -c -c -c -h -h -h -d -c -h -c -c -h -c -c -c -h -h -h -h -h -f -c -c -c -c -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(46,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -b -b -c -c -c -c -c -c -h -h -c -c -c -h -h -h -c -c -c -h -h -c -h -c -c -h -c -c -c -h -d -c -c -c -c -h -h -h -h -h -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(47,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -c -c -c -h -c -c -c -c -d -h -c -c -c -c -c -c -h -c -c -h -c -c -c -c -c -c -c -c -h -h -d -h -h -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(48,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -c -c -c -h -c -c -c -c -c -h -h -h -c -c -c -c -h -c -c -h -h -h -c -c -c -c -h -h -h -f -c -f -c -f -c -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(49,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -b -b -c -c -c -c -c -c -c -c -h -h -c -c -f -f -c -c -h -h -h -h -h -h -c -c -c -f -h -h -h -h -h -h -c -c -c -c -c -c -c -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(50,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -c -c -c -c -c -h -h -h -c -c -c -c -c -c -c -c -d -h -h -c -c -c -c -c -c -c -c -c -c -c -c -h -h -h -h -h -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(51,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -i -c -c -c -c -c -c -h -h -h -c -c -c -c -c -c -c -c -h -h -d -c -c -f -c -c -c -c -c -c -c -h -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(52,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -f -c -c -c -d -c -c -c -c -h -c -c -c -c -c -c -c -c -c -h -h -h -h -c -c -c -c -c -c -c -h -h -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(53,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -c -c -c -c -c -c -c -c -c -h -h -h -h -h -h -c -c -c -c -c -c -c -h -h -c -c -c -h -h -h -h -f -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(54,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -h -h -h -c -c -c -f -f -c -h -h -h -h -h -d -c -f -c -c -h -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(55,1,1) = {" -a -a -a -a -a -a -a -a -a -a -b -b -c -c -c -c -c -c -c -j -c -c -c -f -c -c -c -c -c -c -c -c -c -h -h -h -c -c -c -c -c -c -c -c -c -c -c -c -c -f -h -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(56,1,1) = {" -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -d -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -h -h -h -h -c -c -c -c -c -c -c -c -c -h -h -h -c -f -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(57,1,1) = {" -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -c -c -c -c -c -c -e -c -c -f -c -c -c -c -c -c -c -c -c -c -c -c -h -h -c -c -c -c -c -h -h -h -h -d -c -c -f -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(58,1,1) = {" -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -i -c -c -j -c -c -c -c -c -c -c -c -c -h -h -h -h -h -h -h -c -c -c -c -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(59,1,1) = {" -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -c -c -c -c -c -k -c -c -c -c -c -c -s -s -s -c -k -c -c -c -c -c -c -c -c -c -c -c -c -h -c -c -c -c -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(60,1,1) = {" -a -a -a -a -a -a -a -a -a -a -b -b -c -c -c -c -e -c -c -c -c -c -c -c -c -c -c -c -c -c -f -c -c -c -c -c -c -c -c -c -c -c -c -c -c -h -w -w -h -h -h -h -h -h -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(61,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -c -f -c -c -c -c -c -c -c -j -c -c -c -c -c -i -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(62,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -c -c -c -c -c -c -d -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -f -c -c -c -d -u -u -u -u -d -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(63,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -f -c -c -c -c -c -c -c -c -c -c -f -c -d -c -c -f -c -c -c -c -c -c -c -c -c -c -c -c -v -u -u -u -c -c -f -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(64,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -b -b -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -j -c -f -c -c -c -c -c -c -u -u -u -u -c -f -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(65,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -b -b -c -c -c -c -e -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -u -u -v -u -c -c -c -c -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(66,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -c -c -c -j -c -c -f -c -c -c -c -c -e -c -c -c -c -i -c -c -c -c -c -c -f -c -u -u -u -u -c -c -c -c -c -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(67,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -c -c -c -c -c -c -c -c -j -c -c -c -c -c -c -c -c -c -c -c -f -c -k -c -c -d -u -u -u -u -d -c -c -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(68,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -u -u -u -u -c -c -c -c -c -c -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(69,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -k -c -c -f -c -c -c -c -c -c -c -c -f -c -c -c -c -c -d -c -c -c -c -c -c -c -u -u -u -v -c -c -c -c -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(70,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -u -u -u -u -c -c -c -c -c -k -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(71,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -c -c -c -c -d -c -c -c -c -c -c -c -c -c -c -c -i -c -c -c -c -c -c -f -c -c -u -u -u -u -c -i -c -c -c -c -c -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(72,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -i -c -c -c -c -c -c -c -c -e -c -c -c -c -i -c -c -c -c -c -c -c -c -c -c -c -c -d -u -u -u -u -d -c -c -c -c -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(73,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -c -c -f -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -j -c -c -c -c -c -c -c -c -u -u -u -u -c -c -c -c -c -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(74,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -g -g -c -c -c -c -c -f -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -f -c -u -v -u -u -c -c -c -c -f -c -f -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(75,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -c -g -g -g -c -c -c -c -c -c -c -c -f -c -c -c -f -c -c -i -c -c -c -c -c -u -u -u -u -c -c -c -c -c -c -c -c -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(76,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -c -c -c -g -c -c -i -c -g -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -u -u -u -u -c -c -c -c -c -c -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(77,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -g -c -c -c -c -c -l -c -c -c -c -g -g -c -f -c -c -c -c -c -c -c -c -c -c -c -c -c -d -u -u -u -u -d -c -c -c -c -c -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(78,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -g -c -c -c -c -g -c -c -c -c -g -c -c -c -c -c -c -c -d -c -c -c -c -c -c -c -c -c -u -u -u -u -c -c -c -c -c -c -c -c -b -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(79,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -g -g -k -c -c -g -c -c -c -g -c -c -c -c -c -c -c -c -c -c -c -c -c -c -f -c -c -c -v -u -u -u -c -c -f -c -c -c -b -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(80,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -g -c -c -c -g -c -c -c -g -c -c -c -c -c -t -c -c -c -c -c -f -c -c -c -c -c -c -u -u -u -u -c -c -c -c -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(81,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -g -g -c -g -c -c -c -f -g -c -c -d -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -u -u -u -u -c -c -c -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(82,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -g -c -g -c -g -c -c -c -g -c -c -c -c -c -f -j -c -c -c -c -c -c -c -f -c -d -u -u -u -u -d -c -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(83,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -g -c -g -c -g -c -c -c -g -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(84,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -c -c -c -g -c -g -c -c -g -c -g -g -c -g -g -c -c -c -c -c -g -f -c -c -k -c -c -c -c -c -c -c -c -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(85,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -l -g -g -c -c -g -c -g -c -c -g -c -c -c -c -g -g -g -c -c -c -c -c -c -c -c -c -f -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(86,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -g -g -g -d -g -c -g -c -g -g -c -f -c -c -g -c -c -c -c -c -c -c -c -j -c -c -c -c -k -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(87,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -c -c -c -g -c -g -g -g -g -g -k -g -c -c -c -c -g -g -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(88,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -g -c -g -g -g -g -c -c -g -c -c -c -g -g -c -c -f -c -c -c -c -d -c -c -c -c -c -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(89,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -g -g -i -c -g -f -g -c -c -c -c -g -c -c -c -g -c -c -c -c -c -c -c -c -c -c -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(90,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -g -g -g -c -g -g -g -g -g -c -g -g -r -c -g -g -c -c -c -c -c -c -c -c -c -c -c -c -c -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(91,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -i -c -g -g -g -c -g -g -g -c -g -c -g -g -c -g -g -c -c -c -f -c -c -c -c -j -c -c -c -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(92,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -g -g -l -g -g -g -g -g -c -g -g -g -c -g -g -c -c -g -g -c -c -c -c -c -c -c -c -f -c -c -c -c -b -b -a -a -a -a -A -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(93,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -c -c -c -g -g -g -g -c -g -c -g -l -g -c -g -g -c -c -g -g -c -f -c -c -c -c -c -c -c -c -c -c -c -c -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(94,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -g -g -g -c -d -g -c -g -g -c -g -g -g -g -g -g -c -c -c -c -c -c -c -c -f -c -c -c -c -d -c -c -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(95,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -g -g -g -g -c -c -g -g -l -g -g -g -g -g -g -f -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(96,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -g -g -g -c -c -g -g -g -g -g -g -f -g -c -c -c -g -c -c -c -c -c -c -c -e -c -c -c -c -c -c -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(97,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -g -g -g -c -g -g -g -g -g -c -g -g -c -g -g -g -c -c -c -g -g -g -c -c -c -c -c -c -j -c -c -c -c -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(98,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -g -g -g -g -c -g -g -g -g -g -g -g -c -g -l -g -g -g -g -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(99,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -g -g -i -b -b -g -b -b -g -g -g -g -g -g -g -l -g -c -c -c -c -c -g -c -c -c -c -k -c -c -c -c -c -c -j -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(100,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -d -g -g -b -g -g -g -b -g -g -g -g -g -c -c -g -g -g -g -g -g -g -g -c -c -c -c -c -f -c -j -c -c -c -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(101,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -b -b -g -b -g -b -b -g -g -g -g -l -g -g -c -c -c -c -c -f -c -c -c -c -c -c -c -c -c -c -c -f -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(102,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -c -c -c -b -g -c -g -g -g -b -g -g -g -g -g -g -g -g -g -g -g -c -c -c -c -c -c -d -c -c -c -c -c -c -c -c -c -f -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(103,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -b -g -g -g -g -g -b -g -g -g -c -c -c -c -d -c -c -g -g -g -c -c -c -c -c -c -c -c -c -c -c -d -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(104,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -b -c -d -g -r -c -b -c -c -g -g -g -c -c -c -c -c -c -c -c -c -c -c -c -c -j -c -c -c -c -c -c -c -c -f -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(105,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -b -b -b -b -b -n -b -b -b -b -b -c -d -g -g -g -g -c -c -f -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(106,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -b -p -n -n -n -n -n -n -n -n -b -c -c -c -c -c -g -c -c -c -c -c -c -f -c -f -c -c -c -c -f -c -c -j -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(107,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -b -n -n -n -n -n -n -n -n -n -b -c -c -c -f -c -c -c -c -c -k -c -c -c -c -c -c -f -c -c -c -c -c -c -c -f -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(108,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -n -n -n -n -n -n -o -n -n -b -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -e -c -c -c -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(109,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -b -n -n -n -n -n -b -b -b -b -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(110,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -b -n -n -n -n -b -b -b -b -b -b -b -b -b -b -b -b -b -b -b -b -b -b -c -c -c -c -d -c -c -c -c -c -c -c -f -c -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(111,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -n -n -n -b -b -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -b -b -c -c -c -c -c -c -c -f -c -c -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(112,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -b -n -b -b -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -f -c -c -c -c -f -c -c -c -c -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(113,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -n -q -n -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -c -c -c -c -c -b -b -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(114,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -n -n -b -n -o -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -c -c -c -b -b -b -b -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(115,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -o -n -n -n -n -n -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -b -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(116,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -n -n -n -n -n -n -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(117,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -n -n -n -n -n -n -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -A -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(118,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -m -n -n -n -n -n -n -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(119,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -n -n -n -o -n -n -n -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -"} -(120,1,1) = {" -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -b -b -b -b -b -b -b -b -b -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a -a +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaabbbbbbaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaabbbbbbbccccbbbbbaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaabbbbccccccccccccccbbaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaabbbccccccccccccccccccbbbbbbbbbaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaabbccccccccccccccccccccccccccccbbbbbbbbbbbbaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaabbccccccccccccdcccccccccccccccccccccccccccbbbbaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaabbccccccccccccccccceccfcccccccccccccgcccccccccbbbbbbbaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaabbbbbbbbbbbbaaaaaaabhhhcccccccifcccccccccccccccccccifccccggcccccccccccccbbbbbbbbbbaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaabbccccccccccbbaaaaabbhchhccccccccccccccccfcccecccccccccccccgggccccccccccccccccccccbbbbbbaaaaaaaaabbbb +aaaaaaaaaaaaaaaaabbbhhccchhhchchbbbbbbbcccchhcccccccccjccccccccccccckccccccccckcgggglcccccicccccccccccccbbbbbbaaabbbbmnb +aaaaaaaaaaaaaaaaabccchhhccchhhchcccccccccccchhcccccccccccccccccccccccccccgccccccccccggggcccgccgcccgdccccbbbbbbbbbbonnnnb +aaaaaaaaaaaaaaaabbccchhhhhfcdhchhccccccfcdccchhhhccdcccccckccccccccccccccggcccccggggggccggggggggccggccccbpnnbbbbbnnnnnnb +aaaaaaaaaaaaaaaabcccccccccccchcchhhccccfchhhcccchhcccccceccccccccjccfcccccgclgggcccccgggggglgggggcigbbbbbnnnnnnbnnnnnnob +aaaaaaaaaaaaaaabbcchhccccfcfchcccchhhhccchhhhcccchccccfccccccdccccccccdcccggcccccggccdggigggggggggbbbggcbnnnnnnnqbnnnnnb +aaaaaaaaaaaaaabbcccdhhhhhhhhhhhhccccchhccccchcccchhccccccccccccccccccccccccccccccccgggggcccggcccggbggcgdbnnnnnnbnnnnnnnb +aaaaaaaaaaaabbbcccccccfcccccccchcccccchhcccchhccfchcccccfccccccccfccccccccccccccfcccccggggggcdcccgggbgggnnnnnnbbbonnnnnb +aaaaaaaaaaaabbhhhcccfcccccccccchhcccccchhhccchdcfchhhcccciccjcccccccccceccciccgggccggggcfgggggggggbggggrbnnnnbbbbbbbbbbb +aaaaaaaaaaabbccchhhccccccchhhccchdccccccchhcchhhcccchcccccccccfcccjccccccfccggcccgggcckcggggccgggcbbbggcbnnobbbbaaaabbba +aaaaaaaaaaabcccccchhhhhhhhhdcccchhcccccccchdccchcccchcccccsccccccccccccccccggccccccccgggcgccgglgggggbbbbbnnnbbbaaaaaaaaa +aaaaaaaaaaabcccccccccfcfccccccccchcccccccfhhhcchhccchccccjscccdcccccccccccccccccdccgggcccggglggggggggggcbnnnbbaaaaaaaaaa +aaaaaaaaaaabccchccccccccccccccchhhhhhhhccccchccchccchcccccsfccccccccccccccccfccccccgcccccccggcgggggggggcbbbbbbaaaaaaaaaa +aaaaabbaaabbccchhhhhhhhhhccccchhcccccchhhccchhcchccchhccccccccccceccfccicccccccccccccfcccgggcgggcgggggggcccccbaaaaaaaaaa +aaaabbbbaabccccccdcccccchhhhhchccccccccchcfcdhcchcccchcccckcicfcccccccccccfcccctcccccccggggcgggfggggggcgdccccbaaaaaaaaaa +aaaabccbbbbhhhcccccccccccccchhhchhhhcccchccccccchdccchhccccccccccccccccccccccccccfccccggcrcggggggggclgcggccccbaaaaaaaaaa +aaabbcccccccchhhhhhhhhccccccdhhchcfhcccchhhhhhhhhhcccchccccccccccccccccccccccccccjccgggcccggcggccggcggccgcfccbaaaaaaaaaa +aaabccccfcfcccccccccdhhhhhhccccchfchdccchcccccccchhccchhcccccccccccccciccccccdccccccgccccggccgfcgclgggccgccccbaaaaaaaaaa +aaabccchcccchhhhhccccccccchhccfchffhhhcccccccccccchhccchcccccccjciccccccjcfccccccccggccfggccggccggggcgdcggcccbaaaaaaaaaa +aaabbcchhhdhhccchhhcccccccchhccchcfcchhcfchhhhhhccdhcfchccccccccccccdccccccccccccccfcccccccggccgglcgcgcccccccbaaaaaaaaaa +aaaabbccchhhhcfccchcchhhhccchccchccfcchhcchcccchfcchcfchhccccccfcccccccccccccccfcccccccccccgcccccgcgcgcccccccbaaaaaaaaaa +aaaaabbccccchhhccchhcccfhhhchccchhhcccchcfhcccchhcchhccchhccccccccfcccccccicccccccccccccccfcfccccgcgcggcfccccbaaaaaaaaaa +aaaaaabbcccfcchhhcchhccccchchhcccchhhcchchhccccchcfchhccchcccfccccccccccccccccccccckcccccccccccccgcgccgccckccbaaaaaaaaaa +aaaaaaabbcffcccdhccchhhccfhcchdccccchcchhhcchhcchcccchccchcccccccckcccccccccccfccccccccdccccccccggcgfcgccccccbaaaaaaaaaa +aaaaaaaabcccfccccccccchhcchcchhhhccchcchcccchdcchcccchccchccccccccccccfccccccccccfccccccccccccccgcggcccccccccbaaaaaaaaaa +aaaaaaaabhhhhhcchhhhccchhhhccccccccchcchcccchccchcccchccchcccccccfcccccccfcccccccccccjccccccccccgccccccccfcccbbaaaaaaaaa +aaaaaaaabsssshhhhsshhcccchhhccfccccchccdcccchcchhccchhccchcccdccccdccccdccccdccccdccccccccjcccccccccccccccccccbaaaaaaaaa +aaaaaaaabssssssssssshhcfssshhcchhhcchcccchhhhcchcccchdcchhhhcuvuuuuuuuuuuuuuuuvuuucccccccccccfcecccccccccfccccbaaaaaaaaa +aaaaaaaabshhhhhchhssshfcsssshhhhshhhhcccchfcfchhcccchccchccwcuuuuuuuuuuuuvuuuuuuuuccfccccccccccccccccdccccccccbbbbbaaaaa +aaabbbbbbssssshcchssshhcsssshssssssshhccchcfchhfccchhfcchccwcuuuvuuuuuuuuuuuuuuuuucccccccccfcccccckccccjccfcccccccbaaaaa +aabbsssbbhhhsshcchhssxhhsssshsssssssshhcchccchdcchhhfcchhcchcuuuuuuuvuuuuuuuuuuuuuccckcccccccccccccfcccccccccdcfccbaaaaa +aabsshsshsyssshccfhsssshhcchhssssssssshcchhcchhfchccccfhdcchcdccccdccccdccccdccccdccccccccccccccccccccccccccccccccbaaaaa +aabshhhssysyxshccfhhssssssshsssshhsschhccchcchhcchccchhhccchcccfcccccciccccccccccccbbbbccccccdccjccjcccccfcecccccbbaaaaa +aabsshhhhhhhhhhhccchhhhhhshhssshhsssshsssshhchcfchccccccccchccfcccccccccccccccfcccbbaabbbbcccccccccccccccccccccccbaaaaaa +aabbssshzsysssshdccccccchhhsssshxssshhsssshhccccchcccccffcchcccccccccccccccccccccbbaaaaaabbbcccccccccccccccccccccbaaaaaa +aaabbbshsyhsxsshcccccccccchssshhsyshhssssshcccccbbbbbbbbccchcccccccccccccfccccccbbaaaaaaaaabbcccccccfcdccjcccccfcbaaaaaa +aaaaabshshhsssshhhhhhhhccchssshsssshsssssshccccbbaaaaaabbbbbbbbbbcccckcccccccccbbaaaaaaaaaaabbccccjcccccccccccfccbaaaaaa +aaaaabshshssshhhsssssshccchssxhhhhhhsssssshbbbbbaaaaaaaaaaaaaaaabbcccccccfccccbbaaaaaaaaaaaaabbcccccccccccfcccccbbaaaaaa +aaaaabshshsssssssssysshssssssssssssssssscbbbaaaaaaaaaaaaaaaaaaaaabbbccccccccccbaaaaaaaaaaaaaaabbbccccfcfcccccfccbaaaaaaa +aaaaabscshssssssssyssshssssssssssssssyssbbaaaaaaaaaaaaaaaaaaaaaaaaabbbbccccccbbaaaaaaaaaaaaaaaaabbccccccccccccccbaaaaaaa +aaaaabhhhhhhhhhhhhhwwhhhhhhhhhhhhhhhhhhbbaaaaaaaaaaaaaaaaaaaaaaaaaaaaabbbbbccbaaaaaaaaaaaaaAaaaaabbbbbbbbbbbbbbbbaaaaaaa +aaaaabbbsssssssssssssssssssssssssssssssbaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaabbbbaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaabbaaaaaaaa +aaaaaaabbbsssssxssxssxssxssxssxssxssxssbaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaabbbbbssssssssssBsysssssssssssbbaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaabbbssssssssssssssssssssssssbaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaabbsssssssssssssssssssssssbaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaAaaa +aaaaaaaaaaaaabbbbsssssssssssssssssssbbaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaabbbbbbbbbbbbbbCCbbbbbbaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaDEFDaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaDGFDaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaDFFDaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaDFHDaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaDIIDaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa "} diff --git a/_maps/RandomRuins/SpaceRuins/deepstorage.dmm b/_maps/RandomRuins/SpaceRuins/deepstorage.dmm index 79bc72661d..4ef456676a 100644 --- a/_maps/RandomRuins/SpaceRuins/deepstorage.dmm +++ b/_maps/RandomRuins/SpaceRuins/deepstorage.dmm @@ -5,14 +5,14 @@ "ae" = (/obj/structure/closet/cardboard,/obj/item/weapon/storage/box/monkeycubes,/obj/item/weapon/storage/box/monkeycubes,/obj/item/weapon/storage/box/monkeycubes,/obj/item/weapon/storage/toolbox/drone,/obj/item/weapon/storage/toolbox/drone,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "af" = (/obj/structure/closet/cardboard,/obj/item/stack/sheet/cardboard,/obj/item/stack/cable_coil,/obj/item/stack/sheet/mineral/wood,/obj/item/stack/sheet/mineral/wood,/obj/item/stack/packageWrap,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "ag" = (/obj/structure/closet/cardboard,/obj/item/weapon/storage/box/mousetraps,/obj/item/weapon/storage/box/mousetraps,/obj/item/weapon/storage/box/drinkingglasses,/obj/item/weapon/storage/box/zipties,/obj/item/weapon/switchblade,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) -"ah" = (/obj/structure/closet/cardboard,/obj/item/stack/sheet/metal{amount = 50;pixel_x = 2;pixel_y = 2},/obj/item/stack/sheet/metal{amount = 50;pixel_x = 2;pixel_y = 2},/obj/item/stack/sheet/metal{amount = 50;pixel_x = 2;pixel_y = 2},/obj/item/stack/sheet/metal{amount = 50;pixel_x = 2;pixel_y = 2},/obj/item/stack/rods{amount = 50},/obj/item/stack/rods{amount = 50},/obj/item/stack/rods{amount = 50},/obj/item/stack/rods{amount = 50},/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) +"ah" = (/obj/structure/closet/cardboard,/obj/item/stack/sheet/metal{amount = 50; pixel_x = 2; pixel_y = 2},/obj/item/stack/sheet/metal{amount = 50; pixel_x = 2; pixel_y = 2},/obj/item/stack/sheet/metal{amount = 50; pixel_x = 2; pixel_y = 2},/obj/item/stack/sheet/metal{amount = 50; pixel_x = 2; pixel_y = 2},/obj/item/stack/rods{amount = 50},/obj/item/stack/rods{amount = 50},/obj/item/stack/rods{amount = 50},/obj/item/stack/rods{amount = 50},/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "ai" = (/obj/structure/closet/cardboard,/obj/item/stack/sheet/glass{amount = 50},/obj/item/stack/sheet/glass{amount = 50},/obj/item/stack/sheet/glass{amount = 50},/obj/item/stack/sheet/glass{amount = 50},/obj/item/stack/sheet/plasteel{amount = 10},/obj/item/stack/sheet/plasteel{amount = 10},/obj/item/stack/sheet/plasteel{amount = 10},/obj/item/stack/sheet/plasteel{amount = 10},/obj/item/clothing/shoes/combat,/obj/item/clothing/shoes/combat,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) -"aj" = (/obj/structure/closet/cardboard,/obj/machinery/light{icon_state = "tube1";dir = 8},/obj/item/device/flashlight/flare,/obj/item/device/flashlight/flare,/obj/item/device/flashlight/flare,/obj/item/device/flashlight/flare,/obj/item/device/flashlight/flare,/obj/item/device/flashlight/flare,/obj/item/device/flashlight,/obj/item/device/flashlight,/obj/item/device/flashlight,/obj/item/weapon/shovel,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) +"aj" = (/obj/structure/closet/cardboard,/obj/machinery/light{icon_state = "tube1"; dir = 8},/obj/item/device/flashlight/flare,/obj/item/device/flashlight/flare,/obj/item/device/flashlight/flare,/obj/item/device/flashlight/flare,/obj/item/device/flashlight/flare,/obj/item/device/flashlight/flare,/obj/item/device/flashlight,/obj/item/device/flashlight,/obj/item/device/flashlight,/obj/item/weapon/shovel,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "ak" = (/obj/structure/closet/cardboard,/obj/item/device/flashlight/lantern,/obj/item/device/flashlight/lantern,/obj/item/device/flashlight/lantern,/obj/item/device/tape/random,/obj/item/device/tape/random,/obj/item/device/tape/random,/obj/item/weapon/storage/box/rxglasses,/obj/item/weapon/extinguisher,/obj/item/weapon/extinguisher,/obj/item/clothing/glasses/night,/obj/item/clothing/glasses/night,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "al" = (/obj/structure/closet/cardboard,/obj/item/weapon/storage/box/syringes,/obj/item/weapon/storage/box/syringes,/obj/item/weapon/storage/box/beakers,/obj/item/weapon/storage/box/beakers,/obj/item/weapon/storage/box/matches,/obj/item/weapon/storage/box/bodybags,/obj/item/clothing/glasses/meson/engine,/obj/item/clothing/glasses/meson/engine,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "am" = (/obj/structure/closet/cardboard,/obj/item/weapon/kitchen/knife,/obj/item/weapon/kitchen/knife,/obj/item/weapon/cultivator,/obj/item/weapon/hatchet,/obj/item/weapon/kitchen/rollingpin,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "an" = (/obj/structure/closet/cardboard,/obj/item/weapon/defibrillator,/obj/item/weapon/storage/box/medipens,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) -"ao" = (/obj/structure/closet/cardboard,/obj/machinery/light{dir = 4;icon_state = "tube1"},/obj/item/ammo_box/c9mm,/obj/item/ammo_box/c9mm,/obj/item/ammo_box/c9mm,/obj/item/ammo_box/c9mm,/obj/item/ammo_box/c9mm,/obj/item/ammo_box/c9mm,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) +"ao" = (/obj/structure/closet/cardboard,/obj/machinery/light{dir = 4; icon_state = "tube1"},/obj/item/ammo_box/c9mm,/obj/item/ammo_box/c9mm,/obj/item/ammo_box/c9mm,/obj/item/ammo_box/c9mm,/obj/item/ammo_box/c9mm,/obj/item/ammo_box/c9mm,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "ap" = (/obj/structure/closet/crate/freezer,/obj/item/weapon/reagent_containers/blood/OMinus,/obj/item/weapon/reagent_containers/blood/OMinus,/obj/item/weapon/reagent_containers/blood/OMinus,/obj/item/weapon/reagent_containers/blood/OMinus,/obj/item/weapon/reagent_containers/blood/OMinus,/obj/item/weapon/reagent_containers/blood/random,/obj/item/weapon/reagent_containers/blood/random,/obj/item/weapon/reagent_containers/blood/random,/obj/item/weapon/reagent_containers/blood/random,/obj/item/weapon/reagent_containers/blood/random,/obj/item/weapon/reagent_containers/blood/random,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "aq" = (/obj/machinery/iv_drip,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "ar" = (/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) @@ -20,27 +20,27 @@ "at" = (/obj/machinery/portable_atmospherics/canister/air,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "au" = (/obj/machinery/door/airlock/highsecurity{name = "Bunker"},/turf/open/floor/plasteel,/area/ruin/unpowered) "av" = (/obj/structure/toilet{dir = 4},/turf/open/floor/plasteel/freezer,/area/ruin/unpowered) -"aw" = (/obj/structure/mirror{pixel_x = 30},/obj/structure/sink{dir = 4;icon_state = "sink";pixel_x = 11;pixel_y = 0},/turf/open/floor/plasteel/freezer,/area/ruin/unpowered) +"aw" = (/obj/structure/mirror{pixel_x = 30},/obj/structure/sink{dir = 4; icon_state = "sink"; pixel_x = 11; pixel_y = 0},/turf/open/floor/plasteel/freezer,/area/ruin/unpowered) "ax" = (/obj/structure/table,/obj/item/weapon/storage/toolbox/drone,/obj/item/device/flashlight,/obj/item/device/flashlight,/turf/open/floor/plasteel,/area/ruin/unpowered) -"ay" = (/obj/structure/table,/obj/item/weapon/gun/projectile/automatic/wt550{pixel_x = -3;pixel_y = 6},/obj/item/weapon/gun/projectile/automatic/wt550{pixel_x = 2;pixel_y = 0},/obj/structure/reagent_dispensers/peppertank{pixel_y = 30},/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) -"az" = (/obj/structure/table,/obj/item/weapon/storage/backpack/dufflebag/sec{contents = newlist(/obj/item/weapon/scalpel,/obj/item/weapon/hemostat,/obj/item/weapon/retractor,/obj/item/weapon/cautery,/obj/item/weapon/circular_saw,/obj/item/weapon/surgical_drapes,/obj/item/clothing/mask/surgical);desc = "A large dufflebag for holding extra supplies - this one has a material inlay with space for various sharp-looking tools.";name = "dufflebag";pixel_y = 5},/turf/open/floor/plasteel,/area/ruin/unpowered) +"ay" = (/obj/structure/table,/obj/item/weapon/gun/projectile/automatic/wt550{pixel_x = -3; pixel_y = 6},/obj/item/weapon/gun/projectile/automatic/wt550{pixel_x = 2; pixel_y = 0},/obj/structure/reagent_dispensers/peppertank{pixel_y = 30},/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) +"az" = (/obj/structure/table,/obj/item/weapon/storage/backpack/dufflebag/sec{contents = newlist(/obj/item/weapon/scalpel,/obj/item/weapon/hemostat,/obj/item/weapon/retractor,/obj/item/weapon/cautery,/obj/item/weapon/circular_saw,/obj/item/weapon/surgical_drapes,/obj/item/clothing/mask/surgical); desc = "A large dufflebag for holding extra supplies - this one has a material inlay with space for various sharp-looking tools."; name = "dufflebag"; pixel_y = 5},/turf/open/floor/plasteel,/area/ruin/unpowered) "aA" = (/obj/structure/table,/obj/item/device/radio{pixel_x = -4},/obj/item/device/radio,/obj/item/device/radio{pixel_x = 4},/turf/open/floor/plasteel,/area/ruin/unpowered) -"aB" = (/obj/structure/table,/obj/item/stack/sheet/metal{amount = 50;pixel_x = 2;pixel_y = 2},/obj/item/stack/rods{amount = 50},/obj/item/stack/cable_coil,/obj/item/stack/cable_coil,/turf/open/floor/plasteel,/area/ruin/unpowered) -"aC" = (/obj/structure/table,/obj/item/weapon/storage/firstaid/brute{pixel_x = 4;pixel_y = 4},/obj/item/weapon/storage/firstaid/brute,/turf/open/floor/plasteel,/area/ruin/unpowered) -"aD" = (/obj/structure/table,/obj/item/weapon/storage/firstaid/regular{pixel_x = 4;pixel_y = 4},/obj/item/weapon/storage/firstaid/regular,/obj/machinery/light/small{dir = 4},/turf/open/floor/plasteel,/area/ruin/unpowered) +"aB" = (/obj/structure/table,/obj/item/stack/sheet/metal{amount = 50; pixel_x = 2; pixel_y = 2},/obj/item/stack/rods{amount = 50},/obj/item/stack/cable_coil,/obj/item/stack/cable_coil,/turf/open/floor/plasteel,/area/ruin/unpowered) +"aC" = (/obj/structure/table,/obj/item/weapon/storage/firstaid/brute{pixel_x = 4; pixel_y = 4},/obj/item/weapon/storage/firstaid/brute,/turf/open/floor/plasteel,/area/ruin/unpowered) +"aD" = (/obj/structure/table,/obj/item/weapon/storage/firstaid/regular{pixel_x = 4; pixel_y = 4},/obj/item/weapon/storage/firstaid/regular,/obj/machinery/light/small{dir = 4},/turf/open/floor/plasteel,/area/ruin/unpowered) "aE" = (/obj/structure/closet/crate/radiation,/turf/open/floor/plasteel,/area/ruin/unpowered) "aF" = (/obj/structure/closet/cardboard,/obj/item/weapon/reagent_containers/food/snacks/beans,/obj/item/weapon/reagent_containers/food/snacks/beans,/obj/item/weapon/reagent_containers/food/snacks/beans,/obj/item/weapon/reagent_containers/food/snacks/beans,/obj/item/weapon/reagent_containers/food/snacks/beans,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) -"aG" = (/obj/structure/closet/cardboard,/obj/item/weapon/reagent_containers/food/snacks/beans,/obj/item/weapon/reagent_containers/food/snacks/beans,/obj/item/weapon/reagent_containers/food/snacks/beans,/obj/machinery/light{dir = 4;icon_state = "tube1"},/obj/item/weapon/reagent_containers/food/snacks/beans,/obj/item/weapon/reagent_containers/food/snacks/beans,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) +"aG" = (/obj/structure/closet/cardboard,/obj/item/weapon/reagent_containers/food/snacks/beans,/obj/item/weapon/reagent_containers/food/snacks/beans,/obj/item/weapon/reagent_containers/food/snacks/beans,/obj/machinery/light{dir = 4; icon_state = "tube1"},/obj/item/weapon/reagent_containers/food/snacks/beans,/obj/item/weapon/reagent_containers/food/snacks/beans,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "aH" = (/obj/structure/closet/cardboard,/obj/item/weapon/reagent_containers/food/drinks/soda_cans/cola,/obj/item/weapon/reagent_containers/food/drinks/soda_cans/cola,/obj/item/weapon/reagent_containers/food/drinks/soda_cans/cola,/obj/item/weapon/reagent_containers/food/drinks/soda_cans/cola,/obj/item/weapon/reagent_containers/food/drinks/soda_cans/cola,/turf/open/floor/plasteel,/area/ruin/unpowered) "aI" = (/obj/machinery/vending/clothing,/turf/open/floor/wood,/area/ruin/unpowered) "aJ" = (/turf/open/floor/wood{icon_state = "wood-broken3"},/area/ruin/unpowered) "aK" = (/obj/structure/bed,/turf/open/floor/wood,/area/ruin/unpowered) "aL" = (/turf/open/floor/plasteel/freezer,/area/ruin/unpowered) "aM" = (/obj/machinery/light/small{dir = 4},/turf/open/floor/plasteel/freezer,/area/ruin/unpowered) -"aN" = (/obj/structure/table,/obj/item/clothing/gloves/combat{pixel_x = -3;pixel_y = 4},/obj/item/clothing/gloves/combat{pixel_x = 3;pixel_y = -2},/obj/item/clothing/mask/gas,/obj/item/clothing/mask/gas,/obj/item/clothing/mask/gas,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) +"aN" = (/obj/structure/table,/obj/item/clothing/gloves/combat{pixel_x = -3; pixel_y = 4},/obj/item/clothing/gloves/combat{pixel_x = 3; pixel_y = -2},/obj/item/clothing/mask/gas,/obj/item/clothing/mask/gas,/obj/item/clothing/mask/gas,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "aO" = (/turf/open/floor/plasteel,/area/ruin/unpowered) "aP" = (/obj/structure/table,/obj/item/device/mass_spectrometer/adv,/obj/item/device/mass_spectrometer/adv,/obj/item/device/healthanalyzer,/obj/item/device/healthanalyzer,/obj/item/stack/medical/gauze,/obj/item/stack/medical/gauze,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) -"aQ" = (/obj/structure/closet/radiation,/obj/machinery/light{icon_state = "tube1";dir = 8},/turf/open/floor/plasteel,/area/ruin/unpowered) +"aQ" = (/obj/structure/closet/radiation,/obj/machinery/light{icon_state = "tube1"; dir = 8},/turf/open/floor/plasteel,/area/ruin/unpowered) "aR" = (/obj/structure/closet/cardboard,/obj/item/weapon/reagent_containers/food/snacks/beans,/obj/item/weapon/reagent_containers/food/snacks/beans,/obj/item/weapon/reagent_containers/food/snacks/beans,/obj/item/weapon/reagent_containers/food/snacks/beans,/obj/item/weapon/reagent_containers/food/snacks/beans,/turf/open/floor/plasteel,/area/ruin/unpowered) "aS" = (/obj/structure/closet/cardboard,/obj/item/weapon/reagent_containers/food/drinks/soda_cans/cola,/obj/item/weapon/reagent_containers/food/drinks/soda_cans/cola,/obj/item/weapon/reagent_containers/food/drinks/soda_cans/cola,/obj/item/weapon/reagent_containers/food/drinks/soda_cans/cola,/obj/item/weapon/reagent_containers/food/drinks/soda_cans/cola,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "aT" = (/obj/structure/closet/wardrobe/pink,/turf/open/floor/wood{icon_state = "wood-broken"},/area/ruin/unpowered) @@ -48,7 +48,7 @@ "aV" = (/obj/structure/bed,/turf/open/floor/wood{icon_state = "wood-broken7"},/area/ruin/unpowered) "aW" = (/obj/machinery/shower{dir = 4},/turf/open/floor/plasteel/freezer,/area/ruin/unpowered) "aX" = (/obj/machinery/shower{dir = 8},/turf/open/floor/plasteel/freezer,/area/ruin/unpowered) -"aY" = (/obj/machinery/light/small{dir = 8},/obj/structure/table,/obj/item/weapon/storage/firstaid/toxin{pixel_x = 4;pixel_y = 4},/obj/item/weapon/storage/firstaid/toxin,/obj/item/weapon/storage/pill_bottle/charcoal,/turf/open/floor/plasteel,/area/ruin/unpowered) +"aY" = (/obj/machinery/light/small{dir = 8},/obj/structure/table,/obj/item/weapon/storage/firstaid/toxin{pixel_x = 4; pixel_y = 4},/obj/item/weapon/storage/firstaid/toxin,/obj/item/weapon/storage/pill_bottle/charcoal,/turf/open/floor/plasteel,/area/ruin/unpowered) "aZ" = (/obj/structure/table,/obj/item/device/flashlight/flare,/obj/item/device/flashlight/flare,/obj/item/device/flashlight/flare,/obj/item/device/flashlight/flare{pixel_y = 6},/obj/item/device/flashlight/flare,/obj/item/weapon/crowbar/red,/turf/open/floor/plasteel,/area/ruin/unpowered) "ba" = (/obj/machinery/suit_storage_unit/standard_unit,/turf/open/floor/plasteel,/area/ruin/unpowered) "bb" = (/obj/structure/closet/wardrobe/pjs,/obj/machinery/light/small{dir = 8},/turf/open/floor/wood,/area/ruin/unpowered) @@ -61,10 +61,10 @@ "bi" = (/obj/machinery/door/airlock/highsecurity{name = "Bunker"},/turf/open/floor/wood,/area/ruin/unpowered) "bj" = (/obj/machinery/door/airlock/highsecurity{name = "Bunker"},/turf/open/floor/plasteel/freezer,/area/ruin/unpowered) "bk" = (/obj/structure/fireaxecabinet{pixel_y = 30},/turf/open/floor/plasteel,/area/ruin/unpowered) -"bl" = (/obj/machinery/sleeper{icon_state = "sleeper-open";dir = 4},/obj/machinery/light/small{dir = 8},/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) +"bl" = (/obj/machinery/sleeper{icon_state = "sleeper-open"; dir = 4},/obj/machinery/light/small{dir = 8},/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "bm" = (/obj/machinery/light/small{dir = 1},/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "bn" = (/obj/machinery/light/small{dir = 4},/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) -"bo" = (/obj/machinery/sleeper{icon_state = "sleeper-open";dir = 4},/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) +"bo" = (/obj/machinery/sleeper{icon_state = "sleeper-open"; dir = 4},/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "bp" = (/obj/machinery/door/airlock/highsecurity{name = "Bunker"},/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "bq" = (/obj/machinery/processor{name = "processor"},/turf/open/floor/plasteel,/area/ruin/unpowered) "br" = (/obj/structure/table,/obj/item/weapon/storage/box/matches,/turf/open/floor/plasteel,/area/ruin/unpowered) @@ -73,14 +73,14 @@ "bu" = (/obj/machinery/light{dir = 1},/obj/machinery/hydroponics/constructable,/turf/open/floor/light,/area/ruin/unpowered) "bv" = (/obj/machinery/hydroponics/constructable,/turf/open/floor/light,/area/ruin/unpowered) "bw" = (/obj/machinery/blackbox_recorder,/turf/open/floor/plasteel,/area/ruin/unpowered) -"bx" = (/obj/structure/cable{icon_state = "0-4";d2 = 4},/obj/machinery/power/port_gen/pacman,/turf/open/floor/plasteel,/area/ruin/unpowered) -"by" = (/obj/machinery/power/smes/magical{desc = "A high-capacity superconducting magnetic energy storage (SMES) unit.";name = "power storage unit"},/obj/structure/cable,/obj/structure/cable{icon_state = "0-2";pixel_y = 1;d2 = 2},/obj/structure/cable{d1 = 2;d2 = 8;icon_state = "2-8"},/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) +"bx" = (/obj/structure/cable{icon_state = "0-4"; d2 = 4},/obj/machinery/power/port_gen/pacman,/turf/open/floor/plasteel,/area/ruin/unpowered) +"by" = (/obj/machinery/power/smes/magical{desc = "A high-capacity superconducting magnetic energy storage (SMES) unit."; name = "power storage unit"},/obj/structure/cable,/obj/structure/cable{icon_state = "0-2"; pixel_y = 1; d2 = 2},/obj/structure/cable{d1 = 2; d2 = 8; icon_state = "2-8"},/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "bz" = (/obj/machinery/telecomms/relay/preset/telecomms,/turf/open/floor/plasteel,/area/ruin/unpowered) "bA" = (/obj/machinery/light/small{dir = 1},/obj/structure/tank_dispenser/oxygen,/turf/open/floor/plasteel,/area/ruin/unpowered) "bB" = (/obj/machinery/biogenerator,/turf/open/floor/plasteel,/area/ruin/unpowered) "bC" = (/obj/machinery/light,/obj/machinery/hydroponics/constructable,/turf/open/floor/light,/area/ruin/unpowered) "bD" = (/obj/machinery/autolathe,/turf/open/floor/plasteel,/area/ruin/unpowered) -"bE" = (/obj/structure/cable{d1 = 1;d2 = 2;icon_state = "1-2"},/obj/machinery/power/terminal{icon_state = "term";dir = 1},/turf/open/floor/plasteel,/area/ruin/unpowered) +"bE" = (/obj/structure/cable{d1 = 1; d2 = 2; icon_state = "1-2"},/obj/machinery/power/terminal{icon_state = "term"; dir = 1},/turf/open/floor/plasteel,/area/ruin/unpowered) "bF" = (/obj/structure/reagent_dispensers/fueltank,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "bG" = (/obj/structure/table,/obj/machinery/microwave,/turf/open/floor/plasteel/bar,/area/ruin/unpowered) "bH" = (/turf/open/floor/plasteel/bar,/area/ruin/unpowered) @@ -88,9 +88,9 @@ "bJ" = (/obj/structure/table,/obj/item/weapon/reagent_containers/food/snacks/beans,/turf/open/floor/plasteel/bar,/area/ruin/unpowered) "bK" = (/obj/structure/chair{dir = 8},/turf/open/floor/plasteel/bar,/area/ruin/unpowered) "bL" = (/obj/machinery/seed_extractor,/turf/open/floor/plasteel,/area/ruin/unpowered) -"bM" = (/obj/machinery/power/apc{dir = 8;name = "Bunker APC";pixel_x = -24;pixel_y = 0},/obj/structure/cable{icon_state = "0-4";d2 = 4},/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) -"bN" = (/obj/structure/cable{d1 = 4;d2 = 8;icon_state = "4-8";pixel_y = 0;tag = ""},/turf/open/floor/plasteel,/area/ruin/unpowered) -"bO" = (/obj/structure/cable{d1 = 1;d2 = 8;icon_state = "1-8";tag = ""},/turf/open/floor/plasteel,/area/ruin/unpowered) +"bM" = (/obj/machinery/power/apc{dir = 8; name = "Bunker APC"; pixel_x = -24; pixel_y = 0},/obj/structure/cable{icon_state = "0-4"; d2 = 4},/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) +"bN" = (/obj/structure/cable{d1 = 4; d2 = 8; icon_state = "4-8"; pixel_y = 0; tag = ""},/turf/open/floor/plasteel,/area/ruin/unpowered) +"bO" = (/obj/structure/cable{d1 = 1; d2 = 8; icon_state = "1-8"; tag = ""},/turf/open/floor/plasteel,/area/ruin/unpowered) "bP" = (/obj/structure/reagent_dispensers/watertank,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "bQ" = (/obj/structure/table,/obj/item/weapon/kitchen/knife,/turf/open/floor/plasteel/bar,/area/ruin/unpowered) "bR" = (/obj/structure/table,/turf/open/floor/plasteel/bar,/area/ruin/unpowered) @@ -105,14 +105,14 @@ "ca" = (/obj/machinery/light/small{dir = 8},/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "cb" = (/obj/structure/chair/office/dark,/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) "cc" = (/obj/structure/frame/computer,/turf/open/floor/plasteel,/area/ruin/unpowered) -"cd" = (/obj/structure/table/reinforced,/obj/machinery/computer/security/telescreen{dir = 1;name = "Bunker Entrance";network = list("Bunker1");pixel_x = 0;pixel_y = 2},/turf/open/floor/plasteel,/area/ruin/unpowered) -"ce" = (/obj/structure/table/reinforced,/obj/machinery/button/door{id = "bunker1";name = "Inner Doors";pixel_y = 6},/obj/machinery/button/door{id = "bunker2";name = "Outer Doors";pixel_y = -4},/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) -"cf" = (/obj/machinery/door/poddoor{id = "bunker1";name = "Bunker Door";tag = "inner"},/turf/open/floor/plating,/area/ruin/unpowered) +"cd" = (/obj/structure/table/reinforced,/obj/machinery/computer/security/telescreen{dir = 1; name = "Bunker Entrance"; network = list("Bunker1"); pixel_x = 0; pixel_y = 2},/turf/open/floor/plasteel,/area/ruin/unpowered) +"ce" = (/obj/structure/table/reinforced,/obj/machinery/button/door{id = "bunker1"; name = "Inner Doors"; pixel_y = 6},/obj/machinery/button/door{id = "bunker2"; name = "Outer Doors"; pixel_y = -4},/turf/open/floor/plasteel/floorgrime,/area/ruin/unpowered) +"cf" = (/obj/machinery/door/poddoor{id = "bunker1"; name = "Bunker Door"; tag = "inner"},/turf/open/floor/plating,/area/ruin/unpowered) "cg" = (/turf/open/floor/plating,/area/ruin/unpowered) "ch" = (/obj/machinery/camera{network = list("Bunker1")},/turf/open/floor/plating,/area/ruin/unpowered) "ci" = (/obj/machinery/light/small{dir = 4},/turf/open/floor/plating,/area/ruin/unpowered) -"cj" = (/obj/machinery/door/poddoor{id = "bunker2";name = "Bunker Door";tag = "outer"},/turf/open/floor/plating,/area/ruin/unpowered) -"ck" = (/turf/open/floor/plating/asteroid,/area/ruin/unpowered) +"cj" = (/obj/machinery/door/poddoor{id = "bunker2"; name = "Bunker Door"; tag = "outer"},/turf/open/floor/plating,/area/ruin/unpowered) +"ck" = (/turf/open/floor/plating/asteroid/airless,/area/ruin/unpowered) (1,1,1) = {" aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaababababababababababababababababababaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa diff --git a/_maps/RandomRuins/SpaceRuins/emptyshell.dmm b/_maps/RandomRuins/SpaceRuins/emptyshell.dmm index 0a20bc0ff6..f0470d1b56 100644 --- a/_maps/RandomRuins/SpaceRuins/emptyshell.dmm +++ b/_maps/RandomRuins/SpaceRuins/emptyshell.dmm @@ -5,12 +5,12 @@ "e" = (/obj/effect/spawner/lootdrop/crate_spawner,/turf/open/floor/plating,/area/ruin/unpowered) "f" = (/obj/item/ammo_box/magazine/sniper_rounds,/turf/open/floor/plating,/area/ruin/unpowered) "g" = (/obj/effect/spawner/lootdrop/maintenance,/turf/open/floor/plating,/area/ruin/unpowered) -"h" = (/obj/item/stack/rods,/turf/open/floor/plating,/area/ruin/unpowered) -"i" = (/turf/open/floor/plating/airless,/area/ruin/unpowered) +"h" = (/turf/open/floor/plating/airless,/area/ruin/unpowered) +"i" = (/obj/item/stack/rods,/turf/open/floor/plating,/area/ruin/unpowered) "j" = (/obj/machinery/door/airlock,/turf/open/floor/plating,/area/ruin/unpowered) -"k" = (/obj/effect/spawner/lootdrop/maintenance{lootcount = 2;name = "2maintenance loot spawner"},/turf/open/floor/plating,/area/ruin/unpowered) +"k" = (/obj/effect/spawner/lootdrop/maintenance{lootcount = 2; name = "2maintenance loot spawner"},/turf/open/floor/plating,/area/ruin/unpowered) "l" = (/obj/item/stack/cable_coil,/turf/open/floor/plating,/area/ruin/unpowered) -"m" = (/obj/effect/spawner/lootdrop/maintenance{lootcount = 4;name = "4maintenance loot spawner"},/turf/open/floor/plating,/area/ruin/unpowered) +"m" = (/obj/effect/spawner/lootdrop/maintenance{lootcount = 4; name = "4maintenance loot spawner"},/turf/open/floor/plating,/area/ruin/unpowered) (1,1,1) = {" aaaaaaaaabaaaaaaa @@ -19,10 +19,10 @@ aaabccccccccccaba aabccccccccccccaa abacccdeddfdcccba abaccddddddgdccbb -bbbdcdhddddddccbb -aadijddhdgdddccaa -aadijddkdddddccbb -abbdcddddddhdccbb +bbbhcdiddddddccbb +aahhjddidgdddccaa +aahhjddkdddddccbb +abbhcddddddidccbb aaaccldeddmddccbb aaacccdddddecccaa aaaccccccccccccba diff --git a/_maps/RandomRuins/SpaceRuins/onehalf.dmm b/_maps/RandomRuins/SpaceRuins/onehalf.dmm index a2520e780a..e4801445dc 100644 --- a/_maps/RandomRuins/SpaceRuins/onehalf.dmm +++ b/_maps/RandomRuins/SpaceRuins/onehalf.dmm @@ -1,175 +1,173 @@ "aa" = (/turf/open/space,/area/space) -"ab" = (/obj/structure/lattice,/obj/structure/cable{d1 = 2;d2 = 4;icon_state = "2-4"},/turf/open/space,/area/space) -"ac" = (/obj/structure/lattice,/obj/structure/cable{d1 = 4;d2 = 8;icon_state = "4-8"},/turf/open/space,/area/space) -"ad" = (/obj/structure/lattice,/obj/structure/cable{d1 = 2;d2 = 8;icon_state = "2-8"},/turf/open/space,/area/space) -"ae" = (/obj/structure/lattice,/obj/item/stack/cable_coil/cut{amount = 2;dir = 2;icon_state = "coil_red2"},/turf/open/space,/area/space) -"af" = (/obj/structure/lattice,/obj/structure/cable{d1 = 1;d2 = 8;icon_state = "1-8"},/turf/open/space,/area/space) +"ab" = (/obj/structure/lattice,/obj/structure/cable{d1 = 2; d2 = 4; icon_state = "2-4"},/turf/open/space,/area/space) +"ac" = (/obj/structure/lattice,/obj/structure/cable{d1 = 4; d2 = 8; icon_state = "4-8"},/turf/open/space,/area/space) +"ad" = (/obj/structure/lattice,/obj/structure/cable{d1 = 2; d2 = 8; icon_state = "2-8"},/turf/open/space,/area/space) +"ae" = (/obj/structure/lattice,/obj/item/stack/cable_coil/cut{amount = 2; dir = 2; icon_state = "coil_red2"},/turf/open/space,/area/space) +"af" = (/obj/structure/lattice,/obj/structure/cable{d1 = 1; d2 = 8; icon_state = "1-8"},/turf/open/space,/area/space) "ag" = (/turf/closed/wall,/area/ruin/onehalf/dorms_med) "ah" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/turf/open/floor/plating,/area/ruin/onehalf/dorms_med) -"ai" = (/obj/structure/lattice,/obj/structure/cable{d1 = 1;d2 = 2;icon_state = "1-2"},/turf/open/space,/area/space) +"ai" = (/obj/structure/lattice,/obj/structure/cable{d1 = 1; d2 = 2; icon_state = "1-2"},/turf/open/space,/area/space) "aj" = (/turf/open/floor/plating/airless,/area/ruin/onehalf/hallway) "ak" = (/turf/closed/wall,/area/ruin/onehalf/hallway) "al" = (/obj/machinery/sleeper/syndie{dir = 4},/turf/open/floor/plasteel/white,/area/ruin/onehalf/dorms_med) "am" = (/turf/open/floor/plasteel/white,/area/ruin/onehalf/dorms_med) -"an" = (/obj/structure/table,/obj/item/weapon/storage/firstaid/toxin{pixel_x = 3;pixel_y = 3},/obj/item/weapon/storage/firstaid/fire,/turf/open/floor/plasteel/white,/area/ruin/onehalf/dorms_med) +"an" = (/obj/structure/table,/obj/item/weapon/storage/firstaid/toxin{pixel_x = 3; pixel_y = 3},/obj/item/weapon/storage/firstaid/fire,/turf/open/floor/plasteel/white,/area/ruin/onehalf/dorms_med) "ao" = (/obj/structure/bed,/obj/item/weapon/bedsheet/black,/turf/open/floor/plasteel,/area/ruin/onehalf/dorms_med) "ap" = (/turf/open/floor/plasteel,/area/ruin/onehalf/dorms_med) -"aq" = (/obj/machinery/door/airlock/external,/obj/structure/cable{d1 = 1;d2 = 2;icon_state = "1-2"},/turf/open/floor/plating,/area/ruin/onehalf/drone_bay) +"aq" = (/obj/machinery/door/airlock/external,/obj/structure/cable{d1 = 1; d2 = 2; icon_state = "1-2"},/turf/open/floor/plating,/area/ruin/onehalf/drone_bay) "ar" = (/turf/closed/wall,/area/ruin/onehalf/drone_bay) -"as" = (/obj/machinery/door/poddoor{id = "onehalf_drone1ext";name = "mining drone bay blast door"},/turf/open/floor/plating/airless{dir = 1;icon_state = "warnplate"},/area/ruin/onehalf/drone_bay) -"at" = (/obj/machinery/door/poddoor{id = "onehalf_drone2ext";name = "mining drone bay blast door"},/turf/open/floor/plating/airless{dir = 1;icon_state = "warnplate"},/area/ruin/onehalf/drone_bay) -"au" = (/obj/machinery/door/poddoor/preopen{id = "onehalf_drone3ext";name = "mining drone bay blast door"},/turf/open/floor/plating/airless{dir = 1;icon_state = "warnplate"},/area/ruin/onehalf/drone_bay) -"av" = (/obj/machinery/door/poddoor{id = "onehalf_drone4ext";name = "mining drone bay blast door"},/turf/open/floor/plating/airless{dir = 1;icon_state = "warnplate"},/area/ruin/onehalf/drone_bay) +"as" = (/obj/machinery/door/poddoor{id = "onehalf_drone1ext"; name = "mining drone bay blast door"},/turf/open/floor/plating/airless,/area/ruin/onehalf/drone_bay) +"at" = (/obj/machinery/door/poddoor{id = "onehalf_drone2ext"; name = "mining drone bay blast door"},/turf/open/floor/plating/airless,/area/ruin/onehalf/drone_bay) +"au" = (/obj/machinery/door/poddoor/preopen{id = "onehalf_drone3ext"; name = "mining drone bay blast door"},/turf/open/floor/plating/airless,/area/ruin/onehalf/drone_bay) +"av" = (/obj/machinery/door/poddoor{id = "onehalf_drone4ext"; name = "mining drone bay blast door"},/turf/open/floor/plating/airless,/area/ruin/onehalf/drone_bay) "aw" = (/obj/structure/lattice,/turf/open/space,/area/space) "ax" = (/obj/structure/lattice,/turf/open/space,/area/ruin/onehalf/hallway) "ay" = (/obj/structure/table_frame,/turf/open/floor/plasteel/airless{icon_state = "damaged3"},/area/ruin/onehalf/hallway) "az" = (/obj/machinery/washing_machine,/turf/open/floor/plasteel/airless,/area/ruin/onehalf/hallway) "aA" = (/obj/item/roller,/turf/open/floor/plasteel/white,/area/ruin/onehalf/dorms_med) -"aB" = (/obj/machinery/light{icon_state = "tube1";dir = 4},/obj/structure/table,/obj/item/weapon/storage/firstaid/brute{pixel_x = 3;pixel_y = 3},/obj/item/weapon/storage/firstaid/regular,/turf/open/floor/plasteel/white,/area/ruin/onehalf/dorms_med) +"aB" = (/obj/machinery/light{icon_state = "tube1"; dir = 4},/obj/structure/table,/obj/item/weapon/storage/firstaid/brute{pixel_x = 3; pixel_y = 3},/obj/item/weapon/storage/firstaid/regular,/turf/open/floor/plasteel/white,/area/ruin/onehalf/dorms_med) "aC" = (/obj/machinery/light{dir = 8},/turf/open/floor/plasteel,/area/ruin/onehalf/dorms_med) -"aD" = (/obj/structure/cable{d1 = 1;d2 = 2;icon_state = "1-2"},/obj/machinery/light/small{dir = 8},/turf/open/floor/plating,/area/ruin/onehalf/drone_bay) +"aD" = (/obj/structure/cable{d1 = 1; d2 = 2; icon_state = "1-2"},/obj/machinery/light/small{dir = 8},/turf/open/floor/plating,/area/ruin/onehalf/drone_bay) "aE" = (/obj/structure/disposalpipe/trunk,/turf/open/floor/plating/airless,/area/ruin/onehalf/drone_bay) "aF" = (/obj/structure/disposalpipe/trunk,/obj/item/weapon/ore/diamond,/turf/open/floor/plating/airless,/area/ruin/onehalf/drone_bay) -"aG" = (/turf/open/floor/plating/airless{dir = 1;icon_state = "warnplate"},/area/ruin/onehalf/drone_bay) +"aG" = (/turf/open/floor/plating/airless,/area/ruin/onehalf/drone_bay) "aH" = (/obj/item/stack/rods,/turf/open/space,/area/ruin/onehalf/hallway) "aI" = (/turf/open/floor/plating/airless{icon_state = "platingdmg3"},/area/ruin/onehalf/hallway) "aJ" = (/turf/open/floor/plasteel/airless{icon_state = "damaged5"},/area/ruin/onehalf/hallway) "aK" = (/obj/machinery/iv_drip,/turf/open/floor/plasteel/white,/area/ruin/onehalf/dorms_med) -"aL" = (/obj/structure/cable{d1 = 2;d2 = 4;icon_state = "2-4"},/turf/open/floor/plasteel/white,/area/ruin/onehalf/dorms_med) -"aM" = (/obj/structure/cable{d2 = 8;icon_state = "0-8"},/obj/structure/closet/crate/medical,/obj/item/clothing/tie/stethoscope,/obj/item/device/healthanalyzer,/obj/item/weapon/reagent_containers/blood/OMinus,/obj/item/weapon/reagent_containers/blood/OMinus,/obj/machinery/power/apc{dir = 4;name = "Crew Quarters APC";pixel_x = 26;pixel_y = 0},/turf/open/floor/plasteel/white,/area/ruin/onehalf/dorms_med) -"aN" = (/obj/structure/disposalpipe/segment,/obj/machinery/door/poddoor{id = "onehalf_drone1int";name = "mining drone bay blast door"},/turf/open/floor/plating,/area/ruin/onehalf/drone_bay) -"aO" = (/obj/structure/disposalpipe/segment,/obj/machinery/door/poddoor{id = "onehalf_drone2int";name = "mining drone bay blast door"},/turf/open/floor/plating,/area/ruin/onehalf/drone_bay) -"aP" = (/obj/structure/disposalpipe/segment,/obj/machinery/door/poddoor{id = "onehalf_drone3int";name = "mining drone bay blast door"},/turf/open/floor/plating,/area/ruin/onehalf/drone_bay) -"aQ" = (/obj/structure/disposalpipe/segment,/obj/machinery/door/poddoor{id = "onehalf_drone4int";name = "mining drone bay blast door"},/turf/open/floor/plating,/area/ruin/onehalf/drone_bay) +"aL" = (/obj/structure/cable{d1 = 2; d2 = 4; icon_state = "2-4"},/turf/open/floor/plasteel/white,/area/ruin/onehalf/dorms_med) +"aM" = (/obj/structure/cable{d2 = 8; icon_state = "0-8"},/obj/structure/closet/crate/medical,/obj/item/clothing/tie/stethoscope,/obj/item/device/healthanalyzer,/obj/item/weapon/reagent_containers/blood/OMinus,/obj/item/weapon/reagent_containers/blood/OMinus,/obj/machinery/power/apc{dir = 4; name = "Crew Quarters APC"; pixel_x = 26; pixel_y = 0},/turf/open/floor/plasteel/white,/area/ruin/onehalf/dorms_med) +"aN" = (/obj/structure/disposalpipe/segment,/obj/machinery/door/poddoor{id = "onehalf_drone1int"; name = "mining drone bay blast door"},/turf/open/floor/plating,/area/ruin/onehalf/drone_bay) +"aO" = (/obj/structure/disposalpipe/segment,/obj/machinery/door/poddoor{id = "onehalf_drone2int"; name = "mining drone bay blast door"},/turf/open/floor/plating,/area/ruin/onehalf/drone_bay) +"aP" = (/obj/structure/disposalpipe/segment,/obj/machinery/door/poddoor{id = "onehalf_drone3int"; name = "mining drone bay blast door"},/turf/open/floor/plating,/area/ruin/onehalf/drone_bay) +"aQ" = (/obj/structure/disposalpipe/segment,/obj/machinery/door/poddoor{id = "onehalf_drone4int"; name = "mining drone bay blast door"},/turf/open/floor/plating,/area/ruin/onehalf/drone_bay) "aR" = (/obj/structure/disposaloutlet{dir = 1},/obj/structure/disposalpipe/trunk,/turf/open/floor/plating/airless,/area/ruin/onehalf/drone_bay) "aS" = (/obj/structure/lattice,/obj/item/weapon/storage/toolbox/syndicate,/turf/open/space,/area/space) -"aT" = (/obj/structure/cable{d1 = 1;d2 = 2;icon_state = "1-2"},/turf/open/floor/plasteel/airless{icon_state = "damaged3"},/area/ruin/onehalf/hallway) +"aT" = (/obj/structure/cable{d1 = 1; d2 = 2; icon_state = "1-2"},/turf/open/floor/plasteel/airless{icon_state = "damaged3"},/area/ruin/onehalf/hallway) "aU" = (/turf/open/floor/plasteel/airless{icon_state = "damaged1"},/area/ruin/onehalf/hallway) -"aV" = (/obj/machinery/door/airlock/glass_medical,/obj/structure/cable{d1 = 1;d2 = 2;icon_state = "1-2"},/turf/open/floor/plasteel/white,/area/ruin/onehalf/dorms_med) +"aV" = (/obj/machinery/door/airlock/glass_medical,/obj/structure/cable{d1 = 1; d2 = 2; icon_state = "1-2"},/turf/open/floor/plasteel/white,/area/ruin/onehalf/dorms_med) "aW" = (/obj/machinery/door/airlock,/turf/open/floor/plasteel,/area/ruin/onehalf/dorms_med) -"aX" = (/obj/structure/cable{d1 = 1;d2 = 4;icon_state = "1-4"},/obj/structure/cable{d1 = 1;d2 = 2;icon_state = "1-2"},/turf/open/floor/plasteel{dir = 9;icon_state = "warning"},/area/ruin/onehalf/drone_bay) -"aY" = (/obj/structure/cable{d2 = 8;icon_state = "0-8"},/obj/machinery/power/apc{cell_type = 2500;dir = 1;name = "Mining Drone Bay APC";pixel_y = 24},/turf/open/floor/plasteel{dir = 1;icon_state = "warning"},/area/ruin/onehalf/drone_bay) -"aZ" = (/obj/structure/disposalpipe/segment,/turf/open/floor/plasteel{dir = 1;icon_state = "warning"},/area/ruin/onehalf/drone_bay) -"ba" = (/obj/machinery/button/door{id = "onehalf_drone2int";name = "Drone 2 Internal Hatch Override";pixel_x = 8;pixel_y = 27},/obj/machinery/button/door{id = "onehalf_drone2ext";name = "Drone 2 External Hatch Override";pixel_x = 8;pixel_y = 37},/obj/machinery/button/door{id = "onehalf_drone1int";name = "Drone 1 Internal Hatch Override";pixel_x = -8;pixel_y = 27},/obj/machinery/button/door{id = "onehalf_drone1ext";name = "Drone 1 External Hatch Override";pixel_x = -8;pixel_y = 37},/turf/open/floor/plasteel{dir = 1;icon_state = "warning"},/area/ruin/onehalf/drone_bay) -"bb" = (/turf/open/floor/plasteel{dir = 1;icon_state = "warning"},/area/ruin/onehalf/drone_bay) -"bc" = (/obj/machinery/button/door{id = "onehalf_drone3int";name = "Drone 3 Internal Hatch Override";pixel_x = -8;pixel_y = 27},/obj/machinery/button/door{id = "onehalf_drone3ext";name = "Drone 3 External Hatch Override";pixel_x = -8;pixel_y = 37},/obj/machinery/button/door{id = "onehalf_drone4ext";name = "Drone 4 External Hatch Override";pixel_x = 8;pixel_y = 37},/obj/machinery/button/door{id = "onehalf_drone4int";name = "Drone 4 Internal Hatch Override";pixel_x = 8;pixel_y = 27},/turf/open/floor/plasteel{dir = 1;icon_state = "warning"},/area/ruin/onehalf/drone_bay) -"bd" = (/obj/structure/disposalpipe/segment,/turf/open/floor/plasteel{dir = 5;icon_state = "warning"},/area/ruin/onehalf/drone_bay) -"be" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/turf/open/floor/plating,/area/ruin/onehalf/drone_bay) -"bf" = (/obj/item/stack/sheet/metal,/turf/open/floor/plating/airless{broken = 1;icon_state = "platingdmg1"},/area/ruin/onehalf/hallway) -"bg" = (/obj/structure/disposalpipe/broken{tag = "icon-pipe-b (EAST)";icon_state = "pipe-b";dir = 4},/obj/item/stack/cable_coil/cut{amount = 2;dir = 2;icon_state = "coil_red2"},/turf/open/floor/plating/airless{broken = 1;icon_state = "platingdmg2"},/area/ruin/onehalf/hallway) -"bh" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/structure/cable{d1 = 4;d2 = 8;icon_state = "4-8"},/obj/structure/cable{d1 = 1;d2 = 4;icon_state = "1-4"},/turf/open/floor/plasteel/airless{icon_state = "damaged3"},/area/ruin/onehalf/hallway) -"bi" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/structure/cable{d1 = 4;d2 = 8;icon_state = "4-8"},/turf/open/floor/plasteel/airless{icon_state = "damaged5"},/area/ruin/onehalf/hallway) -"bj" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/structure/cable{d1 = 4;d2 = 8;icon_state = "4-8"},/turf/open/floor/plasteel/airless,/area/ruin/onehalf/hallway) -"bk" = (/obj/structure/disposalpipe/junction{icon_state = "pipe-j1";dir = 4},/obj/structure/cable{d1 = 1;d2 = 4;icon_state = "1-4"},/obj/structure/cable{d1 = 4;d2 = 8;icon_state = "4-8"},/turf/open/floor/plasteel/airless{icon_state = "damaged1"},/area/ruin/onehalf/hallway) -"bl" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/structure/cable{d1 = 4;d2 = 8;icon_state = "4-8"},/obj/structure/cable{d1 = 2;d2 = 8;icon_state = "2-8"},/turf/open/floor/plasteel/airless,/area/ruin/onehalf/hallway) -"bm" = (/obj/structure/disposalpipe/junction{icon_state = "pipe-j1";dir = 4},/obj/structure/cable{d1 = 4;d2 = 8;icon_state = "4-8"},/turf/open/floor/plasteel/airless,/area/ruin/onehalf/hallway) -"bn" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/door/airlock/glass,/obj/structure/cable{d1 = 4;d2 = 8;icon_state = "4-8"},/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) -"bo" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/structure/cable{d1 = 1;d2 = 8;icon_state = "1-8"},/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) -"bp" = (/obj/structure/disposalpipe/segment{dir = 4},/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) -"bq" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/structure/disposalpipe/segment,/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) -"br" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/door/airlock/maintenance_hatch,/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) -"bs" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/light/small{dir = 1},/turf/open/floor/plasteel{icon_state = "floorgrime"},/area/ruin/onehalf/drone_bay) -"bt" = (/obj/structure/disposalpipe/junction{icon_state = "pipe-y";dir = 1},/turf/open/floor/plasteel{icon_state = "floorgrime"},/area/ruin/onehalf/drone_bay) -"bu" = (/obj/structure/disposalpipe/trunk{dir = 8},/obj/machinery/disposal/bin,/turf/open/floor/plating,/area/ruin/onehalf/drone_bay) -"bv" = (/obj/structure/disposalpipe/broken{tag = "icon-pipe-b (EAST)";icon_state = "pipe-b";dir = 4},/turf/open/floor/plating/airless{icon_state = "platingdmg3"},/area/ruin/onehalf/hallway) -"bw" = (/obj/structure/disposalpipe/segment{dir = 4},/turf/open/floor/plasteel/airless{icon_state = "damaged3"},/area/ruin/onehalf/hallway) -"bx" = (/obj/structure/disposalpipe/segment{dir = 4},/turf/open/floor/plasteel/airless,/area/ruin/onehalf/hallway) -"by" = (/obj/structure/disposalpipe/segment,/obj/structure/disposalpipe/segment{dir = 4},/turf/open/floor/plasteel/airless{icon_state = "damaged1"},/area/ruin/onehalf/hallway) -"bz" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/structure/cable,/obj/machinery/power/apc{dir = 2;name = "Hallway APC";pixel_y = -24},/turf/open/floor/plasteel/airless,/area/ruin/onehalf/hallway) -"bA" = (/obj/structure/disposalpipe/segment{dir = 4},/turf/open/floor/plasteel/airless{icon_state = "damaged4"},/area/ruin/onehalf/hallway) -"bB" = (/obj/structure/disposalpipe/segment,/obj/structure/disposalpipe/segment{dir = 4},/turf/open/floor/plasteel/airless,/area/ruin/onehalf/hallway) -"bC" = (/obj/machinery/door/airlock/glass,/obj/structure/disposalpipe/segment{dir = 4},/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) -"bD" = (/obj/structure/disposalpipe/junction{dir = 8;icon_state = "pipe-j1"},/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) -"bE" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/light,/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) -"bF" = (/obj/structure/disposalpipe/segment{dir = 8;icon_state = "pipe-c"},/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) -"bG" = (/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) -"bH" = (/obj/machinery/portable_atmospherics/canister/oxygen,/turf/open/floor/plasteel{icon_state = "floorgrime"},/area/ruin/onehalf/drone_bay) -"bI" = (/turf/open/floor/plasteel{icon_state = "floorgrime"},/area/ruin/onehalf/drone_bay) -"bJ" = (/obj/structure/chair/office{tag = "icon-chair (EAST)";icon_state = "chair";dir = 4},/turf/open/floor/plasteel{icon_state = "floorgrime"},/area/ruin/onehalf/drone_bay) -"bK" = (/obj/structure/girder,/turf/open/floor/plating/airless,/area/ruin/onehalf/hallway) -"bL" = (/obj/structure/closet/emcloset,/turf/open/floor/plasteel/airless{icon_state = "damaged4"},/area/ruin/onehalf/hallway) -"bM" = (/obj/machinery/vending/coffee,/turf/open/floor/plasteel/airless{icon_state = "damaged4"},/area/ruin/onehalf/hallway) -"bN" = (/obj/machinery/vending/snack,/turf/open/floor/plasteel/airless{icon_state = "damaged2"},/area/ruin/onehalf/hallway) -"bO" = (/obj/structure/disposalpipe/trunk{dir = 1},/obj/machinery/disposal/bin,/turf/open/floor/plasteel/airless,/area/ruin/onehalf/hallway) -"bP" = (/obj/structure/girder/reinforced,/obj/item/stack/sheet/plasteel,/turf/open/floor/plating/airless,/area/ruin/onehalf/hallway) -"bQ" = (/obj/structure/girder/reinforced,/turf/open/floor/plating/airless,/area/ruin/onehalf/hallway) -"bR" = (/turf/closed/wall/r_wall,/area/ruin/onehalf/hallway) -"bS" = (/turf/open/floor/plasteel/airless{icon_state = "damaged2"},/area/ruin/onehalf/hallway) -"bT" = (/obj/structure/disposalpipe/segment,/turf/open/floor/plasteel/airless,/area/ruin/onehalf/hallway) -"bU" = (/turf/closed/wall/r_wall,/area/ruin/onehalf/bridge) -"bV" = (/obj/item/stack/sheet/metal,/turf/open/space,/area/space) -"bW" = (/turf/open/floor/plating/airless{broken = 1;icon_state = "platingdmg1"},/area/ruin/onehalf/hallway) -"bX" = (/obj/structure/disposalpipe/segment,/obj/item/stack/rods,/turf/open/floor/plasteel/airless{icon_state = "damaged5"},/area/ruin/onehalf/hallway) -"bY" = (/obj/structure/grille,/turf/open/floor/plating/airless,/area/ruin/onehalf/hallway) -"bZ" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/obj/machinery/door/poddoor/preopen{id = "bridge_onehalf";name = "bridge blast door"},/turf/open/floor/plating,/area/ruin/onehalf/bridge) -"ca" = (/obj/structure/table/reinforced,/obj/item/device/flashlight/lamp,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"cb" = (/obj/structure/table/reinforced,/obj/item/weapon/paper,/obj/item/weapon/pen,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"cc" = (/obj/structure/closet/emcloset,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"cd" = (/obj/machinery/light{dir = 1},/obj/structure/frame/computer,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"ce" = (/obj/structure/frame/computer,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"cf" = (/obj/structure/cable{icon_state = "0-4";d2 = 4},/obj/machinery/power/apc{cell_type = 2500;dir = 1;name = "Bridge APC";pixel_y = 24},/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"cg" = (/obj/structure/cable{d1 = 2;d2 = 8;icon_state = "2-8"},/obj/structure/table/reinforced,/obj/item/stack/spacecash/c500{pixel_y = 8},/obj/item/stack/spacecash/c1000,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"ch" = (/obj/structure/girder/reinforced,/turf/open/floor/plating/airless,/area/space) -"ci" = (/obj/structure/disposalpipe/junction{tag = "icon-pipe-j1 (NORTH)";icon_state = "pipe-j1";dir = 1},/obj/item/weapon/shard,/turf/open/floor/plating/airless{broken = 1;icon_state = "platingdmg2"},/area/ruin/onehalf/hallway) -"cj" = (/obj/structure/lattice,/obj/structure/disposalpipe/broken{tag = "icon-pipe-b (EAST)";icon_state = "pipe-b";dir = 4},/obj/structure/disposalpipe/broken{tag = "icon-pipe-b (WEST)";icon_state = "pipe-b";dir = 8},/obj/item/stack/rods,/turf/open/space,/area/ruin/onehalf/hallway) -"ck" = (/obj/structure/lattice,/obj/structure/disposalpipe/segment{dir = 4},/obj/item/weapon/shard{icon_state = "small"},/turf/open/space,/area/space) -"cl" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/door/poddoor/preopen{id = "bridge_onehalf";name = "bridge blast door"},/turf/open/floor/plating,/area/ruin/onehalf/bridge) -"cm" = (/obj/structure/disposalpipe/segment{dir = 2;icon_state = "pipe-c"},/obj/structure/table/reinforced,/obj/item/weapon/paper_bin{amount = 12},/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"cn" = (/obj/structure/chair/office{dir = 8},/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"co" = (/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"cp" = (/obj/structure/chair/office{tag = "icon-chair (NORTH)";icon_state = "chair";dir = 1},/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"cq" = (/obj/structure/cable{d1 = 1;d2 = 4;icon_state = "1-4"},/obj/structure/cable{d1 = 2;d2 = 4;icon_state = "2-4"},/obj/structure/table/reinforced,/obj/item/weapon/lighter,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"cr" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/obj/structure/cable{icon_state = "0-4";d2 = 4},/obj/structure/cable{icon_state = "0-2";pixel_y = 1;d2 = 2},/obj/structure/cable{d2 = 8;icon_state = "0-8"},/obj/machinery/door/poddoor/preopen{id = "bridge_onehalf";name = "bridge blast door"},/turf/open/floor/plating,/area/ruin/onehalf/bridge) -"cs" = (/obj/item/stack/rods,/turf/open/space,/area/space) -"ct" = (/turf/open/floor/plating/airless,/area/space) -"cu" = (/obj/item/stack/sheet/plasteel{amount = 10},/obj/structure/lattice,/turf/open/space,/area/space) -"cv" = (/obj/structure/lattice,/obj/item/weapon/shard{icon_state = "medium"},/turf/open/space,/area/ruin/onehalf/hallway) -"cw" = (/obj/structure/disposalpipe/segment,/turf/open/floor/plasteel/airless{icon_state = "damaged5"},/area/ruin/onehalf/hallway) -"cx" = (/obj/structure/girder/reinforced,/turf/open/floor/plating/airless,/area/ruin/onehalf/bridge) -"cy" = (/obj/structure/disposalpipe/trunk{dir = 1},/obj/machinery/disposal/bin,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"cz" = (/obj/item/stack/tile/plasteel,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"cA" = (/obj/machinery/power/solar_control,/obj/structure/cable,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"cB" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/obj/structure/cable,/obj/structure/cable{icon_state = "0-2";pixel_y = 1;d2 = 2},/obj/machinery/door/poddoor/preopen{id = "bridge_onehalf";name = "bridge blast door"},/turf/open/floor/plating,/area/ruin/onehalf/bridge) -"cC" = (/obj/item/stack/tile/wood,/turf/open/space,/area/space) -"cD" = (/turf/open/space,/area/ruin/onehalf/hallway) -"cE" = (/obj/structure/lattice,/obj/structure/cable{d1 = 2;d2 = 8;icon_state = "2-8"},/turf/open/space,/area/ruin/onehalf/hallway) -"cF" = (/obj/structure/lattice,/obj/structure/disposalpipe/broken{tag = "icon-pipe-b (WEST)";icon_state = "pipe-b";dir = 8},/obj/structure/disposalpipe/broken{tag = "icon-pipe-b (NORTH)";icon_state = "pipe-b";dir = 1},/turf/open/space,/area/ruin/onehalf/hallway) -"cG" = (/obj/machinery/door/airlock/glass_command{name = "Bridge"},/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"cH" = (/obj/machinery/light/small,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"cI" = (/obj/machinery/door/poddoor/preopen{id = "bridge_onehalf";name = "bridge blast door"},/obj/machinery/door/airlock/glass_command{name = "Bridge"},/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"cJ" = (/obj/item/weapon/crowbar/red,/obj/item/device/multitool,/turf/open/floor/plating,/area/ruin/onehalf/bridge) -"cK" = (/obj/structure/safe/floor,/obj/item/weapon/tank/internals/oxygen/red,/obj/item/clothing/mask/gas/syndicate,/obj/item/clothing/suit/space/hardsuit/syndi,/obj/item/weapon/reagent_containers/food/drinks/bottle/rum,/obj/item/weapon/reagent_containers/food/drinks/bottle/rum,/obj/item/weapon/folder/syndicate/mining,/turf/open/floor/plating,/area/ruin/onehalf/bridge) -"cL" = (/obj/structure/chair/comfy/black{dir = 4},/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"cM" = (/obj/structure/lattice,/obj/item/stack/cable_coil/cut{amount = 2;dir = 2;icon_state = "coil_red2"},/turf/open/space,/area/ruin/onehalf/hallway) -"cN" = (/turf/open/floor/plating/airless{broken = 1;icon_state = "platingdmg2"},/area/ruin/onehalf/hallway) -"cO" = (/obj/machinery/light{dir = 8},/obj/machinery/vending/sovietsoda,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"cP" = (/obj/item/stack/sheet/plasteel,/turf/open/space,/area/space) -"cQ" = (/obj/structure/lattice,/obj/structure/cable{d1 = 1;d2 = 2;icon_state = "1-2"},/turf/open/space,/area/ruin/onehalf/hallway) -"cR" = (/turf/open/floor/plasteel/airless{icon_state = "damaged3"},/area/ruin/onehalf/hallway) -"cS" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/turf/open/floor/plating,/area/ruin/onehalf/hallway) -"cT" = (/obj/structure/table/reinforced,/obj/machinery/recharger,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"cU" = (/obj/structure/chair/office,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"cV" = (/obj/machinery/button/door{id = "bridge_onehalf";name = "Bridge Blast Door";pixel_x = 32;pixel_y = 5},/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"cW" = (/obj/structure/table/reinforced,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"cX" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/obj/structure/cable{icon_state = "0-4";d2 = 4},/obj/structure/cable,/obj/machinery/door/poddoor/preopen{id = "bridge_onehalf";name = "bridge blast door"},/turf/open/floor/plating,/area/ruin/onehalf/bridge) -"cY" = (/obj/structure/lattice,/obj/structure/cable{d1 = 1;d2 = 2;icon_state = "1-2"},/obj/structure/cable{d1 = 2;d2 = 8;icon_state = "2-8"},/turf/open/space,/area/space) -"cZ" = (/obj/structure/cable{d1 = 1;d2 = 2;icon_state = "1-2"},/turf/open/floor/plasteel/airless{icon_state = "damaged5"},/area/ruin/onehalf/hallway) -"da" = (/obj/structure/table/reinforced,/obj/item/device/flashlight,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"db" = (/obj/structure/table/reinforced,/obj/item/weapon/ore/bluespace_crystal,/obj/item/weapon/coin/plasma,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"dc" = (/obj/structure/closet/firecloset/full,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"dd" = (/obj/machinery/light,/obj/structure/table/reinforced,/obj/item/weapon/storage/firstaid/regular,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) -"de" = (/obj/structure/girder/reinforced,/obj/item/stack/sheet/plasteel,/turf/open/floor/plating/airless,/area/space) -"df" = (/turf/open/floor/plating/airless{broken = 1;icon_state = "platingdmg2"},/area/space) -"dg" = (/obj/structure/grille{density = 0;icon_state = "brokengrille"},/obj/structure/cable{d1 = 1;d2 = 2;icon_state = "1-2"},/turf/open/floor/plating/airless{broken = 1;icon_state = "platingdmg1"},/area/ruin/onehalf/hallway) -"dh" = (/obj/structure/grille,/obj/item/weapon/shard,/turf/open/floor/plating/airless{icon_state = "platingdmg3"},/area/ruin/onehalf/hallway) -"di" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/obj/structure/cable{icon_state = "0-2";pixel_y = 1;d2 = 2},/obj/structure/cable{icon_state = "0-4";d2 = 4},/obj/machinery/door/poddoor/preopen{id = "bridge_onehalf";name = "bridge blast door"},/turf/open/floor/plating,/area/ruin/onehalf/bridge) -"dj" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/obj/structure/cable{icon_state = "0-4";d2 = 4},/obj/structure/cable{d2 = 8;icon_state = "0-8"},/obj/machinery/door/poddoor/preopen{id = "bridge_onehalf";name = "bridge blast door"},/turf/open/floor/plating,/area/ruin/onehalf/bridge) -"dk" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/obj/structure/cable{icon_state = "0-2";pixel_y = 1;d2 = 2},/obj/structure/cable{d2 = 8;icon_state = "0-8"},/obj/machinery/door/poddoor/preopen{id = "bridge_onehalf";name = "bridge blast door"},/turf/open/floor/plating,/area/ruin/onehalf/bridge) -"dl" = (/obj/structure/lattice,/obj/item/stack/sheet/plasteel,/turf/open/space,/area/space) -"dm" = (/obj/structure/lattice,/obj/structure/cable{d1 = 4;d2 = 8;icon_state = "4-8"},/obj/item/weapon/shard{icon_state = "medium"},/turf/open/space,/area/space) -"dn" = (/obj/structure/lattice,/obj/structure/cable{d1 = 4;d2 = 8;icon_state = "4-8"},/obj/structure/cable{d1 = 1;d2 = 4;icon_state = "1-4"},/obj/item/stack/rods,/turf/open/space,/area/space) -"do" = (/obj/structure/lattice,/obj/structure/cable{d1 = 1;d2 = 8;icon_state = "1-8"},/obj/structure/cable{d1 = 4;d2 = 8;icon_state = "4-8"},/turf/open/space,/area/space) -"dp" = (/obj/item/stack/cable_coil/cut{amount = 2;dir = 2;icon_state = "coil_red2"},/turf/open/space,/area/space) +"aX" = (/obj/structure/cable{d1 = 1; d2 = 4; icon_state = "1-4"},/obj/structure/cable{d1 = 1; d2 = 2; icon_state = "1-2"},/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) +"aY" = (/obj/structure/cable{d2 = 8; icon_state = "0-8"},/obj/machinery/power/apc{cell_type = 2500; dir = 1; name = "Mining Drone Bay APC"; pixel_y = 24},/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) +"aZ" = (/obj/structure/disposalpipe/segment,/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) +"ba" = (/obj/machinery/button/door{id = "onehalf_drone2int"; name = "Drone 2 Internal Hatch Override"; pixel_x = 8; pixel_y = 27},/obj/machinery/button/door{id = "onehalf_drone2ext"; name = "Drone 2 External Hatch Override"; pixel_x = 8; pixel_y = 37},/obj/machinery/button/door{id = "onehalf_drone1int"; name = "Drone 1 Internal Hatch Override"; pixel_x = -8; pixel_y = 27},/obj/machinery/button/door{id = "onehalf_drone1ext"; name = "Drone 1 External Hatch Override"; pixel_x = -8; pixel_y = 37},/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) +"bb" = (/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) +"bc" = (/obj/machinery/button/door{id = "onehalf_drone3int"; name = "Drone 3 Internal Hatch Override"; pixel_x = -8; pixel_y = 27},/obj/machinery/button/door{id = "onehalf_drone3ext"; name = "Drone 3 External Hatch Override"; pixel_x = -8; pixel_y = 37},/obj/machinery/button/door{id = "onehalf_drone4ext"; name = "Drone 4 External Hatch Override"; pixel_x = 8; pixel_y = 37},/obj/machinery/button/door{id = "onehalf_drone4int"; name = "Drone 4 Internal Hatch Override"; pixel_x = 8; pixel_y = 27},/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) +"bd" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/turf/open/floor/plating,/area/ruin/onehalf/drone_bay) +"be" = (/obj/item/stack/sheet/metal,/turf/open/floor/plating/airless{broken = 1; icon_state = "platingdmg1"},/area/ruin/onehalf/hallway) +"bf" = (/obj/structure/disposalpipe/broken{tag = "icon-pipe-b (EAST)"; icon_state = "pipe-b"; dir = 4},/obj/item/stack/cable_coil/cut{amount = 2; dir = 2; icon_state = "coil_red2"},/turf/open/floor/plating/airless{broken = 1; icon_state = "platingdmg2"},/area/ruin/onehalf/hallway) +"bg" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/structure/cable{d1 = 4; d2 = 8; icon_state = "4-8"},/obj/structure/cable{d1 = 1; d2 = 4; icon_state = "1-4"},/turf/open/floor/plasteel/airless{icon_state = "damaged3"},/area/ruin/onehalf/hallway) +"bh" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/structure/cable{d1 = 4; d2 = 8; icon_state = "4-8"},/turf/open/floor/plasteel/airless{icon_state = "damaged5"},/area/ruin/onehalf/hallway) +"bi" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/structure/cable{d1 = 4; d2 = 8; icon_state = "4-8"},/turf/open/floor/plasteel/airless,/area/ruin/onehalf/hallway) +"bj" = (/obj/structure/disposalpipe/junction{icon_state = "pipe-j1"; dir = 4},/obj/structure/cable{d1 = 1; d2 = 4; icon_state = "1-4"},/obj/structure/cable{d1 = 4; d2 = 8; icon_state = "4-8"},/turf/open/floor/plasteel/airless{icon_state = "damaged1"},/area/ruin/onehalf/hallway) +"bk" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/structure/cable{d1 = 4; d2 = 8; icon_state = "4-8"},/obj/structure/cable{d1 = 2; d2 = 8; icon_state = "2-8"},/turf/open/floor/plasteel/airless,/area/ruin/onehalf/hallway) +"bl" = (/obj/structure/disposalpipe/junction{icon_state = "pipe-j1"; dir = 4},/obj/structure/cable{d1 = 4; d2 = 8; icon_state = "4-8"},/turf/open/floor/plasteel/airless,/area/ruin/onehalf/hallway) +"bm" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/door/airlock/glass,/obj/structure/cable{d1 = 4; d2 = 8; icon_state = "4-8"},/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) +"bn" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/structure/cable{d1 = 1; d2 = 8; icon_state = "1-8"},/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) +"bo" = (/obj/structure/disposalpipe/segment{dir = 4},/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) +"bp" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/structure/disposalpipe/segment,/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) +"bq" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/door/airlock/maintenance_hatch,/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) +"br" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/light/small{dir = 1},/turf/open/floor/plasteel{icon_state = "floorgrime"},/area/ruin/onehalf/drone_bay) +"bs" = (/obj/structure/disposalpipe/junction{icon_state = "pipe-y"; dir = 1},/turf/open/floor/plasteel{icon_state = "floorgrime"},/area/ruin/onehalf/drone_bay) +"bt" = (/obj/structure/disposalpipe/trunk{dir = 8},/obj/machinery/disposal/bin,/turf/open/floor/plating,/area/ruin/onehalf/drone_bay) +"bu" = (/obj/structure/disposalpipe/broken{tag = "icon-pipe-b (EAST)"; icon_state = "pipe-b"; dir = 4},/turf/open/floor/plating/airless{icon_state = "platingdmg3"},/area/ruin/onehalf/hallway) +"bv" = (/obj/structure/disposalpipe/segment{dir = 4},/turf/open/floor/plasteel/airless{icon_state = "damaged3"},/area/ruin/onehalf/hallway) +"bw" = (/obj/structure/disposalpipe/segment{dir = 4},/turf/open/floor/plasteel/airless,/area/ruin/onehalf/hallway) +"bx" = (/obj/structure/disposalpipe/segment,/obj/structure/disposalpipe/segment{dir = 4},/turf/open/floor/plasteel/airless{icon_state = "damaged1"},/area/ruin/onehalf/hallway) +"by" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/structure/cable,/obj/machinery/power/apc{dir = 2; name = "Hallway APC"; pixel_y = -24},/turf/open/floor/plasteel/airless,/area/ruin/onehalf/hallway) +"bz" = (/obj/structure/disposalpipe/segment{dir = 4},/turf/open/floor/plasteel/airless{icon_state = "damaged4"},/area/ruin/onehalf/hallway) +"bA" = (/obj/structure/disposalpipe/segment,/obj/structure/disposalpipe/segment{dir = 4},/turf/open/floor/plasteel/airless,/area/ruin/onehalf/hallway) +"bB" = (/obj/machinery/door/airlock/glass,/obj/structure/disposalpipe/segment{dir = 4},/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) +"bC" = (/obj/structure/disposalpipe/junction{dir = 8; icon_state = "pipe-j1"},/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) +"bD" = (/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/light,/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) +"bE" = (/obj/structure/disposalpipe/segment{dir = 8; icon_state = "pipe-c"},/turf/open/floor/plasteel,/area/ruin/onehalf/drone_bay) +"bF" = (/obj/machinery/portable_atmospherics/canister/oxygen,/turf/open/floor/plasteel{icon_state = "floorgrime"},/area/ruin/onehalf/drone_bay) +"bG" = (/turf/open/floor/plasteel{icon_state = "floorgrime"},/area/ruin/onehalf/drone_bay) +"bH" = (/obj/structure/chair/office{tag = "icon-chair (EAST)"; icon_state = "chair"; dir = 4},/turf/open/floor/plasteel{icon_state = "floorgrime"},/area/ruin/onehalf/drone_bay) +"bI" = (/obj/structure/girder,/turf/open/floor/plating/airless,/area/ruin/onehalf/hallway) +"bJ" = (/obj/structure/closet/emcloset,/turf/open/floor/plasteel/airless{icon_state = "damaged4"},/area/ruin/onehalf/hallway) +"bK" = (/obj/machinery/vending/coffee,/turf/open/floor/plasteel/airless{icon_state = "damaged4"},/area/ruin/onehalf/hallway) +"bL" = (/obj/machinery/vending/snack,/turf/open/floor/plasteel/airless{icon_state = "damaged2"},/area/ruin/onehalf/hallway) +"bM" = (/obj/structure/disposalpipe/trunk{dir = 1},/obj/machinery/disposal/bin,/turf/open/floor/plasteel/airless,/area/ruin/onehalf/hallway) +"bN" = (/obj/structure/girder/reinforced,/obj/item/stack/sheet/plasteel,/turf/open/floor/plating/airless,/area/ruin/onehalf/hallway) +"bO" = (/obj/structure/girder/reinforced,/turf/open/floor/plating/airless,/area/ruin/onehalf/hallway) +"bP" = (/turf/closed/wall/r_wall,/area/ruin/onehalf/hallway) +"bQ" = (/turf/open/floor/plasteel/airless{icon_state = "damaged2"},/area/ruin/onehalf/hallway) +"bR" = (/obj/structure/disposalpipe/segment,/turf/open/floor/plasteel/airless,/area/ruin/onehalf/hallway) +"bS" = (/turf/closed/wall/r_wall,/area/ruin/onehalf/bridge) +"bT" = (/obj/item/stack/sheet/metal,/turf/open/space,/area/space) +"bU" = (/turf/open/floor/plating/airless{broken = 1; icon_state = "platingdmg1"},/area/ruin/onehalf/hallway) +"bV" = (/obj/structure/disposalpipe/segment,/obj/item/stack/rods,/turf/open/floor/plasteel/airless{icon_state = "damaged5"},/area/ruin/onehalf/hallway) +"bW" = (/obj/structure/grille,/turf/open/floor/plating/airless,/area/ruin/onehalf/hallway) +"bX" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/obj/machinery/door/poddoor/preopen{id = "bridge_onehalf"; name = "bridge blast door"},/turf/open/floor/plating,/area/ruin/onehalf/bridge) +"bY" = (/obj/structure/table/reinforced,/obj/item/device/flashlight/lamp,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"bZ" = (/obj/structure/table/reinforced,/obj/item/weapon/paper,/obj/item/weapon/pen,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"ca" = (/obj/structure/closet/emcloset,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"cb" = (/obj/machinery/light{dir = 1},/obj/structure/frame/computer,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"cc" = (/obj/structure/frame/computer,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"cd" = (/obj/structure/cable{icon_state = "0-4"; d2 = 4},/obj/machinery/power/apc{cell_type = 2500; dir = 1; name = "Bridge APC"; pixel_y = 24},/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"ce" = (/obj/structure/cable{d1 = 2; d2 = 8; icon_state = "2-8"},/obj/structure/table/reinforced,/obj/item/stack/spacecash/c500{pixel_y = 8},/obj/item/stack/spacecash/c1000,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"cf" = (/obj/structure/girder/reinforced,/turf/open/floor/plating/airless,/area/space) +"cg" = (/obj/structure/disposalpipe/junction{tag = "icon-pipe-j1 (NORTH)"; icon_state = "pipe-j1"; dir = 1},/obj/item/weapon/shard,/turf/open/floor/plating/airless{broken = 1; icon_state = "platingdmg2"},/area/ruin/onehalf/hallway) +"ch" = (/obj/structure/lattice,/obj/structure/disposalpipe/broken{tag = "icon-pipe-b (EAST)"; icon_state = "pipe-b"; dir = 4},/obj/structure/disposalpipe/broken{tag = "icon-pipe-b (WEST)"; icon_state = "pipe-b"; dir = 8},/obj/item/stack/rods,/turf/open/space,/area/ruin/onehalf/hallway) +"ci" = (/obj/structure/lattice,/obj/structure/disposalpipe/segment{dir = 4},/obj/item/weapon/shard{icon_state = "small"},/turf/open/space,/area/space) +"cj" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/obj/structure/disposalpipe/segment{dir = 4},/obj/machinery/door/poddoor/preopen{id = "bridge_onehalf"; name = "bridge blast door"},/turf/open/floor/plating,/area/ruin/onehalf/bridge) +"ck" = (/obj/structure/disposalpipe/segment{dir = 2; icon_state = "pipe-c"},/obj/structure/table/reinforced,/obj/item/weapon/paper_bin{amount = 12},/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"cl" = (/obj/structure/chair/office{dir = 8},/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"cm" = (/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"cn" = (/obj/structure/chair/office{tag = "icon-chair (NORTH)"; icon_state = "chair"; dir = 1},/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"co" = (/obj/structure/cable{d1 = 1; d2 = 4; icon_state = "1-4"},/obj/structure/cable{d1 = 2; d2 = 4; icon_state = "2-4"},/obj/structure/table/reinforced,/obj/item/weapon/lighter,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"cp" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/obj/structure/cable{icon_state = "0-4"; d2 = 4},/obj/structure/cable{icon_state = "0-2"; pixel_y = 1; d2 = 2},/obj/structure/cable{d2 = 8; icon_state = "0-8"},/obj/machinery/door/poddoor/preopen{id = "bridge_onehalf"; name = "bridge blast door"},/turf/open/floor/plating,/area/ruin/onehalf/bridge) +"cq" = (/obj/item/stack/rods,/turf/open/space,/area/space) +"cr" = (/turf/open/floor/plating/airless,/area/space) +"cs" = (/obj/item/stack/sheet/plasteel{amount = 10},/obj/structure/lattice,/turf/open/space,/area/space) +"ct" = (/obj/structure/lattice,/obj/item/weapon/shard{icon_state = "medium"},/turf/open/space,/area/ruin/onehalf/hallway) +"cu" = (/obj/structure/disposalpipe/segment,/turf/open/floor/plasteel/airless{icon_state = "damaged5"},/area/ruin/onehalf/hallway) +"cv" = (/obj/structure/girder/reinforced,/turf/open/floor/plating/airless,/area/ruin/onehalf/bridge) +"cw" = (/obj/structure/disposalpipe/trunk{dir = 1},/obj/machinery/disposal/bin,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"cx" = (/obj/item/stack/tile/plasteel,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"cy" = (/obj/machinery/power/solar_control,/obj/structure/cable,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"cz" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/obj/structure/cable,/obj/structure/cable{icon_state = "0-2"; pixel_y = 1; d2 = 2},/obj/machinery/door/poddoor/preopen{id = "bridge_onehalf"; name = "bridge blast door"},/turf/open/floor/plating,/area/ruin/onehalf/bridge) +"cA" = (/obj/item/stack/tile/wood,/turf/open/space,/area/space) +"cB" = (/turf/open/space,/area/ruin/onehalf/hallway) +"cC" = (/obj/structure/lattice,/obj/structure/cable{d1 = 2; d2 = 8; icon_state = "2-8"},/turf/open/space,/area/ruin/onehalf/hallway) +"cD" = (/obj/structure/lattice,/obj/structure/disposalpipe/broken{tag = "icon-pipe-b (WEST)"; icon_state = "pipe-b"; dir = 8},/obj/structure/disposalpipe/broken{tag = "icon-pipe-b (NORTH)"; icon_state = "pipe-b"; dir = 1},/turf/open/space,/area/ruin/onehalf/hallway) +"cE" = (/obj/machinery/door/airlock/glass_command{name = "Bridge"},/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"cF" = (/obj/machinery/light/small,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"cG" = (/obj/machinery/door/poddoor/preopen{id = "bridge_onehalf"; name = "bridge blast door"},/obj/machinery/door/airlock/glass_command{name = "Bridge"},/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"cH" = (/obj/item/weapon/crowbar/red,/obj/item/device/multitool,/turf/open/floor/plating,/area/ruin/onehalf/bridge) +"cI" = (/obj/structure/safe/floor,/obj/item/weapon/tank/internals/oxygen/red,/obj/item/clothing/mask/gas/syndicate,/obj/item/clothing/suit/space/hardsuit/syndi,/obj/item/weapon/reagent_containers/food/drinks/bottle/rum,/obj/item/weapon/reagent_containers/food/drinks/bottle/rum,/obj/item/weapon/folder/syndicate/mining,/turf/open/floor/plating,/area/ruin/onehalf/bridge) +"cJ" = (/obj/structure/chair/comfy/black{dir = 4},/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"cK" = (/obj/structure/lattice,/obj/item/stack/cable_coil/cut{amount = 2; dir = 2; icon_state = "coil_red2"},/turf/open/space,/area/ruin/onehalf/hallway) +"cL" = (/turf/open/floor/plating/airless{broken = 1; icon_state = "platingdmg2"},/area/ruin/onehalf/hallway) +"cM" = (/obj/machinery/light{dir = 8},/obj/machinery/vending/sovietsoda,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"cN" = (/obj/item/stack/sheet/plasteel,/turf/open/space,/area/space) +"cO" = (/obj/structure/lattice,/obj/structure/cable{d1 = 1; d2 = 2; icon_state = "1-2"},/turf/open/space,/area/ruin/onehalf/hallway) +"cP" = (/turf/open/floor/plasteel/airless{icon_state = "damaged3"},/area/ruin/onehalf/hallway) +"cQ" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/turf/open/floor/plating,/area/ruin/onehalf/hallway) +"cR" = (/obj/structure/table/reinforced,/obj/machinery/recharger,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"cS" = (/obj/structure/chair/office,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"cT" = (/obj/machinery/button/door{id = "bridge_onehalf"; name = "Bridge Blast Door"; pixel_x = 32; pixel_y = 5},/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"cU" = (/obj/structure/table/reinforced,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"cV" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/obj/structure/cable{icon_state = "0-4"; d2 = 4},/obj/structure/cable,/obj/machinery/door/poddoor/preopen{id = "bridge_onehalf"; name = "bridge blast door"},/turf/open/floor/plating,/area/ruin/onehalf/bridge) +"cW" = (/obj/structure/lattice,/obj/structure/cable{d1 = 1; d2 = 2; icon_state = "1-2"},/obj/structure/cable{d1 = 2; d2 = 8; icon_state = "2-8"},/turf/open/space,/area/space) +"cX" = (/obj/structure/cable{d1 = 1; d2 = 2; icon_state = "1-2"},/turf/open/floor/plasteel/airless{icon_state = "damaged5"},/area/ruin/onehalf/hallway) +"cY" = (/obj/structure/table/reinforced,/obj/item/device/flashlight,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"cZ" = (/obj/structure/table/reinforced,/obj/item/weapon/ore/bluespace_crystal,/obj/item/weapon/coin/plasma,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"da" = (/obj/structure/closet/firecloset/full,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"db" = (/obj/machinery/light,/obj/structure/table/reinforced,/obj/item/weapon/storage/firstaid/regular,/turf/open/floor/plasteel,/area/ruin/onehalf/bridge) +"dc" = (/obj/structure/girder/reinforced,/obj/item/stack/sheet/plasteel,/turf/open/floor/plating/airless,/area/space) +"dd" = (/turf/open/floor/plating/airless{broken = 1; icon_state = "platingdmg2"},/area/space) +"de" = (/obj/structure/grille{density = 0; icon_state = "brokengrille"},/obj/structure/cable{d1 = 1; d2 = 2; icon_state = "1-2"},/turf/open/floor/plating/airless{broken = 1; icon_state = "platingdmg1"},/area/ruin/onehalf/hallway) +"df" = (/obj/structure/grille,/obj/item/weapon/shard,/turf/open/floor/plating/airless{icon_state = "platingdmg3"},/area/ruin/onehalf/hallway) +"dg" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/obj/structure/cable{icon_state = "0-2"; pixel_y = 1; d2 = 2},/obj/structure/cable{icon_state = "0-4"; d2 = 4},/obj/machinery/door/poddoor/preopen{id = "bridge_onehalf"; name = "bridge blast door"},/turf/open/floor/plating,/area/ruin/onehalf/bridge) +"dh" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/obj/structure/cable{icon_state = "0-4"; d2 = 4},/obj/structure/cable{d2 = 8; icon_state = "0-8"},/obj/machinery/door/poddoor/preopen{id = "bridge_onehalf"; name = "bridge blast door"},/turf/open/floor/plating,/area/ruin/onehalf/bridge) +"di" = (/obj/structure/grille,/obj/structure/window/reinforced/fulltile,/obj/structure/cable{icon_state = "0-2"; pixel_y = 1; d2 = 2},/obj/structure/cable{d2 = 8; icon_state = "0-8"},/obj/machinery/door/poddoor/preopen{id = "bridge_onehalf"; name = "bridge blast door"},/turf/open/floor/plating,/area/ruin/onehalf/bridge) +"dj" = (/obj/structure/lattice,/obj/item/stack/sheet/plasteel,/turf/open/space,/area/space) +"dk" = (/obj/structure/lattice,/obj/structure/cable{d1 = 4; d2 = 8; icon_state = "4-8"},/obj/item/weapon/shard{icon_state = "medium"},/turf/open/space,/area/space) +"dl" = (/obj/structure/lattice,/obj/structure/cable{d1 = 4; d2 = 8; icon_state = "4-8"},/obj/structure/cable{d1 = 1; d2 = 4; icon_state = "1-4"},/obj/item/stack/rods,/turf/open/space,/area/space) +"dm" = (/obj/structure/lattice,/obj/structure/cable{d1 = 1; d2 = 8; icon_state = "1-8"},/obj/structure/cable{d1 = 4; d2 = 8; icon_state = "4-8"},/turf/open/space,/area/space) +"dn" = (/obj/item/stack/cable_coil/cut{amount = 2; dir = 2; icon_state = "coil_red2"},/turf/open/space,/area/space) (1,1,1) = {" aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa @@ -178,18 +176,18 @@ aaaaaaaaaeacafagagagagagagahagagaiaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaajakakakagalamanagaoapaoagaqarasaratarauaravaraaaaaaaaaaaa aaaaawaxaxayazagaAamaBagaCapaoagaDaraEaraFaraEaraEarawaraGaraaaa aaaaaaaHaIaxaJagaKaLaMagaoapaoagaqaraNaraOaraParaQaraaaraRaraaaa -aaaaaSajaxaTaUagagaVagagagaWagagaXaYaZbaaZbbaZbcbdarararbeararaa -aaaaawbfbgbhbibjbjbkbibiblbjbmbnbobpbqbpbqbpbqbpbqbpbrbsbtbubeaa -aaaaaabvbwbwbxbxbwbybxbxbzbAbBbCbpbpbDbEbDbpbDbEbFbGarbHbIbJbeaa -aaaaaabKajakbLbMbNbObPbQbRbSbTbUbUbUbUbUbUbUbUbUbUbUararbeararaa -aaaaaaaabVbWbKakbQbRajawbRbWbXbYaabZcacbcccdcecfcgbUawaaaaaaaaaa -aaaaaaaaaaaaaaaachaaaabVaxaxcicjckclcmcncocpcococqcradaaaaaaaaaa -aaaaaaaaaaaaaacsctcuaaaaajcvcwcxbUbUcycoczcocococAcBaiaaaaaaaaaa -aaaaaaaaaaaaaaaaaaawcCaacDcEcFcGcHcIcoczcJcKcocLcecBaiaaaaaaaaaa -aaaaaaaaaaaaaaaaaaaacsawajcMcNbUbUbUcOcocococococecBaiaaaaaaaaaa -aaaaaaaaaaaaaaaaaaaacPcCaxcQcRcSawbZcTcncocUcocVcWcXcYaaaaaaaaaa -aaaaaaaaaaaaaaaaaacsaaaabRcZaJcSaabZdadbdccececoddbUaiaaaaaaaaaa -aaaaaaaaaaaaaaaaaadeawdfbQdgdhbUbUbUbUdidjdjdjdkbUbUaiaaaaaaaaaa -aaaaaaaaaaaaaaaaaaaaaadldmdnacacacacacdoacacacdoacacafaaaaaaaaaa -aaaaaaaaaaaaaaaaaaaadpaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa +aaaaaSajaxaTaUagagaVagagagaWagagaXaYaZbaaZbbaZbcaZarararbdararaa +aaaaawbebfbgbhbibibjbhbhbkbiblbmbnbobpbobpbobpbobpbobqbrbsbtbdaa +aaaaaabubvbvbwbwbvbxbwbwbybzbAbBbobobCbDbCbobCbDbEbbarbFbGbHbdaa +aaaaaabIajakbJbKbLbMbNbObPbQbRbSbSbSbSbSbSbSbSbSbSbSararbdararaa +aaaaaaaabTbUbIakbObPajawbPbUbVbWaabXbYbZcacbcccdcebSawaaaaaaaaaa +aaaaaaaaaaaaaaaacfaaaabTaxaxcgchcicjckclcmcncmcmcocpadaaaaaaaaaa +aaaaaaaaaaaaaacqcrcsaaaaajctcucvbSbScwcmcxcmcmcmcyczaiaaaaaaaaaa +aaaaaaaaaaaaaaaaaaawcAaacBcCcDcEcFcGcmcxcHcIcmcJccczaiaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaacqawajcKcLbSbSbScMcmcmcmcmcmccczaiaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaacNcAaxcOcPcQawbXcRclcmcScmcTcUcVcWaaaaaaaaaa +aaaaaaaaaaaaaaaaaacqaaaabPcXaJcQaabXcYcZdacccccmdbbSaiaaaaaaaaaa +aaaaaaaaaaaaaaaaaadcawddbOdedfbSbSbSbSdgdhdhdhdibSbSaiaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaaaadjdkdlacacacacacdmacacacdmacacafaaaaaaaaaa +aaaaaaaaaaaaaaaaaaaadnaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa "} diff --git a/_maps/RandomRuins/SpaceRuins/turretedoutpost.dmm b/_maps/RandomRuins/SpaceRuins/turretedoutpost.dmm index 4ed95c7398..d4f3ce9c1f 100644 --- a/_maps/RandomRuins/SpaceRuins/turretedoutpost.dmm +++ b/_maps/RandomRuins/SpaceRuins/turretedoutpost.dmm @@ -1,6 +1,6 @@ "a" = (/turf/open/space,/area/space) "b" = (/obj/structure/lattice,/turf/open/space,/area/space) -"c" = (/obj/structure/grille,/turf/open/floor/plating,/area/ruin/unpowered) +"c" = (/obj/structure/grille,/turf/open/floor/plating/airless,/area/ruin/unpowered) "d" = (/turf/closed/wall/r_wall,/area/ruin/unpowered) "e" = (/obj/structure/table/reinforced,/obj/item/weapon/stock_parts/cell/hyper,/turf/open/floor/plasteel,/area/ruin/unpowered) "f" = (/obj/structure/frame/computer,/turf/open/floor/plasteel,/area/ruin/unpowered) @@ -15,37 +15,37 @@ "o" = (/obj/machinery/porta_turret,/turf/open/floor/plating/airless,/area/ruin/unpowered) "p" = (/obj/structure/filingcabinet,/turf/open/floor/plasteel,/area/ruin/unpowered) "q" = (/obj/machinery/light,/turf/open/floor/plasteel,/area/ruin/unpowered) -"r" = (/obj/machinery/power/apc{dir = 0;name = "Worn-out APC";pixel_y = -24},/turf/open/floor/plasteel,/area/ruin/unpowered) -"s" = (/obj/structure/rack,/turf/open/floor/plasteel{icon_state = "vault";dir = 8},/area/ruin/unpowered) -"t" = (/obj/item/weapon/rack_parts,/turf/open/floor/plasteel{icon_state = "vault";dir = 8},/area/ruin/unpowered) -"u" = (/obj/item/weapon/rack_parts,/obj/machinery/light{dir = 1},/turf/open/floor/plasteel{icon_state = "vault";dir = 8},/area/ruin/unpowered) -"v" = (/obj/structure/rack,/obj/item/device/firing_pin,/turf/open/floor/plasteel{icon_state = "vault";dir = 8},/area/ruin/unpowered) +"r" = (/obj/machinery/power/apc{dir = 0; name = "Worn-out APC"; pixel_y = -24},/turf/open/floor/plasteel,/area/ruin/unpowered) +"s" = (/obj/structure/rack,/turf/open/floor/plasteel{icon_state = "vault"; dir = 8},/area/ruin/unpowered) +"t" = (/obj/item/weapon/rack_parts,/turf/open/floor/plasteel{icon_state = "vault"; dir = 8},/area/ruin/unpowered) +"u" = (/obj/item/weapon/rack_parts,/obj/machinery/light{dir = 1},/turf/open/floor/plasteel{icon_state = "vault"; dir = 8},/area/ruin/unpowered) +"v" = (/obj/structure/rack,/obj/item/device/firing_pin,/turf/open/floor/plasteel{icon_state = "vault"; dir = 8},/area/ruin/unpowered) "w" = (/obj/machinery/door/airlock/glass,/turf/open/floor/plasteel,/area/ruin/unpowered) "x" = (/obj/machinery/door/airlock,/turf/open/floor/plasteel,/area/ruin/unpowered) "y" = (/turf/open/floor/plasteel{icon_state = "dark"},/area/ruin/unpowered) "z" = (/obj/structure/tank_dispenser/oxygen,/turf/open/floor/plasteel{icon_state = "dark"},/area/ruin/unpowered) -"A" = (/obj/structure/table/reinforced,/obj/item/clothing/head/ushanka,/turf/open/floor/plasteel{dir = 4;icon_state = "darkredfull"},/area/ruin/unpowered) +"A" = (/obj/structure/table/reinforced,/obj/item/clothing/head/ushanka,/turf/open/floor/plasteel{dir = 4; icon_state = "darkredfull"},/area/ruin/unpowered) "B" = (/obj/structure/table/reinforced,/obj/structure/reagent_dispensers/peppertank{pixel_y = 32},/turf/open/floor/plasteel,/area/ruin/unpowered) "C" = (/obj/structure/table/reinforced,/obj/item/weapon/clipboard,/obj/machinery/light{dir = 1},/obj/item/device/radio,/turf/open/floor/plasteel,/area/ruin/unpowered) "D" = (/obj/machinery/vending/clothing,/turf/open/floor/plasteel,/area/ruin/unpowered) -"E" = (/obj/structure/rack,/obj/item/ammo_box/c9mm,/turf/open/floor/plasteel{icon_state = "vault";dir = 8},/area/ruin/unpowered) +"E" = (/obj/structure/rack,/obj/item/ammo_box/c9mm,/turf/open/floor/plasteel{icon_state = "vault"; dir = 8},/area/ruin/unpowered) "F" = (/obj/machinery/door/airlock/glass,/turf/open/floor/plasteel{icon_state = "dark"},/area/ruin/unpowered) -"G" = (/turf/open/floor/plasteel{dir = 4;icon_state = "darkredfull"},/area/ruin/unpowered) -"H" = (/obj/structure/bed,/obj/item/weapon/bedsheet/orange,/obj/machinery/light{dir = 4;icon_state = "tube1"},/turf/open/floor/plasteel,/area/ruin/unpowered) -"I" = (/obj/structure/rack,/obj/item/clothing/head/helmet/swat,/turf/open/floor/plasteel{icon_state = "vault";dir = 8},/area/ruin/unpowered) -"J" = (/obj/structure/rack,/obj/item/weapon/crowbar/red,/obj/item/weapon/paper/crumpled,/turf/open/floor/plasteel{icon_state = "vault";dir = 8},/area/ruin/unpowered) +"G" = (/turf/open/floor/plasteel{dir = 4; icon_state = "darkredfull"},/area/ruin/unpowered) +"H" = (/obj/structure/bed,/obj/item/weapon/bedsheet/orange,/obj/machinery/light{dir = 4; icon_state = "tube1"},/turf/open/floor/plasteel,/area/ruin/unpowered) +"I" = (/obj/structure/rack,/obj/item/clothing/head/helmet/swat,/turf/open/floor/plasteel{icon_state = "vault"; dir = 8},/area/ruin/unpowered) +"J" = (/obj/structure/rack,/obj/item/weapon/crowbar/red,/obj/item/weapon/paper/crumpled,/turf/open/floor/plasteel{icon_state = "vault"; dir = 8},/area/ruin/unpowered) "K" = (/obj/structure/chair/office/dark,/turf/open/floor/plasteel,/area/ruin/unpowered) "L" = (/obj/structure/chair/comfy/beige{dir = 4},/turf/open/floor/plasteel,/area/ruin/unpowered) "M" = (/obj/structure/bed,/obj/item/weapon/bedsheet/orange,/turf/open/floor/plasteel,/area/ruin/unpowered) "N" = (/obj/structure/rack,/obj/item/weapon/grenade/chem_grenade/teargas,/turf/open/floor/plasteel{icon_state = "dark"},/area/ruin/unpowered) -"O" = (/obj/structure/table/reinforced,/obj/item/weapon/paper/crumpled,/turf/open/floor/plasteel{dir = 4;icon_state = "darkredfull"},/area/ruin/unpowered) +"O" = (/obj/structure/table/reinforced,/obj/item/weapon/paper/crumpled,/turf/open/floor/plasteel{dir = 4; icon_state = "darkredfull"},/area/ruin/unpowered) "P" = (/obj/structure/table/reinforced,/obj/machinery/light,/obj/item/device/camera_bug,/turf/open/floor/plasteel,/area/ruin/unpowered) "Q" = (/obj/structure/table/reinforced,/obj/item/weapon/paper_bin,/turf/open/floor/plasteel,/area/ruin/unpowered) "R" = (/obj/structure/table/reinforced,/obj/item/weapon/pen/blue,/turf/open/floor/plasteel,/area/ruin/unpowered) -"S" = (/obj/structure/table/wood,/obj/item/weapon/reagent_containers/food/drinks/bottle/vodka{pixel_x = -4;pixel_y = 4},/obj/item/weapon/reagent_containers/food/drinks/bottle/vodka/badminka{pixel_x = 3},/turf/open/floor/plasteel,/area/ruin/unpowered) -"T" = (/obj/structure/rack,/obj/item/weapon/storage/belt/military,/obj/machinery/light,/turf/open/floor/plasteel{icon_state = "vault";dir = 8},/area/ruin/unpowered) -"U" = (/obj/structure/rack,/obj/item/clothing/head/helmet/riot,/turf/open/floor/plasteel{icon_state = "vault";dir = 8},/area/ruin/unpowered) -"V" = (/obj/structure/table/wood,/obj/item/weapon/reagent_containers/food/snacks/breadslice/meat,/obj/machinery/light{icon_state = "tube1";dir = 8},/turf/open/floor/plasteel,/area/ruin/unpowered) +"S" = (/obj/structure/table/wood,/obj/item/weapon/reagent_containers/food/drinks/bottle/vodka{pixel_x = -4; pixel_y = 4},/obj/item/weapon/reagent_containers/food/drinks/bottle/vodka/badminka{pixel_x = 3},/turf/open/floor/plasteel,/area/ruin/unpowered) +"T" = (/obj/structure/rack,/obj/item/weapon/storage/belt/military,/obj/machinery/light,/turf/open/floor/plasteel{icon_state = "vault"; dir = 8},/area/ruin/unpowered) +"U" = (/obj/structure/rack,/obj/item/clothing/head/helmet/riot,/turf/open/floor/plasteel{icon_state = "vault"; dir = 8},/area/ruin/unpowered) +"V" = (/obj/structure/table/wood,/obj/item/weapon/reagent_containers/food/snacks/breadslice/meat,/obj/machinery/light{icon_state = "tube1"; dir = 8},/turf/open/floor/plasteel,/area/ruin/unpowered) (1,1,1) = {" aaaaaaaaaaaaaaaaaabbab @@ -55,7 +55,7 @@ aaaaabbbbbcddddddddddd aaaaabaaaacdefffghijki aaalllllllcdmnggggikki aaloddddddcdpqgggrdddd -aalddstuvdddddwdxddkkc +aalddstuvdddddwdxddllc aaldtyyyyzdABCgdgDdddc aaldsysEyyFGgggdgggHdc bbldIysJyyFGgKgdLggMdc